DOCSLIB.ORG

Ultraconserved Elements in the Human Genome

Total Page：16

File Type：pdf, Size：1020Kb

Download full-text PDF Read full-text
Ultraconserved Elements in the Human Genome R EPORTS 16. L. Shen, K. L. Rock, Proc. Natl. Acad. Sci. U.S.A. 101, J. Immunol. 171, 5668 (2003). Supporting Online Material 3035 (2004). 22. N. P. Restifo et al., J. Immunol. 154, 4414 (1995). www.sciencemag.org/cgi/content/full/304/5675/1318/ 17. S. P. Schoenberger et al., J. Immunol. 161, 3808 (1998). 23. We thank B. Buschling, D. Tokarchick, and A. Schell DC1 18. M. L. Albert, B. Sauter, N. Bhardwaj, Nature 392,86 for technical assistance. We are grateful to M. Epler Materials and Methods b (1998). and S. Tevethia for their generous gift of D - Figs. S1 and S2 19. M. Bellone et al., J. Immunol. 159, 5391 (1997). NP366-374 tetramers. This work was supported in part References and Notes 20. J. W. Yewdell, C. C. Norbury, J. R. Bennink, Adv. by a Wellcome Prize Traveling Fellowship and U.S. Immunol. 73, 1 (1999). Public Health Service grants, and NIH grant AI- 21. A. Serna, M. C. Ramirez, A. Soukhanova, L. J. Sigal, 056094-01 to C.C.N. 3 February 2004; accepted 14 April 2004 with the dog genome, which was estimated Ultraconserved Elements in the using reads from the National Center for Biotechnology Information (NCBI) trace ar- Human Genome chive (477/481 ϭ 99.2% of the elements aligning at an average of 99.2% identi- Gill Bejerano,1* Michael Pheasant,3 Igor Makunin,3 ty).Thus, it appears that nearly all of these Stuart Stephen,3 W. James Kent,1 John S. Mattick,3 ultraconserved elements may have been un- David Haussler2* der extreme negative selection in many spe- cies for more than 300 million years, and There are 481 segments longer than 200 base pairs (bp) that are absolutely some of them for at least 400 million years. conserved (100% identity with no insertions or deletions) between orthologous As expected, the ultraconserved elements regions of the human, rat, and mouse genomes.Nearly all of these segments exhibit almost no natural variation in the are also conserved in the chicken and dog genomes, with an average of 95 and human population. Only 6 out of 106,767 99% identity, respectively.Many are also significantly conserved in fish.These bases examined in the ultraconserved ele- ultraconserved elements of the human genome are most often located either ments (excluding the first and last 20 bases in overlapping exons in genes involved in RNA processing or in introns or nearby each element) are at validated single- genes involved in the regulation of transcription and development.Along with nucleotide polymorphisms (SNPs) in NCBI’s more than 5000 sequences of over 100 bp that are absolutely conserved among SNP database (dbSNP) (table S2a). For this the three sequenced mammals, these represent a class of genetic elements much DNA, we would have expected 119 whose functions and evolutionary origins are yet to be determined, but which validated sites, so validated SNPs are under- Ϫ42 are more highly conserved between these species than are proteins and appear represented by 20-fold (P Ͻ 10 ). The 48 to be essential for the ontogeny of mammals and other vertebrates. unvalidated SNPs we found revealed many likely errors in the unvalidated portion of Although only about 1.2% of the human served with orthologous segments in rodents: dbSNP (table S2b). These same 106,767 genome appears to code for proteins (1–3), those showing 100% identity and with no bases exhibit very few differences with the it has been estimated that as much as 5% is insertions or deletions in their alignment with chimp genome as well, showing only 38 more conserved than would be expected the mouse and rat. Exclusive of ribosomal single base changes where the chimp base has from neutral evolution since the split with RNA (rRNA) regions, there are 481 such a Phred quality score at least 45, whereas the rodents, and hence may be under negative segments longer than 200 bp that we call expected number would be 716 (roughly a or “purifying” selection (4–6). Several ultraconserved elements (table S1). They are 19-fold reduction, P Ͻ 10Ϫ200; supporting studies have found specific noncoding seg- widely distributed in the genome (on all chro- text, section S2). This low level of variation ments in the human genome that appear to mosomes except chromosomes 21 and Y) and within the human population and in comparison be under selection, using a threshold for are often found in clusters (Fig. 1). The prob- with the chimp suggests that these elements are conservation of 70 or 80% identity with the ability is less than 10Ϫ22 of finding even one currently changing at a rate that is roughly 20 mouse over more than 100 base pairs (bp) such element in 2.9 billion bases under a times slower than the average for the genome. (7–13). A study of these elements on hu- simple model of neutral evolution with inde- Only 4.3% of the bases are different in the man chromosome 21 found that those that pendent substitutions at each site, using the chicken, which is also consistent with a roughly were very highly conserved in multiple spe- slowest neutral substitution rate that is ob- 20-fold reduction from neutral substitution rates cies contained significant numbers of non- served for any 1-Mb region of the genome (supporting text, section S2). coding elements (13). Similar results were (supporting text, section S1). Nearly all of Of the 481 ultraconserved elements, 111 found when comparing the human, mouse, these elements also exhibit extremely high overlap the mRNA of a known human and rat genomes (14, 15) in a study of the levels of conservation with orthologous re- protein-coding gene [including the untrans- 1.8–megabase (Mb) CFTR region (16, 17) gions in the chicken genome [467 out of 481 lated regions (UTRs)], 256 show no evidence and in a functional study of the SIM2 locus (467/481) ϭ 97% of the elements aligning at of transcription from any matching expressed in a number of mammalian species (18). an average of 95.7% identity, 29 at 100% sequence tag (EST) or mRNA from any spe- We determined the longest segments of identity] and about two-thirds of them with cies, and for the remaining 114 the evidence the human genome that are maximally con- the fugu genome as well (324/481 ϭ 67.3% for transcription is inconclusive. We call of the elements aligning at an average of these partly exonic (or exonic for short), non- 1Department of Biomolecular Engineering, 2Howard 76.8% identity), despite the fact that only exonic, and possibly exonic ultraconserved Hughes Medical Institute, University of California about 4% of the human genome can be reli- elements, respectively. A hundred non- Santa Cruz, Santa Cruz, CA 95064, USA. 3ARC Special ably aligned to the chicken genome (at an exonic elements are located in introns of Research Centre for Functional and Applied Genom- average of 62.9% identity where an align- known genes and the rest are intergenic. ics, Institute for Molecular Bioscience, University of Queensland, Brisbane, QLD 4072, Australia. ment is found), and less than 1.8% of the The non-exonic elements, both intronic and human genome aligns to fugu (at an average intergenic, tend to congregate in clusters *To whom correspondence should be addressed. E- mail: [email protected] (G.B.); [email protected] of 60% identity). In addition, nearly all ex- near transcription factors and developmen- (D.H.). hibit extremely high levels of conservation tal genes, whereas the exonic and possibly www.sciencemag.org SCIENCE VOL 304 28 MAY 2004 1321 R EPORTS exonic elements are more randomly distrib- enrichment for RNA binding and regulation attributes are enriched in type I genes as well uted along the chromosomes (Fig. 1). of splicing (P Ͻ 10Ϫ18 and 10Ϫ9, respective- but 16, 8, and 9 orders of magnitude less There are 93 known genes that overlap ly, against all GO annotated human genes) significantly, respectively. This suggests that with exonic ultraconserved elements; we call and are uniquely abundant in the RNA rec- exonic ultraconserved elements may be spe- these type I genes. The 225 genes that are ognition motif RRM (P Ͻ 10Ϫ17, against all cifically associated with RNA processing and near the non-exonic elements we call type II InterPro annotated human genes). In contrast, non-exonic elements with regulation of tran- genes (methods in supporting text, section the type II genes are devoid of enrichment for scription at the DNA level. S3). We looked for categories of biological RNA binding or splicing or the RRM (P ϭ Non-exonic ultraconserved elements are process and molecular function defined in the 0.39, 0.44, and 0.77, respectively). However, often found in “gene deserts” that extend Gene Ontology (GO) database (19) that are type II genes are strongly enriched for regu- more than a megabase. In particular, of the significantly enriched in type I and II genes lation of transcription and DNA binding (P Ͻ non-exonic elements, there are 140 that are and also searched InterPro (20) for enrich- 10Ϫ19 and 10Ϫ14, respectively), as well as more than 10 kilobases (kb) away from any ment in particular structural domains (Fig. 2). DNA binding motifs, in particular the Ho- known gene, and 88 that are more than 100 The type I genes show significant functional meobox domain (P Ͻ 10Ϫ14). These three kb away. The set of 156 annotated genes that chr1 chr7 chr14 POU3F1 LMO4 PBX1 AKT3/ZNF238 SP4/SP8 AUTS2 DLX6 NOVA1 VRK1 FLJ10597 PTBP2 HNRPU TRA2A FOXP2 FOXG1B FAF1 HOXA HIC/TFEC COCH castor-ortholog AUTL1 NPAS3 GARNL1/GARNL2 MIPOL1 PRPF39 chr2 chr8 chr15 BCL11A ZFHX1B ST18 ZFPM2 MEIS2 MAP2K5 NR4A2 BHLHB5 TBR1 FIGN chr9 chr16 HAT1/DLX1/DLX2 SP3/PTD004 HOXD chr3 DMRT1/DMRT3 TLE4 MNAB OAZ C9orf39 HNRPK PBX3 IRX3/IRX5/IRX6 ELAVL2 NFAT5 FLJ22611 ATBF1 chr17 SATB1 FOXP1 ZNF288 SOX14 ZIC4 SHOX2 EVI1 chr10 chr18 LZK1/LHX1/AATF HOXB SFRS1 chr4 DRG11 PAX2 EHZF TCF4 C10orf11 FLJ13188 TAF4B ZNF407 BUB3 BRUNOL4 LRBA EBF3 chr11 chr19 chr20 chr5 LMO1 PAX6 KIAA1474 SOX6 KPNB2 RANBP17 orthopedia-ortholog chr12 chr21 chr22 chrY MEF2C NR2F1 chr6 chr13 HOXC chrX DDX3X TFAP2B/PKHD1 POU3F2 DACH POLA/ARX NLGN3 GRIA3/STAG2 Base Position 24000000 24500000 Chromosome Band Xp22.11 Xp21.3 PDK3 POLA PCYT1B ARX Ultra-conserved Elements Fig.
Load more

Recommended publications
  • HNRPH1 (HNRNPH1) (NM 005520) Human Tagged ORF Clone Product Data
    OriGene Technologies, Inc. 9620 Medical Center Drive, Ste 200 Rockville, MD 20850, US Phone: +1-888-267-4436 [email protected] EU: [email protected] CN: [email protected] Product datasheet for RC201834 HNRPH1 (HNRNPH1) (NM_005520) Human Tagged ORF Clone Product data: Product Type: Expression Plasmids Product Name: HNRPH1 (HNRNPH1) (NM_005520) Human Tagged ORF Clone Tag: Myc-DDK Symbol: HNRNPH1 Synonyms: hnRNPH; HNRPH; HNRPH1 Vector: pCMV6-Entry (PS100001) E. coli Selection: Kanamycin (25 ug/mL) Cell Selection: Neomycin This product is to be used for laboratory only. Not for diagnostic or therapeutic use. View online » ©2021 OriGene Technologies, Inc., 9620 Medical Center Drive, Ste 200, Rockville, MD 20850, US 1 / 6 HNRPH1 (HNRNPH1) (NM_005520) Human Tagged ORF Clone – RC201834 ORF Nucleotide >RC201834 ORF sequence Sequence: Red=Cloning site Blue=ORF Green=Tags(s) TTTTGTAATACGACTCACTATAGGGCGGCCGGGAATTCGTCGACTGGATCCGGTACCGAGGAGATCTGCC GCCGCGATCGCC ATGATGTTGGGCACGGAAGGTGGAGAGGGATTCGTGGTGAAGGTCCGGGGCTTGCCCTGGTCTTGCTCGG CCGATGAAGTGCAGAGGTTTTTTTCTGACTGCAAAATTCAAAATGGGGCTCAAGGTATTCGTTTCATCTA CACCAGAGAAGGCAGACCAAGTGGCGAGGCTTTTGTTGAACTTGAATCAGAAGATGAAGTCAAATTGGCC CTGAAAAAAGACAGAGAAACTATGGGACACAGATATGTTGAAGTATTCAAGTCAAACAACGTTGAAATGG ATTGGGTGTTGAAGCATACTGGTCCAAATAGTCCTGACACGGCCAATGATGGCTTTGTACGGCTTAGAGG ACTTCCCTTTGGATGTAGCAAGGAAGAAATTGTTCAGTTCTTCTCAGGGTTGGAAATCGTGCCAAATGGG ATAACATTGCCGGTGGACTTCCAGGGGAGGAGTACGGGGGAGGCCTTCGTGCAGTTTGCTTCACAGGAAA TAGCTGAAAAGGCTCTAAAGAAACACAAGGAAAGAATAGGGCACAGGTATATTGAAATCTTTAAGAGCAG TAGAGCTGAAGTTAGAACTCATTATGATCCACCACGAAAGCTTATGGCCATGCAGCGGCCAGGTCCTTAT
    [Show full text]
  • Snapshot: the Splicing Regulatory Machinery Mathieu Gabut, Sidharth Chaudhry, and Benjamin J
    192 Cell SnapShot: The Splicing Regulatory Machinery Mathieu Gabut, Sidharth Chaudhry, and Benjamin J. Blencowe 133 Banting and Best Department of Medical Research, University of Toronto, Toronto, ON M5S 3E1, Canada Expression in mouse , April4, 2008©2008Elsevier Inc. Low High Name Other Names Protein Domains Binding Sites Target Genes/Mouse Phenotypes/Disease Associations Amy Ceb Hip Hyp OB Eye SC BM Bo Ht SM Epd Kd Liv Lu Pan Pla Pro Sto Spl Thy Thd Te Ut Ov E6.5 E8.5 E10.5 SRp20 Sfrs3, X16 RRM, RS GCUCCUCUUC SRp20, CT/CGRP; −/− early embryonic lethal E3.5 9G8 Sfrs7 RRM, RS, C2HC Znf (GAC)n Tau, GnRH, 9G8 ASF/SF2 Sfrs1 RRM, RS RGAAGAAC HipK3, CaMKIIδ, HIV RNAs; −/− embryonic lethal, cond. KO cardiomyopathy SC35 Sfrs2 RRM, RS UGCUGUU AChE; −/− embryonic lethal, cond. KO deficient T-cell maturation, cardiomyopathy; LS SRp30c Sfrs9 RRM, RS CUGGAUU Glucocorticoid receptor SRp38 Fusip1, Nssr RRM, RS ACAAAGACAA CREB, type II and type XI collagens SRp40 Sfrs5, HRS RRM, RS AGGAGAAGGGA HipK3, PKCβ-II, Fibronectin SRp55 Sfrs6 RRM, RS GGCAGCACCUG cTnT, CD44 DOI 10.1016/j.cell.2008.03.010 SRp75 Sfrs4 RRM, RS GAAGGA FN1, E1A, CD45; overexpression enhances chondrogenic differentiation Tra2α Tra2a RRM, RS GAAARGARR GnRH; overexpression promotes RA-induced neural differentiation SR and SR-Related Proteins Tra2β Sfrs10 RRM, RS (GAA)n HipK3, SMN, Tau SRm160 Srrm1 RS, PWI AUGAAGAGGA CD44 SWAP Sfrs8 RS, SWAP ND SWAP, CD45, Tau; possible asthma susceptibility gene hnRNP A1 Hnrnpa1 RRM, RGG UAGGGA/U HipK3, SMN2, c-H-ras; rheumatoid arthritis, systemic lupus
    [Show full text]
  • Genetic and Pharmacological Approaches to Preventing Neurodegeneration
    University of Pennsylvania ScholarlyCommons Publicly Accessible Penn Dissertations 2012 Genetic and Pharmacological Approaches to Preventing Neurodegeneration Marco Boccitto University of Pennsylvania, [email protected] Follow this and additional works at: https://repository.upenn.edu/edissertations Part of the Neuroscience and Neurobiology Commons Recommended Citation Boccitto, Marco, "Genetic and Pharmacological Approaches to Preventing Neurodegeneration" (2012). Publicly Accessible Penn Dissertations. 494. https://repository.upenn.edu/edissertations/494 This paper is posted at ScholarlyCommons. https://repository.upenn.edu/edissertations/494 For more information, please contact [email protected]. Genetic and Pharmacological Approaches to Preventing Neurodegeneration Abstract The Insulin/Insulin-like Growth Factor 1 Signaling (IIS) pathway was first identified as a major modifier of aging in C.elegans. It has since become clear that the ability of this pathway to modify aging is phylogenetically conserved. Aging is a major risk factor for a variety of neurodegenerative diseases including the motor neuron disease, Amyotrophic Lateral Sclerosis (ALS). This raises the possibility that the IIS pathway might have therapeutic potential to modify the disease progression of ALS. In a C. elegans model of ALS we found that decreased IIS had a beneficial effect on ALS pathology in this model. This beneficial effect was dependent on activation of the transcription factor daf-16. To further validate IIS as a potential therapeutic target for treatment of ALS, manipulations of IIS in mammalian cells were investigated for neuroprotective activity. Genetic manipulations that increase the activity of the mammalian ortholog of daf-16, FOXO3, were found to be neuroprotective in a series of in vitro models of ALS toxicity.
    [Show full text]
  • Aneuploidy: Using Genetic Instability to Preserve a Haploid Genome?
    Health Science Campus FINAL APPROVAL OF DISSERTATION Doctor of Philosophy in Biomedical Science (Cancer Biology) Aneuploidy: Using genetic instability to preserve a haploid genome? Submitted by: Ramona Ramdath In partial fulfillment of the requirements for the degree of Doctor of Philosophy in Biomedical Science Examination Committee Signature/Date Major Advisor: David Allison, M.D., Ph.D. Academic James Trempe, Ph.D. Advisory Committee: David Giovanucci, Ph.D. Randall Ruch, Ph.D. Ronald Mellgren, Ph.D. Senior Associate Dean College of Graduate Studies Michael S. Bisesi, Ph.D. Date of Defense: April 10, 2009 Aneuploidy: Using genetic instability to preserve a haploid genome? Ramona Ramdath University of Toledo, Health Science Campus 2009 Dedication I dedicate this dissertation to my grandfather who died of lung cancer two years ago, but who always instilled in us the value and importance of education. And to my mom and sister, both of whom have been pillars of support and stimulating conversations. To my sister, Rehanna, especially- I hope this inspires you to achieve all that you want to in life, academically and otherwise. ii Acknowledgements As we go through these academic journeys, there are so many along the way that make an impact not only on our work, but on our lives as well, and I would like to say a heartfelt thank you to all of those people: My Committee members- Dr. James Trempe, Dr. David Giovanucchi, Dr. Ronald Mellgren and Dr. Randall Ruch for their guidance, suggestions, support and confidence in me. My major advisor- Dr. David Allison, for his constructive criticism and positive reinforcement.
    [Show full text]
  • A Novel Resveratrol Analog: Its Cell Cycle Inhibitory, Pro-Apoptotic and Anti-Inflammatory Activities on Human Tumor Cells
    A NOVEL RESVERATROL ANALOG : ITS CELL CYCLE INHIBITORY, PRO-APOPTOTIC AND ANTI-INFLAMMATORY ACTIVITIES ON HUMAN TUMOR CELLS A dissertation submitted to Kent State University in partial fulfillment of the requirements for the degree of Doctor of Philosophy by Boren Lin May 2006 Dissertation written by Boren Lin B.S., Tunghai University, 1996 M.S., Kent State University, 2003 Ph. D., Kent State University, 2006 Approved by Dr. Chun-che Tsai , Chair, Doctoral Dissertation Committee Dr. Bryan R. G. Williams , Co-chair, Doctoral Dissertation Committee Dr. Johnnie W. Baker , Members, Doctoral Dissertation Committee Dr. James L. Blank , Dr. Bansidhar Datta , Dr. Gail C. Fraizer , Accepted by Dr. Robert V. Dorman , Director, School of Biomedical Sciences Dr. John R. Stalvey , Dean, College of Arts and Sciences ii TABLE OF CONTENTS LIST OF FIGURES……………………………………………………………….………v LIST OF TABLES……………………………………………………………………….vii ACKNOWLEDGEMENTS….………………………………………………………….viii I INTRODUCTION….………………………………………………….1 Background and Significance……………………………………………………..1 Specific Aims………………………………………………………………………12 II MATERIALS AND METHODS.…………………………………………….16 Cell Culture and Compounds…….……………….…………………………….….16 MTT Cell Viability Assay………………………………………………………….16 Trypan Blue Exclusive Assay……………………………………………………...18 Flow Cytometry for Cell Cycle Analysis……………..……………....……………19 DNA Fragmentation Assay……………………………………………...…………23 Caspase-3 Activity Assay………………………………...……….….…….………24 Annexin V-FITC Staining Assay…………………………………..…...….………28 NF-kappa B p65 Activity Assay……………………………………..………….…29
    [Show full text]
  • Gene Expression During Normal and FSHD Myogenesis Tsumagari Et Al
    Gene expression during normal and FSHD myogenesis Tsumagari et al. Tsumagari et al. BMC Medical Genomics 2011, 4:67 http://www.biomedcentral.com/1755-8794/4/67 (27 September 2011) Tsumagari et al. BMC Medical Genomics 2011, 4:67 http://www.biomedcentral.com/1755-8794/4/67 RESEARCHARTICLE Open Access Gene expression during normal and FSHD myogenesis Koji Tsumagari1, Shao-Chi Chang1, Michelle Lacey2,3, Carl Baribault2,3, Sridar V Chittur4, Janet Sowden5, Rabi Tawil5, Gregory E Crawford6 and Melanie Ehrlich1,3* Abstract Background: Facioscapulohumeral muscular dystrophy (FSHD) is a dominant disease linked to contraction of an array of tandem 3.3-kb repeats (D4Z4) at 4q35. Within each repeat unit is a gene, DUX4, that can encode a protein containing two homeodomains. A DUX4 transcript derived from the last repeat unit in a contracted array is associated with pathogenesis but it is unclear how. Methods: Using exon-based microarrays, the expression profiles of myogenic precursor cells were determined. Both undifferentiated myoblasts and myoblasts differentiated to myotubes derived from FSHD patients and controls were studied after immunocytochemical verification of the quality of the cultures. To further our understanding of FSHD and normal myogenesis, the expression profiles obtained were compared to those of 19 non-muscle cell types analyzed by identical methods. Results: Many of the ~17,000 examined genes were differentially expressed (> 2-fold, p < 0.01) in control myoblasts or myotubes vs. non-muscle cells (2185 and 3006, respectively) or in FSHD vs. control myoblasts or myotubes (295 and 797, respectively). Surprisingly, despite the morphologically normal differentiation of FSHD myoblasts to myotubes, most of the disease-related dysregulation was seen as dampening of normal myogenesis- specific expression changes, including in genes for muscle structure, mitochondrial function, stress responses, and signal transduction.
    [Show full text]
  • Identification of Differentially Expressed Genes in Human Bladder Cancer Through Genome-Wide Gene Expression Profiling
    521-531 24/7/06 18:28 Page 521 ONCOLOGY REPORTS 16: 521-531, 2006 521 Identification of differentially expressed genes in human bladder cancer through genome-wide gene expression profiling KAZUMORI KAWAKAMI1,3, HIDEKI ENOKIDA1, TOKUSHI TACHIWADA1, TAKENARI GOTANDA1, KENGO TSUNEYOSHI1, HIROYUKI KUBO1, KENRYU NISHIYAMA1, MASAKI TAKIGUCHI2, MASAYUKI NAKAGAWA1 and NAOHIKO SEKI3 1Department of Urology, Graduate School of Medical and Dental Sciences, Kagoshima University, 8-35-1 Sakuragaoka, Kagoshima 890-8520; Departments of 2Biochemistry and Genetics, and 3Functional Genomics, Graduate School of Medicine, Chiba University, 1-8-1 Inohana, Chuo-ku, Chiba 260-8670, Japan Received February 15, 2006; Accepted April 27, 2006 Abstract. Large-scale gene expression profiling is an effective CKS2 gene not only as a potential biomarker for diagnosing, strategy for understanding the progression of bladder cancer but also for staging human BC. This is the first report (BC). The aim of this study was to identify genes that are demonstrating that CKS2 expression is strongly correlated expressed differently in the course of BC progression and to with the progression of human BC. establish new biomarkers for BC. Specimens from 21 patients with pathologically confirmed superficial (n=10) or Introduction invasive (n=11) BC and 4 normal bladder samples were studied; samples from 14 of the 21 BC samples were subjected Bladder cancer (BC) is among the 5 most common to microarray analysis. The validity of the microarray results malignancies worldwide, and the 2nd most common tumor of was verified by real-time RT-PCR. Of the 136 up-regulated the genitourinary tract and the 2nd most common cause of genes we detected, 21 were present in all 14 BCs examined death in patients with cancer of the urinary tract (1-7).
    [Show full text]
  • Mouse Srsf7 Knockout Project (CRISPR/Cas9)
    https://www.alphaknockout.com Mouse Srsf7 Knockout Project (CRISPR/Cas9) Objective: To create a Srsf7 knockout Mouse model (C57BL/6J) by CRISPR/Cas-mediated genome engineering. Strategy summary: The Srsf7 gene (NCBI Reference Sequence: NM_146083.2 ; Ensembl: ENSMUSG00000024097 ) is located on Mouse chromosome 17. 8 exons are identified, with the ATG start codon in exon 1 and the TGA stop codon in exon 8 (Transcript: ENSMUST00000063417). Exon 3~8 will be selected as target site. Cas9 and gRNA will be co-injected into fertilized eggs for KO Mouse production. The pups will be genotyped by PCR followed by sequencing analysis. Note: Exon 3 starts from about 29.41% of the coding region. Exon 3~8 covers 70.73% of the coding region. The size of effective KO region: ~3889 bp. The KO region does not have any other known gene. Page 1 of 9 https://www.alphaknockout.com Overview of the Targeting Strategy Wildtype allele 5' gRNA region gRNA region 3' 1 2 3 4 5 6 7 8 Legends Exon of mouse Srsf7 Knockout region Page 2 of 9 https://www.alphaknockout.com Overview of the Dot Plot (up) Window size: 15 bp Forward Reverse Complement Sequence 12 Note: The 2000 bp section upstream of Exon 3 is aligned with itself to determine if there are tandem repeats. No significant tandem repeat is found in the dot plot matrix. So this region is suitable for PCR screening or sequencing analysis. Overview of the Dot Plot (down) Window size: 15 bp Forward Reverse Complement Sequence 12 Note: The 2000 bp section downstream of stop codon is aligned with itself to determine if there are tandem repeats.
    [Show full text]
  • Open Data for Differential Network Analysis in Glioma
    International Journal of Molecular Sciences Article Open Data for Differential Network Analysis in Glioma , Claire Jean-Quartier * y , Fleur Jeanquartier y and Andreas Holzinger Holzinger Group HCI-KDD, Institute for Medical Informatics, Statistics and Documentation, Medical University Graz, Auenbruggerplatz 2/V, 8036 Graz, Austria; [email protected] (F.J.); [email protected] (A.H.) * Correspondence: [email protected] These authors contributed equally to this work. y Received: 27 October 2019; Accepted: 3 January 2020; Published: 15 January 2020 Abstract: The complexity of cancer diseases demands bioinformatic techniques and translational research based on big data and personalized medicine. Open data enables researchers to accelerate cancer studies, save resources and foster collaboration. Several tools and programming approaches are available for analyzing data, including annotation, clustering, comparison and extrapolation, merging, enrichment, functional association and statistics. We exploit openly available data via cancer gene expression analysis, we apply refinement as well as enrichment analysis via gene ontology and conclude with graph-based visualization of involved protein interaction networks as a basis for signaling. The different databases allowed for the construction of huge networks or specified ones consisting of high-confidence interactions only. Several genes associated to glioma were isolated via a network analysis from top hub nodes as well as from an outlier analysis. The latter approach highlights a mitogen-activated protein kinase next to a member of histondeacetylases and a protein phosphatase as genes uncommonly associated with glioma. Cluster analysis from top hub nodes lists several identified glioma-associated gene products to function within protein complexes, including epidermal growth factors as well as cell cycle proteins or RAS proto-oncogenes.
    [Show full text]
  • Transcriptional Recapitulation and Subversion Of
    Open Access Research2007KaiseretVolume al. 8, Issue 7, Article R131 Transcriptional recapitulation and subversion of embryonic colon comment development by mouse colon tumor models and human colon cancer Sergio Kaiser¤*, Young-Kyu Park¤†, Jeffrey L Franklin†, Richard B Halberg‡, Ming Yu§, Walter J Jessen*, Johannes Freudenberg*, Xiaodi Chen‡, Kevin Haigis¶, Anil G Jegga*, Sue Kong*, Bhuvaneswari Sakthivel*, Huan Xu*, Timothy Reichling¥, Mohammad Azhar#, Gregory P Boivin**, reviews Reade B Roberts§, Anika C Bissahoyo§, Fausto Gonzales††, Greg C Bloom††, Steven Eschrich††, Scott L Carter‡‡, Jeremy E Aronow*, John Kleimeyer*, Michael Kleimeyer*, Vivek Ramaswamy*, Stephen H Settle†, Braden Boone†, Shawn Levy†, Jonathan M Graff§§, Thomas Doetschman#, Joanna Groden¥, William F Dove‡, David W Threadgill§, Timothy J Yeatman††, reports Robert J Coffey Jr† and Bruce J Aronow* Addresses: *Biomedical Informatics, Cincinnati Children's Hospital Medical Center, Cincinnati, OH 45229, USA. †Departments of Medicine, and Cell and Developmental Biology, Vanderbilt University and Department of Veterans Affairs Medical Center, Nashville, TN 37232, USA. ‡McArdle Laboratory for Cancer Research, University of Wisconsin, Madison, WI 53706, USA. §Department of Genetics and Lineberger Cancer Center, University of North Carolina, Chapel Hill, NC 27599, USA. ¶Molecular Pathology Unit and Center for Cancer Research, Massachusetts deposited research General Hospital, Charlestown, MA 02129, USA. ¥Division of Human Cancer Genetics, The Ohio State University College of Medicine, Columbus, Ohio 43210-2207, USA. #Institute for Collaborative BioResearch, University of Arizona, Tucson, AZ 85721-0036, USA. **University of Cincinnati, Department of Pathology and Laboratory Medicine, Cincinnati, OH 45267, USA. ††H Lee Moffitt Cancer Center and Research Institute, Tampa, FL 33612, USA. ‡‡Children's Hospital Informatics Program at the Harvard-MIT Division of Health Sciences and Technology (CHIP@HST), Harvard Medical School, Boston, Massachusetts 02115, USA.
    [Show full text]
  • Supplementary Table 1
    Supplementary Table 1 Name Class Description SU-8 CAN SU-8 Homo sapiens apoptosis related protein APR-4 mRNA, partial cds. AF144054 Apoptosis [AF144054] 3,300 BM023129 ie79h07.x1 Melton Normalized Human Islet 4 N4-HIS 1 Homo sapiens cDNA clone IMAGE:5673444 3' similar to SW:BUB3_MOUSE Q9WVA3 MITOTIC CHECKPOINT PROTEIN BM023129 Cell cycle BUB3 ;, mRNA sequence [BM023129] 0.332 TAGLN2 Differentiation Homo sapiens transgelin 2 (TAGLN2), mRNA [NM_003564] 3.349 HSPC065 Heat shock Homo sapiens HSPC065 protein (HSPC065), mRNA [NM_014157] 3.102 Homo sapiens chemokine (C-C motif) ligand 19 (CCL19), mRNA CCL19 Ligand [NM_006274] 3.800 THC2045396 Membrane O00429 (O00429) Dynamin-like protein, partial (16%) [THC2045396] 0.131 AW075437 xb23c01.x1 NCI_CGAP_Kid13 Homo sapiens cDNA clone IMAGE:2577120 3' similar to WP:C17G10.8 CE16861 FAT-3: AW075437 Metabolism ALCOHOL DEHYDROGENASE ;, mRNA sequence [AW075437] 0.314 Homo sapiens 3-hydroxyanthranilate 3,4-dioxygenase (HAAO), mRNA HAAO Metabolism [NM_012205] 4.733 3.885 Homo sapiens abhydrolase domain containing 9 (ABHD9), mRNA ABHD9 Metabolism [NM_024794] 3.689 NPEPL1 Metabolism Homo sapiens aminopeptidase-like 1 (NPEPL1), mRNA [NM_024663] 3.837 4.054 Homo sapiens pyridoxine 5'-phosphate oxidase (PNPO), mRNA PNPO Metabolism [NM_018129] 3.978 Homo sapiens solute carrier family 27 (fatty acid transporter), member SLC27A1 Metabolism 1 (SLC27A1), mRNA [NM_198580] 3.066 RIB2_HUMAN (P04844) Dolichyl-diphosphooligosaccharide--protein glycosyltransferase 63 kDa subunit precursor (Ribophorin II) (RPN-II) THC2159243
    [Show full text]
  • Ultraconserved Elements Are Associated with Homeostatic Control of Splicing Regulators by Alternative Splicing and Nonsense-Mediated Decay
    Downloaded from genesdev.cshlp.org on September 24, 2021 - Published by Cold Spring Harbor Laboratory Press Ultraconserved elements are associated with homeostatic control of splicing regulators by alternative splicing and nonsense-mediated decay Julie Z. Ni,1 Leslie Grate,1 John Paul Donohue,1 Christine Preston,2 Naomi Nobida,2 Georgeann O’Brien,2 Lily Shiue,1 Tyson A. Clark,3 John E. Blume,3 and Manuel Ares Jr.1,2,4 1Center for Molecular Biology of RNA and Department of Molecular, Cell, and Developmental Biology, University of California at Santa Cruz, Santa Cruz, California 95064, USA; 2Hughes Undergraduate Research Laboratory, University of California at Santa Cruz, Santa Cruz, California 95064, USA; 3Affymetrix, Inc., Santa Clara, California 95051, USA Many alternative splicing events create RNAs with premature stop codons, suggesting that alternative splicing coupled with nonsense-mediated decay (AS-NMD) may regulate gene expression post-transcriptionally. We tested this idea in mice by blocking NMD and measuring changes in isoform representation using splicing-sensitive microarrays. We found a striking class of highly conserved stop codon-containing exons whose inclusion renders the transcript sensitive to NMD. A genomic search for additional examples identified >50 such exons in genes with a variety of functions. These exons are unusually frequent in genes that encode splicing activators and are unexpectedly enriched in the so-called “ultraconserved” elements in the mammalian lineage. Further analysis show that NMD of mRNAs for splicing activators such as SR proteins is triggered by splicing activation events, whereas NMD of the mRNAs for negatively acting hnRNP proteins is triggered by splicing repression, a polarity consistent with widespread homeostatic control of splicing regulator gene expression.
    [Show full text]