DOCSLIB.ORG

Mean Depth 1000 More Than100×

Total Page：16

File Type：pdf, Size：1020Kb

Download full-text PDF Read full-text
Mean Depth 1000 More Than100× A B ×20 ×50 ×100 100% 1000 800 90% 600 80% 400 Mean depth 70% 200 0 60% 50% Mean coverage 40% PBL002_T PBL003_T PBL004_T PBL005_T PBL006_T PBL007_T PBL008_T PBL009_T PBL010_T PBL001_P 30% 20% 10% 0% PBL002_T PBL003_T PBL004_T PBL005_T PBL006_T PBL007_T PBL008_T PBL009_T PBL010_T PBL001_P Figure S1. Depths and coverages of targeted deep sequencing. A. Depths of targeted deep sequencing on 10 PBL cases (mean depth = 677). B. Coverages of the targeted sequences analyzed at the indicated depths; 98.8% of the targeted regions were sequenced at a depth more than 100×. A B ×2 ×10 ×20 250 100% 200 90% 150 80% 100 Mean depth 50 70% 0 60% 50% PBL002_T PBL004_T PBL007_T PBL008_T PBL010_T PBL001_P PBL001_N PBL002_N PBL004_N PBL007_N PBL008_N PBL010_N PBL001_M1 PBL001_M2 PBL001_M3 PBL001_M4 PBL001_M5 PBL001_M6 Mean coverage 40% 30% 20% 10% 0% PBL002_T PBL004_T PBL007_T PBL008_T PBL010_T PBL001_P PBL001_N PBL002_N PBL004_N PBL007_N PBL008_N PBL010_N PBL001_M1 PBL001_M2 PBL001_M3 PBL001_M4 PBL001_M5 PBL001_M6 C D 14 80 12 70 10 60 50 8 40 6 30 4 Number of mutations Number of mutations 20 2 10 0 0 PBL002_T PBL004_T PBL007_T PBL008_T PBL010_T PBL001_P PBL001_P PBL001_M1 PBL001_M2 PBL001_M3 PBL001_M4 PBL001_M5 PBL001_M6 Nonsynonymous SNV Stopgain SNV Nonframeshift indels Frameshift indels Splice site Figure S2. Sequencing coverages and numbers of mutations detected by WES. A. Depths of WES on tumor and normal DNA samples from 6 cases (mean depth = 124 for tumor samples and 141 for normal samples). B. Coverages of the exome sequences; 97.5% of the exome sequences were analyzed at a depth more than 20×. C-D. The number of somatic non-silent mutations and indels detected by WES and validated by PCR-based amplicon deep sequencing in 6 primary tumor samples (C) and 7 multiple samples from PBL001 (D). SNV, single-nucleotide variant. P M1 M2 M3 CLEC19A NOTCH1 SIK3 MFSD2B CTNNB1 UBE2E2 GOLM1 PTPRU CTSW KIAA0368 UBE2E2 UBE2E2 PTPRU CCDC88C CTNNB1 KDM6A CTNNB1 MRGPRE BRS3 CCDC88C SYNJ1 OR4D11 KDM6A OR4D11 CCDC88C DSP KDM6A MRGPRE PLXNB1 CTNNB1 CCDC88C SIK3 ZC3H18 OR4D11 ABCA13 PGK2_c.A155T NTNG1_c.A300T HUWE1 OR4D11 LEF1 MAGEB1 PGK2_c.G154A KLKB1 NTNG1_c.C301T LRRIQ3 TMEM132C_c.A2550G UBE2E2 PHKA2 EXPH5 ADGRG2 MUC3A ADCY1 BRWD1 ZBED2 FOXP4 MRGPRE LCN9 TMPRSS5 SIK3 MYBPC1 IQCF1 GRM2 CYP2W1 TMEM132C_c.G2551T MRGPRE ABHD12B KDM6A SERPINB7 FRMD6 HECW1 PTPRU HOXB13 LOC650293 ZNF804B MYO6 XCR1 SIK3 GLRA3 MADD KMT2A CFAP43 NARFL DNAH17 EDN2 CUX1 PCLO HIST1H4D NUDCD3 PTPRU SLC5A10 NLRP10 PCNXL3 DLL1 AOC1 CNBP IFT43 GBF1 CEP295 GSX2 MKI67 CADPS2 ASCC3 KRTAP13-2 GALR1 CELSR1 DMBT1 0.0 0.2 0.4 0.6 0.8 1.0 0.0 0.2 0.4 0.6 0.8 1.0 0.0 0.2 0.4 0.6 0.8 1.0 0.0 0.2 0.4 0.6 0.8 1.0 Cellular Frequency Cellular Frequency Cellular Frequency Cellular Frequency M4 M5 M6 UBE2U SIK3 PKP3 KAT6B PTPRU MVK PIK3CD OGN CBS UBE2E2 OR51T1 KDM6A CCDC88C ADGB SIK3 KCNK17 ZBTB38 PPL MRGPRE BTBD16 MGMT OGN CTNNB1 OR51M1 MRGPRE CCDC88C MRGPRE GPR149 CTNNB1 OR51M1 FANCG OGN KDM6A OR51B4 SYNE1 KCTD1 UBE2E2 GLI3 PTPRU OR4D11 MLLT10 NPSR1 ARHGAP29 OR4D11 CUTC CDH3 PABPN1L UBE2E2 AHNAK OR4D11 DGCR14 TNXB OR51T1 ABCD4 SIK3 KDM6A GART PTPRU SETD4 ATR TIGD3 RAB11FIP3_c.C379A ZFHX3 OR51T1 CUL9 OR51M1 STIM1 CDKN2AIP GBP5 CTNNB1 XKRX ZNF516 RAB11FIP3_c.C380A TRNT1 KIAA2026 ADGRG4 RNF40 TRH HNRNPCL2 FA2H NTAN1 SLC17A6 MOXD1 SEMA3E CYSRT1 ZCCHC11 CD109 RPS6KA5 KCNQ5 COL6A5 RBM25 DMBT1 RANBP10 ALG1L TRH DLK1 LAMC3 KIAA1462 SLC34A2 TAF7L RNF38 HECW2 0.0 0.2 0.4 0.6 0.8 1.0 0.0 0.2 0.4 0.6 0.8 1.0 0.0 0.2 0.4 0.6 0.8 1.0 Cellular Frequency Cellular Frequency Cellular Frequency Figure S3. Tumor subclonal populations in multiple samples from PBL001 estimated by PyClone. Cellular frequencies of detected somatic mutaions in each sample from PBL001 are shown on each panel. Mutations on chromosomal regions with copy number gains were not used for the analysis because mutant cell fractions may be underestimated. P, primary sample; M1-M6, metastatic samples. B A Probability Probability 0.00 0.05 0.10 0.15 0.00 0.05 0.10 0.15 for primary(left),andmetastaticPBL(right). substitution patterns,the±2flankingbases,and transcriptionstranddirections,plotted immediately 3’and5’tothemutatedbase.B.Mutational signaturesconsistingofthe of substitutions.Eachsubstitutiontypecontains16 barsrepresentingthesequencecontext samples fromPBL001(lowerplot).Theprobability bars arecoloredaccordingtothe6types of 6primaryPBLsamplesinwhichWESwasperformed (upperplot),and6metastatic Figure S4. A C G Metastatic PBL Primary PBL ACA ACA ACC ACC ACG ACG ACT ACT CCA CCA T C>A CCC CCC C>A Primary PBL CCG CCG Mutationalsignaturesofprimaryandmetastatic PBL.A.Mutationalsignatures CCT CCT GCA GCA GCC GCC T C GCG GCG GCT GCT TCA TCA TCC TCC TCG TCG TCT TCT C G Strand directions ACA ACA ACC ACC ACG ACG ACT ACT A CCA CCA C>G C>G + CCC CCC G CCG CCG − CCT CCT GCA GCA GCC GCC GCG GCG GCT GCT TCA TCA TCC TCC TCG TCG TCT TCT ACA ACA C ACC ACC ACG ACG G ACT ACT T CCA CCA C>T CCC CCC C>T CCG CCG CCT CCT C GCA GCA GCC GCC GCG GCG Metastatic PBL T GCT GCT TCA TCA TCC TCC TCG TCG TCT TCT T C ATA ATA ATC ATC ATG ATG ATT ATT C CTA CTA T>A CTC CTC T>A Strand directions CTG CTG CTT CTT GTA GTA GTC GTC GTG GTG + GTT GTT G TTA TTA − TTC TTC T TTG TTG TTT TTT ATA ATA ATC ATC ATG ATG ATT ATT CTA CTA T>C CTC CTC T>C CTG CTG CTT CTT GTA GTA GTC GTC GTG GTG GTT GTT TTA TTA TTC TTC TTG TTG TTT TTT ATA ATA ATC ATC ATG ATG ATT ATT CTA CTA T>G CTC CTC T>G CTG CTG CTT CTT GTA GTA GTC GTC GTG GTG GTT GTT TTA TTA TTC TTC TTG TTG TTT TTT 1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 2122 PBL001_P PBL001_M1 PBL001_M2 PBL001_M3 PBL001_M4 PBL001_M5 PBL001_M6 PBL002_T PBL004_T PBL007_T PBL008_T PBL010_T CN Loss Gain Figure S5. SNP array-based copy number analysis of PBL. Copy number alterations in multiple samples from PBL001 and 5 primary tumor samples identified by SNP array analysis are shown. CN, copy number. A PBL001 PBL002 Chr11 Chr11 Hetero Hetero SNPs SNPs 1 1 0.5 0.5 ratio ratio Allelic Allelic 0 0 PBL003 PBL004 Chr11 Chr11 Hetero Hetero SNPs SNPs 1 1 ratio 0.5 0.5 ratio Allelic Allelic 0 0 PBL005 PBL006 Chr11 Chr11 Hetero Hetero SNPs SNPs 1 1 ratio 0.5 ratio 0.5 Allelic Allelic 0 0 PBL007 PBL008 Chr11 Chr11 Hetero Hetero SNPs SNPs 1 1 0.5 0.5 ratio ratio Allelic Allelic 0 0 B PBL010 PBL009 Chr11 Chr11 Hetero Hetero SNPs SNPs 1 1 0.5 0.5 ratio ratio Allelic Allelic 0 0 Figure S6. Targeted deep sequencing based allele-specific copy number analysis of chromosome 11. A. Sequencing-based copy number analysis identified CN-LOH with the minimal common region identical to chromosome 11p15.5 locus in 8 cases. Allelic ratios were calculated by allele frequencies and sequenced depths of SNPs; red/green dots represent major/minor allele frequencies at SNP sites. B. Allelic ratio of PBL009, the case with gain of whole chromosome 11, is also plotted. A PBL002 (tumor purity = 0.57) PBL004 (tumor purity = 0.86) TTCGTTCGTGGAAACGTTTC GGGTTATTTAA GTTACGCGTCGT TTC GTTC GTGGAAACGT TTCGGGTTAT TTAA GTTACGCGTCGT (T) (T) (T) (T) (T) (T) (T) PBL010 (tumor purity = 0.44) TTCGTTCGTGGAAACGTTTCGGGTTATTTAA GTTACGCGTCGT (T) (T) (T) (T) (T) (T) (T) B PBL009 (tumor purity = 0.69) TTCGTTCGTGGAAACGTTTCGGGTTAT TTAA GTTACGCGTCGT (T) (T) (T) (T) (T) (T) (T) Figure S7. Bisulfite Sanger sequencing of ICR1 on chromosome 11p15.5. A. Bisulfite Sanger sequencing of 3 CN-LOH (+) cases (CpG sites are indicated by arrows). From the estimated tumor purity (see Methods), all samples examined were considered homozygously methylated, indicating that their CN-LOH causes paternal uniparental disomy. B. Bisulfite sequencing of PBL009, the case with gain of whole chromosome 11. A B * M 3.0 IGF2 ACTB ** * * 2.5 IGF2 1000 bp 500 bp 2.0 100 bp 1.5 xpression of e e v 1.0 Relati PBL001 PBL005PBL009 PBL001 PBL005PBL009 0.5 Normal pancreas (Negative control) Normal pancreas (Negative control) 0 Normal PBL001 PBL005 PBL009 pancreas Sample Figure S8. Relative expression levels of IGF2 in CN-LOH-negative samples. A. Reverse transcription PCR was performed in normal pancreas (as a normal control), PBL001 (as a CN-LOH-positive control), PBL005, and PBL009. ACTB (encoding β-actin) was used as a reference gene. The lanes of negative control contain water control. M, DNA size markers. B. DNA bands were quantified using Image Lab software (Bio-Rad). Relative intensities of IGF2 compared to ACTB were computed, and mean intensities ± s.d. of 3 technical replicates are plotted with corresponding P-values (Student’s t-test). *P < 0.05, **P < 0.01. A 3 2 ratio 1 Log2 0 CN = 2 -1 -2 1 0.5 ratio Allelic 0 1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19202122 Chromosome B C 3 2 1 ratio 0 Log2 -1 -2 ● 1 ● ● ● ●● ● ● ● ● ● ● ● ● ● ● ● ● ● ● ● ●● ● ● ● ● ● ● ● ● ● ● ●● ● ● ● ● ● ● ● ● 0.5 ● ●● ● ratio Allelic ● ● ● 0 Chr5 APC Figure S9. Aberrant activation of Wnt signaling pathway in PBL009. A. Sequencing-based copy number analysis identified CN-LOH within chromosome 5q involving APC gene locus. Upper panel shows the genome-wide copy number profile in PBL009. A log2 ratio of zero (horizontal red line) corresponds to a normal, diploid copy number.
Load more

Recommended publications
  • Single Cell Derived Clonal Analysis of Human Glioblastoma Links
    SUPPLEMENTARY INFORMATION: Single cell derived clonal analysis of human glioblastoma links functional and genomic heterogeneity ! Mona Meyer*, Jüri Reimand*, Xiaoyang Lan, Renee Head, Xueming Zhu, Michelle Kushida, Jane Bayani, Jessica C. Pressey, Anath Lionel, Ian D. Clarke, Michael Cusimano, Jeremy Squire, Stephen Scherer, Mark Bernstein, Melanie A. Woodin, Gary D. Bader**, and Peter B. Dirks**! ! * These authors contributed equally to this work.! ** Correspondence: [email protected] or [email protected]! ! Supplementary information - Meyer, Reimand et al. Supplementary methods" 4" Patient samples and fluorescence activated cell sorting (FACS)! 4! Differentiation! 4! Immunocytochemistry and EdU Imaging! 4! Proliferation! 5! Western blotting ! 5! Temozolomide treatment! 5! NCI drug library screen! 6! Orthotopic injections! 6! Immunohistochemistry on tumor sections! 6! Promoter methylation of MGMT! 6! Fluorescence in situ Hybridization (FISH)! 7! SNP6 microarray analysis and genome segmentation! 7! Calling copy number alterations! 8! Mapping altered genome segments to genes! 8! Recurrently altered genes with clonal variability! 9! Global analyses of copy number alterations! 9! Phylogenetic analysis of copy number alterations! 10! Microarray analysis! 10! Gene expression differences of TMZ resistant and sensitive clones of GBM-482! 10! Reverse transcription-PCR analyses! 11! Tumor subtype analysis of TMZ-sensitive and resistant clones! 11! Pathway analysis of gene expression in the TMZ-sensitive clone of GBM-482! 11! Supplementary figures and tables" 13" "2 Supplementary information - Meyer, Reimand et al. Table S1: Individual clones from all patient tumors are tumorigenic. ! 14! Fig. S1: clonal tumorigenicity.! 15! Fig. S2: clonal heterogeneity of EGFR and PTEN expression.! 20! Fig. S3: clonal heterogeneity of proliferation.! 21! Fig.
    [Show full text]
  • Genetic Characterization of Greek Population Isolates Reveals Strong Genetic Drift at Missense and Trait-Associated Variants
    ARTICLE Received 22 Apr 2014 | Accepted 22 Sep 2014 | Published 6 Nov 2014 DOI: 10.1038/ncomms6345 OPEN Genetic characterization of Greek population isolates reveals strong genetic drift at missense and trait-associated variants Kalliope Panoutsopoulou1,*, Konstantinos Hatzikotoulas1,*, Dionysia Kiara Xifara2,3, Vincenza Colonna4, Aliki-Eleni Farmaki5, Graham R.S. Ritchie1,6, Lorraine Southam1,2, Arthur Gilly1, Ioanna Tachmazidou1, Segun Fatumo1,7,8, Angela Matchan1, Nigel W. Rayner1,2,9, Ioanna Ntalla5,10, Massimo Mezzavilla1,11, Yuan Chen1, Chrysoula Kiagiadaki12, Eleni Zengini13,14, Vasiliki Mamakou13,15, Antonis Athanasiadis16, Margarita Giannakopoulou17, Vassiliki-Eirini Kariakli5, Rebecca N. Nsubuga18, Alex Karabarinde18, Manjinder Sandhu1,8, Gil McVean2, Chris Tyler-Smith1, Emmanouil Tsafantakis12, Maria Karaleftheri16, Yali Xue1, George Dedoussis5 & Eleftheria Zeggini1 Isolated populations are emerging as a powerful study design in the search for low-frequency and rare variant associations with complex phenotypes. Here we genotype 2,296 samples from two isolated Greek populations, the Pomak villages (HELIC-Pomak) in the North of Greece and the Mylopotamos villages (HELIC-MANOLIS) in Crete. We compare their genomic characteristics to the general Greek population and establish them as genetic isolates. In the MANOLIS cohort, we observe an enrichment of missense variants among the variants that have drifted up in frequency by more than fivefold. In the Pomak cohort, we find novel associations at variants on chr11p15.4 showing large allele frequency increases (from 0.2% in the general Greek population to 4.6% in the isolate) with haematological traits, for example, with mean corpuscular volume (rs7116019, P ¼ 2.3 Â 10 À 26). We replicate this association in a second set of Pomak samples (combined P ¼ 2.0 Â 10 À 36).
    [Show full text]
  • Table S3. RAE Analysis of Well-Differentiated Liposarcoma
    Table S3. RAE analysis of well-differentiated liposarcoma Model Chromosome Region start Region end Size q value freqX0* # genes Genes Amp 1 145009467 145122002 112536 0.097 21.8 2 PRKAB2,PDIA3P Amp 1 145224467 146188434 963968 0.029 23.6 10 CHD1L,BCL9,ACP6,GJA5,GJA8,GPR89B,GPR89C,PDZK1P1,RP11-94I2.2,NBPF11 Amp 1 147475854 148412469 936616 0.034 23.6 20 PPIAL4A,FCGR1A,HIST2H2BF,HIST2H3D,HIST2H2AA4,HIST2H2AA3,HIST2H3A,HIST2H3C,HIST2H4B,HIST2H4A,HIST2H2BE, HIST2H2AC,HIST2H2AB,BOLA1,SV2A,SF3B4,MTMR11,OTUD7B,VPS45,PLEKHO1 Amp 1 148582896 153398462 4815567 1.5E-05 49.1 152 PRPF3,RPRD2,TARS2,ECM1,ADAMTSL4,MCL1,ENSA,GOLPH3L,HORMAD1,CTSS,CTSK,ARNT,SETDB1,LASS2,ANXA9, FAM63A,PRUNE,BNIPL,C1orf56,CDC42SE1,MLLT11,GABPB2,SEMA6C,TNFAIP8L2,LYSMD1,SCNM1,TMOD4,VPS72, PIP5K1A,PSMD4,ZNF687,PI4KB,RFX5,SELENBP1,PSMB4,POGZ,CGN,TUFT1,SNX27,TNRC4,MRPL9,OAZ3,TDRKH,LINGO4, RORC,THEM5,THEM4,S100A10,S100A11,TCHHL1,TCHH,RPTN,HRNR,FLG,FLG2,CRNN,LCE5A,CRCT1,LCE3E,LCE3D,LCE3C,LCE3B, LCE3A,LCE2D,LCE2C,LCE2B,LCE2A,LCE4A,KPRP,LCE1F,LCE1E,LCE1D,LCE1C,LCE1B,LCE1A,SMCP,IVL,SPRR4,SPRR1A,SPRR3, SPRR1B,SPRR2D,SPRR2A,SPRR2B,SPRR2E,SPRR2F,SPRR2C,SPRR2G,LELP1,LOR,PGLYRP3,PGLYRP4,S100A9,S100A12,S100A8, S100A7A,S100A7L2,S100A7,S100A6,S100A5,S100A4,S100A3,S100A2,S100A16,S100A14,S100A13,S100A1,C1orf77,SNAPIN,ILF2, NPR1,INTS3,SLC27A3,GATAD2B,DENND4B,CRTC2,SLC39A1,CREB3L4,JTB,RAB13,RPS27,NUP210L,TPM3,C1orf189,C1orf43,UBAP2L,HAX1, AQP10,ATP8B2,IL6R,SHE,TDRD10,UBE2Q1,CHRNB2,ADAR,KCNN3,PMVK,PBXIP1,PYGO2,SHC1,CKS1B,FLAD1,LENEP,ZBTB7B,DCST2, DCST1,ADAM15,EFNA4,EFNA3,EFNA1,RAG1AP1,DPM3 Amp 1
    [Show full text]
  • Get High-Res Image
    50 40 30 20 10 226 155 243 73 63 51 # mutations Non syn. Syn. *CpG->T *Cp(A/C/T)->T A->G transver indel+null double_null # mutations/"< 0 10 15 20 25 1% 1% 1% 1% 1% 1% 1% 1% 1% 1% 1% 1% 1% 0% 0% 1% 2% 1% 1% 1% 1% 0% 1% 1% 4% 1% 1% 1% 2% 0% 1% 1% 1% 1% 1% 1% 1% 1% 1% 1% 1% 1% 1% 1% 1% 1% 1% 1% 1% 1% 1% 1% 1% 1% 1% 1% 1% 1% 2% 1% 1% 1% 1% 1% 0% 1% 1% 1% 1% 2% 1% 1% 3% 1% 1% 1% 1% 2% 1% 1% 1% 2% 1% 1% 2% 1% 1% 1% 1% 1% 2% 1% 1% 1% 1% 1% 2% 1% 1% 1% 1% 1% 1% 1% 1% 1% 1% 1% 2% 1% 1% 5% 1% 1% 1% 2% 1% 1% 1% 1% 1% 2% 1% 1% 1% 1% 1% 1% 2% 2% 1% 2% 2% 13% 2% 4% 4% 9% 4% 19% 0% 1% 1% 1% 1% 1% 1% 1% 1% 1% 1% 1% 1% 1% 1% 1% 1% 1% 1% 1% 2% 2% 2% 2% 2% 2% 2% 2% 2% 2% 2% 2% 2% 2% 2% 3% 3% 3% 4% 5% 29% 0 5 %IRC-A$'3778'TP %IRC-C3'5677-TP%IRC'(0'4710'TP%IRC-A3'3383'TP %IRC-E.'5907-TP%IRC-A3'3382'TP%IRC'(0'4712'TP %IRC-A3'3372'TP%IRC-A3'3316'TP%IRC-A%'3444'TP %IRC-C*'59,2-TP%IRC-A3'3378'TP%IRC-A3'3308'TP %IRC'(P'5184'TP%IRC'(0'5693'TP%IRC'(,'5159'TP %IRC'(P'4968'TP%IRC'(P'5196'TP%IRC-C3'5675-TP %IRC-C--55,0-TP%IRC'(P'5169'TP%IRC'(0'5699'TP %IRC-C3'5676-TP%IRC'(P'5198'TP%IRC-C3'56,4-TP %IRC-A3'3331'TP%IRC'(0'5399'TP%IRC-C*'5470-TP %IRC'(0'4706'TP%IRC'(0'4,16'TP%IRC'(P'4159'TP %IRC'(P'5183'TP%IRC'(0'5703'TP%IRC'(P'5187'TP %IRC'(,'4148'TP%IRC-C*'5460-TP%IRC'(P'4164'TP %IRC'(0'5085'TP%IRC-C3'4903-TP%IRC-C3'4634-TP %IRC'(4'5,32'TP%IRC'(4'5,36'TP%IRC'(P'49,,'TP %IRC'(P'4960'TP%IRC'(0'5696'TP%IRC-C3'5679-TP %IRC'(0'5115'TP%IRC'(P'4989'TP%IRC-C*'5465-TP %IRC'(P'4999'TP%IRC'(P'5181'TP%IRC'(P'5200'TP %IRC'(P'4964'TP%IRC'(0'5705'TP%IRC'(,'4154'TP %IRC-C3'4920-TP%IRC-C*'5466-TP%IRC-C3'6030-TP
    [Show full text]
  • Output Results of CLIME (Clustering by Inferred Models of Evolution)
    Output results of CLIME (CLustering by Inferred Models of Evolution) Dataset: Num of genes in input gene set: 4 Total number of genes: 20834 Prediction LLR threshold: 0 The CLIME PDF output two sections: 1) Overview of Evolutionarily Conserved Modules (ECMs) Top panel shows the predefined species tree. Bottom panel shows the partition of input genes into Evolutionary Conserved Modules (ECMs), ordered by ECM strength (shown at right), and separated by horizontal lines. Each row show one gene, where the phylogenetic profile indicates presence (blue) or absence (gray) of homologs in each species (column). Gene symbols are shown at left. Gray color indicates that the gene is a paralog to a higher scoring gene within the same ECM (based on BLASTP E < 1e-3). 2) Details of each ECM and its expansion ECM+ Top panel shows the inferred evolutionary history on the predefined species tree. Branch color shows the gain event (blue) and loss events (red color, with brighter color indicating higher confidence in loss). Branches before the gain or after a loss are shown in gray. Bottom panel shows the input genes that are within the ECM (blue/white rows) as well as all genes in the expanded ECM+ (green/gray rows). The ECM+ includes genes likely to have arisen under the inferred model of evolution relative to a background model, and scored using a log likelihood ratio (LLR). PG indicates "paralog group" and are labeled alphabetically (i.e., A, B). The first gene within each paralog group is shown in black color. All other genes sharing sequence similarity (BLAST E < 1e-3) are assigned to the same PG label and displayed in gray.
    [Show full text]
  • The Hypothalamus As a Hub for SARS-Cov-2 Brain Infection and Pathogenesis
    bioRxiv preprint doi: https://doi.org/10.1101/2020.06.08.139329; this version posted June 19, 2020. The copyright holder for this preprint (which was not certified by peer review) is the author/funder, who has granted bioRxiv a license to display the preprint in perpetuity. It is made available under aCC-BY-NC-ND 4.0 International license. The hypothalamus as a hub for SARS-CoV-2 brain infection and pathogenesis Sreekala Nampoothiri1,2#, Florent Sauve1,2#, Gaëtan Ternier1,2ƒ, Daniela Fernandois1,2 ƒ, Caio Coelho1,2, Monica ImBernon1,2, Eleonora Deligia1,2, Romain PerBet1, Vincent Florent1,2,3, Marc Baroncini1,2, Florence Pasquier1,4, François Trottein5, Claude-Alain Maurage1,2, Virginie Mattot1,2‡, Paolo GiacoBini1,2‡, S. Rasika1,2‡*, Vincent Prevot1,2‡* 1 Univ. Lille, Inserm, CHU Lille, Lille Neuroscience & Cognition, DistAlz, UMR-S 1172, Lille, France 2 LaBoratorY of Development and PlasticitY of the Neuroendocrine Brain, FHU 1000 daYs for health, EGID, School of Medicine, Lille, France 3 Nutrition, Arras General Hospital, Arras, France 4 Centre mémoire ressources et recherche, CHU Lille, LiCEND, Lille, France 5 Univ. Lille, CNRS, INSERM, CHU Lille, Institut Pasteur de Lille, U1019 - UMR 8204 - CIIL - Center for Infection and ImmunitY of Lille (CIIL), Lille, France. # and ƒ These authors contriButed equallY to this work. ‡ These authors directed this work *Correspondence to: [email protected] and [email protected] Short title: Covid-19: the hypothalamic hypothesis 1 bioRxiv preprint doi: https://doi.org/10.1101/2020.06.08.139329; this version posted June 19, 2020. The copyright holder for this preprint (which was not certified by peer review) is the author/funder, who has granted bioRxiv a license to display the preprint in perpetuity.
    [Show full text]
  • Amino Acid Sequences Directed Against Cxcr4 And
    (19) TZZ ¥¥_T (11) EP 2 285 833 B1 (12) EUROPEAN PATENT SPECIFICATION (45) Date of publication and mention (51) Int Cl.: of the grant of the patent: C07K 16/28 (2006.01) A61K 39/395 (2006.01) 17.12.2014 Bulletin 2014/51 A61P 31/18 (2006.01) A61P 35/00 (2006.01) (21) Application number: 09745851.7 (86) International application number: PCT/EP2009/056026 (22) Date of filing: 18.05.2009 (87) International publication number: WO 2009/138519 (19.11.2009 Gazette 2009/47) (54) AMINO ACID SEQUENCES DIRECTED AGAINST CXCR4 AND OTHER GPCRs AND COMPOUNDS COMPRISING THE SAME GEGEN CXCR4 UND ANDERE GPCR GERICHTETE AMINOSÄURESEQUENZEN SOWIE VERBINDUNGEN DAMIT SÉQUENCES D’ACIDES AMINÉS DIRIGÉES CONTRE CXCR4 ET AUTRES GPCR ET COMPOSÉS RENFERMANT CES DERNIÈRES (84) Designated Contracting States: (74) Representative: Hoffmann Eitle AT BE BG CH CY CZ DE DK EE ES FI FR GB GR Patent- und Rechtsanwälte PartmbB HR HU IE IS IT LI LT LU LV MC MK MT NL NO PL Arabellastraße 30 PT RO SE SI SK TR 81925 München (DE) (30) Priority: 16.05.2008 US 53847 P (56) References cited: 02.10.2008 US 102142 P EP-A- 1 316 801 WO-A-99/50461 WO-A-03/050531 WO-A-03/066830 (43) Date of publication of application: WO-A-2006/089141 WO-A-2007/051063 23.02.2011 Bulletin 2011/08 • VADAY GAYLE G ET AL: "CXCR4 and CXCL12 (73) Proprietor: Ablynx N.V. (SDF-1) in prostate cancer: inhibitory effects of 9052 Ghent-Zwijnaarde (BE) human single chain Fv antibodies" CLINICAL CANCER RESEARCH, THE AMERICAN (72) Inventors: ASSOCIATION FOR CANCER RESEARCH, US, • BLANCHETOT, Christophe vol.10, no.
    [Show full text]
  • Supplementary Data
    SUPPLEMENTARY METHODS 1) Characterisation of OCCC cell line gene expression profiles using Prediction Analysis for Microarrays (PAM) The ovarian cancer dataset from Hendrix et al (25) was used to predict the phenotypes of the cell lines used in this study. Hendrix et al (25) analysed a series of 103 ovarian samples using the Affymetrix U133A array platform (GEO: GSE6008). This dataset comprises clear cell (n=8), endometrioid (n=37), mucinous (n=13) and serous epithelial (n=41) primary ovarian carcinomas and samples from 4 normal ovaries. To build the predictor, the Prediction Analysis of Microarrays (PAM) package in R environment was employed (http://rss.acs.unt.edu/Rdoc/library/pamr/html/00Index.html). When more than one probe described the expression of a given gene, we used the probe with the highest median absolute deviation across the samples. The dataset from Hendrix et al. (25) and the dataset of OCCC cell lines described in this manuscript were then overlaid on the basis of 11536 common unique HGNC gene symbols. Only the 99 primary ovarian cancers samples and the four normal ovary samples were used to build the predictor. Following leave one out cross-validation, a predictor based upon 126 genes was able to identify correctly the four distinct phenotypes of primary ovarian tumour samples with a misclassification rate of 18.3%. This predictor was subsequently applied to the expression data from the 12 OCCC cell lines to determine the likeliest phenotype of the OCCC cell lines compared to primary ovarian cancers. Posterior probabilities were estimated for each cell line in comparison to the following phenotypes: clear cell, endometrioid, mucinous and serous epithelial.
    [Show full text]
  • Us 2018 / 0305689 A1
    US 20180305689A1 ( 19 ) United States (12 ) Patent Application Publication ( 10) Pub . No. : US 2018 /0305689 A1 Sætrom et al. ( 43 ) Pub . Date: Oct. 25 , 2018 ( 54 ) SARNA COMPOSITIONS AND METHODS OF plication No . 62 /150 , 895 , filed on Apr. 22 , 2015 , USE provisional application No . 62/ 150 ,904 , filed on Apr. 22 , 2015 , provisional application No. 62 / 150 , 908 , (71 ) Applicant: MINA THERAPEUTICS LIMITED , filed on Apr. 22 , 2015 , provisional application No. LONDON (GB ) 62 / 150 , 900 , filed on Apr. 22 , 2015 . (72 ) Inventors : Pål Sætrom , Trondheim (NO ) ; Endre Publication Classification Bakken Stovner , Trondheim (NO ) (51 ) Int . CI. C12N 15 / 113 (2006 .01 ) (21 ) Appl. No. : 15 /568 , 046 (52 ) U . S . CI. (22 ) PCT Filed : Apr. 21 , 2016 CPC .. .. .. C12N 15 / 113 ( 2013 .01 ) ; C12N 2310 / 34 ( 2013. 01 ) ; C12N 2310 /14 (2013 . 01 ) ; C12N ( 86 ) PCT No .: PCT/ GB2016 /051116 2310 / 11 (2013 .01 ) $ 371 ( c ) ( 1 ) , ( 2 ) Date : Oct . 20 , 2017 (57 ) ABSTRACT The invention relates to oligonucleotides , e . g . , saRNAS Related U . S . Application Data useful in upregulating the expression of a target gene and (60 ) Provisional application No . 62 / 150 ,892 , filed on Apr. therapeutic compositions comprising such oligonucleotides . 22 , 2015 , provisional application No . 62 / 150 ,893 , Methods of using the oligonucleotides and the therapeutic filed on Apr. 22 , 2015 , provisional application No . compositions are also provided . 62 / 150 ,897 , filed on Apr. 22 , 2015 , provisional ap Specification includes a Sequence Listing . SARNA sense strand (Fessenger 3 ' SARNA antisense strand (Guide ) Mathew, Si Target antisense RNA transcript, e . g . NAT Target Coding strand Gene Transcription start site ( T55 ) TY{ { ? ? Targeted Target transcript , e .
    [Show full text]
  • Comprehensive Genomic Analysis of Dietary Habits in UK Biobank Identifies Hundreds of Genetic Associations
    ARTICLE https://doi.org/10.1038/s41467-020-15193-0 OPEN Comprehensive genomic analysis of dietary habits in UK Biobank identifies hundreds of genetic associations ✉ Joanne B. Cole 1,2,3, Jose C. Florez1,2,4 & Joel N. Hirschhorn1,3,5 Unhealthful dietary habits are leading risk factors for life-altering diseases and mortality. Large-scale biobanks now enable genetic analysis of traits with modest heritability, such as 1234567890():,; diet. We perform a genomewide association on 85 single food intake and 85 principal component-derived dietary patterns from food frequency questionnaires in UK Biobank. We identify 814 associated loci, including olfactory receptor associations with fruit and tea intake; 136 associations are only identified using dietary patterns. Mendelian randomization suggests our top healthful dietary pattern driven by wholemeal vs. white bread consumption is causally influenced by factors correlated with education but is not strongly causal for coronary artery disease or type 2 diabetes. Overall, we demonstrate the value in complementary phenotyping approaches to complex dietary datasets, and the utility of genomic analysis to understand the relationships between diet and human health. 1 Programs in Metabolism and Medical and Population Genetics, The Broad Institute of MIT and Harvard, Cambridge, MA, USA. 2 Diabetes Unit and Center for Genomic Medicine, Massachusetts General Hospital, Boston, MA, USA. 3 Division of Endocrinology and Center for Basic and Translational Obesity Research, Boston Children’s Hospital, Boston, MA,
    [Show full text]
  • Two-Dimensional Enrichment Analysis for Mining High-Level Imaging Genetic Associations
    Brain Informatics (2017) 4:27–37 DOI 10.1007/s40708-016-0052-4 Two-dimensional enrichment analysis for mining high-level imaging genetic associations Xiaohui Yao . Jingwen Yan . Sungeun Kim . Kwangsik Nho . Shannon L. Risacher . Mark Inlow . Jason H. Moore . Andrew J. Saykin . Li Shen Received: 21 January 2016 / Accepted: 29 April 2016 / Published online: 13 May 2016 Ó The Author(s) 2016. This article is published with open access at Springerlink.com Abstract Enrichment analysis has been widely applied in expression data from Allen Human Brain Atlas and the genome-wide association studies, where gene sets imaging genetics data from Alzheimer’s Disease Neu- corresponding to biological pathways are examined for roimaging Initiative as test beds, we present an IGEA significant associations with a phenotype to help increase framework and conduct a proof-of-concept study. This statistical power and improve biological interpretation. In empirical study identifies 25 significant high-level two-di- this work, we expand the scope of enrichment analysis into mensional imaging genetics modules. Many of these brain imaging genetics, an emerging field that studies how modules are relevant to a variety of neurobiological path- genetic variation influences brain structure and function ways or neurodegenerative diseases, showing the promise measured by neuroimaging quantitative traits (QT). Given of the proposal framework for providing insight into the the high dimensionality of both imaging and genetic data, mechanism of complex diseases. we propose to study Imaging Genetic Enrichment Analysis (IGEA), a new enrichment analysis paradigm that jointly Keywords Imaging genetics Á Enrichment analysis Á considers meaningful gene sets (GS) and brain circuits Genome-wide association study Á Quantitative trait (BC) and examines whether any given GS–BC pair is enriched in a list of gene–QT findings.
    [Show full text]
  • Explorations in Olfactory Receptor Structure and Function by Jianghai
    Explorations in Olfactory Receptor Structure and Function by Jianghai Ho Department of Neurobiology Duke University Date:_______________________ Approved: ___________________________ Hiroaki Matsunami, Supervisor ___________________________ Jorg Grandl, Chair ___________________________ Marc Caron ___________________________ Sid Simon ___________________________ [Committee Member Name] Dissertation submitted in partial fulfillment of the requirements for the degree of Doctor of Philosophy in the Department of Neurobiology in the Graduate School of Duke University 2014 ABSTRACT Explorations in Olfactory Receptor Structure and Function by Jianghai Ho Department of Neurobiology Duke University Date:_______________________ Approved: ___________________________ Hiroaki Matsunami, Supervisor ___________________________ Jorg Grandl, Chair ___________________________ Marc Caron ___________________________ Sid Simon ___________________________ [Committee Member Name] An abstract of a dissertation submitted in partial fulfillment of the requirements for the degree of Doctor of Philosophy in the Department of Neurobiology in the Graduate School of Duke University 2014 Copyright by Jianghai Ho 2014 Abstract Olfaction is one of the most primitive of our senses, and the olfactory receptors that mediate this very important chemical sense comprise the largest family of genes in the mammalian genome. It is therefore surprising that we understand so little of how olfactory receptors work. In particular we have a poor idea of what chemicals are detected by most of the olfactory receptors in the genome, and for those receptors which we have paired with ligands, we know relatively little about how the structure of these ligands can either activate or inhibit the activation of these receptors. Furthermore the large repertoire of olfactory receptors, which belong to the G protein coupled receptor (GPCR) superfamily, can serve as a model to contribute to our broader understanding of GPCR-ligand binding, especially since GPCRs are important pharmaceutical targets.
    [Show full text]