Title Isolation of , Rickettsiella, and Spiroplasma from Questing in Japan Using Arthropod Cells

Thu, May June; Qiu, Yongjin; Kataoka-Nakamura, Chikako; Sugimoto, Chihiro; Katakura, Ken; Isoda, Norikazu; Author(s) Nakao, Ryo

Vector-Borne and Zoonotic Diseases, 19(7), 474-485 Citation https://doi.org/10.1089/vbz.2018.2373

Issue Date 2019-06

Doc URL http://hdl.handle.net/2115/78725

Rights Final publication is available from Mary Ann Liebert, Inc., publishers http://dx.doi.org/10.1089/vbz.2018.2373

Type article (author version)

File Information manuscript.pdf

Instructions for use

Hokkaido University Collection of Scholarly and Academic Papers : HUSCAP 1 Isolation of Rickettsia, Rickettsiella, and Spiroplasma from questing ticks in

2 Japan using arthropod cells

3

4 May June THU1,2, Yongjin QIU3, Chikako KATAOKA-NAKAMURA2,4, Chihiro

5 SUGIMOTO5,6, Ken KATAKURA1, Norikazu ISODA2,6, Ryo NAKAO1,*

6

7 1 Laboratory of Parasitology, Faculty of Veterinary Medicine, Graduate School of

8 Infectious Diseases, Hokkaido University, Kita 18, Nishi 9, Kita-ku, Sapporo 060-

9 0818, Japan

10 2 Unit of Risk Analysis and Management, Hokkaido University Research Center for

11 Zoonosis Control, Kita 20, Nishi 10, Kita-ku, Sapporo 001-0020, Japan

12 3 Hokudai Center for Zoonosis Control in Zambia, School of Veterinary Medicine,

13 University of Zambia, P. O. Box 32379, Lusaka 10101, Zambia

14 4 Division of Surveillance, Biomedical Science Center, General Foundation Osaka

15 University Microbiology Research Group Kanonji Laboratory Seto Center, 4-1-70,

16 Seto-cho, Kan-onji, Kagawa 768-0065, Japan

17 5 Division of Collaboration and Education, Hokkaido University Research Center for

18 Zoonosis Control, Kita 20, Nishi 10, Kita-ku, Sapporo 001-0020, Japan

19 6 Global Station for Zoonosis Control, Global Institution for Collaborative Research

20 and Education (GI-CoRE), Hokkaido University, Kita 18, Nishi 9, Kita-ku, Sapporo,

21 Hokkaido 060-0818, Japan

22 *Corresponding author:

23 Ryo NAKAO

24 Laboratory of Parasitology,

25 Graduate School of Veterinary Medicine,

1

26 Hokkaido University,

27 Sapporo 060-0818, Japan

28 Tel: +81-(0)11-706-5196

29 Fax: +81-(0)11-706-5196

30 E-mail address: [email protected]

31

32 MJT: [email protected]

33 YQ: [email protected]

34 CK: [email protected]

35 CS: [email protected]

36 KK: [email protected]

37 NI: [email protected]

38 RN: [email protected]

39

40 Running title: Bacterial isolation using arthropod cells

41

2

42 Abstract

43 Ticks are blood sucking ectoparasites that transmit zoonotic pathogens to

44 humans and animals. Ticks harbour not only pathogenic microorganisms, but also

45 endosymbionts. Although some endosymbionts are known to be essential for the

46 survival of ticks, their roles in ticks remain poorly understood. The main aim of this

47 study was to isolate and characterise tick-borne microorganisms from field-collected

48 ticks using two arthropod cell lines derived from Ixodes scapularis embryos (ISE6)

49 and Aedes albopictus larvae (C6/36). A total of 170 tick homogenates originating from

50 15 different tick species collected in Japan were inoculated into each cell line. Bacterial

51 growth was confirmed by PCR amplification of 16S ribosomal DNA (rDNA) of

52 eubacteria. During the 8 weeks observation period, bacterial isolation was confirmed

53 in 14 and 4 samples using ISE6 and C6/36 cells, respectively. The sequencing analysis

54 of the 16S rDNA PCR products indicated that they were previously known tick-borne

55 pathogens/endosymbionts in three different genera; Rickettsia, Rickettsiella, and

56 Spiroplasma. These included 4 previously validated rickettsial species namely

57 Rickettsia asiatica (n = 2), Rickettsia helvetica (n = 3), Rickettsia monacensis (n = 2),

58 and Rickettsia tamurae (n = 3) and one uncharacterised genotype Rickettsia sp. LON

59 (n = 2). Four isolates of Spiroplasma had the highest similarity with previsouly

60 reported Spiroplasma isolates; Spiroplasma ixodetis obtained from ticks in North

61 America and Spiroplasma sp. Bratislava 1 obtained from Ixodes ricinus in Europe,

62 while two isolates of Rickettsiella showed 100% identity with Rickettsiella sp. detected

63 from Ixodes uriae at Grimsey Island in Iceland. To the best of our knowledge, this is

64 the first report on successful isolation of Rickettsiella from ticks. The isolates obtained

65 in the present study can be further analysed to evaluate their pathogenic potential in

66 animals and their roles as symbionts in ticks.

3

67 Keywords: Arthropods, Isolation, Rickettsia, Rickettsiella, Spiroplasma, Symbionts

4

68 Introduction

69 Ticks are important vectors among blood sucking ectoparasites that transmit

70 various zoonotic pathogens to humans and animals through their bite. Ticks harbour

71 not only pathogenic microorganisms of veterinary and medical importance (Jongejan

72 and Uilenberg 2004) but also several endosymbionts of the genera Coxiella,

73 Francisella, and Rickettsia (Paddock et al. 2004, Ahantarig et al. 2013). The recent

74 development of deep sequencing technologies has enabled high-throughput screening

75 of pathogens and symbionts in ticks and expanded our knowledge on the diversity of

76 microorganisms harboured by ticks (Nakao et al. 2013, Qiu et al. 2014, Kurilshikov et

77 al. 2015). Although these studies have led to the discovery of several previously

78 unexpected or poorly characterised microorganisms, it is challenging to evaluate their

79 roles in ticks and their pathogenic potential to animals solely based on their partial

80 genome sequences.

81 In Japan, several tick-borne human diseases have been recognised. Until the

82 recent emergence of severe fever with thrombocytopenia syndrome (Takahashi et al.

83 2014) and the re-emergence of tick-borne encephalitis (Yoshii et al. 2017), most cases

84 of tick-borne human diseases have been associated with bacterial infections. In

85 particular, caused by is the most common

86 tick-borne human diseases with hundreds of cases reported annually (National Institute

87 of Infectious Diseases 2017). Several other rickettsioses caused by Rickettsia

88 heilongjiangensis, Rickettsia helvetica, and Rickettsia tamurae have also been reported

89 to date (Noji et al. 2005, Ando et al. 2010, Imaoka et al. 2011). The etiological agents

90 of these rickettsial diseases were isolated from patients and ticks primarily using L929

91 mouse fibroblast cells, (Uchida et al. 1992, Fournier et al. 2002, Fujita et al. 2006,

5

92 Mahara 2006, Ando et al. 2010, Andoh et al. 2014). However, none of these studies

93 have used arthropod cells for isolation of tick-borne pathogens in Japan.

94 At present, tick cell lines are indispensable tools to study the interaction

95 between ticks and tick-borne microorganisms including pathogens and symbionts in

96 vitro (Bell-Sakyi et al. 2007, Bell-Sakyi et al. 2012). The cells have also been

97 successfully used for isolating and propagating a number of tick-borne

98 microorganisms (Bell-Sakyi et al. 2007, Bell-Sakyi et al. 2015). For example, the

99 previously unculturable Borrelia lonestari was isolated and propagated for the first

100 time in a tick cell line (Varela et al. 2004). Similarly, other tick-borne pathogens from

101 genera such as Anaplasma and Ehrlichia have been successfully cultivated and

102 maintained in tick cell lines (Munderloh et al. 2003, Zweygarth et al. 2013).

103 The main aim of this study was to isolate and characterise tick-borne

104 microorganisms from field-collected ticks using two arthropod cell lines derived from

105 Ixodes scapularis embryo (ISE6) and Aedes albopictus larvae (C6/36). Our approach

106 led to the isolation of four previously validated rickettsial species, one uncharacterised

107 rickettsial genotype and two tick endosymbionts, Rickettsiella and Spiroplasma.

108

109 Materials and Methods

110 Tick samples

111 This study employed unfed ticks collected in 11 different prefectures by a

112 flagging method between 2013 and 2015 (Table 1). Tick species were identified

113 morphologically under a stereomicroscope using standard keys (Yamaguti et al. 1971,

114 Nakao et al.1992). The samples included fifteen different tick species; Amblyomma

115 testudinarium (n = 10), Dermacentor taiwanensis (n = 3), Haemaphysalis concinna (n

116 = 3), Haemaphysalis flava (n = 8), Haemaphysalis formosensis (n = 15),

6

117 Haemaphysalis hystricis (n = 24), Haemaphysalis japonica (n = 9), Haemaphysalis

118 kitaokai (n = 3), Haemaphysalis longicornis (n = 18), Haemaphysalis megaspinosa (n

119 = 27), Ixodes monospinosus (n = 7), Ixodes nipponensis (n = 2), Ixodes ovatus (n = 9),

120 Ixodes pavlovskyi (n = 2) and Ixodes persulcatus (n = 30). After identifying tick species,

121 ticks were washed with 70% ethanol and sterile PBS, then homogenised in 100 µl of

122 high-glucose Dulbecco’s Modified Eagle medium (DMEM Gibco, Life Technologies,

123 Carlsbad, CA, USA) using a Micro SmashTM MS100R (TOMY, Tokyo, Japan). Half

124 of the homogenate was subjected to DNA extraction using a blackPREP Tick

125 DNA/RNA Kit (Analytikjena, Germany), while the other half was kept at -80°C and

126 used for this study. A total of 170 tick homogenates including 158 from single unfed

127 ticks (adult or nymph) and 12 from nymphal pools (5 to 24 nymphs/pool) were

128 included in the present study.

129

130 Maintenance of cell lines

131 ISE6 cells, originally reported by Kurtti et al (1996) and received from the

132 CEH Institute of Virology and Environmental Microbiology (Oxford, UK), were

133 grown in L-15B medium supplemented with 10% foetal bovine serum, and 5%

134 tryptose phosphate broth (Sigma-Aldrich, St. Louis, MO, USA) at 32°C as described

135 previously (Munderloh and Kurtti 1989), except that 0.1% bovine lipoprotein

136 concentrate was not included in the culture medium. C6/36 cells, purchased from the

137 American Type Culture Collection (No. CRL-1660), were grown in Minimum

138 Essential Medium (MEM, Gibco) supplemented with 10% foetal bovine serum, 2%

139 MEM Non-essential amino acids (Gibco), 1% Sodium Pyruvate 100 mM (Gibco), and

140 1% L-glutamine (Gibco) at 28°C in a humidified atmosphere of 5% CO2 in air.

141

7

142 Co-culture with tick homogenates

143 ISE6 and C6/36 cells were seeded in 24-well culture plates and incubated

144 overnight. On the following day, 5 μl of each tick homogenate was inoculated into

145 separate wells of both cell lines. Culture medium was changed every three days for

146 C6/36 cells and once a week for ISE6 cells. At 2 weeks post-inoculation (pi), 100 μl

147 of culture suspension was passaged into new wells containing uninfected cells. Second

148 and third passages were conducted in the same way as first at 4 and 6 weeks pi,

149 respectively. At 8 weeks pi, the experiment was terminated. All the bacterial isolates

150 obtained in this study were preserved at -80°C for downstream analysis. Cell

151 morphology was observed daily under an inverted microscope to detect cytopathic

152 effects presumably caused by bacterial infections. When contamination of fungi or

153 environmental was observed, the contaminated wells were sterilised with 10%

154 hypochlorous acid for more than 10 min to prevent the spread of contamination to the

155 neighbouring wells.

156

157 PCR

158 When the cells showed sign of bacterial infection, DNA was extracted from

159 100 μl of parent culture suspension and/or first subculture using a Wizard Genomic

160 DNA Purification Kit (Promega, Madison, WI, USA) following the manufacturer’s

161 instructions. In addition, cell suspensions from all wells at 4 and 8 weeks pi (from first

162 and third subcultures, respectively) were subjected to DNA extraction to detect

163 possible bacterial infection whether or not morphological changes were seen in cells.

164 PCR was conducted using the primers, fD1 and Rp2 to amplify eubacterial 16S

165 ribosomal DNA (rDNA) (Weisburg et al. 1991). In order to characterise rickettsial

166 isolates, three additional genes were amplified: citrate synthase gene (gltA) (Regnery

8

167 et al. 1991), 190-kDa outer membrane gene (ompA) (Roux and Raoult, 2000), and 120-

168 kDa outer membrane protein gene (ompB) (Gaowa et al. 2013). All PCR reactions

169 were conducted in a 25 µl-reaction mixture containing 2.5 µl of 10 × KOD Plus Neo

170 PCR Buffer, 0.5 µl of a high-fidelity KOD-Plus-Neo DNA polymerase (Toyobo), 200

171 nM of each primer, and 1.0 µl of template DNA. PCR conditions were as follows: 40

172 cycles of denaturation (94°C, 15 sec), annealing (55°C for gltA, ompA, and 16S rDNA

173 and 48°C for ompB, 30 sec) and extension (68°C, 30 sec for gltA, ompA, and ompB

174 and 90 sec for 16S rDNA). For some samples, we conducted TA-cloning using the

175 pGEM-T vector (Promega, Madison, WI) as described previously (Nakao et al. 2013).

176 The experimental procedures were approved by the Hokkaido University Safety

177 Committee on Genetic Recombination Experiments (No. 2017-046). All the primer

178 information is available in Table 2. All negative control containing sterile water

179 instead of template DNA was included in all PCR assays.

180

181 Real-time PCR

182 Real-time PCR to detect the gltA gene of spotted fever group and

183 group rickettsiae was conducted using the primers and probe shown in Table 2.

184 Reactions mixtures were prepared using THUNDERBIRD Probe qPCR Mix (Toyobo,

185 Osaka, Japan) and the reactions were carried out in a C1000 Thermal Cycler with a

186 CFX96 Real-Time PCR Detection System (BioRad Laboratories, Hercules, CA) as

187 described previously (Nakao et al. 2013).

188

189 Sequencing and data analysis

190 All amplified PCR products were purified using a NucleoSpin Gel and PCR

191 Clean Up Kit (Takara Bio Inc.) and sequenced using the BigDye Terminator version

9

192 3.1 Cycle Sequencing Kit (Applied Biosystems, Foster City, CA, USA). To sequence

193 16S rDNA PCR products, sequencing primers were newly designed in the present

194 study (Table 2). The purified sequencing products were analysed on an ABI Prism

195 3130xl Genetic Analyzer Kit (Applied Biosystems) according to the manufacturers'

196 instructions. The sequences from this study were submitted to the DNA Data Bank of

197 Japan (http://www.ddbj.nig.ac.jp) under accession numbers (16S rDNA: LC388759-

198 LC388776; gltA: LC388777-LC388788; ompA: LC388789-LC388795; and ompB:

199 LC388796-LC388807). Sequenced data were aligned using ATGC software version

200 6.0.4. Phylogenetic analyses were conducted by a maximum likelihood method using

201 MEGA7 version 7.0.18 (Kumar et al. 2016). Bootstrap values were obtained with

202 1,000 replicates.

203

204 Results

205 Real-time PCR

206 Among 170 tick homogenates examined, 114 tested positive for Rickettsia

207 infections by gltA real-time PCR (Table 1). We used both negative and Rickettsia-

208 positive samples for the cell culture isolation experiments.

209

210 Isolation results

211 During the 8 weeks observation period, we confirmed bacterial isolation in

212 14 and 4 samples using ISE6 and C6/36 cells, respectively (Table 3). Ten isolates (9

213 from ISE6 and 1 from C6/36) were obtained in the parent cultures, while 8 isolates (5

214 from ISE6 and 3 from C6/36) were obtained in the first subcultures (Figure 1). The

215 sequencing analysis of the 16S rDNA PCR products indicated that they were

216 previously known tick-borne bacteria in three different genera; Rickettsia, Rickettsiella,

10

217 and Spiroplasma (Table 4). Although a further 11 and 4 samples in ISE6 and C6/36

218 cells, respectively, also showed bacterial growth in the well, sequencing analysis

219 indicated the growth of environmental bacteria such as Bacillus spp., Pseudomonas

220 spp., and Mycobacterium spp. (data not shown). Fungal infections developed in 75

221 ISE6 and 57 C6/36 wells; the remaining 77 and 98 wells respectively did not yield any

222 isolates (Table 3). Although 4 rickettsial and 3 spiroplasmal isolates did not show any

223 cytopathic effects in the infected cells, their infections were detected by PCR

224 conducted at 28 days pi (Figure 1).

225

226 Rickettsia isolation

227 Twelve isolates of Rickettsia (11 in ISE6 and one in C6/36) were obtained

228 from different tick homogenates (Table 3). The amplification of gltA and ompB genes

229 was successful in all rickettsial isolates, while the ompA gene was amplified only from

230 seven isolates (Table 4). Based on the phylogenetic analysis of each rickettsial gene,

231 the 12 isolates were identified as 4 previously validated species, Rickettsia asiatica (n

232 = 2), R. helvetica (n = 3), Rickettsia monacensis (n = 2), R. tamurae (n = 3), and

233 Rickettsia sp. LON, an unnamed rickettsial agent previously isolated from H.

234 longicornis in Japan (Fujita 2008), (n = 2) (Figure 2 and Supplementary Table S1).

235 There was a complete correspondence between rickettsial species/genotype and tick

236 species of origin; R. asiatica, R. helvetica, R. monacensis, R. tamurae, and Rickettsia

237 sp. LON were isolated from I. ovatus, I. persulcatus, I. nipponensis, A. testudinarium,

238 and H. longicornis, respectively. A cytopathic effect was observed in R. helvetica-, R.

239 monacensis-, and R. tamurae-infected cells at 6, 14 and 10 days pi, while there was no

240 obvious morphological damage observed in R. asiatica- and Rickettsia sp. LON-

241 infected cells (Figure 1).

11

242

243 Rickettsiella isolation

244 Rickettsiella was isolated from a homogenate of H. concinna collected in

245 Hokkaido using both ISE6 and C6/36 cells (Table 1). A cytopathic effect was observed

246 at 6 and 13 days pi in ISE6 and C6/36 cells, respectively (Figure 1). The sequences of

247 16S rDNA of Rickettsiella obtained from two cell lines were identical and showed

248 100% identity with Rickettsiella sp. detected in Ixodes uriae from Grimsey Island in

249 Iceland (GenBank No. KT697673). A phylogenetic analysis showed that our isolates

250 formed a cluster with Rickettsiella spp. detected in pea aphids (Figure 3 and

251 Supplementary Table S1).

252

253 Spiroplasma isolation

254 Four Spiroplasma isolates were obtained (2 each from ISE6 and C6/36)

255 (Table 3). Since two isolates were obtained from the same tick homogenate using

256 different cell lines, four isolates originated from three tick homogenates: I.

257 monospinosus, I. persulcatus, and H. kitaokai collected from Yamagata, Hokkaido and

258 Fukushima prefectures, respectively (Table 1). Only one isolate (147_ISE6) showed a

259 cytopathic effect in ISE6 cells at 23 days pi (Figure 1). Among 4 isolates, two sequence

260 types of 16S rDNA had two base pair (bp) differences in their sequences. One sequence

261 type was obtained from two isolates (135_ISE6 and 135_C6/36) from I. monospinosus

262 and one isolate (1033_ISE6) from H. kitaokai, while the other was from I. persulcatus

263 (147_ISE6). Both sequences showed the highest identities (1443/1444 bp and

264 1441/1444 bp) with 16S rDNA from Spiroplasma sp. detected from Fannia manicata

265 (little housefly) (GenBank No. AY569829). In a phylogenetic analysis, our isolates

266 were clustered together with 16S rDNA of two tick-derived Spiroplasma isolates;

12

267 Spiroplasma ixodetis (GenBank No. NR104852) obtained from Ixodes pacificus and

268 Spiroplasma sp. Bratislava 1 (GenBank No. KP967685) obtained from I. ricinus, and

269 several Spiroplasma spp. detected from various arthropods (Figure 4 and

270 Supplementary Table S1).

271

272 Discussion

273 We achieved the first isolation and propagation of R. monacensis from Japan

274 using ISE6 cells. This rickettsial agent has not been officially reported in Japan; in a

275 recent nationwide survey we found sequences of R. monacensis in I. nipponensis with

276 high infection rates (Thu et al. submitted). R. monacensis was first isolated from Ixodes

277 ricinus collected in Germany using ISE6 cells (Simser et al. 2002), where the authors

278 detected a cytopathic effect after the third passage (5 months). In our experiment, we

279 observed a cytopathic effect as early as 14 days after the inoculation in both ISE6 and

280 C6/36 cells (Figure 1). Although the reason for this difference is not clear, it may

281 suggest that phenotypes under in vitro culture conditions differ between R. monacensis

282 strains. R. monacensis has been associated with a human presenting

283 Mediterranean spotted fever-like symptoms (Jado et al. 2007, Madeddu et al. 2012,

284 Kim et al. 2017). The present study reconfirmed the presence of this rickettsial agent

285 in Japan and highlighted the necessity for further investigation of the clinical cases it

286 may cause.

287 In addition to R. monacensis, we isolated 3 previously validated rickettsial

288 species, R. asiatica, R. helvetica, R. tamurae, and one uncharacterised genotype

289 Rickettsia sp. LON using ISE6 cells, among which only R. asiatica was also isolated

290 in C6/36 cells (Table 4). Although the C6/36 cells inoculated with the tick

291 homogenates from which Rickettsia were isolated using ISE6 cells were tested for

13

292 rickettsial infections by PCR at 8 weeks pi, there were no positive amplicons. However,

293 when the isolates of R. monacensis and R. helvetica obtained from ISE6 culture were

294 inoculated into C6/36 cells in our preliminary experiments, their persistent growth in

295 the cells was observed (data not shown). In fact, R. monacensis and R. helvetica were

296 isolated from I. ricinus in Portugal using C6/36 cells in a previous study (Milhano et

297 al. 2010). These results may indicate that lower success rates of rickettial isolation

298 using C6/36 cells is partly attributed to low bacterial burden in the inocula. It is also

299 possible that propagation in ISE6 cells might help the rickettsial isolates adapt to in

300 vitro culture conditions using C6/36 cells.

301 There are only a few reports on the in vitro propagation of Rickettsiella. For

302 example, Rickettsiella grylli isolated from the variegated grasshopper, Zonocerus

303 variegatus, was cultured in several cell lines derived from different arthropods (Henry

304 et al. 1986). To the best of our knowledge, this is the first report of the successful

305 isolation of Rickettsiella spp. from ticks using ISE6 cells and C6/36 cells. Bacteria

306 within the genus Rickettsiella are known to be symbionts of many arthropods

307 (Tsuchida et al. 2010, Leclerque et al. 2011, Iasur-Kruh et al. 2013, Łukasik et al.

308 2013). In ticks, Rickettsiella species have been reported in the genera Ixodes and

309 Ornithodoros (Duron et al. 2016, Duron et al. 2015, Vilcins et al. 2009, Kurtti et al.

310 2002). A recent metagenomic approach based on 16S rDNA amplicons also showed

311 the presence of Rickettsiella in the genus Haemaphysalis (Khoo et al. 2016). The

312 sequence analysis of 16S rDNA revealed that the Rickettsiella sp. isolated from H.

313 concinna showed 100% identity with a Rickettsiella endosymbiont detected in I. uriae

314 collected from a seabird in Iceland (Figure 3). These facts may support the hypothesis

315 that Rickettsiella has a wide geographical distribution in ticks and is maintained by

316 horizontal transfer between arthropod species as previously suggested (Duron et al.

14

317 2016). However, a more detailed analysis such as whole genome comparison between

318 Rickettsiella spp. found in different arthropod hosts is essential to prove this hypothesis.

319 The role of Rickettsiella in ticks is totally unknown; however, the lines of evidence

320 from other arthropods indicated an effect on the survival of their host arthropods

321 (Tsuchida et al. 2010, Łukasik et al. 2013). The isolate obtained in the present study

322 might be useful to further investigate potential roles of Rickettsiella in ticks.

323 We obtained four spiroplasmal isolates from three tick species: I.

324 monospinosus, I. persulcatus, and H. kitaokai. The isolates obtained from I.

325 monospinosus and H. kitaokai had completely identical 16S rDNA sequences and all

326 spiroplamal isolates in the present study made one clade with previously reported

327 Spiroplasma species which were detected in a variety of arthropods including ticks,

328 ladybirds, plant hoppers and mealybugs (Figure 4). These findings may suggest that

329 Spiroplasma is maintained by horizontal transfer between different arthropod species

330 as suggested for Rickettsiella. This hypothesis should be explored in future studies.

331 Most members of Spiroplasma are symbionts in arthropods and some of them are

332 known to be beneficial to their hosts for example, by protecting from fungal or parasitic

333 infections (Łukasik et al. 2013, Yadav et al. 2018, Xie et al. 2014). In some arthropods,

334 Spiroplasma species are pathogenic and cause gender-ratio distortions known as a

335 male-killing effect in Drosophila (Harumoto et al. 2014). However, a recent study

336 conducted on a nidicolous tick Ixodes arboricola did not find any association between

337 female-biased sex ratios and infections of six maternally inherited bacteria including

338 Spiroplasma (Van Oosten et al. 2018). Moreover, Spiroplasma mirum, an isolate

339 obtained from the rabbit tick Haemaphysalis leporispalustris in the USA (Tully et al.

340 1982), was shown to have potentially pathogenic properties; for example, S. mirum

341 was virulent for chick embryos and induced cataracts or lethal brain infections when

15

342 introduced intracerebrally into experimental animals such as suckling rats and rabbits

343 (Tully et al. 1977). Collectively, further biological characterisation of Spiroplasma

344 detected in the present study is necessary to understand their roles in ticks and potential

345 risks for human and animal health.

346 In the present study, a number of wells were contaminated with bacterial or

347 fungal infections (79 wells of ISE6 culture and 78 wells of C6/36 culture) (Table 3),

348 despite the fact that tick surface was washed with 70% ethanol and sterile PBS. This

349 result highlights the necessity of using additional chemicals to sterilize the tick surface,

350 especially those effective against fungal infections. Another possible option might be

351 to use only internal organs for bacterial isolation by dissecting ticks.

352

353 Conclusion

354 In conclusion, the present study employed two arthropod cell lines to isolate

355 pathogenic and symbiotic microorganisms from questing ticks collected in the field.

356 Although the technique needs to be improved to reduce contaminations by fungal

357 infections, the use of arthropod cell lines seems promising to expand our knowledge

358 on microorganisms in ticks. The isolates obtained in the present study are useful

359 materials to further analyze their pathogenic potential in vertebrate animals and their

360 roles as symbionts in ticks.

361

362 Acknowledgements

363 We would like to thank Dr. Ulrike Munderloh from the University of Minnesota and

364 Dr. Kentaro Yoshii from Hokkaido University for providing ISE6 cells and Dr. Yasuko

365 Orba from Hokkaido University for providing C6/36 cells during the experiments. This

366 work was financially supported by JSPS KAKENHI Grant-in-Aid for Young

16

367 Scientists (B) (25850195 and 16K19112) and (A) (15H05633) and for Scientific

368 Research on Innovative Areas (16H06429, 16K21723 and 16H06431).

369

370 Disclosure Statement

371 The authors declare no conflict of interest.

372

373 References

374 Ahantarig A, Trinachartvanit W, Baimai V, Grubhoffer L. Hard ticks and their

375 bacterial endosymbionts (or would be pathogens). Folia Microbiol 2013;58:419-

376 428.

377 Ando S, Kurosawa M, Sakata A, Fujita H, et al. Human Rickettsia heilongjiangensis

378 infection, Japan. Emerging Infect Dis 2010;16:1306-1308.

379 Andoh M, Ogasawara Y, Sakata A, Ito T, et al. Isolation of the rickettsial agent

380 genetically similar to Candidatus Rickettsia kotlanii, from Haemaphysalis

381 megaspinosa in Japan. Vector Borne Zoonotic Dis 2014;14:681-684.

382 Bell-Sakyi L, Kohl A, Bente DA, Fazakerley JK. Tick cell lines for study of Crimean-

383 Congo hemorrhagic fever virus and other arboviruses. Vector Borne Zoonotic Dis

384 2012;12:769-781.

385 Bell-Sakyi L, Palomar AM, Kazimirova M. Isolation and propagation of a

386 Spiroplasma sp. from Slovakian Ixodes ricinus ticks in Ixodes spp. cell lines. Ticks

387 Tick Borne Dis 2015;6: 601-606.

388 Bell-Sakyi L, Zweygarth E, Blouin EF, Gould EA, et al. Tick cell lines: tools for tick

389 and tick-borne disease research. Trends Parasitol 2007;23:450-457.

17

390 Duron O, Noël V, McCoy KD, Bonazzi M, et al. The recent evolution of a maternally-

391 inherited endosymbiont of ticks led to the emergence of the pathogen,

392 . PLoS Pathog 2015;11:e1004892.

393 Duron O, Cremaschi J, McCoy KD. 2016. The high diversity and global distribution

394 of the intracellular bacterium Rickettsiella in the polar seabird tick Ixodes uriae.

395 Microb Ecol 2016;71:761-770.

396 Fournier PE, Fujita H, Takada N, Raoult D. Genetic identification of rickettsiae

397 isolated from ticks in Japan. J Clin Microbiol 2002;40:2176-2181.

398 Fujita H, Fournier PE, Takada N, Saito T, et al. Rickettsia asiatica sp. nov., isolated in

399 Japan. Int J Syst Evol Microbiol 2006;56:2365-2368.

400 Fujita H. Cell culture system for isolation of disease agents: 15 years of experience in

401 Ohara Research Laboratory. Annu Rep Ohara Hosp. 2008;48:21-42.

402 Gaowa, Ohashi N, Aochi M, Wuritu D, et al. Rickettsiae in ticks, Japan, 2007–2011.

403 Emerg Infect Dis 2013;19:338-340.

404 Harumoto T, Anbutsu H, Fukatsu T. Male-killing Spiroplasma induces sex-specific

405 cell death via host apoptotic pathway. PLoS Pathog 2014;10:e1003956.

406 Henry JE, Streett DA, Oma EA, Goodwin RH. Ultrastructure of an isolate of

407 Rickettsiella from the African grasshopper Zonocerus variegatus. J Invertebr Pathol

408 1986;47:203-213.

409 Iasur-Kruh L, Weintraub PG, Mozes-Daube N, Robinson WE, et al. Novel

410 Rickettsiella bacterium in the leafhopper Orosius albicinctus (Hemiptera:

411 Cicadellidae). Appl Environ Microbiol 2013;79:4246-4252.

18

412 Imaoka K, Kaneko S, Tabara K, Kusatake K, et al. The first human case of Rickettsia

413 tamurae infection in Japan. Case Rep Dermatol 2011;3:68-73.

414 Jado I, Oteo JA, Aldámiz M, Gil H, et al. Rickettsia monacensis and human disease,

415 Spain. Emerging Infect Dis 2007;13:1405-1407.

416 Jongejan F, Uilenberg G. The global importance of ticks. Parasitology 2004;129:S3-

417 S14.

418 Khoo JJ, Chen F, Kho KL, Shanizza AIA, et al. Bacterial community in

419 Haemaphysalis ticks of domesticated animals from the Orang Asli communities in

420 Malaysia. Ticks Tick Borne Dis 2016;7:929-937.

421 Kim YS, Choi YJ, Lee KM, Ahn KJ, et al. First isolation of Rickettsia monacensis

422 from a patient in South Korea. Microbiol Immunol 2017;61:258-263.

423 Kumar S, Stecher G, Tamura K. MEGA7: Molecular evolutionary genetics analysis

424 version 7.0 for bigger datasets. Mol Biol Evol 2016;33:1870-1874.

425 Kurilshikov A, Livanova NN, Fomenko NV, Tupikin AE, et al. Comparative

426 metagenomic profiling of symbiotic bacterial communities associated with Ixodes

427 persulcatus, Ixodes pavlovskyi and Dermacentor reticulatus ticks. PLoS ONE

428 2015;10:e0131413.

429 Kurtti TJ, Munderloh UG, Andreadis TG, Magnarelli LA, et al. Tick cell culture

430 isolation of an intracellular prokaryote from the tick Ixodes scapularis. J Inv Path

431 1996;67:318-321.

432 Kurtti TJ, Palmer AT, Oliver JH. Rickettsiella-like bacteria in Ixodes woodi (Acari:

433 Ixodidae). J Med Entomol 2002;39:534-540.

19

434 Leclerque A, Kleespies RG, Ritter C, Schuster C, et al. Genetic and electron-

435 microscopic characterization of ‘Rickettsiella agriotidis’, a new Rickettsiella

436 pathotype associated with wireworm, Agriotes sp. (Coleoptera: Elateridae). Curr

437 Microbiol 2011;63:158-163.

438 Łukasik P, Asch MV, Guo H, Ferrari J. Unrelated facultative endosymbionts protect

439 aphids against a fungal pathogen. Ecol Lett 2013;16:214-218.

440 Madeddu G, Mancini F, Caddeo AC, Babudieri AS, et al. Rickettsia monacensis as

441 cause of Mediterranean spotted fever-like illness, Italy. Emerging Infect Dis

442 2012;18:702-704.

443 Mahara F. Rickettsioses in Japan and the Far East. Ann N Y Acad Sci 2006;1078:60-

444 73.

445 Milhano N, de Carvalho IL, Alves AS, Arroube S, et al. Coinfections of Rickettsia

446 slovaca and Rickettsia helvetica with Borrelia lusitaniae in ticks collected in a

447 Safari Park, Portugal. Ticks Tick Borne Dis 2010;1:172-177.

448 Munderloh UG, Kurtti TJ. Formulation of medium for tick cell culture. Exp Appl

449 Acarol 1989;7:219-229.

450 Munderloh UG, Tate CM, Lynch MJ, Howerth EW, et al. Isolation of an Anaplasma

451 sp. organism from white-tailed deer by tick cell culture. J Clin Microbiol

452 2003;41:4328-4335.

453 National Institute of Infectious Diseases. and Japanese spotted fever in

454 Japan 2007–2016. IASR (Infectious Agents Surveillance Report) 2017; 38:109-112.

455 [accessed 2018 June 4]. https://www.niid.go.jp/niid/ja/tsutsugamushi-

456 m/tsutsugamushi-iasrtpc/7324-448t.html (in Japanese).

20

457 Nakao M, Miyamoto K, Kitaoka S. A new record of Ixodes pavlovskgi Pomerantzev

458 from Hokkaido, Japan (Acari: Ixodidae). Eisei Dobutsu 1992;43:229-234.

459 Nakao R, Qiu Y, Igarashi M, Magona JW, et al. High prevalence of spotted fever group

460 rickettsiae in Amblyomma variegatum from Uganda and their identification using

461 sizes of intergenic spacers. Ticks Tick Borne Dis 2013;4:506-512.

462 Noji Y, Takada N, Ishiguro F, Fujino S, et al. The first reported case of spotted fever

463 in Fukui Prefecture, the Northern part of Central Japan. Jpn J Infect Dis

464 2005;58:112-114.

465 Paddock CD, Sumner JW, Comer JA, Zaki SR, et al. : a newly

466 recognized cause of spotted fever rickettsiosis in the United States. Clin Infect Dis.

467 2004;38:805-811.

468 Qiu Y, Nakao R, Ohnuma A, Kawamori F, et al. Microbial population analysis of the

469 salivary glands of ticks; A possible strategy for the surveillance of bacterial

470 pathogens. PLoS ONE 2014;9:e103961.

471 Regnery RL, Spruill CL, Plikaytis BD. Genotypic identification of rickettsiae and

472 estimation of intraspecies sequence divergence for portions of two rickettsial genes.

473 J Bacteriol 1991;173:1576-1589.

474 Roux V, Fournier PE, Raoult D. Differentation of spotted fever group rickettsiae by

475 sequencing analysis of restriction fragment length polymorphism of PCR-amplified

476 DNA of the gene encoding the protein rOmpA. J Clin Microbiology 1996;34:2058-

477 2065.

478 Roux V, Raoult D. Phylogenetic analysis of members of the genus Rickettsia using the

479 gene encoding the outer-membrane protein rOmpB (ompB). Int J Syst Evol

480 Microbiol 2000;50:1449-1455.

21

481 Simser JA, Palmer AT, Fingerle V, Wilske B, et al. Rickettsia monacensis sp. nov., a

482 spotted fever group Rickettsia, from ticks (Ixodes ricinus) collected in a European

483 City Park. Appl Environ Microbiol 2002;68:4559-4566.

484 Stenos J, Graves SR, Unsworth NB. A highly sensitive and specific real-time PCR

485 assay for the detection of spotted fever and typhus group rickettsiae. Am J Trop

486 Med Hyg 2005;73,1083-1085.

487 Takahashi T, Maeda K, Suzuki T, Ishido A, et al. The first identification and

488 retrospective study of severe fever with thrombocytopenia syndrome in Japan. J

489 Infect Dis 2014;209:816-827.

490 Tsuchida T, Koga R, Horikawa M, Tsunoda T, et al. Symbiotic bacterium modifies

491 aphid body color. Science 2010;330:1102-1104.

492 Tully JG, Whitcomb RF, Clark HF, Williamson DL. Pathogenic mycoplasmas:

493 cultivation and vetebrate pathogenicity of a new Spiroplasma. Science

494 1977;195:892-894.

495 Tully JG, Whitcomb RF, Rose DL, Bové JM. Spiroplasma mirum, a new species from

496 the rabbit tick (Haemaphysalis leporispalustris). Int J Syst Bacteriol 1982;32:92-

497 100.

498 Uchida T, Uchiyama T, Kumano K, Walker DH. Rickettsia japonica sp. nov., the

499 etiological agent of spotted fever group rickettsiosis in Japan. Int J Syst Bacteriol

500 1992;42:303-305.

501 Van Oosten RA, Duron O, Heylen DJA. Sex ratios of the tick Ixodes arboricola are

502 strongly female-biased, but there are no indications of sex-distorting bacteria. Ticks

503 Tick Borne Dis 2018;9:307-313.

22

504 Varela AS, Luttrell MP, Howerth EW, Moore VA, et al. First culture isolation of

505 Borrelia lonestari, putative agent of southern tick associatedd rash illness. J Clin

506 Microbiol 2004;42:1163-1169.

507 Vilcins IM, Old JM, Deane E. Molecular detection of Rickettsia, Coxiella and

508 Rickettsiella DNA in three native Australian tick species. Exp Appl Acarol

509 2009:49:229-242.

510 Weisburg WG, Barns SM, Pelletier DA, Lane DJ. 16S ribosomal DNA amplification

511 for phylogenetic study. J Bacteriol 1991;173:697-703.

512 Yamaguti N, Tipton VJ, Keegan HL, Toshioka S. Ticks of Japan, Korea and the

513 Ryushu islands. Brigham Young University Science Bulletin, Biological Series 15,

514 1971.

515 Yoshii K, Song JY, Park SB, Yang J, et al. Tick-borne encephalitis in Japan, Republic

516 of Korea and China. Emerg Microbes Infect 2017;6:e82.

517 Yadav S, Frazer J, Banga A, Pruitt K, et al. Endosymbiont-based immunity in

518 Drosophila melanogaster against parasitic nematode infection. PLoS One

519 2018;13;e0192183.

520 Xie J, Butler S, Sanchez G, Mateos M. Male killing Spiroplasma protects Drosophila

521 melanogaster against two parasitoid wasps. Heredity 2014;11:399-408.

522 Zweygarth E, Schol H, Lis K, Cabezas CA, et al. In vitro culture of a novel genotype

523 of Ehrlichia sp. from Brazil. Transbound Emerg Dis 2013;60:86-92.

524

525

526

23

527 Correspondence address.

528 Ryo NAKAO

529 Laboratory of Parasitology,

530 Graduate School of Veterinary Medicine,

531 Hokkaido University,

532 Sapporo 060-0818, Japan

533 Tel: +81-(0)11-706-5196

534 Fax: +81-(0)11-706-5196

535 E-mail address: [email protected]

24

TABLE 1. COLLECTION DETAILS OF TICKS USED FOR BACTERIAL ISOLATION

USING ARTHROPOD CELLS

Nymphal Prefecture Collected year Tick species Female Male Nymph poola

Hokkaido 2013 H. concinna - 3(0)b - -

2013 H. japonica 5 (0) 1 (1) - -

2013 & 2015 H. megaspinosa 3 (1) 10 (4) - 5 (5)

2013 I. ovatus 1(0) 5 (1) - -

2015 I. pavlovskyi - 2(0) - -

2013, 2014 & 2015 I. persulcatus 20 (18) 8 (5) - -

Fukushima 2014 D. taiwanensis - 1(0) - -

2013 H. flava - 3 (2) - 1 (1)

2014 H. japonica 1 (1) 1 (1) - 1 (1)

2014 H. kitaokai 2(0) 1(0) - -

2014 H. megaspinosa - - - 1 (1)

2014 I. monospinosus - 1 (1) - -

2014 I. nipponensis - 1 (1) - -

2014 I. persulcatus 1 (1) 1(0) - -

Yamagata 2014 H. flava 1 (1) - - 1 (1)

2013 & 2014 I. monospinosus 5 (5) 1 (1) - -

2013 I. nipponensis - 1 (1) - -

2014 I. ovatus 1 (1) 1 (1) - -

Tochigi 2014 H. flava - - - 1 (1)

Shizuoka 2013 H. longicornis 5 (5) - - -

Nara 2014 H. longicornis - - - 1 (1)

2014 H. megaspinosa - 1 (1) - 1 (1)

Wakayama 2015 A. testudinarium 1 (1) - - - 2015 D. taiwanensis 1(0) 1(0) - -

2015 H. formosensis 1(0) - - -

2013 H. hystricis 4 (3) - - -

2013 & 2015 H. longicornis 3 (2) 8 (8) 1 (1) -

2015 H. megaspinosa 1 (1) - - -

2015 I. ovatus 1(0) - - -

Kumamoto 2015 H. formosensis 4 (1) 3 (2) - -

2015 H. hystricis 1 (1) 2 (1) - -

Miyazaki 2013 A. testudinarium - - 6 (3) -

2013 H. flava 1 (1) - - -

2013 H. formosensis 1 (1) 2(0) - -

2013 H. megaspinosa 2 (2) 1 (1) - -

Kagoshima 2015 A. testudinarium - - 2 (1) -

2015 H. formosensis - 4 (1) - -

2015 H. hystricis 5 (4) 12 (11) - -

2013 & 2015 H. megaspinosa 1 (1) 1 (1) - -

Okinawa 2014 A. testudinarium - - 1 (1) -

Total 72 (51) 76 (45) 10 (6) 12 (12)

­, this tick species was not collected in the sample year. aNymphal pool samples were prepared from a pool of 5 to 24 nymphs. bThe number in parentheses indicates the number of samples positive for rickettsiae by gtlA real-time

PCR.

TABLE 2. OLIGONUCLEOTIDE PRIMERS AND PROBE USED IN REAL-TIME AND CONVENTIONAL POLYMERASE CHAIN

REACTIONS AND SEQUENCING

Primer Primer sequence (5'-3') Target gene Target organism(s) Annealing temperature (°C) Amplicon size (bp) Reference

Rickettsiae spotted fever CS-F TCGCAAATGTTCACGGTACTTT Citrate synthase gene (gltA) 60 74 Stenos et al. (2005) group and typhus group

CS-R TCGTGCATTTCTTTCCATTGTG

CS-P TGCAATAGCAAGAACCGTAGGCTGGATG

gltA_Fc CGAACTTACCGCTATTAGAATG Citrate synthase gene (gltA) Rickettsia spp. 55 580 Gaowa et al. (2013)

gltA_Rc CTTTAAGAGCGATAGCTTCAAG

Outer membrane A gene Rr.190.70p ATGGCGAATATTTCTCCAAAA Rickettsia spp. 55 632 Roux et al. (1996) (ompA)

Rr.190.701n GTTCCGTTAATGGCAGCATCT

Outer membrane B gene 120-2788 AAACAATAATCAAGGTACTGT Rickettsia spp. 48 816 Roux and Raoult (2000) (ompB)

120-3599 TACTTCCGGTTACAGCAAAGT

16S ribosomal RNA gene fD1 AGAGTTTGATCCTGGCTCAG Eubacteria 55 about 1500 Weisburg et al. (1991) (16S rRNA)

Rp2 ACGGCTACCTTGTTACGACTT

rrs_seq1 AGGCCTTCATCACTCACTCG 16S rRNA Rickettsia spp. This study

Rickettsia spp., Spiroplasma rrs_seq2 CTACACGCGTGCTACAATGG 16S rRNA This study spp. and Rickettsiella spp.

rrs_seq3 CGTGTCTCAGTCCCAATGTG 16S rRNA Spiroplasma spp. This study

TABLE 3. SUMMARY OF BACTERIAL ISOLATION FROM HOMOGENATES OF

TICKS COLLECTED IN JAPAN USING TICK (ISE6) AND MOSQUITO (C6/36)

CELL LINES

Cell line Isolation result ISE6 C6/36

Rickettsia and symbionts 14 4

Bacterial contamination 4 11

Fungal contamination 75 57

No isolate 77 98

Total 170 170

TABLE 4. DETAILS OF TICKS FROM WHICH BACTERIAL ISOLATES WERE OBTAINED AND THE RESULTS OF REAL-TIME

AND CONVENTIONAL PCRS AMPLIFYING BACTERIAL ISOLATES

Arthropod cell line Real-time PCR resulta PCR resultb Stage Tick ID Tick species Prefecture Rickettsial Rickettsial Rickettsial /Sex ISE6 C6/36 16S rDNA gltA ompA ompB

135 I. monospinosus M Yamagata Isolated (Spiroplasma) Isolated (Spiroplasma) + + NA NA NA

141 I. nipponensis M Yamagata Isolated (Rickettsia) No isolate + + + + +

147 I. persulcatus F Hokkaido Isolated (Spiroplasma) Contaminated (Mycobacterium) + + NA NA NA

202 I. persulcatus M Hokkaido Isolated (Rickettsia) No isolate + + + - +

309 I. persulcatus M Hokkaido Isolated (Rickettsia) No isolate + + + - +

318 I. persulcatus M Hokkaido Isolated (Rickettsia) No isolate + + + - +

412 H. concinna M Hokkaido Isolated (Rickettsiella) Isolated (Rickettsiella) - + NA NA NA

772 A. testudinarium N Miyazaki Isolated (Rickettsia) Contaminated (7 dpi) + + + + +

774 A. testudinarium N Miyazaki Isolated (Rickettsia) No isolate + + + + +

1033 H. kitaokai F Fukushima No isolate Isolated (Spiroplasma) - + NA NA NA

1187 I. nipponensis M Fukushima Isolated (Rickettsia) No isolate + + + + +

1284 I. ovatus F Yamagata Isolated (Rickettsia) Contaminated (Bacillus) + + + - +

1328 I. ovatus M Yamagata Contaminated (2 dpi) Isolated (Rickettsia) + + + - +

1994 A. testudinarium F Wakayama Isolated (Rickettsia) Contaminated (1 dpi) + + + + +

2014 H. longicornis M Wakayama Isolated (Rickettsia) No isolate + + + + +

2019 H. longicornis M Wakayama Isolated (Rickettsia) Contaminated (Williamsia) + + + + + a, Screened by gltA real-time PCR using DNA extracted from tick homogenates. +, positive; -, negative. b, PCR using DNA extracted from ISE6 and C6/36 cells.

NA, not applicable; dpi, day post inoculation. SUPPLEMENTARY TABLE S1. CHARACTERIZATION OF CLOSEST RICKETTSIA, RICKETTSIELLA AND SPIROPLASMA SPECIES WITH BLAST ANALYSIS

16S rRNA gltA ompA ompB Closest Rickettsia Closest Rickettsia Tick ID Tick species % Sequence % Sequence species (Accession species (Accession similarity similarity number) number) 99% R. monacensis 99% R. 100 % R. monacensis CN45kr R. monacensis 99% Ini-141I I. nipponensis (588/592) Crimea-3 (1417/1422) monacensis(LN794217) (537/537) (KC993860) (EU665232) (768/770) (KU961543) 99% 99% R. monacensis 99% R. 100 % Uncultured Rickettsia sp. Rickettsiasp. ZJ42/2007 (588/592) (768/770) IrR/Munich (1417/1422) monacensis(NR115686) (537/537) (LC060716) (EU258734) (KC137254) 99% R. monacensis 99% Rickettsia sp. IRS4 100 % R. monacensis R. monacensis MT34 99% (584/588) A3-264 (1416/1422) (AF141908) (537/537) (EU665235) (JX972178) (768/770) (EU330639 99% 99% Rickettsia sp. IRS3 100 % Rickettsia sp. POTiR5dt R. monacensisCHO11 99% R. monacensis D- (578/582) (1416/1423) (AF141907) (537/537) (EF501755) (KJ588273) (767/770) 2 (EU330640)

Rickettsia 98% R. monacecnsis 99% 100 % Rickettsia sp. IRS3 R. 99% endosymbiont of I. (585/598) MT34 (1414/1422) (537/537) (AF140706) monacensis(EU665233) (766/770) pacificus (KP276591) (JX625150) R.helvetica 100% 99% R. helvetica st. C9P9 100% Mu10/2166 Ipe-202I I. persulcatus R. helvetica (KY488349) NA (773/773) (1417/1421) (L36212) (537/537) (MG242313)

100% R. helvetica 98% 100% C. R. mendelii R. raoultii (KY474575) (773/773) KS14/0497 (1406/1421) (537/537) (KY678089) (MG242307) 100% R. helvetica 98% 100% C. R. mendelii R. raoultii (CP010969) (773/773) AS819 (1406/1421) (537/537) (KY678088) (MF163037) 100% R. helvetica 98% Uncultured Rickettsia 100% C. R. mendelii (773/773) Suedafrika 1544 (1406/1421) sp. (JX432017) (537/537) (KY678087) (KT835126) 100% 98% 100% C. R. mendelii R. helvetica R. raoultii (NR043755) (773/773) (1406/1421) (537/537) (KY678086) (KU310591)

100% R.helvetica 99% R. helvetica st. C9P9 100% Ipe-309I I. persulcatus R. helvetica (KY488349) NA (773/773) Mu10/2166 (1417/1421) (L36212) (537/537) (MG242313) 100% R. helvetica 98% 100% C. R. mendelii R. raoultii (KY474575) (773/773) KS14/0497 (1406/1421) (537/537) (KY678089) (MG242307) 100% R. helvetica 98% 100% C. R. mendelii R. raoultii (CP010969) (773/773) AS819 (1406/1421) (537/537) (KY678088) (MF163037) 100% R. helvetica 98% Uncultured Rickettsia 100% C. R. mendelii (773/773) Suedafrika 1544 (1406/1421) sp. (JX432017) (537/537) (KY678087) (KT835126) 100% 98% 100% C. R. mendelii R. helvetica R. raoultii (NR043755) (773/773) (1406/1421) (537/537) (KY678086) (KU310591)

R.helvetica 99% R. helvetica st. C9P9 100% 100% Ipe-318I I. persulcatus R. helvetica (KY488349) NA Mu10/2166 (1417/1421) (L36212) (537/537) (773/773) (MG242313) R. helvetica 98% 100% C. R. mendelii 100% R. raoultii (KY474575) KS14/0497 (1406/1421) (537/537) (KY678089) (773/773) (MG242307) R. helvetica 98% 100% C. R. mendelii 100% R. raoultii (CP010969) AS819 (1406/1421) (537/537) (KY678088) (773/773) (MF163037) R. helvetica 98% Uncultured Rickettsia 100% C. R. mendelii 100% Suedafrika 1544 (1406/1421) sp. (JX432017) (537/537) (KY678087) (773/773) (KT835126) 98% 100% C. R. mendelii 100% R. helvetica R. raoultii (NR043755) (1406/1421) (537/537) (KY678086) (773/773) (KU310591) 99% Uncultured Rickettsia 100% 99% R. tamurae AT-1 98% R. tamurae AT-1 Ate-772I A. testudinarium R. tamurae (AB812551) (1415/1422) sp. (KF981786) (537/537) (573/576) (DQ103259) (755/771) (DQ113910) R. monacensis 99% R. tamurae AT-1 100% 99% Rickettsia sp. Ae-8 98% R. tamurae (AF394896) Crimea-3 (1415/1422) (NR042727) (537/537) (568/576) (DQ365985) (752/770) (KU961543) Rickettsia sp. R. monacensis 99% Uncultured Rickettsia 99% 96% 98% R. tamurae (KT753273) ARAGAOI IrR/Munich (1414/1422) sp. (KF981787) (536/537) (554/576) (752/770) (KX077194) (KC137254) Rickettsia R. monacensis 99% 99% 96% Uncultured Rickettsia 98% endosymbiont of I. R. tamurae (KT753265) A3-264 (1409/1422) (536/537) (554/576) sp. (KU001175) (752/770) pacificus (KP276591) (EU330639) Rickettsia Rickettsia Rickettsia endosymbiont 99% 99% 96% endosymbiont of I. 98% R. monacensis D- endosymbiont of I. of A. dubitatum (1409/1422) (534/537) (553/576) pararicinus (751/770) 2 (EU330640) pacificus (KP276590) (JN676158) (KU744414) 98% R. tamurae AT-1 99% Uncultured Rickettsia 100% 99% R. tamurae AT-1 Ate-774I A. testudinarium R. tamurae (AB812551) (755/771) (DQ113910) (1415/1422) sp. (KF981786) (537/537) (573/576) (DQ103259)

R. monacensis 98% 99% R. tamurae AT-1 100% 99% Rickettsia sp. Ae-8 Crimea-3 R. tamurae (AF394896) (752/770) (1415/1422) (NR042727) (537/537) (568/576) (DQ365985) (KU961543)

Rickettsia sp. 98% R. monacensis 99% Uncultured Rickettsia 99% 96% R. tamurae (KT753273) ARAGAOI (752/770) IrR/Munich (1414/1422) sp. (KF981787) (536/537) (554/576) (KX077194) (KC137254)

R. monacensis Rickettsia 98% 99% 99% 96% Uncultured Rickettsia A3-264 endosymbiont of I. R. tamurae (KT753265) (752/770) (1409/1422) (536/537) (554/576) sp. (KU001175) (EU330639) pacificus (KP276591)

Rickettsia Rickettsia Rickettsia endosymbiont 98% R. monacensis D- 99% 99% 96% endosymbiont of I. endosymbiont of I. of A. dubitatum (751/770) 2 (EU330640) (1409/1422) (534/537) (553/576) pararicinus pacificus (KP276590) (JN676158) (KU744414) R. monacensis 99% 99% R. 100 % R. monacensis 99% R. monacensisCHO11 Crimea-3 Ini-1187I I. nipponensis (768/770) (1417/1422) monacensis(LN794217) (537/537) (KC993860) (578/582) (KJ588273) (KU961543)

R. monacensis 99% 99% R. 100 % Uncultured Rickettsia sp. 99% R. monacensisMT34 IrR/Munich (768/770) (1417/1422) monacensis(NR115686) (537/537) (LC060716) (578/582) (JX972178) (KC137254)

R. monacensis 99% 99% Rickettsia sp. IRS4 100 % R. monacensis 99% R. monacensis A3-264 (768/770) (1416/1422) (AF141908) (537/537) (EU665235) (578/582) (EU665232) (EU330639)

99% R. monacensis D- 99% Rickettsia sp. IRS3 100 % Rickettsia sp POTiR5dt 99% Rickettsiasp. ZJ42/2007 (767/770) 2 (EU330640) (1416/1423) (AF141907) (537/537) (EF501755) (578/582) (EU258734)

R. monacecnsis Rickettsia 99% 99% 100 % Rickettsia sp. IRS3 98% R. MT34 endosymbiont of I. (766/770) (1414/1422) (537/537) (AF140706) (575/588) monacensis(EU665233) (JX625150) pacificus (KP276591)

R.helvetica 99% 99% R. asiatica IO-1 100 % Mu10/2166 Iov-1284I I. ovatus R. asistica (AF394901) NA (767/773) (1403/1423) (NR041840) (537/537) (MG242313)

R. helvetica 99% 98% R. helvetica st. C9P9 99% KS14/0497 R. asistica (AB297808) (767/773) (1401/1423) (L36212) (535/537) (MG242307)

R. helvetica 98% 99% 99% Rickettsia sp. (L36102) R. asistica (AB297810) AS819 (1400/1423) (533/538) (767/773) (MF163037) 99% R. helvetica 98% R. massiliae st. AZT80 99% R. helvetica (KY488349) (767/773) Suedafrika 1544 (1399/1423) (CP003319) (532/539) (KT835126) 98% R. massiliae MTU5 99% C. R. mendelii 99% R. helvetica

(1399/1423) (CP000683) (532/540) (KY678089) (767/773) (KU310591) 99% R.helvetica 99% R. asiatica IO-1 100 % Iov-1328C I. ovatus R. asistica (AF394901) NA (767/773) Mu10/2166 (1403/1423) (NR041840) (537/537) (MG242313) 99% R. helvetica 98% R. helvetica st. C9P9 99% R. asistica (AB297808) (767/773) KS14/0497 (1401/1423) (L36212) (535/537) (MG242307) 99% R. helvetica 98% 99% Rickettsia sp. (L36102) R. asistica (AB297810) (767/773) AS819 (1400/1423) (533/538) (MF163037) 99% R. helvetica 98% R. massiliae st. AZT80 99% R. helvetica (KY488349) (767/773) Suedafrika 1544 (1399/1423) (CP003319) (532/539) (KT835126) 98% R. massiliae MTU5 99% C. R. mendelii 99% R. helvetica

(1399/1423) (CP000683) (532/540) (KY678089) (767/773) (KU310591) 99% Uncultured Rickettsia 100% 99% R. tamurae AT-1 98% R. tamurae AT-1 Ate-1994I A. testudinarium R. tamurae (AB812551) (1415/1422) sp. (KF981786) (537/537) (575/578) (DQ103259) (755/771) (DQ113910) R. monacensis 99% R. tamurae AT-1 100% 99% Rickettsia sp. Ae-8 98% R. tamurae (AF394896) Crimea-3 (1415/1422) (NR042727) (537/537) (570/578) (DQ365985) (752/770) (KU961543) Rickettsia sp. R. monacensis 99% Uncultured Rickettsia 99% 96% 98% R. tamurae (KT753273) ARAGAOI IrR/Munich (1414/1422) sp. (KF981787) (536/537) (556/578) (752/770) (KX077194) (KC137254) Rickettsia R. monacensis 99% 99% 96% Uncultured Rickettsia 98% endosymbiont of I. R. tamurae (KT753265) A3-264 (1409/1422) (536/537) (556/578) sp. (KU001175) (752/770) pacificus (KP276591) (EU330639) Rickettsia Rickettsia Rickettsia endosymbiont 99% 99% 96% endosymbiont of I. 98% R. monacensis D- endosymbiont of I. of A. dubitatum (1409/1422) (534/537) (555/578) pararicinus (751/770) 2 (EU330640) pacificus (KP276590) (JN676158) (KU744414) Rickettsia sp. 99% 99% 99% Uncultured Rickettsia 100% Rickettsia sp. LON-13 Rickettsia sp. HIR/D91 AUS118 Hlo-2014I H. longicornis (586/587) (766/770) (1419/1421) sp. HtM69 (KU758904) (537/537) (AB516964) (KC888951) (KF666469)

99% 99% Rickettsia sp. 99% Uncultured Rickettsia 100% C. R. jingxinensis Rickettsia sp. FYJ98 (585/587) (750/752) A598 (KJ619632) (1419/1421) sp. HtFM4 (KU758903) (537/537) (KT899089) (AF169629)

99% 99% R. japonica HH- 99% Rickettsia YN03 100% C. R. jingxinensis Uncultured Rickettsia (577/587) (762/770) 18 (AP017588) (1417/1421) (KY433580) (537/537) (KT899088) sp. (MG228270)

Rickettsia sp. st 99% 99% R. japonica HH- 99% R. japonica st. YH 100% Uncultured Rickettsia WHBMXZ-80 (576/587) (762/770) 17 (AP017587) (1416/1421) (NR074459) (537/537) sp. (JN943296) (KX987339) Rickettsia 99% R. japonica HH- 99% R. japonica 100% Uncultured Rickettsia sp. 99% endosymbiont of H. (762/770) 16 (AP017586) (1416/1421) (AP017602) (537/537) (KF728367) (555/556) longicornis

(MF590726) Rickettsia sp. 99% 99% Uncultured Rickettsia 100% Rickettsia sp. LON-13 99% Rickettsia sp. HIR/D91 AUS118 Hlo-2019I H. longicornis (766/770) (1419/1421) sp. HtM69 (KU758904) (537/537) (AB516964) (586/587) (KC888951) (KF666469)

99% 99% Uncultured Rickettsia 100% C. R. jingxinensis 99% Rickettsia sp. FYJ98 Rickettsia sp. (750/752) (1419/1421) sp. HtFM4 (KU758903) (537/537) (KT899089) (585/587) (AF169629) A598 (KJ619632)

99% R. japonica HH- 99% Rickettsia YN03 100% C. R. jingxinensis 99% Uncultured Rickettsia (762/770) 18 (AP017588) (1417/1421) (KY433580) (537/537) (KT899088) (577/587) sp. (MG228270)

Rickettsia sp. st 99% R. japonica HH- 99% R. japonica st. YH 100% 99% Uncultured Rickettsia WHBMXZ-80 (762/770) 17 (AP017587) (1416/1421) (NR074459) (537/537) (576/587) sp. (JN943296) (KX987339) Rickettsia 99% R. japonica HH- 99% R. japonica 100% Uncultured Rickettsia sp. 99% endosymbiont of H. (762/770) 16 (AP017586) (1416/1421) (AP017602) (537/537) (KF728367) (555/556) longicornis

(MF590726) 99% Spiroplasma sp. 'Gent' Imo-135I I. monospinosus (1443/1444) (AY569829) 99% Spiroplasma-symbiont of Antonina (1441/1444) crawii (AB030022) Sprioplasma sp. 99% Anisosticta MK (1439/1444) (AM087471) Uncultured bacterium 99% isolate RFLP (1440/1444) (EF121346) Spiroplasma symbiont 99% of Laodelphax (1438/1444) striatellus (AB553862) Imo- 99% Spiroplasma sp. 'Gent' 135C I. monospinosus (1442/1444) (AY569829) 99% Spiroplasma-symbiont of Antonina (1440/1444) crawii (AB030022) Sprioplasma sp. 99% Anisosticta MK (1438/1444) (AM087471) Uncultured bacterium 99% isolate RFLP (1439/1444) (EF121346) Spiroplasma symbiont 99% of Laodelphax (1436/1444) striatellus (AB553862) 99% Spiroplasma sp. 'Gent' Ipe-147I I. persulcatus (1441/1444) (AY569829) 99% Spiroplasma-symbiont of Antonina (1439/1444) crawii (AB030022) Sprioplasma sp. 99% Anisosticta MK (1437/1444) (AM087471) Uncultured bacterium 99% isolate RFLP (1438/1444) (EF121346) Spiroplasma symbiont 99% of Laodelphax (1435/1444) striatellus (AB553862) 99% Spiroplasma sp. 'Gent' Hki-1033C H. kitaokai (1442/1444) (AY569829) 99% Spiroplasma-symbiont of Antonina (1440/1444) crawii (AB030022) Sprioplasma sp. 99% Anisosticta MK (1438/1444) (AM087471) Uncultured bacterium 99% isolate RFLP (1439/1444) (EF121346) Spiroplasma symbiont 99% of Laodelphax (1436/1444) striatellus (AB553862) 99% Uncultured bacterium Hcn-412I H. concinna (1470/1480) clone (MF086655) 99% Rickettsiella endosymbiont of (1388/1408) Acyrthosiphon pisum (AB522697) Candidatus 98% Rickettsiella viridis (1387/1408) (AB780468) 98% Rickettsiella endosymbiont of (1387/1408) Acyrthosiphon pisum (AB522705) Rickettsiella 98% endosymbiont of

(1352/1372) Acyrthosiphon pisum (JX943560) 99% Uncultured bacterium Hcn-412C H. concinna (1470/1480) clone (MF086655) 99% Rickettsiella endosymbiont of (1388/1408) Acyrthosiphon pisum (AB522697) Candidatus 98% Rickettsiella viridis (1387/1408) (AB780468) 98% Rickettsiella endosymbiont of (1387/1408) Acyrthosiphon pisum (AB522705) Rickettsiella 98% endosymbiont of

(1352/1372) Acyrthosiphon pisum (JX943560)

NA, Not amplified

1 Figure Legends

2 FIG. 1. The time of onset of cytopathic effect observed in each bacterial isolate in ISE6 and

3 C6/36 cells.

4 FIG. 2. Phylogenetic tree of (A) 16S rDNA, (B) gltA, (C) ompA and (D) ompB sequences of

5 Rickettsia species isolated from ticks in Japan and representative rickettsiae using maximum

6 likelihood method. The sequences obtained in this study are shown in bold. GenBank

7 accession numbers are given after species name.

8 FIG. 3. Phylogenetic tree of 16S rDNA of Rickettsiella endosymbionts isolated from ticks in

9 Japan using maximum likelihood method. The sequences obtained in this study are shown in

10 bold. GenBank accession numbers are given after species name.

11 FIG. 4. Phylogenetic tree of 16S rDNA of Spiroplasma endosymbionts isolated from ticks in

12 Japan using maximum likelihood method. The sequences obtained in this study are shown in

13 bold. GenBank accession numbers are given after species name.

1

FIG. 1

R. asiatica lov-12841�------·9 -9 ➔ ------R. asiatica lov-1328C - R. helvetica lpe-2021 -t� ―------—●------·

R. helvetica lpe-3091 i------●------—ー 1 R. helvetica lpe-3181 i·------—● ______)

--――: ------—● ------R. monacensis lni-1411 +------;

Sのie1os1 ―ー1------R. m onacens1s lni-11871�------�

R. tamurae Ate-7721 +------―--: ------●------: ------

R. tamurae Ate-7741�------: -● ------

R. tamurae Ate-19941�------: ● ------―ー 1一 ―------t------―: ------�------―------: - 9 Rickettsi a sp. H I o-2 0 141 I コ―------1------Rickettsia sp. Hlo-20191 i : , I Q Spiroplasma sp. lmo-1351 i------: : -—ー1 ー ―------·O Spiroplasma sp. lpe-1471 1------:------� ―------―------—: ●------­ ------―:―------」------— ―------¢ Spiroplasma sp. lmo-135Ci- : ------r i � -6 Spiroplasma sp. Hki-1033C +------―:------�------� ― ー―------Ricketts i eI I a s p. H c n-4 121 i·------―------: ------● --: —------ート

Rickettsiella sp. Hcn-412C i------● ------.J ------,―------'------

゜ 2 4 6 8 10 12 14 16 18 20 22 24 26 28

Detected by PCR with CPE 0 Detected by PCR without showing CPE FIG. 2

(A) R (L36217) (B) Seven (U59730) 73 I 74 lRickettsia s/ovaca 13-B (L36224) Rickettsia slovaca N .A. 13-B (U59725) Rickettsia parkeri Maculatum20 (U59732) Rickettsia parkeri (L36673) 9 2179Rickettsia1 japonica YM (U59724) Rickettsia conorii Malish7 (AF541999) Rickettsia heilongjiangensis Sendai16 (AB473992) Rickettsia Japonica YM (L36213) Candidatus Rickettsia jingxinensis (KT899089) Rickettsia heilongjiangensis HLJ-054 (AF178037) Rickettsia sp. LON-13 (AB516964) ● Rickettsia sp. Hlo-20141 (LC388775) Rickettsia sp. Mie180 (JQ697958) s6 I 91 I 96 I● Rickettsiasp. Hlo-20191 (LC388776) ● Rickettsiasp. Hlo-20141 (LC388787) ● Rickettsia sp. Hlo-20191 (LC388788) 1 (L36101) � Candidatus Rickettsiaprincipis (AY578115) Candida/us Rickettsia tarasevichiae (AF503168) ---i_98 Rickettsia sp. Mie201 (JQ697957) Rickettsia monacensis lrR/Munich (NR115686) 98 I ● Rickettsia monacensis lni-1411 (LC388761) 84 Rickettsia sp. Mie334 (JQ697955) 75� ● Rickettsia monacensis lni-11871 (LC388771) wril-Rickettsia sp. Goto13 (JQ697954) Rickettsia monacensis (EU665235) 97 I ● Rickettsia tamurae Ate-7721 (LC388768) ● Rickettsia monacensis lni-1411 (LC388777) 21● Rickettsia tamurae Ate-7741 (LC388769) ● Rickettsia monacensis lni-11871 (LC388783) ● Rickettsia tamurae Ate-19941 (LC388774) 82 Rickettsia tamurae AT-1 (AF394896) ● Rickettsia tamurae Ate-7721 (LC388781) 95 I● Rickettsia tamurae Ate-7741 (LC388782) ● Rickettsia asiatica lov-12841 (LC388772) ● Rickettsia tamurae Ate-19941 (LC388786) 勾● Rickettsia asiatica lov-1328C (LC388773) Rickettsia asiatica 10-1 (AF394901) 98 I ● Rickettsia asiatica lov-12841 (LC388784) ● Rickettsia helvetica lpe-2021 (LC388763) ● Rickettsia asiatica lov-1328C (LC388785) ● Rickettsia helvetica lpe-3091 (LC388764) Rickettsia helvetica C9P9 (U59723) ● Rickettsia helvetica lpe-2021 (LC388778) ● Rickettsia helvetica lpe-3181 (LC388765) 99 I● Rickettsia helvetica lpe-3091 (LC388779) Wilmington (L36331) ● Rickettsia helvetica lpe-3181 (LC388780) Rickettsia massiliaeMtu1 (L36214) Candidatus Rickettsia tarasevichiae lp1010 (KT899085) Cand1datus Wolbachia inokumae (DQ402518) Rickettsia be/Iii (A Y362703)

I I I I 0.02 0.02

(C) Rickettsia rickettsii (U43804) (D) Rickettsia rickettsii (X16353) Rickettsia parkeri (AF123717) Rickettsia conorii Seven (AF123721) Rickettsia s/ovaca 13-B (AF123723) Rickettsia peacockii Skalkaho (AH013412) 98 Rickettsia japonica (AF123713) Rickettsia japonica (U43795) 94 I 93 Rickettsia heilongjiangensis (AY260451) 閂 Rickettsia heilongjiangii (AF179362) 占● Ricketts/asp. Hlo-20141 (LC388806) 66 100● Rickettsiasp. Hlo-20191 (LC388807) Candidatus Rickettsia jingxinensis H16 (KT899081) 99 67 Rickettsia massi/iae (AF123714) Rickettsia sp. LON-13 (AB516963) Rickettsia australis Phillips (AF123709) 99 I ● Rickettsia sp. Hlo-20141 (LC388794) Rickettsia tamurae AT-1 (DQ113910) ● Rickettsia sp. Hlo-20191 (LC388795) ● Rickettsia tamurae Ate-7721 (LC388800) Rickettsia massiliae Mtu1 (U43799) ● Rickettsia tamurae Ate-77 41 (LC388801) Rickettsia monacensis (EU665232) ● Rickettsia tamurae Ate-19941 (LC388805) 39 ● Rickettsia monacensis lni-1411 (LC388789) Rickettsia monacensis lrR/Munich (EF380356) 11● Rickettsia monacensis lni-1411 (LC388796) ● Rickettsia monacensis lni-11871 (LC388792) 99 89l● Rickettsia monacensis lni-11871 (LC388802) 85 Rickettsia asiatica 10-1 (DO 110870) Rickettsia tamurae AT-1 (D0103259) ● Rickettsia asiatica lov-12841 (LC388803) 叫 ● Rickettsia tamurae Ate-7721 (LC388790) ● Rickettsia asiatica lov-1328C (LC388804) 72 , Rickettsia tamurae Ate-7741 (LC388791) Rickettsia helvetica C9P9 (AF123725) I ・ 100 II ● Rickettsia tamurae Ate-19941 (LC388793) ● Rickettsia he/vetica lpe-2021 (LC388797) 951● Rickettsia helvetica lpe-3091 (LC388798) Candidatus Rickettsia tarasevichiae IP621 (KP982901) ● Rickettsia he/vetica lpe-3181 (LC388799) Rickettsia australis PHS (AF149108) Rickettsia be/Iii (A Y970508) (L01461)

0.1 I I 0.1 FIG. 3

77 I Rickettsiellaarmadillidi Av (AM490937) (pill woodlouse) 6壬 Rickettsiella armadillidiHb (AM490938) (woodlouse) 99 I I Rickettsiellaarmadillidi Pm (AM490939) (fast woodlouse) 2 3 Candidatus Rickettsiella isopodorum JKI-D244/2012 (JX406180) (common woodlouse) 41 Rickettsiellasp. RKTSLLA-T3262 (KT697685) (/. uriae tick) Rickettsiellasp. clone? (AY447040) (waterlouse)

Ia7 Rickettsiellasp. PC08106 (JN983648) (amphipod) 10 ー 戸

98 r- Rickettsiellasp. CAA428 (HF912421) (/. kingi tick) ....Rickettsiella sp. CAA109 (HF912420) (/. sculptus tick)

85 Rickettsiellagrylli (U97547) (field crickets) 16 Rickettsiellasp. GSU (AF383621) (/. woodi tick) 77 Rickettsiellasp. lxotasmani 1 (KP994858) (/. tasani tick)

9 I Rickettsiellasp. RKTSLLA-T 4067 (KT697671) (/. uriaetick) 3 l ― Rickettsiellasp. (AF327558) (springtail) ..... ·Rickettsiella pyronotaecf2-8 (HM017957) (Manuka beetle) 85 1 33 Rickettsiellatipulae T184-7 (EU190598) (tube worm) � s1 rRickettsiella sp. RKTSLLA-T3222 (KT697678) (/. uriaetick) 千Rickettsiella agriotidis JKI-E1959/09D (HQ640943) (beetle) 59 49 I Rickettsiella melolonthaeBBA 1806/LAM6-D/2004 (EF408231) (cockchafer) --- Rickettsiellasp. lxoricinus1 (KP994857) (/. ricinus tick) 25 .___Rickettsiella sp. RKTSLLA-T3095 (KT697683) (/. uriae tick) Rickettsiellasp. (KC764412) (leafhopper) Rickettsiellasp. Orib-g06 (GU906700) () l ― 40 1 Rickettsiellasp. (AF286124) Uumping plant louse) 竺1 Rickettsiellasp. cloneJ240 (JX943560) (pea aphid) Candidatus Rickettsiella viridis (AB522697) (pea aphid)

97 1 1 Rickettsiellasp. RKTSLLA-T1699 (KT697673) (/. uriae tick) • Rickettsiella sp. Hcn-4121 (LC388766) 99 ● Rickettsiella sp. Hcn-412C (LC388767) Coxiellaburnetii (M21291) ． ． 0.020 FIG. 4 Spiroplasma sp. (MK AM087471) (ladybird beetle) Spiroplasma ixodetis Y32(N R104852) (/. pacificus tick) Spiroplasma sp. (AB553862) (plant hopper) Spiroplasma sp. (AB030022) (mealybug) Spiroplasma sp. SM (AB048263) (pea louse) 901 Spiroplasma sp. (AJ132412) (Japanese ladybird) Spiroplasma sp. Bratislava 1(KP967685) (/. ricinus tick) ● Spiroplasma sp. Hki-1033C (LC388770) ● Spiroplasma sp. lmo-135C (LC388760) 7911 ● Spiroplasma sp. lmo-1351 (LC388759) _,''● Spiroplasma sp. lpe-1471 (LC388762) 1 o"'I 11 Spiroplasma sp. (AJ245996) (butterfly) Spiroplasma sp. 10-1 (DQ059993) (/. ovatus tick) 52 Spiroplasma sp. (AJ006775) (ladybird) Spiroplasma syrphidicola EA-1 (AY189309)(shrimp) Spiroplasma chrysopicola DF-1(AY189127) (shrimp) 9986」 Spiroplasma penaei(AY771927) (shr imp) 19 Spiroplasma poulsonii DW-1(M24483) (fruit fly) aol1 Spiroplasma melliferum BC-3(AY325304) (shrimp) L 81 Spirop/asma citriR8A2HP (X63781) (leafhopper) Spiroplasma lampyridicola PUP-1 (AY189134)(beetle) 51 14 Spiroplasma leptinotarsae LD-1B(AY189305)(shrimp) 国Spiroplasma gladiatorisTG-1 (M24475) (horsefly) Spiroplasma clarkia CN-5(M244 74) (beetle) 5「 Spiroplasma mirum SMCA(M24662) (H. leporispalustristick) Spiroplasma velocicrescens MQ-4 (AY189311) (wasp) 41 ← Spiroplasma helicoidesTABS-2 (AY189132)(horsefly) Spiroplasma taiwanense CT-1 (M24476)(mosquito) 竺Spiroplasma apis(M23937) (honeybee) 301 Spiroplasma montanense HYOS-1 (AY189307)(horsefly) Spiroplasma litorale TN-1(AY189306) (horsefly) 2J Spiroplasma corruscae EC-1(AY189128) (firefly) 32 IL__ ; Spiroplasma turonicum Tab-4c(AY189310) (wasp) 311 r Spiroplasma alleghenense PLHS-1(AY189125) (scorpion fly) 磁 Spiroplasma sabaudienseAr-1343 (AY189308)(mosquito) Spiroplasma culicicola AES-1(AY189129) (mosquito)

57u Spiroplasma monobiae MQ-1(M24481) (wasp) 2au Spiroplasma diminutum CUAS-1(AY189130) (mosquito) Spiroplasma diabroticae DU-1(M24482) (beetle) Coxiella burnetii(M21291)

0.05