The Journal of Neuroscience, October 9, 2013 • 33(41):16297–16309 • 16297 Cellular/Molecular Visualization of Synaptic Inhibition with an Optogenetic Sensor Developed by Cell-Free Protein Engineering Automation Joshua S. Grimley,1*LiLi,2* Weina Wang,1 Lei Wen,3 Lorena S. Beese,1 Homme W. Hellinga,1 and George J. Augustine2,3,4,5,6 1Department of Biochemistry and 2Department of Neurobiology, Duke University Medical Center, Durham, North Carolina 27710, 3Center for Functional Connectomics, Korea Institute of Science and Technology, Seongbukgu, Seoul, 136-791 Republic of Korea, 4Program in Neuroscience and Behavioral Disorders, Duke-NUS Graduate Medical School, Singapore 169857, Singapore, 5A*STAR/Duke-NUS Neuroscience Research Partnership, Proteos, Singapore 138673, Singapore, 6Lee Kong Chian School of Medicine, Nanyang Technological University, Singapore 637553, Singapore, and 7Institute of Molecular and Cell Biology, Singapore 138673, Singapore We describe an engineered fluorescent optogenetic sensor, SuperClomeleon, that robustly detects inhibitory synaptic activity in single, cultured mouse neurons by reporting intracellular chloride changes produced by exogenous GABA or inhibitory synaptic activity. Using a cell-free protein engineering automation methodology that bypasses gene cloning, we iteratively constructed, produced, and assayed hundreds of mutations in binding-site residues to identify improvements in Clomeleon, a first-generation, suboptimal sensor. Structural anal- ysis revealed that these improvements involve halide contacts and distant side chain rearrangements. The development of optogenetic sensors that respond to neural activity enables cellular tracking of neural activity using optical, rather than electrophysiological, signals. Construction of such sensors using in vitro protein engineering establishes a powerful approach for developing new probes for brain imaging. Introduction changes in the concentrations of signaling molecules typically Optogenetic sensors (OSs) based on the green fluorescent protein associated with neuronal activity has been challenging (Miyawaki (GFP), combined with advances in optical imaging methods, et al., 1997; Kuner and Augustine, 2000; Okumoto et al., 2005; have enabled quantitative monitoring of cellular processes with Hires et al., 2008; Arosio et al., 2010). Presynaptic release of GABA opens postsynaptic GABA recep- high spatiotemporal resolution (Okumoto, 2010). Many such Ϫ OSs have been developed to track subcellular localization (Flach tors, resulting in Cl fluxes that underlie synaptic inhibition. Ϫ et al., 1994) or monitor protein–protein interactions (Xia et al., Fluorescent OSs that monitor intracellular Cl concentration, Ϫ 2001), and have great potential for measurement of neuronal [Cl ]i, therefore could report on this important class of synaptic Ϫ activity by enabling precise, cellular-level reporting of neural cir- action. A first-generation Cl sensor, Clomeleon, has been used Ϫ cuit activity (Zhang et al., 2010; Mancuso et al., 2011) based on to monitor such dynamic changes in [Cl ]i in cultured neurons optical rather than electrophysiological signals (Siegel and (Kuner and Augustine, 2000) and in brain tissue (Berglund et al., Isacoff, 1997; Kuner and Augustine, 2000; Hires et al., 2008). 2006). Clomeleon is a fusion of the yellow fluorescent protein Ϫ However, engineering OSs that monitor the small and rapid (YFP), which contains a serendipitous Cl binding site adjacent to its chromophore (Wachter et al., 2000), and the chloride- Received Sept. 9, 2011; revised Aug. 14, 2013; accepted Sept. 5, 2013. insensitive cyan fluorescent protein (CFP). Halide binding to Authorcontributions:J.S.G.,L.L.,W.W.,L.W.,L.S.B.,H.W.H.,andG.J.A.designedresearch;J.S.G.,L.L.,W.W.,and YFP quenches fluorescence emission (Wachter and Remington, L.W. performed research; J.S.G., L.L., W.W., L.W., L.S.B., H.W.H., and G.J.A. analyzed data; J.S.G., L.L., W.W., L.W., 1999), altering fluorescence resonance energy transfer (FRET) L.S.B., H.W.H., and G.J.A. wrote the paper. between the CFP donor and the YFP acceptor (Kuner and Augus- This work was supported by the Duke Institute for Brain Science and the National Institutes of Health Director’s tine, 2000). The use of FRET enables ratiometric determination Pioneer Award (5DPI OD000122), by a Competitive Research Program grant from the National Research Foundation Ϫ (NRF) of Singapore, and by the World Class Institute Program of the NRF of Korea funded by the Ministry of Educa- of [Cl ]i, which is unaffected by variations in fluorescence emis- tion,Science,andTechnologyofKorea(NRFGrantnumberWCI2009-003).WethankKenBerglundformanyhelpful sion intensity associated with differences in indicator concentra- discussions. tion, optical path length, or excitation intensity (Bright et al., *J.S.G. and L.L. contributed equally to this work. 1989; Miyawaki, 2005). However, it remains extremely challeng- The authors declare no competing financial interests. Ϫ Correspondence should be addressed to either of the following: Homme Hellinga, Department of Biochemistry, ing to detect GABA-induced [Cl ]i changes with Clomeleon be- Ϫ Duke University Medical Center, P.O. Box 3711, Durham, NC 27710, E-mail: [email protected]; or George cause the Cl affinity of Clomeleon (ϳ100 mM) is well beyond Augustine, Lee Kong Chian School of Medicine, Nanyang Technological University, Singapore 637553, Singapore, Ϫ ϳ the physiological range of [Cl ]i ( 5–6 mM in most adult neu- E-mail: [email protected]. J.S. Grimley’s present address: Allen Institute for Brain Science, Seattle, WA 98103. rons; Berglund et al., 2006). This limits the signal-to-noise ratio DOI:10.1523/JNEUROSCI.4616-11.2013 (s/n), requiring averaging of multiple trials before a response can Copyright © 2013 the authors 0270-6474/13/3316297-13$15.00/0 be detected via fluorescence imaging. 16298 • J. Neurosci., October 9, 2013 • 33(41):16297–16309 Grimley, Li et al. • “Engineering SuperClomeleon” Here we report the use of recently developed protein engi- scrambled rTEV sequence of FQENLY. The diverged DNA sequence of Clo- neering automation techniques (Cox et al., 2007; Allert et al., meleon CFP is as follows: 5Ј-ATGGTAAGCAAAGGTGAAGAACTGTTCA 2010) to improve the fluorescence response of Clomeleon by CGGGCGTTGTCCCGATTTTGGTTGAACTCGATGGTGATGTTAATG manipulating its halide affinity and fluorophore characteristics. GTCACCGTTTTTCTGTCAGCGGCGAGGGTGAAGGTGATGCCACCT The resulting sensor, SuperClomeleon, has a significantly im- ACGGTAAACTGACCTTGAAATTTATTTGCACGACCGGCAAACTGC proved s/n in the relevant range of postsynaptic [Cl Ϫ] and CGGTTCCATGGCCGACGTTGGTCACCACGCTGACCTGGGGTGTTC i AATGCTTTTCTCGCTACCCGGATCACATGAAACAGCATGACTTTTT greatly enhances imaging of synaptic inhibition in neurons. CAAGTCCGCCATGCCGGAAGGTTATGTGCAGGAACGCACCATCT TTTTCAAAGATGACGGCAACTACAAGACCCGTGCTGAAGTCAAGT Materials and Methods TTGAAGGTGATACCTTGGTTAATCGTATCGAGCTGAAAGGTATTG Protein engineering. Oligonucleotides (79–80 bases) were synthesized by ATTTTAAAGAAGATGGCAACATTCTGGGTCACAAACTGGAATACA solid phase oligonucleotide synthesis (MerMade 192; BioAutomation) ACTATATCAGCCACAATGTTTACATCACCGCAGACAAACAAAAGA and assembled into full-length open reading frames (ORFs) by automa- ATGGCATCAAAGCGCATTTCAAAATTCGCCACAACATTGAAGATG tion (Cox et al., 2007), which were reamplified by PCR using 5Ј- GTAGCGTTCAACTGGCGGACCATTATCAACAAAATACGCCAATTG biotinylated primers. GCGATGGCCCGGTCTTGCTGCCGGACAACCATTACCTGTCCACC Protein was produced by in vitro-coupled transcription and transla- CAATCTGCCCTCTCGAAAGATCCGAACGAAAAGCGTGACCAvCAT tion (TnT) reactions (Allert et al., 2010): 2.4 ␮g of linear, biotinylated GGTCTTGCTGGAGTTTGTGACCGCAGCGGGCATTACACATGGCA dsDNA was added to 30 ␮l of a BL21 Star (DE3; Invitrogen) cell lysate TGGATGAACTGTACAAAAAGCTCACCGGTTCGGGCTCGGGTTTTC and a solution of amino acids, nucleotide triphosphates, and cofactors AGAACGAACTCTATGGTGGCGGCTCCGGCGGTACTAGCTCGACCG and water (final volume 120 ␮l) in 96-well PCR plates, which were cov- GCGGCAGCAACGATTACAAAGACGACGACGATAAAGGCGGTAGC ered with a breathable seal for optimum aerobic expression and chro- CATCATCACCACCACCAC-3Ј, where the 72 italicized bases correspond to mophore maturation (Heim et al., 1994), and incubated with shaking for the 24 aa linker. 8 h at 30°C, followed by6hat4°C. The linear DNA ORFs of select variants were amplified with primers to All proteins had combined C-terminal Flag and His6 peptides for af- clone each ORF into the BamHI (5Ј-CGCGGATCCCGGCGTAGAGGAT finity purification. Proteins were purified at 4°C from TnT reactions Ј Ј Ϫ CGAGATCTCGATCCC-3 )andHindIII(5 -CCCAAGCTTCCTCAAGAC using anti-Flag M2 agarose (Sigma) and Cl -free buffer: four (15 min) Ј Ϫ CCGTTTAGAGGCCCCAAGG-3 ) restriction sites of pUC19 (Invitrogen). washes of agarose-bound FPs with 20 mM HEPES, pH 7.1, removed Cl For the gene fusions encoding the 24 aa linker, the CFP vector was digested ␮ ϫ before elution with 120 lof3 Flag (Sigma). Protein expression and with AgeI and HindIII. The YFP genes were amplified from their vectors purity relative to a sample of the Clomeleon chloride-sensitive YFP To- with the 3Ј HindIII primer and a new 5Ј primer (5Ј-AAGCTCACCGGTTC paz domain (CT) was determined by densitometry of the YFP band in GGGCTCGGGTTTTCAGAACGAACTCTATGGTGGCGGCTCCGGCG protein gels stained with GelCode Blue (Thermo Scientific) using ImageJ GTACTAGCTCGACCATGGTTAGCAAAGGAGAAGAATTATTTACA Ͼ (release 1.42q) software (good category of expression 90% pure; poorly G-3Ј) encoding the linker and AgeI site. expressed proteins were less pure).