Supplementary Tables
Total Page:16
File Type:pdf, Size:1020Kb
Load more
Recommended publications
-
Supplemental Information to Mammadova-Bach Et Al., “Laminin Α1 Orchestrates VEGFA Functions in the Ecosystem of Colorectal Carcinogenesis”
Supplemental information to Mammadova-Bach et al., “Laminin α1 orchestrates VEGFA functions in the ecosystem of colorectal carcinogenesis” Supplemental material and methods Cloning of the villin-LMα1 vector The plasmid pBS-villin-promoter containing the 3.5 Kb of the murine villin promoter, the first non coding exon, 5.5 kb of the first intron and 15 nucleotides of the second villin exon, was generated by S. Robine (Institut Curie, Paris, France). The EcoRI site in the multi cloning site was destroyed by fill in ligation with T4 polymerase according to the manufacturer`s instructions (New England Biolabs, Ozyme, Saint Quentin en Yvelines, France). Site directed mutagenesis (GeneEditor in vitro Site-Directed Mutagenesis system, Promega, Charbonnières-les-Bains, France) was then used to introduce a BsiWI site before the start codon of the villin coding sequence using the 5’ phosphorylated primer: 5’CCTTCTCCTCTAGGCTCGCGTACGATGACGTCGGACTTGCGG3’. A double strand annealed oligonucleotide, 5’GGCCGGACGCGTGAATTCGTCGACGC3’ and 5’GGCCGCGTCGACGAATTCACGC GTCC3’ containing restriction site for MluI, EcoRI and SalI were inserted in the NotI site (present in the multi cloning site), generating the plasmid pBS-villin-promoter-MES. The SV40 polyA region of the pEGFP plasmid (Clontech, Ozyme, Saint Quentin Yvelines, France) was amplified by PCR using primers 5’GGCGCCTCTAGATCATAATCAGCCATA3’ and 5’GGCGCCCTTAAGATACATTGATGAGTT3’ before subcloning into the pGEMTeasy vector (Promega, Charbonnières-les-Bains, France). After EcoRI digestion, the SV40 polyA fragment was purified with the NucleoSpin Extract II kit (Machery-Nagel, Hoerdt, France) and then subcloned into the EcoRI site of the plasmid pBS-villin-promoter-MES. Site directed mutagenesis was used to introduce a BsiWI site (5’ phosphorylated AGCGCAGGGAGCGGCGGCCGTACGATGCGCGGCAGCGGCACG3’) before the initiation codon and a MluI site (5’ phosphorylated 1 CCCGGGCCTGAGCCCTAAACGCGTGCCAGCCTCTGCCCTTGG3’) after the stop codon in the full length cDNA coding for the mouse LMα1 in the pCIS vector (kindly provided by P. -
Human and Mouse CD Marker Handbook Human and Mouse CD Marker Key Markers - Human Key Markers - Mouse
Welcome to More Choice CD Marker Handbook For more information, please visit: Human bdbiosciences.com/eu/go/humancdmarkers Mouse bdbiosciences.com/eu/go/mousecdmarkers Human and Mouse CD Marker Handbook Human and Mouse CD Marker Key Markers - Human Key Markers - Mouse CD3 CD3 CD (cluster of differentiation) molecules are cell surface markers T Cell CD4 CD4 useful for the identification and characterization of leukocytes. The CD CD8 CD8 nomenclature was developed and is maintained through the HLDA (Human Leukocyte Differentiation Antigens) workshop started in 1982. CD45R/B220 CD19 CD19 The goal is to provide standardization of monoclonal antibodies to B Cell CD20 CD22 (B cell activation marker) human antigens across laboratories. To characterize or “workshop” the antibodies, multiple laboratories carry out blind analyses of antibodies. These results independently validate antibody specificity. CD11c CD11c Dendritic Cell CD123 CD123 While the CD nomenclature has been developed for use with human antigens, it is applied to corresponding mouse antigens as well as antigens from other species. However, the mouse and other species NK Cell CD56 CD335 (NKp46) antibodies are not tested by HLDA. Human CD markers were reviewed by the HLDA. New CD markers Stem Cell/ CD34 CD34 were established at the HLDA9 meeting held in Barcelona in 2010. For Precursor hematopoetic stem cell only hematopoetic stem cell only additional information and CD markers please visit www.hcdm.org. Macrophage/ CD14 CD11b/ Mac-1 Monocyte CD33 Ly-71 (F4/80) CD66b Granulocyte CD66b Gr-1/Ly6G Ly6C CD41 CD41 CD61 (Integrin b3) CD61 Platelet CD9 CD62 CD62P (activated platelets) CD235a CD235a Erythrocyte Ter-119 CD146 MECA-32 CD106 CD146 Endothelial Cell CD31 CD62E (activated endothelial cells) Epithelial Cell CD236 CD326 (EPCAM1) For Research Use Only. -
Supplemental Material Table of Contents
Supplemental material Table of Contents Detailed Materials and Methods ......................................................................................................... 2 Perioperative period ........................................................................................................................... 2 Ethical aspects ................................................................................................................................... 4 Evaluation of heart failure ................................................................................................................. 4 Sample preparation for ANP mRNA expression .................................................................................. 5 Sample preparation for validative qRT-PCR (Postn, Myh7, Gpx3, Tgm2) ............................................ 6 Tissue fibrosis .................................................................................................................................... 7 Ventricular remodeling and histological tissue preservation ................................................................ 8 Evaluation of the histological preservation of cardiac tissue ................................................................ 9 Sample preparation and quantitative label-free proteomics analyses .................................................. 10 Statistical methods ........................................................................................................................... 12 References ........................................................................................................................................ -
A Network-Informed Analysis of SARS-Cov-2 and Hemophagocytic Lymphohistiocytosis Genes' Interactions Points to Neutrophil Extr
medRxiv preprint doi: https://doi.org/10.1101/2020.07.01.20144121; this version posted July 2, 2020. The copyright holder for this preprint (which was not certified by peer review) is the author/funder, who has granted medRxiv a license to display the preprint in perpetuity. It is made available under a CC-BY-NC-ND 4.0 International license . 1 A network-informed analysis of SARS-CoV-2 and hemophagocytic 2 lymphohistiocytosis genes’ interactions points to Neutrophil Extracellular Traps as 3 mediators of thromBosis in COVID-19 4 5 Jun Ding1, David Earl Hostallero2, Mohamed Reda El Khili2, Gregory Fonseca3, Simon 6 Millette4, Nuzha Noorah3, Myriam Guay-Belzile3, Jonathan Spicer5, Noriko Daneshtalab6, 7 Martin Sirois7, Karine Tremblay8, Amin Emad2,* and Simon Rousseau3,* 8 9 10 1Computational Biology Department, Carnegie Mellon University, Pittsburgh, PA, USA, 15204 11 12 2Department of Electrical and Computer Engineering, McGill University, Montreal, QC, Canada. 13 14 3The Meakins-Christie Laboratories at the Research Institute of the McGill University Heath 15 Centre Research Institute, 1001 Boul. Décarie, Montréal, H4A 3J1, Canada. 16 17 4Goodman Cancer Research Centre, McGill University 18 19 5Division of Thoracic and Upper Gastrointestinal Surgery, McGill University Health Centre 20 Research Institute, 1001 Boul. Décarie, Montréal, H4A 3J1, Canada. 21 22 6School of Pharmacy, Memorial University of Newfoundland, 300 Prince Philip Drive, Health 23 Sciences Center, St. John’s, Newfoundland, Canada, A1B 3V6 24 25 7Montreal Heart Institute and Department of pharmacology and physiology, Faculty of medicine, 26 Université de Montréal. 27 28 8Pharmacology-physiology Department, Faculty of Medicine and Health Sciences, Université de 29 Sherbrooke, Centre intégré universitaire de santé et de services sociaux du Saguenay–Lac-Saint- 30 Jean (Chicoutimi University Hospital) Research Center, Saguenay, QC, Canada. -
Datasheet PB1029 Anti-AEBP2 Antibody
Product datasheet Anti-AEBP2 Antibody Catalog Number: PB1029 BOSTER BIOLOGICAL TECHNOLOGY Special NO.1, International Enterprise Center, 2nd Guanshan Road, Wuhan, China Web: www.boster.com.cn Phone: +86 27 67845390 Fax: +86 27 67845390 Email: [email protected] Basic Information Product Name Anti-AEBP2 Antibody Gene Name AEBP2 Source Rabbit IgG Species Reactivity human,mouse,rat Tested Application WB,IHC-P,ICC/IF,FCM Contents 500ug/ml antibody with PBS ,0.02% NaN3 , 1mg BSA and 50% glycerol. Immunogen E.coli-derived human AEBP2 recombinant protein (Position: K424-Q517). Human AEBP2 shares 98.8% amino acid (aa) sequence identity with mouse AEBP2. Purification Immunogen affinity purified. Observed MW 54KD Dilution Ratios Western blot: 1:500-2000 Immunohistochemistry(Paraffin-embedded Section): 1:50-400 Immunocytochemistry/Immunofluorescence (ICC/IF): 1:50-400 Flow cytometry (FCM): 1-3μg/1x106 cells Storage 12 months from date of receipt,-20℃ as supplied.6 months 2 to 8℃ after reconstitution. Avoid repeated freezing and thawing Background Information Adipocyte Enhancer-Binding Protein is a zinc finger protein that in humans is encoded by the evolutionarily well-conserved gene AEBP2. This gene is mapped to 12p12.3. AEBP2 is a DNA-binding transcriptional repressor. It may regulate the migration and development of the neural crest cells through the PRC2-mediated epigenetic mechanism and is most likely a targeting protein for the mammalian PRC2 complex. Reference Anti-AEBP2 Antibody被引用在0文献中。 暂无引用 FOR RESEARCH USE ONLY. NOT FOR DIAGNOSTIC AND CLINICAL USE. 1 Product datasheet Anti-AEBP2 Antibody Catalog Number: PB1029 BOSTER BIOLOGICAL TECHNOLOGY Special NO.1, International Enterprise Center, 2nd Guanshan Road, Wuhan, China Web: www.boster.com.cn Phone: +86 27 67845390 Fax: +86 27 67845390 Email: [email protected] Selected Validation Data Figure 1. -
2017.08.28 Anne Barry-Reidy Thesis Final.Pdf
REGULATION OF BOVINE β-DEFENSIN EXPRESSION THIS THESIS IS SUBMITTED TO THE UNIVERSITY OF DUBLIN FOR THE DEGREE OF DOCTOR OF PHILOSOPHY 2017 ANNE BARRY-REIDY SCHOOL OF BIOCHEMISTRY & IMMUNOLOGY TRINITY COLLEGE DUBLIN SUPERVISORS: PROF. CLIONA O’FARRELLY & DR. KIERAN MEADE TABLE OF CONTENTS DECLARATION ................................................................................................................................. vii ACKNOWLEDGEMENTS ................................................................................................................... viii ABBREVIATIONS ................................................................................................................................ix LIST OF FIGURES............................................................................................................................. xiii LIST OF TABLES .............................................................................................................................. xvii ABSTRACT ........................................................................................................................................xix Chapter 1 Introduction ........................................................................................................ 1 1.1 Antimicrobial/Host-defence peptides ..................................................................... 1 1.2 Defensins................................................................................................................. 1 1.3 β-defensins ............................................................................................................. -
Table S1 the Four Gene Sets Derived from Gene Expression Profiles of Escs and Differentiated Cells
Table S1 The four gene sets derived from gene expression profiles of ESCs and differentiated cells Uniform High Uniform Low ES Up ES Down EntrezID GeneSymbol EntrezID GeneSymbol EntrezID GeneSymbol EntrezID GeneSymbol 269261 Rpl12 11354 Abpa 68239 Krt42 15132 Hbb-bh1 67891 Rpl4 11537 Cfd 26380 Esrrb 15126 Hba-x 55949 Eef1b2 11698 Ambn 73703 Dppa2 15111 Hand2 18148 Npm1 11730 Ang3 67374 Jam2 65255 Asb4 67427 Rps20 11731 Ang2 22702 Zfp42 17292 Mesp1 15481 Hspa8 11807 Apoa2 58865 Tdh 19737 Rgs5 100041686 LOC100041686 11814 Apoc3 26388 Ifi202b 225518 Prdm6 11983 Atpif1 11945 Atp4b 11614 Nr0b1 20378 Frzb 19241 Tmsb4x 12007 Azgp1 76815 Calcoco2 12767 Cxcr4 20116 Rps8 12044 Bcl2a1a 219132 D14Ertd668e 103889 Hoxb2 20103 Rps5 12047 Bcl2a1d 381411 Gm1967 17701 Msx1 14694 Gnb2l1 12049 Bcl2l10 20899 Stra8 23796 Aplnr 19941 Rpl26 12096 Bglap1 78625 1700061G19Rik 12627 Cfc1 12070 Ngfrap1 12097 Bglap2 21816 Tgm1 12622 Cer1 19989 Rpl7 12267 C3ar1 67405 Nts 21385 Tbx2 19896 Rpl10a 12279 C9 435337 EG435337 56720 Tdo2 20044 Rps14 12391 Cav3 545913 Zscan4d 16869 Lhx1 19175 Psmb6 12409 Cbr2 244448 Triml1 22253 Unc5c 22627 Ywhae 12477 Ctla4 69134 2200001I15Rik 14174 Fgf3 19951 Rpl32 12523 Cd84 66065 Hsd17b14 16542 Kdr 66152 1110020P15Rik 12524 Cd86 81879 Tcfcp2l1 15122 Hba-a1 66489 Rpl35 12640 Cga 17907 Mylpf 15414 Hoxb6 15519 Hsp90aa1 12642 Ch25h 26424 Nr5a2 210530 Leprel1 66483 Rpl36al 12655 Chi3l3 83560 Tex14 12338 Capn6 27370 Rps26 12796 Camp 17450 Morc1 20671 Sox17 66576 Uqcrh 12869 Cox8b 79455 Pdcl2 20613 Snai1 22154 Tubb5 12959 Cryba4 231821 Centa1 17897 -
Seq2pathway Vignette
seq2pathway Vignette Bin Wang, Xinan Holly Yang, Arjun Kinstlick May 19, 2021 Contents 1 Abstract 1 2 Package Installation 2 3 runseq2pathway 2 4 Two main functions 3 4.1 seq2gene . .3 4.1.1 seq2gene flowchart . .3 4.1.2 runseq2gene inputs/parameters . .5 4.1.3 runseq2gene outputs . .8 4.2 gene2pathway . 10 4.2.1 gene2pathway flowchart . 11 4.2.2 gene2pathway test inputs/parameters . 11 4.2.3 gene2pathway test outputs . 12 5 Examples 13 5.1 ChIP-seq data analysis . 13 5.1.1 Map ChIP-seq enriched peaks to genes using runseq2gene .................... 13 5.1.2 Discover enriched GO terms using gene2pathway_test with gene scores . 15 5.1.3 Discover enriched GO terms using Fisher's Exact test without gene scores . 17 5.1.4 Add description for genes . 20 5.2 RNA-seq data analysis . 20 6 R environment session 23 1 Abstract Seq2pathway is a novel computational tool to analyze functional gene-sets (including signaling pathways) using variable next-generation sequencing data[1]. Integral to this tool are the \seq2gene" and \gene2pathway" components in series that infer a quantitative pathway-level profile for each sample. The seq2gene function assigns phenotype-associated significance of genomic regions to gene-level scores, where the significance could be p-values of SNPs or point mutations, protein-binding affinity, or transcriptional expression level. The seq2gene function has the feasibility to assign non-exon regions to a range of neighboring genes besides the nearest one, thus facilitating the study of functional non-coding elements[2]. Then the gene2pathway summarizes gene-level measurements to pathway-level scores, comparing the quantity of significance for gene members within a pathway with those outside a pathway. -
New Approaches to Functional Process Discovery in HPV 16-Associated Cervical Cancer Cells by Gene Ontology
Cancer Research and Treatment 2003;35(4):304-313 New Approaches to Functional Process Discovery in HPV 16-Associated Cervical Cancer Cells by Gene Ontology Yong-Wan Kim, Ph.D.1, Min-Je Suh, M.S.1, Jin-Sik Bae, M.S.1, Su Mi Bae, M.S.1, Joo Hee Yoon, M.D.2, Soo Young Hur, M.D.2, Jae Hoon Kim, M.D.2, Duck Young Ro, M.D.2, Joon Mo Lee, M.D.2, Sung Eun Namkoong, M.D.2, Chong Kook Kim, Ph.D.3 and Woong Shick Ahn, M.D.2 1Catholic Research Institutes of Medical Science, 2Department of Obstetrics and Gynecology, College of Medicine, The Catholic University of Korea, Seoul; 3College of Pharmacy, Seoul National University, Seoul, Korea Purpose: This study utilized both mRNA differential significant genes of unknown function affected by the display and the Gene Ontology (GO) analysis to char- HPV-16-derived pathway. The GO analysis suggested that acterize the multiple interactions of a number of genes the cervical cancer cells underwent repression of the with gene expression profiles involved in the HPV-16- cancer-specific cell adhesive properties. Also, genes induced cervical carcinogenesis. belonging to DNA metabolism, such as DNA repair and Materials and Methods: mRNA differential displays, replication, were strongly down-regulated, whereas sig- with HPV-16 positive cervical cancer cell line (SiHa), and nificant increases were shown in the protein degradation normal human keratinocyte cell line (HaCaT) as a con- and synthesis. trol, were used. Each human gene has several biological Conclusion: The GO analysis can overcome the com- functions in the Gene Ontology; therefore, several func- plexity of the gene expression profile of the HPV-16- tions of each gene were chosen to establish a powerful associated pathway, identify several cancer-specific cel- cervical carcinogenesis pathway. -
Transcriptomic Analysis of the Aquaporin (AQP) Gene Family
Pancreatology 19 (2019) 436e442 Contents lists available at ScienceDirect Pancreatology journal homepage: www.elsevier.com/locate/pan Transcriptomic analysis of the Aquaporin (AQP) gene family interactome identifies a molecular panel of four prognostic markers in patients with pancreatic ductal adenocarcinoma Dimitrios E. Magouliotis a, b, Vasiliki S. Tasiopoulou c, Konstantinos Dimas d, * Nikos Sakellaridis d, Konstantina A. Svokos e, Alexis A. Svokos f, Dimitris Zacharoulis b, a Division of Surgery and Interventional Science, Faculty of Medical Sciences, UCL, London, UK b Department of Surgery, University of Thessaly, Biopolis, Larissa, Greece c Faculty of Medicine, School of Health Sciences, University of Thessaly, Biopolis, Larissa, Greece d Department of Pharmacology, Faculty of Medicine, School of Health Sciences, University of Thessaly, Biopolis, Larissa, Greece e The Warren Alpert Medical School of Brown University, Providence, RI, USA f Riverside Regional Medical Center, Newport News, VA, USA article info abstract Article history: Background: This study aimed to assess the differential gene expression of aquaporin (AQP) gene family Received 14 October 2018 interactome in pancreatic ductal adenocarcinoma (PDAC) using data mining techniques to identify novel Received in revised form candidate genes intervening in the pathogenicity of PDAC. 29 January 2019 Method: Transcriptome data mining techniques were used in order to construct the interactome of the Accepted 9 February 2019 AQP gene family and to determine which genes members are differentially expressed in PDAC as Available online 11 February 2019 compared to controls. The same techniques were used in order to evaluate the potential prognostic role of the differentially expressed genes. Keywords: PDAC Results: Transcriptome microarray data of four GEO datasets were incorporated, including 142 primary Aquaporin tumor samples and 104 normal pancreatic tissue samples. -
A Computational Approach for Defining a Signature of Β-Cell Golgi Stress in Diabetes Mellitus
Page 1 of 781 Diabetes A Computational Approach for Defining a Signature of β-Cell Golgi Stress in Diabetes Mellitus Robert N. Bone1,6,7, Olufunmilola Oyebamiji2, Sayali Talware2, Sharmila Selvaraj2, Preethi Krishnan3,6, Farooq Syed1,6,7, Huanmei Wu2, Carmella Evans-Molina 1,3,4,5,6,7,8* Departments of 1Pediatrics, 3Medicine, 4Anatomy, Cell Biology & Physiology, 5Biochemistry & Molecular Biology, the 6Center for Diabetes & Metabolic Diseases, and the 7Herman B. Wells Center for Pediatric Research, Indiana University School of Medicine, Indianapolis, IN 46202; 2Department of BioHealth Informatics, Indiana University-Purdue University Indianapolis, Indianapolis, IN, 46202; 8Roudebush VA Medical Center, Indianapolis, IN 46202. *Corresponding Author(s): Carmella Evans-Molina, MD, PhD ([email protected]) Indiana University School of Medicine, 635 Barnhill Drive, MS 2031A, Indianapolis, IN 46202, Telephone: (317) 274-4145, Fax (317) 274-4107 Running Title: Golgi Stress Response in Diabetes Word Count: 4358 Number of Figures: 6 Keywords: Golgi apparatus stress, Islets, β cell, Type 1 diabetes, Type 2 diabetes 1 Diabetes Publish Ahead of Print, published online August 20, 2020 Diabetes Page 2 of 781 ABSTRACT The Golgi apparatus (GA) is an important site of insulin processing and granule maturation, but whether GA organelle dysfunction and GA stress are present in the diabetic β-cell has not been tested. We utilized an informatics-based approach to develop a transcriptional signature of β-cell GA stress using existing RNA sequencing and microarray datasets generated using human islets from donors with diabetes and islets where type 1(T1D) and type 2 diabetes (T2D) had been modeled ex vivo. To narrow our results to GA-specific genes, we applied a filter set of 1,030 genes accepted as GA associated. -
A Clinicopathological and Molecular Genetic Analysis of Low-Grade Glioma in Adults
A CLINICOPATHOLOGICAL AND MOLECULAR GENETIC ANALYSIS OF LOW-GRADE GLIOMA IN ADULTS Presented by ANUSHREE SINGH MSc A thesis submitted in partial fulfilment of the requirements of the University of Wolverhampton for the degree of Doctor of Philosophy Brain Tumour Research Centre Research Institute in Healthcare Sciences Faculty of Science and Engineering University of Wolverhampton November 2014 i DECLARATION This work or any part thereof has not previously been presented in any form to the University or to any other body whether for the purposes of assessment, publication or for any other purpose (unless otherwise indicated). Save for any express acknowledgments, references and/or bibliographies cited in the work, I confirm that the intellectual content of the work is the result of my own efforts and of no other person. The right of Anushree Singh to be identified as author of this work is asserted in accordance with ss.77 and 78 of the Copyright, Designs and Patents Act 1988. At this date copyright is owned by the author. Signature: Anushree Date: 30th November 2014 ii ABSTRACT The aim of the study was to identify molecular markers that can determine progression of low grade glioma. This was done using various approaches such as IDH1 and IDH2 mutation analysis, MGMT methylation analysis, copy number analysis using array comparative genomic hybridisation and identification of differentially expressed miRNAs using miRNA microarray analysis. IDH1 mutation was present at a frequency of 71% in low grade glioma and was identified as an independent marker for improved OS in a multivariate analysis, which confirms the previous findings in low grade glioma studies.