1 2 3 Two locus inheritance of non-syndromic midline craniosynostosis via rare SMAD6 and 4 common BMP2 alleles 5 6 Andrew T. Timberlake1-3, Jungmin Choi1,2, Samir Zaidi1,2, Qiongshi Lu4, Carol Nelson- 7 Williams1,2, Eric D. Brooks3, Kaya Bilguvar1,5, Irina Tikhonova5, Shrikant Mane1,5, Jenny F. 8 Yang3, Rajendra Sawh-Martinez3, Sarah Persing3, Elizabeth G. Zellner3, Erin Loring1,2,5, Carolyn 9 Chuang3, Amy Galm6, Peter W. Hashim3, Derek M. Steinbacher3, Michael L. DiLuna7, Charles 10 C. Duncan7, Kevin A. Pelphrey8, Hongyu Zhao4, John A. Persing3, Richard P. Lifton1,2,5,9 11 12 1Department of Genetics, Yale University School of Medicine, New Haven, CT, USA 13 2Howard Hughes Medical Institute, Yale University School of Medicine, New Haven, CT, USA 14 3Section of Plastic and Reconstructive Surgery, Department of Surgery, Yale University School of Medicine, New Haven, CT, USA 15 4Department of Biostatistics, Yale University School of Medicine, New Haven, CT, USA 16 5Yale Center for Genome Analysis, New Haven, CT, USA 17 6Craniosynostosis and Positional Plagiocephaly Support, New York, NY, USA 18 7Department of Neurosurgery, Yale University School of Medicine, New Haven, CT, USA 19 8Child Study Center, Yale University School of Medicine, New Haven, CT, USA 20 9The Rockefeller University, New York, NY, USA 21 22 ABSTRACT 23 Premature fusion of the cranial sutures (craniosynostosis), affecting 1 in 2,000 24 newborns, is treated surgically in infancy to prevent adverse neurologic outcomes. To 25 identify mutations contributing to common non-syndromic midline (sagittal and metopic) 26 craniosynostosis, we performed exome sequencing of 132 parent-offspring trios and 59 27 additional probands. Thirteen probands (7%) had damaging de novo or rare transmitted 28 mutations in SMAD6, an inhibitor of BMP – induced osteoblast differentiation (P < 10-20). 29 SMAD6 mutations nonetheless showed striking incomplete penetrance (<60%). 30 Genotypes of a common variant near BMP2 that is strongly associated with midline 31 craniosynostosis explained nearly all the phenotypic variation in these kindreds, with 32 highly significant evidence of genetic interaction between these loci via both association 33 and analysis of linkage. This epistatic interaction of rare and common variants defines 34 the most frequent cause of midline craniosynostosis and has implications for the genetic 35 basis of other diseases. 36 37 INTRODUCTION 38 The cranial sutures are not fused at birth, allowing for doubling of brain volume in the first year 39 of life and continued growth through adolescence1. The metopic suture normally closes between 40 6 and 12 months, while the sagittal, coronal, and lambdoid sutures typically fuse in adulthood1,2. 41 Premature fusion of any of these sutures can result in brain compression and suture-specific 42 craniofacial dysmorphism (Figure 1). Studies of syndromic forms of craniosynostosis, each with 43 prevalence of ~1/60,000 to 1/1,000,000 live births and collectively accounting for 15-20% of all 44 cases, have implicated mutations in more than 50 genes3,4. For example, mutations that 45 increase MAPK/ERK signaling (e.g. FGFR1-33,4, ERF5) cause rare syndromic coronal or 46 multisuture craniosynostosis, while mutations that perturb SMAD signaling (e.g. TGFBR1/26, 47 SKI7, RUNX28,9) cause rare syndromes involving the midline (sagittal and metopic) sutures. 48 While the detailed pathophysiology of premature suture fusion has not been elucidated, 49 aberrant signaling in cranial neural crest cells during craniofacial development has been 50 suggested as a common mechanism10,11. 51 52 Despite success in identifying the genes underlying rare syndromic craniosynostosis, mutations 53 in these genes are very rarely found in their non-syndromic counterparts12. Non-syndromic 54 craniosynostosis of the midline sutures account for 50% of all craniosynostosis13,14. A GWAS of 55 non-syndromic sagittal craniosynostosis has implicated common variants in a segment of a 56 gene desert ~345 kb downstream of BMP2, and within an intron of BBS9; these risk alleles 57 have unusually large effect (odds ratios > 4 at each locus)15. Nonetheless, rare alleles with 58 large effect have not been identified to date in non-syndromic sagittal or metopic 59 craniosynostosis. We considered that the often sporadic occurrence of non-syndromic 60 craniosynostosis might frequently be attributable to de novo mutation or incomplete penetrance 61 of rare transmitted variants. 62 63 RESULTS 64 Exome sequencing of non-syndromic midline craniosynostosis. We recruited a cohort of 65 191 probands with non-syndromic midline craniosynostosis, including 132 parent-offspring trios 66 and 59 probands with one parent, along with selected extended family members (see Methods). 67 All probands had undergone reconstructive surgery for either isolated sagittal (n=113), metopic 68 (n=70) or combined sagittal and metopic (n=8) craniosynostosis. Seventeen kindreds had 1 to 3 69 additional affected family members, including 7 parents, 12 siblings, 3 aunts/uncles and 4 more 70 distant relatives of probands. DNA was prepared from buccal swab samples. Exome 71 sequencing was performed as described in Methods; summary data is shown in Supplementary 72 File 1A. Variants were called using the GATK pipeline (see Methods) and de novo mutations in 73 parent-offspring trios were called using TrioDeNovo16. The impact of identified missense 74 variants on protein function was inferred using MetaSVM17. All de novo calls were verified by in 75 silico visualization of aligned reads (Figure 2- Figure Supplement 1), and all calls contributing to 76 significant results for individual genes were verified by direct Sanger sequencing. 77 78 We identified a total of 144 de novo mutations, providing a de novo mutation rate of 1.64 x 10-8 79 per base pair, and 1.09 de novo mutations in the coding region per offspring, consistent with 80 prior experimental results and expectation18,19 (Table 1). Comparison of the observed 81 distribution of mutation types to the expected from the Poisson distribution demonstrated 82 significant enrichment of protein-altering mutations, predominantly accounted for by an excess 83 of damaging missense mutations (MetaSVM D-mis; 28 observed D-mis compared to 14.5 84 expected, P = 1.0 x 10-3, 1.93-fold enrichment), with a corresponding paucity of silent mutations 85 (21 compared to 40.4 expected, P = 3.0 x 10-4). From the difference in the observed vs. 86 expected number of de novo protein-altering mutations per subject, we infer that these de novo 87 mutations contribute to ~15% of non-syndromic midline craniosynostosis. 88 89 De novo and transmitted mutations in SMAD6. Analysis of de novo mutation burden 90 revealed that a single gene, SMAD6, harbored three de novo mutations, including two inferred 91 loss of function (LOF) mutations (p.Q78fs*41 and p.E374*) and one D-mis mutation (p.G390C). 92 All three were heterozygous and occurred in families in which the proband was the sole affected 93 member. Two de novo mutations occurred in probands and one occurred in an unaffected 94 mother of a proband (Figure 2). All three de novo mutations were confirmed by Sanger 95 sequencing of PCR amplicons containing the putative mutation (Figure 2- Figure Supplement 96 2). TTN, which encodes the largest human protein, was the only other gene with more than one 97 protein altering de novo mutation, and both of these were predicted by MetaSVM to encode 98 tolerated variants (p.I3580M, p.T19373S). From the prior probability of de novo mutation of each 99 base in SMAD6 and the impact on the encoded protein20, the probability of seeing at least two 100 de novo LOFs and one missense mutation by chance in a cohort of this size was 3.6 x 10-9 101 (Table 2). Similarly, observing two or more de novo LOF mutations in any gene in this cohort 102 was not expected by chance (P=8.4 x 10-3, see Methods). Lastly, SMAD6 is not unusually 103 mutable, as we found no de novo SMAD6 mutations in 900 control trios comprising healthy 104 siblings of individuals with autism21-23. These findings provide highly significant evidence 105 implicating damaging mutations in SMAD6 as a cause of midline suture craniosynostosis. 106 107 We next considered the total burden of rare (prospectively specified allele frequency in ExAC 108 database < 2 x 10-5) LOF and D-mis mutations in each gene in probands. Among 191 probands, 109 we found 1135 rare LOF and 3156 rare damaging (LOF + D-mis) alleles. The probability of the 110 observed number of rare variants in each gene occurring by chance was calculated from the 111 binomial distribution after adjusting for the length of each gene; Q-Q plots comparing the 112 observed and expected P-value distributions are shown in Figure 3. The observed distribution 113 conforms closely to expected with the exception of SMAD6. The expected number of rare LOF 114 alleles in SMAD6 in probands was 0.05, and the observed number was 8 (P = 1.1 x 10-15, 156- 115 fold enrichment). Similarly, there were 13 rare damaging variants in SMAD6 compared to 0.14 116 expected (P = 1.3 x 10-21, 91.4-fold enrichment). All of these SMAD6 variants were confirmed by 117 direct Sanger sequencing (Figure 2- Figure Supplement 2). All were heterozygous and different 118 from one another (Figure 2- Source Data 1); 11 were absent among >105 alleles in the ExAC 119 database, while two were previously seen, each once in ExAC (p.E407* and p.R465C, ExAC 120 allele frequencies 9.0 x 10-6 and 9.4 x 10-6 respectively). The results for SMAD6 remain highly 121 significant after excluding de novo mutations and only analyzing transmitted variants (Figure 3- 122 Figure Supplement 1), demonstrating significant contribution of both de novo and transmitted 123 variants (Table 3). The fact that eight of the 13 rare heterozygous damaging variants in SMAD6 124 seen in our cohort are frameshift (n = 5) or premature termination (n = 3) mutations, which are 125 distributed throughout the encoded protein (Figure 2a), strongly supports haploinsufficiency as 126 the mechanism of the genetic contribution of SMAD6 to craniosynostosis. 127 128 Lastly, we compared the frequency of rare (allele frequency <2 x 10-5 in the ExAC database) 129 damaging (LOF + D-mis) variants in all genes in 172 European probands and 3,337 unrelated 130 European controls, who were parents of autism probands sequenced to a similar depth of 131 coverage and analyzed in a similar fashion (see Methods, Supplementary File 1A). European 132 ancestry was determined by principal component analysis of exome sequence data (Figure 3- 133 Figure Supplement 2). Q-Q plots showed that the observed distribution of Fisher’s exact 134 statistics comparing the frequency of damaging variants in cases and controls closely 135 corresponded to the expected distribution, again with the exception of SMAD6, in which cases 136 showed enrichment of damaging variants (P = 6.3 x 10-8) and LOF variants (P = 5.7 x 10-6) 137 (Figure 3- Figure Supplement 3). Significant enrichment was also seen in comparison to 138 European NHLBI and ExAC controls (Figure 3- Source Data 1). The odds ratios for association 139 of all damaging variants in SMAD6 in cases vs. controls was consistent across control cohorts, 140 ranging from 26.9 to 35.1; the odds ratios for LOFs ranged from 102.6 to infinity (owing to zero 141 LOF’s in autism controls). 142 143 Aside from SMAD6, no other single gene approached genome-wide significance in these 144 analyses of dominant alleles. Analysis of recessive genotypes, considering alleles with 145 frequency < 10-3, identified no genes with more than one rare recessive genotype. 146 147 Collectively, the significant burden of both de novo and rare transmitted mutations, along with 148 significant association results in case-control analysis provide extremely strong evidence that 149 rare damaging SMAD6 alleles impart large effects on risk of non-syndromic midline 150 craniosynostosis. 151 152 SMAD6 mutations were significantly more frequent in kindreds with any metopic 153 craniosynostosis (10 of 78, 12.8%) compared to those with isolated sagittal craniosynostosis (3 154 of 113, 2.7%; P = 8.1 x 10-3 by Fisher’s exact test, odds ratio 5.3). These results suggest that 155 mutations in SMAD6 confer greater risk for metopic suture closure. We found no significant 156 correlation between the type of mutation (LOF vs. D-mis) or location within the gene of SMAD6 157 mutation and phenotypic class (Table 4). 158 159 Interestingly, transmitted SMAD6 mutations were significantly enriched in kindreds with familial 160 craniosynostosis, accounting for 4 of 17 kindreds with more than one affected subject (P = 0.02, 161 Fisher’s exact test; odds ratio 5.6). In these kindreds, all four additional affected subjects carried 162 the SMAD6 mutation found in the proband (Figure 2). 163 164 SMAD6 is a member of the inhibitory-SMAD family. Activation of BMP receptors leads to 165 phosphorylation of receptor SMADs, which can complex with SMAD4, translocate to the nucleus 166 and partner with RUNX2 to induce transcription of genes that promote osteoblast 167 differentiation9,24 (Figure 4a). This process is inhibited by SMAD6 binding to phosphorylated 168 receptor SMADs, forming an inactive complex. SMAD6 also inhibits BMP signaling by 169 complexing with the ubiquitin ligase SMURF1, which ubiquitylates BMP receptors, receptor 170 SMADs and RUNX2, leading to their proteasomal degradation (Figure 4b)25. This pathway plays 171 a well-established role in development of the cranial vault and closure of cranial sutures. In 172 mice, constitutive activity of BMPR1A in cranial neural crest results in SMAD-dependent 173 development of metopic craniosynostosis11, and genetic deficiency for the SMAD inhibitor 174 SMURF1 causes midline craniosynostosis26. Similarly, duplication of RUNX2 causes syndromic 175 metopic craniosynostosis in humans8. Lastly, SMAD6 knockout mice are born with domed skulls 176 and show anomalous bone deposition in the metopic suture; they also show an augmented and 177 prolonged response to BMP2 stimulation27,28. These findings are consistent with 178 haploinsufficiency as the mechanism of SMAD6 mutations in craniosynostosis, with loss of the 179 inhibitory effect of SMAD6 promoting increased BMP signaling and premature closure of 180 sutures. 181 182 We explored our kindreds for other mutations in this signaling pathway. Interestingly, we 183 identified one de novo D-mis mutation in SMURF1 in a proband with sporadic metopic 184 craniosynostosis (Figure 5). 185 186 Incomplete penetrance of SMAD6 mutations explained by a common variant near BMP2. 187 Within the 13 kindreds harboring rare damaging SMAD6 variants, all 17 affected subjects had 188 the SMAD6 mutation found in the proband (Figure 2). Nonetheless, SMAD6 mutations showed 189 striking incomplete penetrance. In particular, zero of 10 parental SMAD6 mutation carriers had a 190 diagnosis of, or showed evidence of craniosynostosis. Examination of Illumina read counts and 191 Sanger sequence traces provided no suggestion that the mutations were mosaic in unaffected 192 parents (mean/median of 52.9%/52.4% variant reads in transmitting parents, respectively; range 193 37.3% to 71.4%). There was no significant effect of gender on penetrance. From the data in 194 these kindreds, the penetrance of SMAD6 mutations is estimated at 24% following exclusion of 195 probands, who were ascertained for the presence of disease (57% if probands are included). 196 The striking absence of craniosynostosis among transmitting parents suggests the possibility of 197 purifying selection, with subjects having craniosynostosis less likely to have offspring. 198 199 We considered whether inheritance at other genetic loci might account for the striking 200 incomplete penetrance of SMAD6 mutations in these kindreds. A previous GWAS of non- 201 syndromic sagittal craniosynostosis implicated common variants ~345 kb downstream of the 202 closest gene, BMP2 (encoding bone morphogenetic protein 2), with unusually large effect size 203 (e.g., rs1884302, with risk allele frequency of 0.34 and odds ratio of 4.6). BMP2 is a ligand for 204 BMP receptors upstream of SMAD signaling29 and is an inducer of osteogenesis. We posited 205 that risk alleles at this locus might increase the penetrance of SMAD6 mutations by increasing 206 BMP2 levels and further increasing SMAD signaling. Genotypes for rs1884302 are shown in 207 Figure 2 and provide strong evidence of epistatic interaction between SMAD6 and BMP2 208 alleles. Fourteen individuals had both a SMAD6 mutation and the rs1884302 risk allele; 100% of 209 these had craniosynostosis. In contrast, 16 subjects had a SMAD6 mutation but no rs1884302 210 risk allele; only 3 of these individuals (19%) had craniosynostosis. Lastly, 0 of 18 members of 211 these kindreds who had only the rs1884302 risk allele had craniosynostosis. The relationship of 212 these two genotypes to craniosynostosis in these kindreds was highly significant (P = 1.4 x 10-10 213 by the Freeman-Halton extension of Fisher’s exact test; Table 5). 214 215 Confining analysis just to subjects with SMAD6 mutation, there was dramatically increased 216 occurrence of craniosynostosis among those with the rs1884302 risk allele compared to those 217 without (P = 4.8 x 10-6 by Fisher’s exact test). The presence of the rs1884302 risk allele 218 increased the risk of craniosynostosis >5-fold with a very high odds ratio that includes infinity 219 owing to 100% penetrance among those with risk genotypes at both loci. This two locus 220 contribution is further supported by significant transmission disequilibrium, with rs1884302 risk 221 alleles transmitted from heterozygous parents to affected offspring in 11 of 13 transmissions (P 222 = 0.013 by Chi-square, Supplementary File 1B). In sum, inheritance at rs1884302 explains 223 nearly all of the variation in phenotype among subjects with SMAD6 mutations and 224 demonstrates two locus transmission of craniosynostosis. 225 226 In contrast, common variants at the BBS9 locus that also showed strong association with 227 midline craniosynostosis in case-control analysis (OR > 4)15 showed no significant interaction 228 with SMAD6 (TDT P=0.89; Supplementary File 1B), demonstrating specificity of the observed 229 interaction of rare variants in SMAD6 and a common variant near BMP2. 230 231 Lastly, we compared the joint segregation of rare damaging SMAD6 and common BMP2 risk 232 alleles to the segregation of craniosynostosis in a parametric two locus linkage model in these 233 kindreds (see Methods, Supplementary File 1C). The results provided extremely strong 234 evidence supporting linkage under a two locus model, with a maximum lod score of 7.37 (odds 235 ratio 2.3 x 107:1 in favor of linkage compared to the null hypothesis; family-specific lod scores 236 are shown in Supplementary File 1D). The maximum likelihood model specified 100% 237 penetrance of craniosynostosis when risk alleles at both loci are present, 9% penetrance when 238 only a damaging SMAD6 allele is present, 0.08% or 0.32% penetrance when only one or two 239 BMP2 risk alleles are present, and a 0.02% phenocopy rate, with zero recombination between 240 trait and both marker loci. This two locus model was 1,410 – fold more likely than than the best 241 single locus model, in which damaging SMAD6 variants had penetrance of 20%. These results 242 provide extremely strong statistical support for the two locus model by linkage and extends the 243 genetic evidence beyond simple association to linkage within pedigrees, which is not 244 susceptible to potential confounders such as population stratification, and is insensitive to 245 misspecification of allele frequency. 246 247 Mutations in MAP kinase regulators. Previous research has implicated increased activity of 248 the MAP kinase/ERK pathway in craniosynostosis5,30. We identified one de novo LOF in both 249 SPRY1 and SPRY4, developmental regulators of the MAP kinase/ERK pathway; these variants 250 comprised two of only 11 de novo LOFs other than those in SMAD6. The SPRY4 mutation 251 (p.E160*) arose de novo in a proband with sagittal craniosynostosis and no family history 252 (Figure 6a). The SPRY1 mutation (p.Q6fs*8) was de novo in a woman with mild cranial 253 dysmorphism who did not undergo surgery, and was transmitted to both of her children, who 254 both had sagittal craniosynostosis (Figure 6b). The probability of observing two or more de novo 255 LOF mutations in any of the 4 Sprouty genes by chance in this cohort surpassed genome-wide 256 significance (P= 7.1 x 10-7, Table 2). Consistent with a role for SPRY1 haploinsufficiency, a de 257 novo microdeletion that included SPRY1 has previously been reported in a child with sagittal 258 craniosynostosis31. Moreover, in mice with TWIST1 haploinsufficiency, a model of syndromic 259 craniosynostosis, overexpression of SPRY1 prevents suture fusion32. Lastly, protein altering de 260 novo mutations were also identified in other regulators and mediators of MAP kinase signaling, 261 including RASAL2, DUSP5, MAP3K8, KSR2, RPS6KA4, and RGS3. 5 of 6 occurred in 262 probands with sagittal craniosynostosis (Table 1- Source Data 1). Determining the significance 263 of these findings will require further study. 264 265 DISCUSSION 266 These findings implicate a two locus model of inheritance in non-syndromic midline 267 craniosynostosis via epistatic interactions of rare heterozygous SMAD6 mutations and common 268 risk alleles near BMP2. There is extremely strong evidence implicating each locus 269 independently, along with highly significant evidence from both analysis of association and 270 linkage that the risk of craniosynostosis is markedly increased in individuals carrying risk alleles 271 at both loci compared to those with only a single risk allele at either locus. Rare damaging 272 variants in SMAD6 alone impart very large effects on disease risk with low penetrance, with 273 inheritance at BMP2 explaining nearly all of the variation in occurrence of craniosynostosis seen 274 among SMAD6 mutation carriers. The results support a threshold effect model, with quantitative 275 increases in SMAD signaling resulting from reduced inhibition of SMAD signaling by SMAD6, 276 owing to haploinsufficiency (strongly supported by a plethora of LOF variants distributed across 277 SMAD6), along with a putative increase in SMAD signaling owing to increased BMP2 278 expression via the risk SNP rs1884302 leading to accelerated closure of midline sutures. 279 Consistent with this model, as articulated previously, substantial prior evidence in mouse and 280 human has implicated BMP signaling via SMADs in closure of the midline sutures, and SMAD6 281 in inhibiting this pathway. Moreover, consistent with the common variant near BMP2 modifying 282 BMP2 expression, duplication of a nearby limb-specific enhancer increased BMP2 expression, 283 leading to a Mendelian limb defect33. While the genetic data provide unequivocal support for the 284 role of these two loci in midline craniosynostosis, and for haploinsufficiency as the mechanism 285 of SMAD6 contribution, further studies will be necessary to delineate the precise mechanism by 286 which the risk genotypes cause disease. 287 288 SMAD6 mutations with and without BMP2 risk alleles account for ~7% of probands in this cohort 289 of non-syndromic midline craniosynostosis. This frequency is much greater than any other 290 genotype causing syndromic midline craniosynostosis (e.g., TGFBR1/2, SKI, RUNX2), which 291 are sufficiently rare that their prevalence has not been well-established. Moreover, because 292 non-syndromic sagittal and metopic craniosynostosis comprise half of all craniosynostoses13,14, 293 SMAD6/BMP2 genotypes are inferred to account for ~3.5% of all craniosynostosis, and are 294 likely rivaled in frequency only by mutations in FGFR2 as the most frequent cause of all 295 craniosynostoses3. 296 297 These findings will be of immediate utility in clinical diagnosis and genetic counseling. The 298 combination of a rare damaging SMAD6 mutation plus a common BMP2 risk allele conferred 299 100% risk of craniosynostosis in our cohort, while those with a SMAD6 mutation but no BMP2 300 risk allele were at markedly lower risk. Interestingly, these SMAD6 mutation-only cases thus far 301 have all had isolated metopic craniosynostosis (Figure 2). Rare damaging SMAD6 mutations 302 were found in nearly 25% of kindreds with recurrent midline craniosynostosis, and 37.5% of 303 patients with combined sagittal and metopic craniosynostosis in our cohort. The precision of 304 penetrance estimates and prevalence in specific disease subsets will improve with larger 305 sample sizes. 306 307 Given the suggestion of a threshold for phenotypic effect, we also considered whether there 308 might be additional SMAD6 alleles that impart phenotypic effect that have higher frequency than 309 the 2 x 10-5 threshold that we used. We found only one additional SMAD6 damaging allele 310 among parents in our cohort with allele frequency < 0.001. Interestingly, this allele, p.E287K, 311 (ExAC frequency 3.3 x 10-5) was transmitted to a proband with sagittal and metopic 312 craniosynostosis along with two doses of the BMP risk allele, each inherited from a 313 heterozygous parent. 314 315 Considering neurodevelopmental outcomes, 11 of 15 subjects with rare damaging SMAD6 316 variants who are more than one year of age (and hence can have neurodevelopmental 317 evaluation) had some form of developmental delay (Supplementary File 1E). While early 318 surgical intervention provides the best neurological outcomes34, more than a third of patients 319 with non-syndromic midline craniosynostosis have subtle learning disability35-37. BMP signaling 320 plays an essential role in vertebrate brain development38, raising the possibility that aberrant 321 BMP signaling could contribute to neurodevelopmental outcome independent of its effect on 322 craniosynostosis. The only other clinical finding observed in more than one subject with SMAD6 323 mutation was congenital inguinal hernia in 3 patients (16.7%; Supplementary File 1E). 324 325 While SMAD6 was the only single gene showing genome-wide significant burden of de novo 326 mutation, de novo protein-altering mutations are estimated to contribute to ~15% of cases. This 327 estimated fraction is similar to estimates for autism and congenital heart disease, other diseases 328 in which large-scale studies have shown a role for de novo mutations19,21,23,39,40. Also like autism 329 and congenital heart disease, few individual genes were implicated after sequencing modest 330 numbers of trios, implying that de novo mutation in a large number of genes are likely to 331 contribute to sagittal and metopic craniosynostosis. This observation strongly supports 332 sequencing substantially larger numbers of non-syndromic patients, an approach that has 333 proved highly productive for discovery of genes and pathways underlying autism and CHD. 334 335 Lastly, these results provide a clear example of the epistatic (non-additive) interaction of very 336 rare mutations at one locus with a common variant at a second, unlinked locus. This 337 observation adds to the small number of two locus phenotypes that have been defined with 338 robust genetic data41, and suggest that other common variants, particularly those with relatively 339 large effect, may combine with rare alleles at one or more loci to produce genotypes with high 340 penetrance that together may account for a substantial fraction of disease risk. 341 References 342 1. Persing, J.A., Jane, J.A., Edgerton, M.T. Surgical treatment of craniosynostosis. in 343 Scientific foundations and surgical treatment of craniosynostosis. 117-238 (Williams and 344 Wilkins, Baltimore, 1989). 345 2. Weinzweig, J., Kirschner, R.E., Farley, A., Reiss, P., Hunter, J., Whitaker, L.A. & Bartlett, 346 S.P. Metopic synostosis: Defining the temporal sequence of normal suture fusion and 347 differentiating it from synostosis on the basis of computed tomography images. Plast 348 Reconstr Surg 112, 1211-8 (2003). 349 3. Twigg, S.R. & Wilkie, A.O. A Genetic-Pathophysiological Framework for 350 Craniosynostosis. Am J Hum Genet 97, 359-77 (2015). 351 4. Flaherty, K., Singh, N. & Richtsmeier, J.T. Understanding craniosynostosis as a growth 352 disorder. Wiley Interdiscip Rev Dev Biol (2016). 353 5. Twigg, S.R., Vorgia, E., McGowan, S.J., Peraki, I., Fenwick, A.L., Sharma, V.P., Allegra, 354 M., Zaragkoulias, A., Sadighi Akha, E., Knight, S.J., Lord, H., Lester, T., Izatt, L., Lampe, 355 A.K., Mohammed, S.N., Stewart, F.J., Verloes, A., Wilson, L.C., Healy, C., Sharpe, P.T., 356 Hammond, P., Hughes, J., Taylor, S., Johnson, D., Wall, S.A., Mavrothalassitis, G. & 357 Wilkie, A.O. Reduced dosage of ERF causes complex craniosynostosis in humans and 358 mice and links ERK1/2 signaling to regulation of osteogenesis. Nat Genet 45, 308-13 359 (2013). 360 6. Loeys, B.L., Chen, J., Neptune, E.R., Judge, D.P., Podowski, M., Holm, T., Meyers, J., 361 Leitch, C.C., Katsanis, N., Sharifi, N., Xu, F.L., Myers, L.A., Spevak, P.J., Cameron, 362 D.E., De Backer, J., Hellemans, J., Chen, Y., Davis, E.C., Webb, C.L., Kress, W., 363 Coucke, P., Rifkin, D.B., De Paepe, A.M. & Dietz, H.C. A syndrome of altered 364 cardiovascular, craniofacial, neurocognitive and skeletal development caused by 365 mutations in TGFBR1 or TGFBR2. Nat Genet 37, 275-81 (2005). 366 7. Doyle, A.J., Doyle, J.J., Bessling, S.L., Maragh, S., Lindsay, M.E., Schepers, D., Gillis, 367 E., Mortier, G., Homfray, T., Sauls, K., Norris, R.A., Huso, N.D., Leahy, D., Mohr, D.W., 368 Caulfield, M.J., Scott, A.F., Destree, A., Hennekam, R.C., Arn, P.H., Curry, C.J., Van 369 Laer, L., McCallion, A.S., Loeys, B.L. & Dietz, H.C. Mutations in the TGF-beta repressor 370 SKI cause Shprintzen-Goldberg syndrome with aortic aneurysm. Nat Genet 44, 1249-54 371 (2012). 372 8. Mefford, H.C., Shafer, N., Antonacci, F., Tsai, J.M., Park, S.S., Hing, A.V., Rieder, M.J., 373 Smyth, M.D., Speltz, M.L., Eichler, E.E. & Cunningham, M.L. Copy number variation 374 analysis in single-suture craniosynostosis: multiple rare variants including RUNX2 375 duplication in two cousins with metopic craniosynostosis. Am J Med Genet A 152A, 376 2203-10 (2010). 377 9. Javed, A., Bae, J.S., Afzal, F., Gutierrez, S., Pratap, J., Zaidi, S.K., Lou, Y., van Wijnen, 378 A.J., Stein, J.L., Stein, G.S. & Lian, J.B. Structural coupling of Smad and Runx2 for 379 execution of the BMP2 osteogenic signal. J Biol Chem 283, 8412-22 (2008). 380 10. Mishina, Y. & Snider, T.N. Neural crest cell signaling pathways critical to cranial bone 381 development and pathology. Exp Cell Res 325, 138-47 (2014). 382 11. Komatsu, Y., Yu, P.B., Kamiya, N., Pan, H., Fukuda, T., Scott, G.J., Ray, M.K., 383 Yamamura, K. & Mishina, Y. Augmentation of Smad-dependent BMP signaling in neural 384 crest cells causes craniosynostosis in mice. J Bone Miner Res 28, 1422-33 (2013). 385 12. Boyadjiev, S.A. & International Craniosynostosis, C. Genetic analysis of non-syndromic 386 craniosynostosis. Orthod Craniofac Res 10, 129-37 (2007). 387 13. Slater, B.J., Lenton, K.A., Kwan, M.D., Gupta, D.M., Wan, D.C. & Longaker, M.T. Cranial 388 sutures: a brief review. Plast Reconstr Surg 121, 170e-8e (2008). 389 14. Greenwood, J., Flodman, P., Osann, K., Boyadjiev, S.A. & Kimonis, V. Familial 390 incidence and associated symptoms in a population of individuals with nonsyndromic 391 craniosynostosis. Genet Med 16, 302-10 (2014). 392 15. Justice, C.M., Yagnik, G., Kim, Y., Peter, I., Jabs, E.W., Erazo, M., Ye, X., Ainehsazan, 393 E., Shi, L., Cunningham, M.L., Kimonis, V., Roscioli, T., Wall, S.A., Wilkie, A.O., Stoler, 394 J., Richtsmeier, J.T., Heuze, Y., Sanchez-Lara, P.A., Buckley, M.F., Druschel, C.M., 395 Mills, J.L., Caggana, M., Romitti, P.A., Kay, D.M., Senders, C., Taub, P.J., Klein, O.D., 396 Boggan, J., Zwienenberg-Lee, M., Naydenov, C., Kim, J., Wilson, A.F. & Boyadjiev, S.A. 397 A genome-wide association study identifies susceptibility loci for nonsyndromic sagittal 398 craniosynostosis near BMP2 and within BBS9. Nat Genet 44, 1360-4 (2012). 399 16. Wei, Q., Zhan, X., Zhong, X., Liu, Y., Han, Y., Chen, W. & Li, B. A Bayesian framework 400 for de novo mutation calling in parents-offspring trios. Bioinformatics 31, 1375-81 (2015). 401 17. Dong, C., Wei, P., Jian, X., Gibbs, R., Boerwinkle, E., Wang, K. & Liu, X. Comparison 402 and integration of deleteriousness prediction methods for nonsynonymous SNVs in 403 whole exome sequencing studies. Hum Mol Genet 24, 2125-37 (2015). 404 18. Ware, J.S., Samocha, K.E., Homsy, J. & Daly, M.J. Interpreting de novo Variation in 405 Human Disease Using denovolyzeR. Curr Protoc Hum Genet 87, 7 25 1-7 25 15 (2015). 406 19. Homsy, J., Zaidi, S., Shen, Y., Ware, J.S., Samocha, K.E., Karczewski, K.J., DePalma, 407 S.R., McKean, D., Wakimoto, H., Gorham, J., Jin, S.C., Deanfield, J., Giardini, A., 408 Porter, G.A., Jr., Kim, R., Bilguvar, K., Lopez-Giraldez, F., Tikhonova, I., Mane, S., 409 Romano-Adesman, A., Qi, H., Vardarajan, B., Ma, L., Daly, M., Roberts, A.E., Russell, 410 M.W., Mital, S., Newburger, J.W., Gaynor, J.W., Breitbart, R.E., Iossifov, I., Ronemus, 411 M., Sanders, S.J., Kaltman, J.R., Seidman, J.G., Brueckner, M., Gelb, B.D., Goldmuntz, 412 E., Lifton, R.P., Seidman, C.E. & Chung, W.K. De novo mutations in congenital heart 413 disease with neurodevelopmental and other congenital anomalies. Science 350, 1262-6 414 (2015). 415 20. Samocha, K.E., Robinson, E.B., Sanders, S.J., Stevens, C., Sabo, A., McGrath, L.M., 416 Kosmicki, J.A., Rehnstrom, K., Mallick, S., Kirby, A., Wall, D.P., MacArthur, D.G., 417 Gabriel, S.B., DePristo, M., Purcell, S.M., Palotie, A., Boerwinkle, E., Buxbaum, J.D., 418 Cook, E.H., Jr., Gibbs, R.A., Schellenberg, G.D., Sutcliffe, J.S., Devlin, B., Roeder, K., 419 Neale, B.M. & Daly, M.J. A framework for the interpretation of de novo mutation in 420 human disease. Nat Genet 46, 944-50 (2014). 421 21. Iossifov, I., O'Roak, B.J., Sanders, S.J., Ronemus, M., Krumm, N., Levy, D., Stessman, 422 H.A., Witherspoon, K.T., Vives, L., Patterson, K.E., Smith, J.D., Paeper, B., Nickerson, 423 D.A., Dea, J., Dong, S., Gonzalez, L.E., Mandell, J.D., Mane, S.M., Murtha, M.T., 424 Sullivan, C.A., Walker, M.F., Waqar, Z., Wei, L., Willsey, A.J., Yamrom, B., Lee, Y.H., 425 Grabowska, E., Dalkic, E., Wang, Z., Marks, S., Andrews, P., Leotta, A., Kendall, J., 426 Hakker, I., Rosenbaum, J., Ma, B., Rodgers, L., Troge, J., Narzisi, G., Yoon, S., Schatz, 427 M.C., Ye, K., McCombie, W.R., Shendure, J., Eichler, E.E., State, M.W. & Wigler, M. 428 The contribution of de novo coding mutations to autism spectrum disorder. Nature 515, 429 216-21 (2014). 430 22. O'Roak, B.J., Deriziotis, P., Lee, C., Vives, L., Schwartz, J.J., Girirajan, S., Karakoc, E., 431 Mackenzie, A.P., Ng, S.B., Baker, C., Rieder, M.J., Nickerson, D.A., Bernier, R., Fisher, 432 S.E., Shendure, J. & Eichler, E.E. Exome sequencing in sporadic autism spectrum 433 disorders identifies severe de novo mutations. Nat Genet 43, 585-9 (2011). 434 23. Sanders, S.J., Murtha, M.T., Gupta, A.R., Murdoch, J.D., Raubeson, M.J., Willsey, A.J., 435 Ercan-Sencicek, A.G., DiLullo, N.M., Parikshak, N.N., Stein, J.L., Walker, M.F., Ober, 436 G.T., Teran, N.A., Song, Y., El-Fishawy, P., Murtha, R.C., Choi, M., Overton, J.D., 437 Bjornson, R.D., Carriero, N.J., Meyer, K.A., Bilguvar, K., Mane, S.M., Sestan, N., Lifton, 438 R.P., Gunel, M., Roeder, K., Geschwind, D.H., Devlin, B. & State, M.W. De novo 439 mutations revealed by whole-exome sequencing are strongly associated with autism. 440 Nature 485, 237-41 (2012). 441 24. Hata, A., Lagna, G., Massague, J. & Hemmati-Brivanlou, A. Smad6 inhibits BMP/Smad1 442 signaling by specifically competing with the Smad4 tumor suppressor. Genes Dev 12, 443 186-97 (1998). 444 25. Murakami, G., Watabe, T., Takaoka, K., Miyazono, K. & Imamura, T. Cooperative 445 inhibition of bone morphogenetic protein signaling by Smurf1 and inhibitory Smads. Mol 446 Biol Cell 14, 2809-17 (2003). 447 26. Shimazu, J., Wei, J. & Karsenty, G. Smurf1 Inhibits Osteoblast Differentiation, Bone 448 Formation, and Glucose Homeostasis through Serine 148. Cell Rep 15, 27-35 (2016). 449 27. Estrada, K.D., Retting, K.N., Chin, A.M. & Lyons, K.M. Smad6 is essential to limit BMP 450 signaling during cartilage development. J Bone Miner Res 26, 2498-510 (2011). 451 28. Retting, K.N. Smad proteins and the regulation of endochondral bone formation., 452 (University of California, Los Angeles, 2008). Available from ProQuest Dissertations & 453 Theses Global. (304651496). Retrieved from 454 http://search.proquest.com/docview/304651496. 455 29. Salazar, V.S., Gamer, L.W. & Rosen, V. BMP signalling in skeletal development, 456 disease and repair. Nat Rev Endocrinol 12, 203-21 (2016). 457 30. Shukla, V., Coumoul, X., Wang, R.H., Kim, H.S. & Deng, C.X. RNA interference and 458 inhibition of MEK-ERK signaling prevent abnormal skeletal phenotypes in a mouse 459 model of craniosynostosis. Nat Genet 39, 1145-50 (2007). 460 31. Fernandez-Jaen, A., Fernandez-Perrone, A.L., Fernandez-Mayoralas, D.M., Calleja- 461 Perez, B., Sanchez-Hombre Mdel, C., Fernandez, E.C. & Lopez-Martin, S. 462 Craniosynostosis, psychomotor retardation, and facial dysmorphic features in a Spanish 463 patient with a 4q27q28.3 deletion. Childs Nerv Syst 30, 2157-61 (2014). 464 32. Connerney, J., Andreeva, V., Leshem, Y., Mercado, M.A., Dowell, K., Yang, X., Lindner, 465 V., Friesel, R.E. & Spicer, D.B. Twist1 homodimers enhance FGF responsiveness of the 466 cranial sutures and promote suture closure. Dev Biol 318, 323-34 (2008). 467 33. Dathe, K., Kjaer, K.W., Brehm, A., Meinecke, P., Nurnberg, P., Neto, J.C., Brunoni, D., 468 Tommerup, N., Ott, C.E., Klopocki, E., Seemann, P. & Mundlos, S. Duplications 469 involving a conserved regulatory element downstream of BMP2 are associated with 470 brachydactyly type A2. Am J Hum Genet 84, 483-92 (2009). 471 34. Patel, A., Yang, J.F., Hashim, P.W., Travieso, R., Terner, J., Mayes, L.C., Kanev, P., 472 Duncan, C., Jane, J., Jr., Jane, J., Sr., Pollack, I., Losee, J.E., Bridgett, D.J. & Persing, 473 J.A. The impact of age at surgery on long-term neuropsychological outcomes in sagittal 474 craniosynostosis. Plast Reconstr Surg 134, 608e-17e (2014). 475 35. Magge, S.N., Westerveld, M., Pruzinsky, T. & Persing, J.A. Long-term 476 neuropsychological effects of sagittal craniosynostosis on child development. J 477 Craniofac Surg 13, 99-104 (2002). 478 36. Shipster, C., Hearst, D., Somerville, A., Stackhouse, J., Hayward, R. & Wade, A. 479 Speech, language, and cognitive development in children with isolated sagittal 480 synostosis. Dev Med Child Neurol 45, 34-43 (2003). 481 37. Sidoti, E.J., Jr., Marsh, J.L., Marty-Grames, L. & Noetzel, M.J. Long-term studies of 482 metopic synostosis: frequency of cognitive impairment and behavioral disturbances. 483 Plast Reconstr Surg 97, 276-81 (1996). 484 38. Bier, E. & De Robertis, E.M. EMBRYO DEVELOPMENT. BMP gradients: A paradigm for 485 morphogen-mediated developmental patterning. Science 348, aaa5838 (2015). 486 39. Zaidi, S., Choi, M., Wakimoto, H., Ma, L., Jiang, J., Overton, J.D., Romano-Adesman, A., 487 Bjornson, R.D., Breitbart, R.E., Brown, K.K., Carriero, N.J., Cheung, Y.H., Deanfield, J., 488 DePalma, S., Fakhro, K.A., Glessner, J., Hakonarson, H., Italia, M.J., Kaltman, J.R., 489 Kaski, J., Kim, R., Kline, J.K., Lee, T., Leipzig, J., Lopez, A., Mane, S.M., Mitchell, L.E., 490 Newburger, J.W., Parfenov, M., Pe'er, I., Porter, G., Roberts, A.E., Sachidanandam, R., 491 Sanders, S.J., Seiden, H.S., State, M.W., Subramanian, S., Tikhonova, I.R., Wang, W., 492 Warburton, D., White, P.S., Williams, I.A., Zhao, H., Seidman, J.G., Brueckner, M., 493 Chung, W.K., Gelb, B.D., Goldmuntz, E., Seidman, C.E. & Lifton, R.P. De novo 494 mutations in histone-modifying genes in congenital heart disease. Nature 498, 220-3 495 (2013). 496 40. De Rubeis, S., He, X., Goldberg, A.P., Poultney, C.S., Samocha, K., Cicek, A.E., Kou, 497 Y., Liu, L., Fromer, M., Walker, S., Singh, T., Klei, L., Kosmicki, J., Shih-Chen, F., 498 Aleksic, B., Biscaldi, M., Bolton, P.F., Brownfeld, J.M., Cai, J., Campbell, N.G., 499 Carracedo, A., Chahrour, M.H., Chiocchetti, A.G., Coon, H., Crawford, E.L., Curran, 500 S.R., Dawson, G., Duketis, E., Fernandez, B.A., Gallagher, L., Geller, E., Guter, S.J., 501 Hill, R.S., Ionita-Laza, J., Jimenz Gonzalez, P., Kilpinen, H., Klauck, S.M., Kolevzon, A., 502 Lee, I., Lei, I., Lei, J., Lehtimaki, T., Lin, C.F., Ma'ayan, A., Marshall, C.R., McInnes, A.L., 503 Neale, B., Owen, M.J., Ozaki, N., Parellada, M., Parr, J.R., Purcell, S., Puura, K., 504 Rajagopalan, D., Rehnstrom, K., Reichenberg, A., Sabo, A., Sachse, M., Sanders, S.J., 505 Schafer, C., Schulte-Ruther, M., Skuse, D., Stevens, C., Szatmari, P., Tammimies, K., 506 Valladares, O., Voran, A., Li-San, W., Weiss, L.A., Willsey, A.J., Yu, T.W., Yuen, R.K., 507 Study, D.D.D., Homozygosity Mapping Collaborative for, A., Consortium, U.K., Cook, 508 E.H., Freitag, C.M., Gill, M., Hultman, C.M., Lehner, T., Palotie, A., Schellenberg, G.D., 509 Sklar, P., State, M.W., Sutcliffe, J.S., Walsh, C.A., Scherer, S.W., Zwick, M.E., Barett, 510 J.C., Cutler, D.J., Roeder, K., Devlin, B., Daly, M.J. & Buxbaum, J.D. Synaptic, 511 transcriptional and chromatin genes disrupted in autism. Nature 515, 209-15 (2014). 512 41. Lupski, J.R. Digenic inheritance and Mendelian disease. Nat Genet 44, 1291-2 (2012). 513 514 MATERIALS AND METHODS 515 516 Subjects and samples. Participants were ascertained from either the Yale Pediatric 517 Craniofacial Clinic or by responding to an invitation posted on the Cranio Kids- Craniosynostosis 518 Support and Craniosynostosis-Positional Plagiocephaly Support Facebook pages. All 519 participants or their parents provided written informed consent to participate in a study of 520 genetic causes of craniosynostosis in their family. Inclusion criteria included diagnosis of sagittal 521 and/or metopic craniosynostosis in the absence of known syndromic forms of disease by a 522 craniofacial plastic surgeon or pediatric neurosurgeon. All probands had undergone 523 reconstructive surgery. Participating family members provided buccal swab samples (Isohelix 524 SK-2S buccal swabs), craniofacial phenotype data, medical records, operative reports, and 525 imaging studies. Written consent was obtained for publication of patient photographs. The study 526 protocol was approved by the Yale Human Investigation Committee Institutional Review Board 527 (IRB). 528 529 Control cohorts comprised 3,337 previously studied healthy European parents of probands with 530 autism, Europeans found in the NHLBI Exome Sequencing Project database (NHLBI), and Non- 531 Finnish Europeans found in the Exome Aggregation Consortium v0.3 database (ExAC). 532 533 Exome sequencing, risk allele genotyping, and analysis. DNA was prepared from buccal 534 swab samples according to the manufacturer’s protocol. Exome sequencing was performed by 535 exon capture using the Roche MedExome or Roche V2 capture reagent followed by 74 base 536 paired-end sequencing on the Illumina HiSeq 2000 instrument as previously described39. 537 Samples were barcoded then captured and sequenced in multiplex. Quality metrics are shown 538 in Supplementary File 1A. 539 540 Sequence reads were aligned to the GRCh37/hg19 human reference genome using BWA-Mem. 541 Local realignment and quality score recalibration were performed using the GATK pipeline, after 542 which variants were called using the Genome Analysis Toolkit Haplotype Caller. A Bayesian 543 algorithm, TrioDeNovo, was used to call de novo mutations16. VQSR “PASS” variants with ExAC 544 allele frequency ≤ .001 sequenced to a depth of 8 or greater in the proband and 12 or greater in 545 each parent with Phred-scaled genotype likelihood scores >30 and de novo quality scores

546 (log10(Bayes factor)) >6 were considered. Independent aligned reads at variant positions were 547 visualized in silico to remove false calls (Figure 2- Figure Supplement 1). For de novo calls 548 passing visual inspection, variants receiving the highest de novo genotype quality score (100) 549 were deemed valid. Forty of these de novo mutations were selected at random for validation by 550 bidirectional Sanger sequencing of the proband and both parents; 100% of these tests 551 confirmed de novo mutation in the proband. The observed number of de novo variants identified 552 per trio closely matched the expected Poisson distribution (Supplementary File 1F). All de novo 553 variants named in the main text were confirmed by Sanger sequencing. Transmitted variants 554 were similarly aligned and called as per above. All de novo and transmitted variants were 555 annotated using ANNOVAR42. Allele frequencies of identified variants were taken from the 556 ExAC database. The impact of nonsynonymous variants was predicted using the MetaSVM 557 rank score, with scores greater than 0.83357 serving as a threshold for predicting that the 558 mutation was deleterious (MetaSVM “D”, D-mis)17. For case control burden analysis of all 559 protein coding genes, all GATK VQSR “PASS” variants were considered. 560 561 In assessing the association of known risk alleles near BMP2 and within BBS9 with 562 craniosynostosis in SMAD6 mutation carriers, genotypes for rs1884302 and rs10262453 were 563 determined by direct Sanger sequencing. 564 565 All mutations reported in SMAD6, SMURF1, SPRY1, and SPRY4 were confirmed by direct 566 bidirectional Sanger sequencing of the products of PCR amplification of segments containing 567 putative mutations (Figure 2- Figure Supplement 2, Figure 5, Figure 6). PCR primers are listed 568 in Figure 2- Source Data 2. Sanger sequencing electropherograms were manually inspected 569 using Geneious after alignment to the reference genome sequence in GRCh37/hg19.

570 Burden of de novo mutations. The observed distribution of mutation type was compared to 571 pre-computed expected values across the exome using Poisson statistics as described18,19. Pre- 572 calculated gene-specific mutation probabilities were used to determine the probability of the 573 observed number and type of de novo mutations in SMAD6 occurring by chance using 574 denovolyzeR18,20.To assess the probability of observing 3 protein damaging mutations, P values 575 for observing 2 de novo LOF’s and one de novo missense mutation were combined using 576 Fisher’s combined probability test. To assess the burden of de novo mutation in Sprouty genes, 577 a gene set was curated in denovolyzeR including: SPRY1, SPRY2, SPRY3, SPRY4. The 578 probability of observing 2 de novo LOF mutations in this gene set was calculated by comparing 579 this number to expectation in denovolyzeR. The probability of observing more than one de novo 580 LOF mutation in any gene in our cohort was determined using a permutation function- 581 denovolyzeMultiHits()18. In total, 13 de novo LOF variants were observed in our cohort. The 582 probability of observing >1 de novo LOF in any gene by chance with a set of 13 mutations was 583 determined by 1 million iterations in which these 13 ‘hits’ were sampled from all genes given the 584 probability of de novo mutation in each19. The number of times any gene had more than one hit 585 in an iteration was counted, and that number divided by 1 million represented the probability of 586 observing more than one de novo LOF mutation in our cohort.

587 Contribution of de novo mutation to craniosynostosis. We infer that the number of 588 probands with protein altering de novo mutations (n=123) in excess of expectation by chance 589 (n=102.4) represents the number of subjects in whom these mutations confer craniosynostosis 590 risk (n=20.6). Comparing this fraction to the total number of trios (20.6/132) yields the fraction of 591 patients in our cohort in whom we expect these mutations contribute to disease: ~15.6%.

592 Binomial test. The observed distribution of rare (ExAC frequency < 2 x 10-5) LOF and D-mis 593 alleles was compared to the expected distribution using the binomial test. The total number of 594 LOF and D-mis alleles in 191 probands was tabulated, totaling 1,135 LOF alleles and 2,021 D- 595 mis alleles (3,156 total damaging alleles). The expected number of variants in each gene was 596 calculated from the proportion of the exome comprising the coding region of each gene 597 multiplied by the total number of alleles identified in cases. Enrichment was calculated as the 598 number of observed mutations divided by the expected number.

599 Transmission Disequilibrium Test. We used a transmission disequilibrium test to compare the

600 transmission (M1) and non-transmission (M2) of BMP2 and BBS9 risk alleles (rs1884302 and 601 rs10262453 respectively) to affected offspring in kindreds with SMAD6 mutations. We tested for 602 deviation from the expected transmission value of 50% by the binomial Chi-square test with 1 603 Df.

604 Case vs. control comparison. A fisher exact test was used to compare the prevalence of LOF 605 or LOF+D-mis variants in 172 craniosynostosis probands and 3,337 controls, the latter 606 comprising the unaffected parents of offspring with autism. Controls were exome sequenced on 607 the Roche V2 capture reagent followed by sequencing on the Illumina platform23,43,44. All control 608 BAM files were processed with sequences aligned and variants called in parallel to 609 aforementioned cases. Cases and controls, on average, both had ~94-95% of targeted bases 610 read 8 or more times (Supplementary File 1A). We restricted cases and controls to European 611 (CEU) ancestry using the EIGENSTRAT program, which compared single nucleotide 612 polymorphism (SNP) genotypes from case and control subjects with individuals of known 613 ancestry in HapMap345 (Figure 3- Figure Supplement 2). To avoid bias, exons analyzed were 614 restricted to those that intersected between the Roche V2 and MedExome capture reagents. 615 For genes with more than 1 LOF or D-mis variant in cases, aligned reads were visualized in 616 silico at all variant positions in both cases and controls. For genes displaying P < 0.005, we 617 compared the burden of mutated alleles in cases to European subjects in the NHLBI ESP and 618 ExAC databases. The total number of alleles evaluated per gene was taken as the median of 619 the allele numbers reported for all positions across a gene in NHLBI and ExAC respectively 620 (Figure 3- Source Data 1).

621 Two locus linkage analysis. Parametric two locus linkage analysis was performed comparing 622 the segregation of rare damaging SMAD6 alleles and common BMP2 risk alleles at rs1884302 623 to the segregation of craniosynostosis in kindreds harboring rare damaging SMAD6 variants. 624 Risk alleles at both loci were specified as showing zero recombination with underlying trait loci; 625 risk/penetrance of each two locus genotype was estimated from their values at the maximum 626 likelihood (Supplementary File 1C). A phenocopy rate of .02% was specified from estimates of 627 disease prevalence and the fraction of disease attributable to risk genotypes. Likelihood ratios 628 of the observed results occurring under the specified model vs. the alternative of chance were 629 calculated for each kindred, converted to lod scores (Supplementary File 1D) and the sum of lod 630 scores across all kindreds was calculated. For kindreds (n = 2) with missing parental genotypes, 631 the likelihood ratio of observed genotypes in offspring occurring under the parametric model 632 compared to chance was estimated from ethnic-specific BMP2 genotype frequencies and 633 frequencies of rare damaging SMAD6 alleles in missing parental genotypes. The likelihood ratio 634 of the best two locus model was compared to that of the best single locus model considering 635 only the segregation of rare damaging SMAD6 variants.

636 Kinship analysis. Kinship analysis was performed for all probands and controls using Plink. All 637 trio structures were confirmed with parent-offspring pairs having PiHat values of 0.45-0.55. 638 639 URLs. GATK: (https://www.broadinstitute.org/gatk); TrioDeNovo: 640 (http://genome.sph.umich.edu/wiki/Triodenovo); DenovolyzeR: (http://denovolyzer.org); Plink: 641 (http://pngu.mgh.harvard.edu/~purcell/plink); MetaSVM/ANNOVAR: 642 (http://annovar.openbioinformatics.org); NHLBI ESP: (http://evs.gs.washington.edu/EVS); 643 ExAC03: (http://exac.broadinstitute.org); Geneious: (www.geneious.com). Isohelix Buccal Swab 644 DNA isolation: (http://www.isohelix.com/wp-content/uploads/2015/09/BuccalFixIsoKit.pdf). 645 646 Accession codes. Whole-exome sequencing data have been deposited in the database of 647 Genotypes and Phenotypes (dbGaP) under accession phs000744. NCBI RefSeq accessions for 648 all named genes are listed in in Table 1- Source Data 1. 649 650 Conflicts of Interest. No authors have any conflicts of interest to report. 651 652 Contributions. JAP and RPL conceived, designed and directed the study. RSM, SP, EGZ, 653 DMS, MLD, CCD, and JAP contributed clinical evaluations. ATT, EDB, JFY, EL, AG, and KAP 654 recruited and enrolled patients. ATT, EDB, JFY, CC, and PWH collected genetic specimens. 655 KB, IT, and SM directed exome sequence production. ATT and CNW performed SNP 656 genotyping and Sanger sequencing. ATT, JC, SZ, QL, CNW, HZ and RPL performed genetic 657 analyses. ATT and RPL wrote the manuscript. 658 659 Acknowledgements. We are enormously grateful to the study participants and their families for 660 their invaluable role in this study, to the Cranio Kids- Craniosynostosis Support Group and the 661 Craniosynostosis-Positional Plagiocephaly Support Group for posting our invitations to 662 participate on their Facebook pages, to the staff of the Yale Center for Genome Analysis for 663 expert performance of exome sequencing, and to Lynn Boyden for helpful discussions. 664 Supported by the Yale Center for Mendelian Genomics (NIH M#UM1HG006504-05), the 665 Maxillofacial Surgeons Foundation/ASMS (M#M156301), the NIH Medical Scientist Training 666 Program (NIH/NIGMS T32GM007205), and the Howard Hughes Medical Institute. 667 668 669 References 670 671 42. Wang, K., Li, M. & Hakonarson, H. ANNOVAR: functional annotation of genetic variants 672 from high-throughput sequencing data. Nucleic Acids Res 38, e164 (2010). 673 43. Krumm, N., Turner, T.N., Baker, C., Vives, L., Mohajeri, K., Witherspoon, K., Raja, A., 674 Coe, B.P., Stessman, H.A., He, Z.X., Leal, S.M., Bernier, R. & Eichler, E.E. Excess of 675 rare, inherited truncating mutations in autism. Nat Genet 47, 582-8 (2015). 676 44. Iossifov, I., Ronemus, M., Levy, D., Wang, Z., Hakker, I., Rosenbaum, J., Yamrom, B., 677 Lee, Y.H., Narzisi, G., Leotta, A., Kendall, J., Grabowska, E., Ma, B., Marks, S., 678 Rodgers, L., Stepansky, A., Troge, J., Andrews, P., Bekritsky, M., Pradhan, K., Ghiban, 679 E., Kramer, M., Parla, J., Demeter, R., Fulton, L.L., Fulton, R.S., Magrini, V.J., Ye, K., 680 Darnell, J.C., Darnell, R.B., Mardis, E.R., Wilson, R.K., Schatz, M.C., McCombie, W.R. & 681 Wigler, M. De novo gene disruptions in children on the autistic spectrum. Neuron 74, 682 285-99 (2012). 683 45. International HapMap, C., Frazer, K.A., Ballinger, D.G., Cox, D.R., Hinds, D.A., Stuve, 684 L.L., Gibbs, R.A., Belmont, J.W., Boudreau, A., Hardenbol, P., Leal, S.M., Pasternak, S., 685 Wheeler, D.A., Willis, T.D., Yu, F., Yang, H., Zeng, C., Gao, Y., Hu, H., Hu, W., Li, C., 686 Lin, W., Liu, S., Pan, H., Tang, X., Wang, J., Wang, W., Yu, J., Zhang, B., Zhang, Q., 687 Zhao, H., Zhao, H., Zhou, J., Gabriel, S.B., Barry, R., Blumenstiel, B., Camargo, A., 688 Defelice, M., Faggart, M., Goyette, M., Gupta, S., Moore, J., Nguyen, H., Onofrio, R.C., 689 Parkin, M., Roy, J., Stahl, E., Winchester, E., Ziaugra, L., Altshuler, D., Shen, Y., Yao, 690 Z., Huang, W., Chu, X., He, Y., Jin, L., Liu, Y., Shen, Y., Sun, W., Wang, H., Wang, Y., 691 Wang, Y., Xiong, X., Xu, L., Waye, M.M., Tsui, S.K., Xue, H., Wong, J.T., Galver, L.M., 692 Fan, J.B., Gunderson, K., Murray, S.S., Oliphant, A.R., Chee, M.S., Montpetit, A., 693 Chagnon, F., Ferretti, V., Leboeuf, M., Olivier, J.F., Phillips, M.S., Roumy, S., Sallee, C., 694 Verner, A., Hudson, T.J., Kwok, P.Y., Cai, D., Koboldt, D.C., Miller, R.D., Pawlikowska, 695 L., Taillon-Miller, P., Xiao, M., Tsui, L.C., Mak, W., Song, Y.Q., Tam, P.K., Nakamura, Y., 696 Kawaguchi, T., Kitamoto, T., Morizono, T., Nagashima, A., Ohnishi, Y., Sekine, A., 697 Tanaka, T., Tsunoda, T., Deloukas, P., Bird, C.P., Delgado, M., Dermitzakis, E.T., 698 Gwilliam, R., Hunt, S., Morrison, J., Powell, D., Stranger, B.E., Whittaker, P., Bentley, 699 D.R., Daly, M.J., de Bakker, P.I., Barrett, J., Chretien, Y.R., Maller, J., McCarroll, S., 700 Patterson, N., Pe'er, I., Price, A., Purcell, S., Richter, D.J., Sabeti, P., Saxena, R., 701 Schaffner, S.F., Sham, P.C., Varilly, P., Altshuler, D., Stein, L.D., Krishnan, L., Smith, 702 A.V., Tello-Ruiz, M.K., Thorisson, G.A., Chakravarti, A., Chen, P.E., Cutler, D.J., 703 Kashuk, C.S., Lin, S., Abecasis, G.R., Guan, W., Li, Y., Munro, H.M., Qin, Z.S., Thomas, 704 D.J., McVean, G., Auton, A., Bottolo, L., Cardin, N., Eyheramendy, S., Freeman, C., 705 Marchini, J., Myers, S., Spencer, C., Stephens, M., Donnelly, P., Cardon, L.R., Clarke, 706 G., Evans, D.M., Morris, A.P., Weir, B.S., Tsunoda, T., Mullikin, J.C., Sherry, S.T., Feolo, 707 M., Skol, A., Zhang, H., Zeng, C., Zhao, H., Matsuda, I., Fukushima, Y., Macer, D.R., 708 Suda, E., Rotimi, C.N., Adebamowo, C.A., Ajayi, I., Aniagwu, T., Marshall, P.A., 709 Nkwodimmah, C., Royal, C.D., Leppert, M.F., Dixon, M., Peiffer, A., Qiu, R., Kent, A., 710 Kato, K., Niikawa, N., Adewole, I.F., Knoppers, B.M., Foster, M.W., Clayton, E.W., 711 Watkin, J., Gibbs, R.A., Belmont, J.W., Muzny, D., Nazareth, L., Sodergren, E., 712 Weinstock, G.M., Wheeler, D.A., Yakub, I., Gabriel, S.B., Onofrio, R.C., Richter, D.J., 713 Ziaugra, L., Birren, B.W., Daly, M.J., Altshuler, D., Wilson, R.K., Fulton, L.L., Rogers, J., 714 Burton, J., Carter, N.P., Clee, C.M., Griffiths, M., Jones, M.C., McLay, K., Plumb, R.W., 715 Ross, M.T., Sims, S.K., Willey, D.L., Chen, Z., Han, H., Kang, L., Godbout, M., 716 Wallenburg, J.C., L'Archeveque, P., Bellemare, G., Saeki, K., Wang, H., An, D., Fu, H., 717 Li, Q., Wang, Z., Wang, R., Holden, A.L., Brooks, L.D., McEwen, J.E., Guyer, M.S., 718 Wang, V.O., Peterson, J.L., Shi, M., Spiegel, J., Sung, L.M., Zacharia, L.F., Collins, F.S., 719 Kennedy, K., Jamieson, R. & Stewart, J. A second generation human haplotype map of 720 over 3.1 million SNPs. Nature 449, 851-61 (2007). 721 722 723 Figure 1. Phenotypes of midline craniosynostosis. a. Normal infant skull with patent sagittal (S) 724 and metopic (M) sutures. b. Three-dimensional reconstruction of computed tomography (3D CT) 725 demonstrating premature fusion of both the sagittal and metopic sutures. c. A 3-month old boy with 726 sagittal craniosynostosis featuring scaphocephaly (narrow and elongated cranial vault), and frontal 727 bossing. d. 3D CT reconstruction of a 1-month-old boy found to have sagittal craniosynostosis. e. A 728 6-month-old boy presenting with trigonocephaly (triangulation of the cranial vault, with prominent 729 forehead ridge resulting from premature fusion of the metopic suture) and hypotelorism 730 (abnormally decreased intercanthal distance, also a result of premature fusion of the metopic 731 suture). 3D CT reconstruction demonstrated metopic craniosynostosis. f. 3D CT reconstruction 732 demonstrating premature fusion of the metopic suture with characteristic trigonocephaly and 733 hypotelorism. 734 735 736 737

738 739 740 Figure 2. Segregation of SMAD6 mutations and BMP2 SNP genotypes in pedigrees with 741 midline craniosynostosis. a. Domain structure of SMAD6 showing location of the MH1 and MH2 742 domains. The MH1 domain mediates DNA binding and negatively regulates the functions of the 743 MH2 domain, while the MH2 domain is responsible for transactivation and mediates 744 phosphorylation-triggered heteromeric assembly with receptor-SMADs. De novo or rare damaging 745 mutations identified in craniosynostosis probands are indicated. Color of text denotes suture(s) 746 showing premature closure. b. Pedigrees harboring de novo (denoted by stars within pedigree 747 symbols) or rare transmitted variants in SMAD6. Filled and unfilled symbols denote individuals 748 with and without craniosynostosis, respectively. The SMAD6 mutation identified in each kindred is 749 noted above each pedigree. Below each symbol, genotypes are shown first for SMAD6 (with “D” 750 denoting the damaging allele) and for rs1884302 risk locus downstream of BMP2, (with “T” 751 conferring protection from and “C” conferring increased risk of craniosynostosis). All 17 subjects 752 with craniosynostosis have SMAD6 mutations, and 14/17 have also inherited the risk allele at 753 rs1884302, whereas only 3 of 16 SMAD6 mutation carriers without the rs1884302 risk allele have 754 craniosynostosis. 755 Position on ExAC03 Patient Ref Alt Impact MetaSVM Chromosome 15 Frequency MET111-1P,2P 67073775 C T R465C 9.38 x 10-6 D MET115-1P 67073851 T C I490T Novel D MET127-1P 66996263 C T Q223* Novel Stop MET148-1P 67073350 C T P323L Novel D MET153-1P 67073550 G T G390C Novel D MET154-1P,2P 67073601 G T E407* 9.00 x 10-6 Stop MET179-1P 66995977 TC del S130fs*146 Novel Frameshift SAGMET100-1P 67073437 A AAT A353fs*187 Novel Frameshift SAGMET101-1P 66995828 19bp del Q78fs*41 Novel Frameshift SAGMET107-1P 67004047 G A E287K 3.30 x 10-5 D SAGMET104-1P,2P 67073416 G del R345fs*194 Novel Frameshift SAG158-1P 67073502 G T E374* Novel Stop SAG210-1P 67008800 A G T306A Novel D SAG220-1P 67004027 T TT R281fs*13 Novel Frameshift SAG-PROBAND3 66995873 A T M93L Novel T 756 757 Figure 2- Source Data 1. Variants identified in SMAD6. Highlighted variants indicate de novo 758 mutations; “D” and “T” respectively denote damaging and tolerated missense variants called by 759 MetaSVM. 760 761 Figure 2- Figure Supplement 1. Plots of independent Illumina sequencing reads in a parent- 762 offspring trio showing de novo SMAD6 mutation. The reference sequence of a segment of SMAD6 763 that includes base 15:67073502 (denoted by arrow) is shown in the top row, with red, blue, green 764 and yellow squares representing A, C, G, T, respectively. Below, all independent reads that map to 765 this interval are shown. The results show that the proband has 23 reads of reference ‘G’, and 10 766 reads of non-reference ‘T’. Only the reference ‘G’ is seen in both parents, providing evidence of a de 767 novo mutation. 768 769

770 771 772 Figure 2- Figure Supplement 2. Confirmation of SMAD6 mutations by Sanger sequencing of 773 PCR products. Sanger sequencing traces of PCR amplicons containing SMAD6 mutations identified 774 by exome sequencing are shown. Above each trace or set of traces, the kindred ID, mutation 775 identified in the DNA sequence and its impact on SMAD6 protein is indicated. Above sequence 776 traces, the inferred DNA sequence is shown, along with the inferred amino acid sequence (shown in 777 single letter code). Heterozygous mutations are indicated beneath the wild-type sequence and non- 778 reference amino acid sequences are shown in red. Deleted and inserted bases are denoted, and 779 result in an overlap of wild-type and mutant sequences. 780 Annealing Temp Gene DNA Change Impact Forward Oligonucleotide Reverse Oligonucleotide (°C) SMAD6 c.232_250del Q78fs CGCTGAGGGAACGGACCCCCGG CCCGCAGCTGCGCCGACCCGCAGTG 56 SMAD6 c.A277T M93L CGCTGAGGGAACGGACCCCCGG CCCGCAGCTGCGCCGACCCGCAGTG 56 SMAD6 c.381_382delTC S130fs CGCTGAGGGAACGGACCCCCGG CCCGCAGCTGCGCCGACCCGCAGTG 56 SMAD6 c.C667T Q223* CGCTGAGGGAACGGACCCCCGG CCCGCAGCTGCGCCGACCCGCAGTG 56 SMAD6 c.839_840insT R281fs GGTCACACAGCCAAAGGTGGC GCTGGGTCTGCTTTGGCCCAAC 56 SMAD6 c.G859A E287K GGTCACACAGCCAAAGGTGGC GCTGGGTCTGCTTTGGCCCAAC 56 SMAD6 c.A916G T306A GGTCACACAGCCAAAGGTGGC GCTGGGTCTGCTTTGGCCCAAC 56 SMAD6 c.C968T P323L CAACCTGGCACACGGTGCCCAC GGTGGCGGTGGCCGCGGCCTCCC 56 SMAD6 c.1034delG R345fs CAACCTGGCACACGGTGCCCAC GGTGGCGGTGGCCGCGGCCTCCC 56 SMAD6 c.1055_1056insAT A353fs CAACCTGGCACACGGTGCCCAC GGTGGCGGTGGCCGCGGCCTCCC 56 SMAD6 c.G1120T E374* CAACCTGGCACACGGTGCCCAC GGTGGCGGTGGCCGCGGCCTCCC 56 SMAD6 c.G1168T G390C CAACCTGGCACACGGTGCCCAC GGTGGCGGTGGCCGCGGCCTCCC 56 SMAD6 c.G1219T E407* CAACCTGGCACACGGTGCCCAC GGTGGCGGTGGCCGCGGCCTCCC 56 SMAD6 c.C1393T R465C CAACCTGGCACACGGTGCCCAC GGTGGCGGTGGCCGCGGCCTCCC 56 SMAD6 T1469C I490T CAACCTGGCACACGGTGCCCAC GGTGGCGGTGGCCGCGGCCTCCC 56 SMURF1 c.C1402T R468W CAGGATCCACACCAAGCTCTTATGC GGGACACTTTTCCCAAGAAGC 56 SPRY1 c.16delC Q6fs GGATTTCAGATGCATGCCAGG CATAGTCTAATCTCTGACGGC 56 SPRY4 c.G478T E160* GACCCAGCAGGAAGGCAACG GGTCCAGCGGCTGGCAGTGGACC 56 BMP2 rs1884302 C/T GGTGGAAGGTGAAGGGTCCC GAGTGAGAATATAAGGTATTGC 56 BBS9 rs10262453 A/C CCCAAACCTAGGCCTCAGTCCTATCC GCCCACTGGTTTGTTACCTTG 56 781 Figure 2- Source Data 2. PCR primer sequences for Sanger sequencing of reported 782 variants. Source Data for Figure 2- Figure Supplement 2. 783 784 785 786 Figure 3. Quantile-quantile plots of observed versus expected P-values comparing the 787 burden of rare LOF and damaging (LOF + D-mis) variants in protein-coding genes in 788 craniosynostosis cases. Rare (allele frequency < 2 x 10-5 in the ExAC03 database) loss of function 789 (LOF) and damaging missense (D-mis) variants were identified in 191 probands. The probability of 790 the observed number of variants in each gene occurring by chance was calculated from the total 791 number of observed variants and the length of the coding region of each gene using the binomial 792 test. The distribution of observed P-values compared to the expected distribution is shown. a. Q-Q 793 plot for rare LOF variants in each gene from a total of 1,135 LOF variants identified in probands. 794 The distribution of observed P-values closely conforms to expectation with the exception of SMAD6, 795 which shows P 1.1 x 10-15 and 156-fold enrichment in cases. b. Q-Q plot for rare damaging (LOF + D- 796 mis) variants in each gene from a total of 3,156 damaging variants in probands. Again, SMAD6 797 deviates greatly from the expected distribution, with P < 10-20 and 91-fold enrichment. 798 799 800 801 802 Figure 3- Figure Supplement 1. Quantile-quantile plots comparing all transmitted, damaging 803 variants in protein-coding genes in 191 probands with midline craniosynostosis to the 804 expected binomial distribution. De novo variants were excluded from this analysis, leaving 1,122 805 rare (ExAC allele frequency < 2 x10-5), transmitted LOF variants and 3,115 transmitted damaging 806 (LOF + D-mis) variants. All genes closely matched expectation, with the exception of SMAD6. a. 807 There were 6 transmitted SMAD6 LOF mutations, a 118-fold enrichment compared to the expected 808 0.05 (P=2.2 x 10-11). b. Similarly, there were 10 transmitted damaging SMAD6 variants, a 71-fold 809 enrichment compared to the expected 0.14 (P=7.0 x 10-16). The results demonstrate genome-wide 810 significance of rare transmitted variants in SMAD6 independent of de novo mutations. 811 812 813 Figure 3- Figure Supplement 2. Principal-component analysis of 191 probands and 3,337 814 European autism controls. a. Principal component analysis of exome sequence genotypes from 815 191 probands with sagittal, metopic, or combined sagittal and metopic craniosynostosis clustered 816 along with HapMap subjects. Results identify 172 craniosynostosis subjects that cluster with 817 HapMap European subjects. b. Principal component analysis of genotypes from exome sequencing 818 data of European autism parent controls (n=3,337) showing clustering with HapMap subjects. In 819 both panels, subjects considered to be of European ancestry are circled. 820 821 822 Figure 3- Figure Supplement 3. Quantile-quantile plot of observed versus expected P-values 823 comparing the burden of damaging (LOF + D-mis) variants in protein-coding genes in 824 craniosynostosis cases and controls. The frequency of rare (allele frequency < 2 x 10-5 in the 825 ExAC03 database) loss of function and D-mis variants in each gene was compared in 172 European 826 probands with midline craniosynostosis and 3,337 European controls. The distribution of observed 827 P-values conforms to expectation with the exception of SMAD6, which deviates significantly from 828 expectation. Because exon 1 of SMAD6 was poorly captured using the V2 capture reagent (used in 829 control samples), 3 damaging variants in exon 1 in cases were excluded from this analysis. 830 831 allele allele 35.1 35.1 17.0 17.0 141.9 -4 -7 -10

exon was well-covered exon was well-covered exon was well-covered alleles respectively across across alleles respectively across alleles respectively + damaging missense) variants test; OR, odds ratio. Reference OR, odds ratio. test; Reference OR, odds ratio. test; ts identified in cases. cases. in identified ts 34.7 41 12.6 59,329 46 10 x 3.58 66,584 10 x 1.31 102.6 5 59,365 10 x 1.24 -9 -4 -6 ism parents, NHLBI ESP, ExAC03). ExAC03). NHLBI ESP, ism parents, ean and non-FinnishEuropean ean and non-FinnishEuropean ontrol analysis excludes exon 1, as this as 1, exon excludes ontrol analysis this as 1, exon excludes ontrol analysis

usion of damagingvarian3 usion of variants damagingidentified3 incases. VAR VAR REF P OR VAR REF P OR sided P-value by Fisher’s exact exact by Fisher’s P-value sided exact by Fisher’s P-value sided and transmitteddamaging (LOF and transmittedLOF variants comparingEuropean - 1 8,593 10 x 9.78 26.9 6 9.8 8,588 10 x 9.54 8 8,578 10 x 8.34 de novo de novo -6 -8 -3 ls (autism parents, NHLBI ESP, ExAC03). ) ) -5 -5 burden in this case-c in this burden case-c in this burden casesEuropean to controls(aut SMAD6 SMAD6 sent the median number ofEurop number sent the median ofEurop number sent the median Source data for Figure 3- Figure Supplement 3. 3- Figure Figure data for Source 4 340 8 6,666 10 x 2.05 8 330 6 6,668 10 x 6.26 4 334 0 6,674 10 x 5.68 CASES CONTROLS AUTISM CONTROLS NHLBI CONTROLS EXAC03 CASES CONTROLS AUTISM CONTROLS NHLBI CONTROLS EXAC03 SMAD6 GENE VAR REF VAR REF P OR SMAD6 GENE VAR REF VAR REF P OR VAR REF P OR VAR REF P OR all control vs. 0.005 groups. P < showing variants + D-mis LOF comparing European craniosynostosis all reported variants for each gene. allreported variants for This exclresulted in controls. casespoorly in but in captured each gene. allreported variants for This resulted excl in controls. casespoorly in but in captured Figure 3- Source Data 1. Figure P, two- alleles; # of reference variant alleles; REF, of # VAR, Burden of rare, (allele frequency < 2 x 10 P, two- alleles; # of reference variant alleles; REF, of # VAR, Burden of rare, (allele frequency < 2 x 10 groups. control all vs. 0.005 P < showing variants LOF craniosynostosis cases to European contro counts from NHLBI and ExAC repre NHLBI from counts and ExAC repre NHLBI from counts PIK3C2A PIK3C2A

832 833

834 Figure 4. SMAD6 inhibits osteoblast differentiation by inhibiting BMP-mediated SMAD 835 signaling29. 836 a. BMP ligands activate BMP receptors, leading to phosphorylation of receptor-regulated SMADs (R- 837 SMADs), which complex with SMAD4 and enter the nucleus, cooperating with RUNX2 to induce 838 osteoblast differentiation. SMAD6 inhibits this signal by competing with SMAD4 for binding to R- 839 SMADs, preventing nuclear translocation. b. SMAD6 also cooperates with SMURF1, an E3 ubiquitin 840 ligase, to induce ubiquitin-mediated proteasomal degradation of R-SMADs, BMP receptor 841 complexes, and RUNX2. 842 843 844 845 846 Figure 5. A de novo variant identified in SMURF1. a. Sanger sequence electropherogram of a PCR 847 product amplified from the genomic DNA of a proband with metopic craniosynostosis, confirming a 848 de novo R468W mutation in SMURF1, a SMAD6 binding partner. b. Patient photographs of the 849 proband, who presented with trigonocephaly and mild orbital abnormalities. 3D CT reconstruction 850 demonstrates metopic craniosynostosis, trigonocephaly, and a patent sagittal suture. 851 852 853 854 855 856 857 Figure 6. De novo loss-of-function mutations in Sprouty genes. a. Pedigree and Sanger 858 sequencing traces for kindred SAG150, demonstrating a de novo nonsense mutation in SPRY4 859 (p.E160*) in the proband. b. Pedigree and Sanger sequencing traces in a kindred with a de novo 860 SPRY1 frameshift mutation (p.Q6fs*8) that was transmitted to two affected offspring. 861 862 863 Table 1. Enrichment of protein-altering de novo mutations in 132 subjects with sagittal 864 and/or metopic craniosynostosis. Observed Expected Enrichment P-value Class # #/subject # #/subject All mutations 144 1.09 142.8 1.08 1.01 0.47 Synonymous 021 0.16 040.4 0.31 0.52 3.0 x 10-4 Protein altering 123 0.93 102.4 0.78 1.17 0.03 Total missense 110 0.83 089.7 0.68 1.23 0.02 T-mis 082 0.62 075.2 0.57 1.09 0.23 D-mis 028 0.21 014.5 0.11 1.93 1.0 x 10-3 Loss of function (LOF) 013 0.10 012.7 0.10 1.03 0.50 LOF + D-mis 041 0.31 027.1 0.21 1.51 7.8 x 10-3 865 866 #, number of de novo mutations in 132 subjects; #/subject, number of de novo mutations per 867 subject; Damaging and tolerated missense called by MetaSVM (D-mis, T-mis respectively); Loss of 868 function denotes premature termination, frameshift, or splice site mutation. For mutation classes 869 with enrichment compared to expectation, P-values represent the upper tail of the Poisson 870 probability density function. For mutation classes in which we observed a paucity of mutations 871 compared to expectation, P-values represent the lower tail. 872 873 874 Table 1- Source Data 1. De novo mutations in 132 trios with sagittal and/or metopic 875 craniosynostosis. Mutations highlighted in orange are likely loss of function mutations, those 876 highlighted in blue are likely damaging missense mutations (D-mis) as called by MetaSVM, and 877 those without highlight are predicted to be tolerated (T-mis) or are synonymous (syn). 878 Type of Mutation ExAC03 RefSeqNM Gene Protein Impact craniosynostosis Class Frequency Accession Sagittal NAA25 p.F359fs*26 frameshift Novel NM_024953 Sagittal NME5 p.I153fs*9 frameshift Novel NM_003551 Sagittal+Metopic SMAD6 p.Q78fs*41 frameshift Novel NM_005585 Sagittal SPRY1 p.Q6fs*8 frameshift Novel NM_001258039 Metopic ZCCHC11 E1275fs*42 frameshift Novel NM_001009881 Sagittal DCAF13 p.R518* nonsense 8.29E-06 NM_015420 Sagittal GPRC5A p.R272* nonsense 3.31E-05 NM_003979 Sagittal KIAA1211 p.G17* nonsense Novel NM_020722 Sagittal MESP1 p.E104* nonsense 8.92E-05 NM_018670 Sagittal SMAD6 p.E374* nonsense Novel NM_005585 Sagittal SPRY4 p.E160* nonsense Novel NM_001127496 Metopic DUS3L exon9:c.760+1G>A splice Novel NM_001161619 Sagittal TTC12 exon20:c.1816+1G>C splice Novel NM_017868 Metopic ABCC5 p.Y700D D-mis Novel NM_005688 Sagittal ACADM p.A103T D-mis Novel NM_001286044 Sagittal AGAP3 p.R185W D-mis 8.37E-06 NM_001281300 Sagittal ASB5 p.H238L D-mis Novel NM_080874 Metopic CACNA1H p.A1851D D-mis Novel NM_001005407 Sagittal CATSPER4 p.I289V D-mis Novel NM_198137 Sagittal CCBL2 p.G260D D-mis Novel NM_001008662 Sagittal COL11A1 p.G1034S D-mis 1.71E-05 NM_080630 Sagittal CSF2RB p.G635W D-mis Novel NM_000395 Sagittal EDEM1 p.D188N D-mis Novel NM_014674 Sagittal H2AFV p.A6P D-mis Novel NM_012412 Sagittal HELZ2 p.R120H D-mis 9.14E-06 NM_033405 Sagittal IVD p.R53H D-mis 8.24E-06 NM_002225 Metopic KCNH3 p.T53M D-mis Novel NM_012284 Sagittal MARCO p.K201T D-mis Novel NM_006770 Metopic PEPD p.G326R D-mis Novel NM_001166056 Sagittal RASAL2 p.R571P D-mis Novel NM_004841 Metopic RCCD1 p.G218E D-mis 8.40E-06 NM_001017919 Sagittal SI p.I1329V D-mis Novel NM_001041 Metopic SLC12A6 p.R724W D-mis 1.65E-05 NM_001042497 Metopic SLC2A14 p.V120F D-mis Novel NM_001286237 Sagittal SLC4A3 p.R553C D-mis Novel NM_005070 Metopic SMAD6 p.G390C D-mis Novel NM_005585 Metopic SMURF1 p.R468W D-mis Novel NM_001199847 Sagittal TBCB p.R30G D-mis Novel NM_001281 Sagittal TENM2 p.R1813H D-mis Novel NM_001122679 Sagittal THBS1 p.R980C D-mis 8.47E-06 NM_003246 Metopic TSC1 p.H661R D-mis Novel NM_001162427 Metopic ADGRL3 p.L575R T-mis Novel NM_015236 Sagittal ADH1A p.V293I T-mis 0.0002 NM_000667 Sagittal AFAP1L2 p.Q480L T-mis Novel NM_001001936 Sagittal ARHGAP33 p.C179Y T-mis Novel NM_001172630 Sagittal ARMC6 p.P359S T-mis Novel NM_033415 Metopic BAZ2A p.T1151S T-mis Novel NM_001300905 Type of Mutation ExAC03 RefSeqNM Gene Protein Impact craniosynostosis Class Frequency Accession BIVM,BIVM- Sagittal p.A72T T-mis Novel NM_001159596 ERCC5 Metopic C1orf141 p.L161V T-mis Novel NM_001276351 Sagittal C1orf95 p.L60V T-mis Novel NM_001003665 Metopic C1RL p.S54Y T-mis Novel NM_001297640 Metopic C22orf23 p.T43M T-mis 2.47E-05 NM_032561 Sagittal CALD1 p.P503L T-mis 0.001 NM_033140 Metopic CBX4 p.V505A T-mis 0.001 NM_003655 Metopic CBX7 p.R159H T-mis 1.03E-05 NM_175709 Metopic CGNL1 p.A484V T-mis 1.65E-05 NM_032866 Sagittal CHCHD4 p.P33R T-mis Novel NM_001098502 Sagittal CRHR2 p.D109N T-mis Novel NM_001202482 Sagittal DECR2 p.R50Q T-mis 2.48E-05 NM_020664 Sagittal DMBT1 p.Q1290R T-mis 8.28E-06 NM_004406 Sagittal DMXL2 p.C1452R T-mis Novel NM_001174117 Sagittal DNAH11 p.P959L T-mis Novel NM_001277115 Metopic DOCK2 p.K636Q T-mis Novel NM_004946 Sagittal DOCK8 p.T1843I T-mis 9.88E-05 NM_001190458 Sagittal+Metopic DONSON p.S551P T-mis Novel NM_017613 Sagittal DUSP5 p.R214W T-mis 4.12E-05 NM_004419 Metopic EP300 p.Q1043H T-mis Novel NM_001429 Sagittal FGG p.K328R T-mis Novel NM_000509 Sagittal+Metopic FOXM1 p.N331Y T-mis Novel NM_001243088 Sagittal GGT7 p.A178S T-mis Novel NM_178026 Sagittal GOLGB1 p.E3052G T-mis Novel NM_001256488 Metopic GPR137C p.C89S T-mis Novel NM_001099652 Sagittal GRIN2A p.K1339E T-mis 1.65E-05 NM_001134407 Sagittal HIST1H3A p.R135K T-mis Novel NM_003529 Sagittal IPO8 p.Q14L T-mis Novel NM_001190995 Metopic KDM4E p.R455C T-mis Novel NM_001161630 Metopic KIAA1549 p.R1603W T-mis 0.0003 NM_001164665 Sagittal KIF17 p.A57V T-mis Novel NM_001122819 Sagittal KSR2 p.R459H T-mis Novel NM_173598 Metopic LRIT1 p.G421R T-mis Novel NM_015613 Sagittal MAP3K8 p.E58G T-mis Novel NM_001244134 Sagittal MCM6 p.M631V T-mis Novel NM_005915 Metopic MUC13 p.G37C T-mis Novel NM_033049 Sagittal NCOR2 p.E1129G T-mis Novel NM_001077261 Sagittal NEURL4 p.E925K T-mis Novel NM_001005408 Metopic NR1D1 p.V393M T-mis 4.46E-05 NM_021724 Sagittal NUAK1 p.P557S T-mis Novel NM_014840 Sagittal OTOGL p.E1713K T-mis Novel NM_173591 Sagittal PHACTR4 p.R631H T-mis Novel NM_023923 Sagittal PKD1L1 p.A1650P T-mis Novel NM_138295 Metopic PLA2G3 p.A64V T-mis 5.01E-05 NM_015715 Metopic PRDM15 p.H459D T-mis Novel NM_001040424 Metopic PSMB10 p.M185T T-mis Novel NM_002801 Metopic PWWP2A p.P287L T-mis Novel NM_001130864 Sagittal+Metopic QTRTD1 p.A298E T-mis Novel NM_001256836 Metopic RGS3 p.N5S T-mis 4.10E-05 NM_001276261 Sagittal RPS6KA4 p.Q604H T-mis Novel NM_001006944 Metopic RPUSD2 p.S178F T-mis Novel NM_001286407 Sagittal RTL1 p.R1184Q T-mis 0.0001 NM_001134888 Type of Mutation ExAC03 RefSeqNM Gene Protein Impact craniosynostosis Class Frequency Accession Sagittal RUFY1 p.Q38P T-mis Novel NM_001040451 Sagittal SCEL p.D329G T-mis Novel NM_001160706 Metopic SEZ6 p.P857L T-mis Novel NM_001098635 Sagittal SGK2 p.K99R T-mis Novel NM_016276 Sagittal SGPL1 p.D553N T-mis 4.94E-05 NM_003901 Sagittal SNX15 p.R124W T-mis 1.66E-05 NM_013306 Sagittal SPAG6 p.I280T T-mis Novel NM_001253855 Sagittal+Metopic SPG11 p.F2230L T-mis Novel NM_001160227 Sagittal SPTBN4 p.R256W T-mis 8.28E-06 NM_020971 Metopic STAP2 p.G186S T-mis 0.0001 NM_001013841 Sagittal TEX15 p.C1374F T-mis Novel NM_031271 Sagittal THRAP3 p.R899W T-mis 8.28E-05 NM_005119 Sagittal TIFA p.Y122C T-mis Novel NM_052864 Metopic TSPYL1 p.L13F T-mis Novel NM_003309 Sagittal TTN p.T19373S T-mis Novel NM_003319 Sagittal TTN p.I3580M T-mis Novel NM_133378 Metopic UGT2B10 p.P154L T-mis Novel NM_001075 Metopic USP20 p.R376Q T-mis 1.81E-05 NM_001008563 Sagittal+Metopic WFIKKN1 p.P412R T-mis Novel NM_053284 Metopic YWHAH p.A189S T-mis Novel NM_003405 Metopic ZNF292 p.R771Q T-mis Novel NM_015021 Metopic ZNF517 p.R309C T-mis 1.98E-05 NM_213605 Sagittal ZNF638 p.M515I T-mis Novel NM_001014972 Sagittal ZNF836 p.K629N T-mis Novel NM_001102657 Sagittal ARFGEF2 p.T1286T syn 4.11E-05 NM_006420 Metopic BMPER p.Y635Y syn 4.12E-05 NM_133468 Metopic COMMD5 p.L59L syn Novel NM_001081003 Metopic DMBT1 p.F1683F syn Novel NM_004406 Metopic GAK p.R1171R syn 0.0001 NM_001286833 Metopic GTSE1 p.A240A syn Novel NM_016426 Sagittal HS6ST3 p.E93E syn Novel NM_153456 Sagittal IDI2 p.S71S syn 8.24E-06 NM_033261 Sagittal KIF22 p.E399E syn Novel NM_001256270 Sagittal KLHL26 p.D135D syn Novel NM_018316 Sagittal MAMDC2 p.A316A syn Novel NM_153267 Sagittal MUC17 p.L3429L syn Novel NM_001040105 Sagittal MYOM1 p.L1511L syn Novel NM_019856 Metopic NFKBIA p.R7R syn Novel NM_020529 Sagittal NLGN2 p.G357G syn 8.25E-06 NM_020795 Metopic NPHS1 p.G394G syn Novel NM_004646 Metopic RIF1 p.S235S syn Novel NM_001177665 Metopic RTN4RL1 p.I66I syn Novel NM_178568 Sagittal SYNE1 p.L5901L syn Novel NM_033071 Metopic VPS13B p.E2529E syn Novel NM_017890 Sagittal+Metopic ZFC3H1 p.A1391A syn 9.95E-05 NM_144982 879 880 881 Table 2. Probability of observed de novo mutations in SMAD6 and Sprouty genes occurring by 882 chance in 132 subjects using gene-specific mutation probabilities. Gene(s) Mutations Number of Number of P value observed expected mutations mutations SMAD6 Loss of function 2 0.00026 3.31 x 10-8

SMAD6 Missense 1 0.0046 4.67 x 10-3

SPRY1, SPRY2, Nonsense, splice 2 .001193 7.11 x 10-7 SPRY3, SPRY4 site, frameshift 883 884 Probabilities calculated from the Poisson distribution using DenovolyzeR. The probability of 885 observing at least 2 LOF and 1 missense mutation in SMAD6 was 3.6 x 10-9 via Fisher’s method. 886 887 Table 3. Enrichment of de novo and transmitted damaging variants in SMAD6 in 888 craniosynostosis. Observed Expected Enrichment P-value De novo LOF and D-mis 3 0.0049 612 3.6 x 10-9 Transmitted LOF and D-mis 10 0.1404 71.2 7.0 x 10-16 Total 13 0.1453 89.5 1.4 x 10-22 889 890 LOF, loss of function; D-mis, damaging missense variants per MetaSVM; The total number of SMAD6 891 variants expected in this cohort was calculated by summing the expected number of de novo and 892 transmitted variants. P-value combining probabilities from de novo and transmitted protein 893 damaging SMAD6 variants was determined by Fisher’s method. 894 895 Table 4. Distribution of suture involvement in kindreds with and without rare (allele 896 frequency < 2 x 10-5) de novo and transmitted damaging (LOF + D-mis) variants in SMAD6. Total # Total # SMAD6 mutations (%) # LOF (%) kindreds Sagittal 113 3 (2.7) 2 (1.8) Metopic 70 7 (10) 3 (3.9) Sagittal and Metopic 8 3 (37.5) 3 (37.5) Total 191 13 (6.8) 8 (4.2) 897 898 Table 5. Risk of craniosynostosis in SMAD6 mutation carriers in the presence or absence of a 899 BMP2 risk allele. SMAD6/BMP2 Genotypes Craniosynostosis (+) Craniosynostosis (-) SMAD6 (+) / BMP2 risk allele (+) 14 0 SMAD6 (+) / BMP2 risk allele (-) 3 13 SMAD6 (-) / BMP2 risk allele (+) 0 18 900 901 All members of kindreds found to have a mutation in SMAD6 were included. SMAD6(+) indicates the 902 presence of a heterozygous LOF or D-mis allele. The reported BMP2 risk allele is ‘C’ at risk locus 903 rs1884302, found within a gene desert ~345kb downstream of BMP2. P = 1.4 x 10-10 by the 904 Freeman-Halton extension of Fisher’s exact test. Odds ratio in favor of disease was incalculable due 905 to the absence of craniosynostosis in SMAD6 (-) individuals in these kindreds. 906 907 Source Data 1. 908 Title: Exome Sequencing Quality Statistics 909 Legend: Exome sequencing quality statistics for all members of craniosynostosis kindreds (n=455) 910 and autism controls (n=3,337). 911 912 Supplementary File 1. 913 Title: Supplementary files for “Two locus inheritance of non-syndromic midline 914 craniosynostosis via rare SMAD6 and common BMP2 alleles” 915 Legend: 916 A. Exome Sequencing Quality Statistics for all members of craniosynostosis kindreds (n=455) and 917 autism controls (n=3,337). 918 B. TDT of an intergenic BMP2 risk allele and intronic BBS9 risk allele in SMAD6 mutation carriers 919 with craniosynostosis. 920 C. Optimized two locus and single locus parametric models of genotype specific penetrances for 921 SMAD6 and BMP2. 922 D. Family specific lod scores for each kindred under the two locus and single locus models. 923 E. Clinical features and BMP2 genotypes in craniosynostosis patients with rare SMAD6, SMURF1, 924 SPRY1, or SPRY4 mutations. 925 F. De novo mutations identified per trio. 926 927 Source Code 928 Title: R script for two locus and single locus linkage analyses 929 930 931 932