Transcriptional Recapitulation and Subversion Of

Total Page:16

File Type:pdf, Size:1020Kb

Load more

Open Access Research2007KaiseretVolume al. 8, Issue 7, Article R131 Transcriptional recapitulation and subversion of embryonic colon comment development by mouse colon tumor models and human colon cancer Sergio Kaiser¤*, Young-Kyu Park¤†, Jeffrey L Franklin†, Richard B Halberg‡, Ming Yu§, Walter J Jessen*, Johannes Freudenberg*, Xiaodi Chen‡, Kevin Haigis¶, Anil G Jegga*, Sue Kong*, Bhuvaneswari Sakthivel*, Huan Xu*, Timothy Reichling¥, Mohammad Azhar#, Gregory P Boivin**, reviews Reade B Roberts§, Anika C Bissahoyo§, Fausto Gonzales††, Greg C Bloom††, Steven Eschrich††, Scott L Carter‡‡, Jeremy E Aronow*, John Kleimeyer*, Michael Kleimeyer*, Vivek Ramaswamy*, Stephen H Settle†, Braden Boone†, Shawn Levy†, Jonathan M Graff§§, Thomas Doetschman#, Joanna Groden¥, William F Dove‡, David W Threadgill§, Timothy J Yeatman††, reports Robert J Coffey Jr† and Bruce J Aronow* Addresses: *Biomedical Informatics, Cincinnati Children's Hospital Medical Center, Cincinnati, OH 45229, USA. †Departments of Medicine, and Cell and Developmental Biology, Vanderbilt University and Department of Veterans Affairs Medical Center, Nashville, TN 37232, USA. ‡McArdle Laboratory for Cancer Research, University of Wisconsin, Madison, WI 53706, USA. §Department of Genetics and Lineberger Cancer Center, University of North Carolina, Chapel Hill, NC 27599, USA. ¶Molecular Pathology Unit and Center for Cancer Research, Massachusetts deposited research General Hospital, Charlestown, MA 02129, USA. ¥Division of Human Cancer Genetics, The Ohio State University College of Medicine, Columbus, Ohio 43210-2207, USA. #Institute for Collaborative BioResearch, University of Arizona, Tucson, AZ 85721-0036, USA. **University of Cincinnati, Department of Pathology and Laboratory Medicine, Cincinnati, OH 45267, USA. ††H Lee Moffitt Cancer Center and Research Institute, Tampa, FL 33612, USA. ‡‡Children's Hospital Informatics Program at the Harvard-MIT Division of Health Sciences and Technology (CHIP@HST), Harvard Medical School, Boston, Massachusetts 02115, USA. §§University of Texas Southwestern Medical Center at Dallas, Dallas, TX 75390, USA. ¤ These authors contributed equally to this work. refereed research refereed Correspondence: Bruce J Aronow. Email: [email protected] Published: 5 July 2007 Received: 22 August 2006 Revised: 12 February 2007 Genome Biology 2007, 8:R131 (doi:10.1186/gb-2007-8-7-r131) Accepted: 5 July 2007 The electronic version of this article is the complete one and can be found online at http://genomebiology.com/2007/8/7/R131 © 2007 Kaiser et al.; licensee BioMed Central Ltd. interactions This is an open access article distributed under the terms of the Creative Commons Attribution License (http://creativecommons.org/licenses/by/2.0), which permits unrestricted use, distribution, and reproduction in any medium, provided the original work is properly cited. Colon<p>Colononic colon tumours tumorsgene recapitulate expression from four from embryonic independent embryonic transcription mouse days models13.5-18.5.</p> and 100 human colorectal cancers all exhibited striking recapitulation of embry- Abstract Background: The expression of carcino-embryonic antigen by colorectal cancer is an example of information oncogenic activation of embryonic gene expression. Hypothesizing that oncogenesis-recapitulating- ontogenesis may represent a broad programmatic commitment, we compared gene expression patterns of human colorectal cancers (CRCs) and mouse colon tumor models to those of mouse colon development embryonic days 13.5-18.5. Genome Biology 2007, 8:R131 R131.2 Genome Biology 2007, Volume 8, Issue 7, Article R131 Kaiser et al. http://genomebiology.com/2007/8/7/R131 Results: We report here that 39 colon tumors from four independent mouse models and 100 human CRCs encompassing all clinical stages shared a striking recapitulation of embryonic colon gene expression. Compared to normal adult colon, all mouse and human tumors over-expressed a large cluster of genes highly enriched for functional association to the control of cell cycle progression, proliferation, and migration, including those encoding MYC, AKT2, PLK1 and SPARC. Mouse tumors positive for nuclear β-catenin shifted the shared embryonic pattern to that of early development. Human and mouse tumors differed from normal embryonic colon by their loss of expression modules enriched for tumor suppressors (EDNRB, HSPE, KIT and LSP1). Human CRC adenocarcinomas lost an additional suppressor module (IGFBP4, MAP4K1, PDGFRA, STAB1 and WNT4). Many human tumor samples also gained expression of a coordinately regulated module associated with advanced malignancy (ABCC1, FOXO3A, LIF, PIK3R1, PRNP, TNC, TIMP3 and VEGF). Conclusion: Cross-species, developmental, and multi-model gene expression patterning comparisons provide an integrated and versatile framework for definition of transcriptional programs associated with oncogenesis. This approach also provides a general method for identifying pattern-specific biomarkers and therapeutic targets. This delineation and categorization of developmental and non-developmental activator and suppressor gene modules can thus facilitate the formulation of sophisticated hypotheses to evaluate potential synergistic effects of targeting within- and between-modules for next-generation combinatorial therapeutics and improved mouse models. Background the small intestine and colon [8]. A major function of APC is The colon is composed of a dynamic and self-renewing epi- to regulate the canonical WNT signaling pathway as part of a thelium that turns over every three to five days. It is generally β-catenin degradation complex. Loss of APC results in a fail- accepted that at the base of the crypt, variable numbers ure to degrade β-catenin, which instead enters the nucleus to (between 1 and 16) of slowly dividing, stationary, pluripotent act as a transcriptional co-activator with the lymphoid stem cells give rise to more rapidly proliferating, transient enhancer factor/T-cell factor (LEF/TCF) family of transcrip- amplifying cells. These cells differentiate chiefly into post- tion factors [9]. The localization of β-catenin within the mitotic columnar colonocytes, mucin-secreting goblet cells, nucleus indicates activated canonical WNT signaling. In addi- and enteroendocrine cells as they migrate from the crypt base tion to germline APC mutations that occur in persons with to the surface where they are sloughed into the lumen [1]. Sev- familial adenomatous polyposis coli (FAP) and ApcMin/+ mice, eral signaling pathways, notably Wnt, Tgfβ, Bmp, Hedgehog loss of functional APC and activation of canonical WNT sign- and Notch, play pivotal roles in the control of proliferation aling occurs in more than 80% of human sporadic CRCs [10]. and differentiation of the developing and adult colon [2]. Similar to the ApcMin/+ model, tumors in the azoxymethane Their perturbation, via mutation or epigenetic modification, (AOM) carcinogen model, which occur predominantly in the occurs in human colorectal cancer (CRC) and the instillation colon [11], have signaling alterations marked by activated of these changes via genetic engineering in mice confers a cor- canonical WNT signaling. respondingly high risk for neoplasia in the mouse models. Moreover, tumor cell de-differentiation correlates with key Two other mouse models that carry different genetic altera- tumor features, such as tumor progression rates, invasive- tions leading to colon tumor formation are based on the ness, drug resistance and metastatic potential [3-5]. observation that transforming growth factor (TGF)β type II receptor (TGFBR2) gene mutations are present in up to 30% A variety of scientific and organizational obstacles make it a of sporadic CRCs and in more than 90% of tumors that occur challenging proposition to undertake large-scale compari- in patients with the DNA mismatch repair deficiency associ- sons of human cancer to the wide range of genetically engi- ated with hereditary non-polyposis colon cancer (HNPCC) neered mouse models. To evaluate the potential of this [12]. In the mouse, a deficiency of TGFβ1 combined with an approach to provide integrated views of the molecular basis of absence of T-cells (Tgfb1-/-; Rag2-/-) results in a high occur- cancer risk, tumor development and malignant progression, rence of colon cancer [13]. These mice develop adenomas by we have undertaken a comparative analysis of a variety of two months of age, and adenocarcinomas, often mucinous, by individually developed mouse colon tumor models (reviewed three to six months of age. Immunohistochemical analyses of in [6,7]) to human CRC. The ApcMin/+ (multiple intestinal these tumors are negative for nuclear β-catenin, suggesting neoplasia) mouse model harbors a germline mutation in the that TGFβ1 does not suppress tumors via a canonical WNT Apc tumor suppressor gene and exhibits multiple tumors in signaling-dependent pathway. The SMAD family proteins are Genome Biology 2007, 8:R131 http://genomebiology.com/2007/8/7/R131 Genome Biology 2007, Volume 8, Issue 7, Article R131 Kaiser et al. R131.3 critical downstream transcription regulators activated by and statistically compared to an average value among the TGFβ signaling, in part through the TGFβ type II receptor. tumors or to embryonic or adult colon gene expression levels Smad3-/- mice also develop intestinal lesions that include on a per-gene basis. First, we compared the four models with comment colon adenomas and adenocarcinomas by six months of age each other, then to mouse colon development,
Recommended publications
  • Supplementary Data

    Supplementary Data

    Figure 2S 4 7 A - C 080125 CSCs 080418 CSCs - + IFN-a 48 h + IFN-a 48 h + IFN-a 72 h 6 + IFN-a 72 h 3 5 MRFI 4 2 3 2 1 1 0 0 MHC I MHC II MICA MICB ULBP-1 ULBP-2 ULBP-3 ULBP-4 MHC I MHC II MICA MICB ULBP-1 ULBP-2 ULBP-3 ULBP-4 7 B 13 080125 FBS - D 080418 FBS - + IFN-a 48 h 12 + IFN-a 48 h + IFN-a 72 h + IFN-a 72 h 6 080125 FBS 11 10 5 9 8 4 7 6 3 MRFI 5 4 2 3 2 1 1 0 0 MHC I MHC II MICA MICB ULBP-1 ULBP-2 ULBP-3 ULBP-4 MHC I MHC II MICA MICB ULBP-1 ULBP-2 ULBP-3 ULBP-4 Molecule Molecule FIGURE 4S FIGURE 5S Panel A Panel B FIGURE 6S A B C D Supplemental Results Table 1S. Modulation by IFN-α of APM in GBM CSC and FBS tumor cell lines. Molecule * Cell line IFN-α‡ HLA β2-m# HLA LMP TAP1 TAP2 class II A A HC§ 2 7 10 080125 CSCs - 1∞ (1) 3 (65) 2 (91) 1 (2) 6 (47) 2 (61) 1 (3) 1 (2) 1 (3) + 2 (81) 11 (80) 13 (99) 1 (3) 8 (88) 4 (91) 1 (2) 1 (3) 2 (68) 080125 FBS - 2 (81) 4 (63) 4 (83) 1 (3) 6 (80) 3 (67) 2 (86) 1 (3) 2 (75) + 2 (99) 14 (90) 7 (97) 5 (75) 7 (100) 6 (98) 2 (90) 1 (4) 3 (87) 080418 CSCs - 2 (51) 1 (1) 1 (3) 2 (47) 2 (83) 2 (54) 1 (4) 1 (2) 1 (3) + 2 (81) 3 (76) 5 (75) 2 (50) 2 (83) 3 (71) 1 (3) 2 (87) 1 (2) 080418 FBS - 1 (3) 3 (70) 2 (88) 1 (4) 3 (87) 2 (76) 1 (3) 1 (3) 1 (2) + 2 (78) 7 (98) 5 (99) 2 (94) 5 (100) 3 (100) 1 (4) 2 (100) 1 (2) 070104 CSCs - 1 (2) 1 (3) 1 (3) 2 (78) 1 (3) 1 (2) 1 (3) 1 (3) 1 (2) + 2 (98) 8 (100) 10 (88) 4 (89) 3 (98) 3 (94) 1 (4) 2 (86) 2 (79) * expression of APM molecules was evaluated by intracellular staining and cytofluorimetric analysis; ‡ cells were treatead or not (+/-) for 72 h with 1000 IU/ml of IFN-α; # β-2 microglobulin; § β-2 microglobulin-free HLA-A heavy chain; ∞ values are indicated as ratio between the mean of fluorescence intensity of cells stained with the selected mAb and that of the negative control; bold values indicate significant MRFI (≥ 2).
  • Aberrant Methylation Underlies Insulin Gene Expression in Human Insulinoma

    Aberrant Methylation Underlies Insulin Gene Expression in Human Insulinoma

    ARTICLE https://doi.org/10.1038/s41467-020-18839-1 OPEN Aberrant methylation underlies insulin gene expression in human insulinoma Esra Karakose1,6, Huan Wang 2,6, William Inabnet1, Rajesh V. Thakker 3, Steven Libutti4, Gustavo Fernandez-Ranvier 1, Hyunsuk Suh1, Mark Stevenson 3, Yayoi Kinoshita1, Michael Donovan1, Yevgeniy Antipin1,2, Yan Li5, Xiaoxiao Liu 5, Fulai Jin 5, Peng Wang 1, Andrew Uzilov 1,2, ✉ Carmen Argmann 1, Eric E. Schadt 1,2, Andrew F. Stewart 1,7 , Donald K. Scott 1,7 & Luca Lambertini 1,6 1234567890():,; Human insulinomas are rare, benign, slowly proliferating, insulin-producing beta cell tumors that provide a molecular “recipe” or “roadmap” for pathways that control human beta cell regeneration. An earlier study revealed abnormal methylation in the imprinted p15.5-p15.4 region of chromosome 11, known to be abnormally methylated in another disorder of expanded beta cell mass and function: the focal variant of congenital hyperinsulinism. Here, we compare deep DNA methylome sequencing on 19 human insulinomas, and five sets of normal beta cells. We find a remarkably consistent, abnormal methylation pattern in insu- linomas. The findings suggest that abnormal insulin (INS) promoter methylation and altered transcription factor expression create alternative drivers of INS expression, replacing cano- nical PDX1-driven beta cell specification with a pathological, looping, distal enhancer-based form of transcriptional regulation. Finally, NFaT transcription factors, rather than the cano- nical PDX1 enhancer complex, are predicted to drive INS transactivation. 1 From the Diabetes Obesity and Metabolism Institute, The Department of Surgery, The Department of Pathology, The Department of Genetics and Genomics Sciences and The Institute for Genomics and Multiscale Biology, The Icahn School of Medicine at Mount Sinai, New York, NY 10029, USA.
  • Genomic Alterations of Ground-Glass Nodular Lung Adenocarcinoma

    Genomic Alterations of Ground-Glass Nodular Lung Adenocarcinoma

    www.nature.com/scientificreports OPEN Genomic alterations of ground- glass nodular lung adenocarcinoma Hyun Lee1, Je-Gun Joung2, Hyun-Tae Shin2, Duk-Hwan Kim3, Yujin Kim3, Hojoong Kim1, O. Jung Kwon1, Young Mog Shim4, Ho Yun Lee5, Kyung Soo Lee5, Yoon-La Choi6, 2 7 1 Received: 1 February 2018 Woong-Yang Park , D. Neil Hayes & Sang-Won Um Accepted: 30 April 2018 In-depth molecular pathogenesis of ground-glass nodular lung adenocarcinoma has not been well Published: xx xx xxxx understood. The objectives of this study were to identify genomic alterations in ground-glass nodular lung adenocarcinomas and to investigate whether viral transcripts were detected in these tumors. Nine patients with pure (n = 4) and part-solid (n = 5) ground-glass nodular adenocarcinomas were included. Six were females with a median age of 58 years. We performed targeted exon sequencing and RNA sequencing. EGFR (n = 10), IDH2 (n = 2), TP53 (n = 1), PTEN (n = 1), EPHB4 (n = 1), and BRAF (n = 1) were identifed as driver mutations by targeted exon sequencing. Vasculogenesis-associated genes including NOTCH4 and TGFBR3 expression were signifcantly downregulated in adenocarcinoma tissue versus normal tissue (adjusted P values < 0.001 for both NOTCH4 and TGFBR3). In addition, fve novel fusion gene loci were identifed in four lung adenocarcinomas. However, no signifcant virus-associated transcripts were detected in tumors. In conclusions, EGFR, IDH2, TP53, PTEN, EPHB4, and BRAF were identifed as putative driver mutations of ground-glass nodular adenocarcinomas. Five novel fusion genes were also identifed in four tumors. Viruses do not appear to be involved in the tumorigenesis of ground-glass nodular lung adenocarcinoma.
  • Analysis of Gene Expression Data for Gene Ontology

    Analysis of Gene Expression Data for Gene Ontology

    ANALYSIS OF GENE EXPRESSION DATA FOR GENE ONTOLOGY BASED PROTEIN FUNCTION PREDICTION A Thesis Presented to The Graduate Faculty of The University of Akron In Partial Fulfillment of the Requirements for the Degree Master of Science Robert Daniel Macholan May 2011 ANALYSIS OF GENE EXPRESSION DATA FOR GENE ONTOLOGY BASED PROTEIN FUNCTION PREDICTION Robert Daniel Macholan Thesis Approved: Accepted: _______________________________ _______________________________ Advisor Department Chair Dr. Zhong-Hui Duan Dr. Chien-Chung Chan _______________________________ _______________________________ Committee Member Dean of the College Dr. Chien-Chung Chan Dr. Chand K. Midha _______________________________ _______________________________ Committee Member Dean of the Graduate School Dr. Yingcai Xiao Dr. George R. Newkome _______________________________ Date ii ABSTRACT A tremendous increase in genomic data has encouraged biologists to turn to bioinformatics in order to assist in its interpretation and processing. One of the present challenges that need to be overcome in order to understand this data more completely is the development of a reliable method to accurately predict the function of a protein from its genomic information. This study focuses on developing an effective algorithm for protein function prediction. The algorithm is based on proteins that have similar expression patterns. The similarity of the expression data is determined using a novel measure, the slope matrix. The slope matrix introduces a normalized method for the comparison of expression levels throughout a proteome. The algorithm is tested using real microarray gene expression data. Their functions are characterized using gene ontology annotations. The results of the case study indicate the protein function prediction algorithm developed is comparable to the prediction algorithms that are based on the annotations of homologous proteins.
  • Molecular and Physiological Basis for Hair Loss in Near Naked Hairless and Oak Ridge Rhino-Like Mouse Models: Tracking the Role of the Hairless Gene

    Molecular and Physiological Basis for Hair Loss in Near Naked Hairless and Oak Ridge Rhino-Like Mouse Models: Tracking the Role of the Hairless Gene

    University of Tennessee, Knoxville TRACE: Tennessee Research and Creative Exchange Doctoral Dissertations Graduate School 5-2006 Molecular and Physiological Basis for Hair Loss in Near Naked Hairless and Oak Ridge Rhino-like Mouse Models: Tracking the Role of the Hairless Gene Yutao Liu University of Tennessee - Knoxville Follow this and additional works at: https://trace.tennessee.edu/utk_graddiss Part of the Life Sciences Commons Recommended Citation Liu, Yutao, "Molecular and Physiological Basis for Hair Loss in Near Naked Hairless and Oak Ridge Rhino- like Mouse Models: Tracking the Role of the Hairless Gene. " PhD diss., University of Tennessee, 2006. https://trace.tennessee.edu/utk_graddiss/1824 This Dissertation is brought to you for free and open access by the Graduate School at TRACE: Tennessee Research and Creative Exchange. It has been accepted for inclusion in Doctoral Dissertations by an authorized administrator of TRACE: Tennessee Research and Creative Exchange. For more information, please contact [email protected]. To the Graduate Council: I am submitting herewith a dissertation written by Yutao Liu entitled "Molecular and Physiological Basis for Hair Loss in Near Naked Hairless and Oak Ridge Rhino-like Mouse Models: Tracking the Role of the Hairless Gene." I have examined the final electronic copy of this dissertation for form and content and recommend that it be accepted in partial fulfillment of the requirements for the degree of Doctor of Philosophy, with a major in Life Sciences. Brynn H. Voy, Major Professor We have read this dissertation and recommend its acceptance: Naima Moustaid-Moussa, Yisong Wang, Rogert Hettich Accepted for the Council: Carolyn R.
  • Two Locus Inheritance of Non-Syndromic Midline Craniosynostosis Via Rare SMAD6 and 4 Common BMP2 Alleles 5 6 Andrew T

    Two Locus Inheritance of Non-Syndromic Midline Craniosynostosis Via Rare SMAD6 and 4 Common BMP2 Alleles 5 6 Andrew T

    1 2 3 Two locus inheritance of non-syndromic midline craniosynostosis via rare SMAD6 and 4 common BMP2 alleles 5 6 Andrew T. Timberlake1-3, Jungmin Choi1,2, Samir Zaidi1,2, Qiongshi Lu4, Carol Nelson- 7 Williams1,2, Eric D. Brooks3, Kaya Bilguvar1,5, Irina Tikhonova5, Shrikant Mane1,5, Jenny F. 8 Yang3, Rajendra Sawh-Martinez3, Sarah Persing3, Elizabeth G. Zellner3, Erin Loring1,2,5, Carolyn 9 Chuang3, Amy Galm6, Peter W. Hashim3, Derek M. Steinbacher3, Michael L. DiLuna7, Charles 10 C. Duncan7, Kevin A. Pelphrey8, Hongyu Zhao4, John A. Persing3, Richard P. Lifton1,2,5,9 11 12 1Department of Genetics, Yale University School of Medicine, New Haven, CT, USA 13 2Howard Hughes Medical Institute, Yale University School of Medicine, New Haven, CT, USA 14 3Section of Plastic and Reconstructive Surgery, Department of Surgery, Yale University School of Medicine, New Haven, CT, USA 15 4Department of Biostatistics, Yale University School of Medicine, New Haven, CT, USA 16 5Yale Center for Genome Analysis, New Haven, CT, USA 17 6Craniosynostosis and Positional Plagiocephaly Support, New York, NY, USA 18 7Department of Neurosurgery, Yale University School of Medicine, New Haven, CT, USA 19 8Child Study Center, Yale University School of Medicine, New Haven, CT, USA 20 9The Rockefeller University, New York, NY, USA 21 22 ABSTRACT 23 Premature fusion of the cranial sutures (craniosynostosis), affecting 1 in 2,000 24 newborns, is treated surgically in infancy to prevent adverse neurologic outcomes. To 25 identify mutations contributing to common non-syndromic midline (sagittal and metopic) 26 craniosynostosis, we performed exome sequencing of 132 parent-offspring trios and 59 27 additional probands.
  • HNRPH1 (HNRNPH1) (NM 005520) Human Tagged ORF Clone Product Data

    HNRPH1 (HNRNPH1) (NM 005520) Human Tagged ORF Clone Product Data

    OriGene Technologies, Inc. 9620 Medical Center Drive, Ste 200 Rockville, MD 20850, US Phone: +1-888-267-4436 [email protected] EU: [email protected] CN: [email protected] Product datasheet for RC201834 HNRPH1 (HNRNPH1) (NM_005520) Human Tagged ORF Clone Product data: Product Type: Expression Plasmids Product Name: HNRPH1 (HNRNPH1) (NM_005520) Human Tagged ORF Clone Tag: Myc-DDK Symbol: HNRNPH1 Synonyms: hnRNPH; HNRPH; HNRPH1 Vector: pCMV6-Entry (PS100001) E. coli Selection: Kanamycin (25 ug/mL) Cell Selection: Neomycin This product is to be used for laboratory only. Not for diagnostic or therapeutic use. View online » ©2021 OriGene Technologies, Inc., 9620 Medical Center Drive, Ste 200, Rockville, MD 20850, US 1 / 6 HNRPH1 (HNRNPH1) (NM_005520) Human Tagged ORF Clone – RC201834 ORF Nucleotide >RC201834 ORF sequence Sequence: Red=Cloning site Blue=ORF Green=Tags(s) TTTTGTAATACGACTCACTATAGGGCGGCCGGGAATTCGTCGACTGGATCCGGTACCGAGGAGATCTGCC GCCGCGATCGCC ATGATGTTGGGCACGGAAGGTGGAGAGGGATTCGTGGTGAAGGTCCGGGGCTTGCCCTGGTCTTGCTCGG CCGATGAAGTGCAGAGGTTTTTTTCTGACTGCAAAATTCAAAATGGGGCTCAAGGTATTCGTTTCATCTA CACCAGAGAAGGCAGACCAAGTGGCGAGGCTTTTGTTGAACTTGAATCAGAAGATGAAGTCAAATTGGCC CTGAAAAAAGACAGAGAAACTATGGGACACAGATATGTTGAAGTATTCAAGTCAAACAACGTTGAAATGG ATTGGGTGTTGAAGCATACTGGTCCAAATAGTCCTGACACGGCCAATGATGGCTTTGTACGGCTTAGAGG ACTTCCCTTTGGATGTAGCAAGGAAGAAATTGTTCAGTTCTTCTCAGGGTTGGAAATCGTGCCAAATGGG ATAACATTGCCGGTGGACTTCCAGGGGAGGAGTACGGGGGAGGCCTTCGTGCAGTTTGCTTCACAGGAAA TAGCTGAAAAGGCTCTAAAGAAACACAAGGAAAGAATAGGGCACAGGTATATTGAAATCTTTAAGAGCAG TAGAGCTGAAGTTAGAACTCATTATGATCCACCACGAAAGCTTATGGCCATGCAGCGGCCAGGTCCTTAT
  • Serum Albumin OS=Homo Sapiens

    Serum Albumin OS=Homo Sapiens

    Protein Name Cluster of Glial fibrillary acidic protein OS=Homo sapiens GN=GFAP PE=1 SV=1 (P14136) Serum albumin OS=Homo sapiens GN=ALB PE=1 SV=2 Cluster of Isoform 3 of Plectin OS=Homo sapiens GN=PLEC (Q15149-3) Cluster of Hemoglobin subunit beta OS=Homo sapiens GN=HBB PE=1 SV=2 (P68871) Vimentin OS=Homo sapiens GN=VIM PE=1 SV=4 Cluster of Tubulin beta-3 chain OS=Homo sapiens GN=TUBB3 PE=1 SV=2 (Q13509) Cluster of Actin, cytoplasmic 1 OS=Homo sapiens GN=ACTB PE=1 SV=1 (P60709) Cluster of Tubulin alpha-1B chain OS=Homo sapiens GN=TUBA1B PE=1 SV=1 (P68363) Cluster of Isoform 2 of Spectrin alpha chain, non-erythrocytic 1 OS=Homo sapiens GN=SPTAN1 (Q13813-2) Hemoglobin subunit alpha OS=Homo sapiens GN=HBA1 PE=1 SV=2 Cluster of Spectrin beta chain, non-erythrocytic 1 OS=Homo sapiens GN=SPTBN1 PE=1 SV=2 (Q01082) Cluster of Pyruvate kinase isozymes M1/M2 OS=Homo sapiens GN=PKM PE=1 SV=4 (P14618) Glyceraldehyde-3-phosphate dehydrogenase OS=Homo sapiens GN=GAPDH PE=1 SV=3 Clathrin heavy chain 1 OS=Homo sapiens GN=CLTC PE=1 SV=5 Filamin-A OS=Homo sapiens GN=FLNA PE=1 SV=4 Cytoplasmic dynein 1 heavy chain 1 OS=Homo sapiens GN=DYNC1H1 PE=1 SV=5 Cluster of ATPase, Na+/K+ transporting, alpha 2 (+) polypeptide OS=Homo sapiens GN=ATP1A2 PE=3 SV=1 (B1AKY9) Fibrinogen beta chain OS=Homo sapiens GN=FGB PE=1 SV=2 Fibrinogen alpha chain OS=Homo sapiens GN=FGA PE=1 SV=2 Dihydropyrimidinase-related protein 2 OS=Homo sapiens GN=DPYSL2 PE=1 SV=1 Cluster of Alpha-actinin-1 OS=Homo sapiens GN=ACTN1 PE=1 SV=2 (P12814) 60 kDa heat shock protein, mitochondrial OS=Homo
  • Ythdc2 Is an N6-Methyladenosine Binding Protein That Regulates Mammalian Spermatogenesis

    Ythdc2 Is an N6-Methyladenosine Binding Protein That Regulates Mammalian Spermatogenesis

    Cell Research (2017) 27:1115-1127. © 2017 IBCB, SIBS, CAS All rights reserved 1001-0602/17 $ 32.00 ORIGINAL ARTICLE www.nature.com/cr Ythdc2 is an N6-methyladenosine binding protein that regulates mammalian spermatogenesis Phillip J Hsu1, 2, 3, *, Yunfei Zhu4, *, Honghui Ma1, 2, *, Yueshuai Guo4, *, Xiaodan Shi4, Yuanyuan Liu4, Meijie Qi4, Zhike Lu1, 2, Hailing Shi1, 2, Jianying Wang4, Yiwei Cheng4, Guanzheng Luo1, 2, Qing Dai1, 2, Mingxi Liu4, Xuejiang Guo4, Jiahao Sha4, Bin Shen4, Chuan He1, 2, 5 1Department of Chemistry and Institute for Biophysical Dynamics, The University of Chicago, Chicago, IL 60637, USA; 2Howard Hughes Medical Institute, The University of Chicago, Chicago, IL 60637, USA; 3Committee on Immunology, The University of Chicago, Chicago, IL 60637, USA; 4State Key Laboratory of Reproductive Medicine, Department of Histology and Embryology, Nanjing Medical University, Nanjing 211166, China; 5Department of Biochemistry and Molecular Biology, The University of Chi- cago, Chicago, IL 60637, USA N6-methyladenosine (m6A) is the most common internal modification in eukaryotic mRNA. It is dynamically in- stalled and removed, and acts as a new layer of mRNA metabolism, regulating biological processes including stem cell pluripotency, cell differentiation, and energy homeostasis. m6A is recognized by selective binding proteins; YTHDF1 and YTHDF3 work in concert to affect the translation of m6A-containing mRNAs, YTHDF2 expedites mRNA decay, and YTHDC1 affects the nuclear processing of its targets. The biological function of YTHDC2, the final member of the YTH protein family, remains unknown. We report that YTHDC2 selectively binds m6A at its consensus motif. YTHDC2 enhances the translation efficiency of its targets and also decreases their mRNA abundance.
  • Anillin Is a Prognostic Factor and Is Correlated with Genovariation in Pancreatic Cancer Based on Databases Analysis

    Anillin Is a Prognostic Factor and Is Correlated with Genovariation in Pancreatic Cancer Based on Databases Analysis

    ONCOLOGY LETTERS 21: 107, 2021 Anillin is a prognostic factor and is correlated with genovariation in pancreatic cancer based on databases analysis YUANHUA NIE, ZHIQIANG ZHAO, MINXUE CHEN, FULIN MA, YONG FAN, YINGXIN KANG, BOXIONG KANG and CHEN WANG Department of General Surgery, Lanzhou University Second Hospital, Lanzhou, Gansu 730030, P.R. China Received March 12, 2020; Accepted October 8, 2020 DOI: 10.3892/ol.2020.12368 Abstract. Pancreatic cancer has a low survival rate globally. PC pathways were associated with low expression of ANLN. Anillin (ANLN) is involved in the pathogenesis of pancreatic Overall, ANLN is more highly expressed in PC compared cancer (PC). The present study used databases and reverse with in normal tissue, and is associated with poor differen‑ transcription‑quantitative PCR to investigate the association tiation. The expression of ANLN may be a novel prognostic between ANLN expression, clinical variables and the survival marker of poor survival. Finally, ANLN exert its functions in rate of patients with pancreatic cancer. Gene expression PC through the p53, cell cycle, DNA replication, mismatch of ANLN in normal and cancer tissues was analyzed using repair and nucleotide excision repair and pathways. data from The Cancer Genome Atlas, Oncomine and Gene Expression database of Normal and Tumor tissues 2 and Introduction ANOVA, and the association between ANLN mRNA expres‑ sion and ANLN genovariation was analyzed using cBioPortal. Pancreatic cancer (PC) is a major public health problem The association between ANLN expression and the survival, and is the eleventh most common cancer in the world, with clinical, pathological and prognostic characteristics of PC 458,918 new cases and 432,242 deaths in 2018 (1).
  • Myopia in African Americans Is Significantly Linked to Chromosome 7P15.2-14.2

    Myopia in African Americans Is Significantly Linked to Chromosome 7P15.2-14.2

    Genetics Myopia in African Americans Is Significantly Linked to Chromosome 7p15.2-14.2 Claire L. Simpson,1,2,* Anthony M. Musolf,2,* Roberto Y. Cordero,1 Jennifer B. Cordero,1 Laura Portas,2 Federico Murgia,2 Deyana D. Lewis,2 Candace D. Middlebrooks,2 Elise B. Ciner,3 Joan E. Bailey-Wilson,1,† and Dwight Stambolian4,† 1Department of Genetics, Genomics and Informatics and Department of Ophthalmology, University of Tennessee Health Science Center, Memphis, Tennessee, United States 2Computational and Statistical Genomics Branch, National Human Genome Research Institute, National Institutes of Health, Baltimore, Maryland, United States 3The Pennsylvania College of Optometry at Salus University, Elkins Park, Pennsylvania, United States 4Department of Ophthalmology, University of Pennsylvania, Philadelphia, Pennsylvania, United States Correspondence: Joan E. PURPOSE. The purpose of this study was to perform genetic linkage analysis and associ- Bailey-Wilson, NIH/NHGRI, 333 ation analysis on exome genotyping from highly aggregated African American families Cassell Drive, Suite 1200, Baltimore, with nonpathogenic myopia. African Americans are a particularly understudied popula- MD 21131, USA; tion with respect to myopia. [email protected]. METHODS. One hundred six African American families from the Philadelphia area with a CLS and AMM contributed equally to family history of myopia were genotyped using an Illumina ExomePlus array and merged this work and should be considered co-first authors. with previous microsatellite data. Myopia was initially measured in mean spherical equiv- JEB-W and DS contributed equally alent (MSE) and converted to a binary phenotype where individuals were identified as to this work and should be affected, unaffected, or unknown.
  • Investigation of the Underlying Hub Genes and Molexular Pathogensis in Gastric Cancer by Integrated Bioinformatic Analyses

    Investigation of the Underlying Hub Genes and Molexular Pathogensis in Gastric Cancer by Integrated Bioinformatic Analyses

    bioRxiv preprint doi: https://doi.org/10.1101/2020.12.20.423656; this version posted December 22, 2020. The copyright holder for this preprint (which was not certified by peer review) is the author/funder. All rights reserved. No reuse allowed without permission. Investigation of the underlying hub genes and molexular pathogensis in gastric cancer by integrated bioinformatic analyses Basavaraj Vastrad1, Chanabasayya Vastrad*2 1. Department of Biochemistry, Basaveshwar College of Pharmacy, Gadag, Karnataka 582103, India. 2. Biostatistics and Bioinformatics, Chanabasava Nilaya, Bharthinagar, Dharwad 580001, Karanataka, India. * Chanabasayya Vastrad [email protected] Ph: +919480073398 Chanabasava Nilaya, Bharthinagar, Dharwad 580001 , Karanataka, India bioRxiv preprint doi: https://doi.org/10.1101/2020.12.20.423656; this version posted December 22, 2020. The copyright holder for this preprint (which was not certified by peer review) is the author/funder. All rights reserved. No reuse allowed without permission. Abstract The high mortality rate of gastric cancer (GC) is in part due to the absence of initial disclosure of its biomarkers. The recognition of important genes associated in GC is therefore recommended to advance clinical prognosis, diagnosis and and treatment outcomes. The current investigation used the microarray dataset GSE113255 RNA seq data from the Gene Expression Omnibus database to diagnose differentially expressed genes (DEGs). Pathway and gene ontology enrichment analyses were performed, and a proteinprotein interaction network, modules, target genes - miRNA regulatory network and target genes - TF regulatory network were constructed and analyzed. Finally, validation of hub genes was performed. The 1008 DEGs identified consisted of 505 up regulated genes and 503 down regulated genes.