DOCSLIB.ORG

Hnrnph1 (NM 021510) Mouse Tagged ORF Clone Lentiviral Particle Product Data

Total Page：16

File Type：pdf, Size：1020Kb

Download full-text PDF Read full-text
Hnrnph1 (NM 021510) Mouse Tagged ORF Clone Lentiviral Particle Product Data OriGene Technologies, Inc. 9620 Medical Center Drive, Ste 200 Rockville, MD 20850, US Phone: +1-888-267-4436 [email protected] EU: [email protected] CN: [email protected] Product datasheet for MR207170L4V Hnrnph1 (NM_021510) Mouse Tagged ORF Clone Lentiviral Particle Product data: Product Type: Lentiviral Particles Product Name: Hnrnph1 (NM_021510) Mouse Tagged ORF Clone Lentiviral Particle Symbol: Hnrnph1 Synonyms: AI642080; E430005G16Rik; Hnrnph; Hnrph1 Vector: pLenti-C-mGFP-P2A-Puro (PS100093) ACCN: NM_021510 ORF Size: 1347 bp ORF Nucleotide The ORF insert of this clone is exactly the same as(MR207170). Sequence: OTI Disclaimer: The molecular sequence of this clone aligns with the gene accession number as a point of reference only. However, individual transcript sequences of the same gene can differ through naturally occurring variations (e.g. polymorphisms), each with its own valid existence. This clone is substantially in agreement with the reference, but a complete review of all prevailing variants is recommended prior to use. More info OTI Annotation: This clone was engineered to express the complete ORF with an expression tag. Expression varies depending on the nature of the gene. RefSeq: NM_021510.2 RefSeq Size: 2242 bp RefSeq ORF: 1350 bp Locus ID: 59013 UniProt ID: O35737, Q811L7 Gene Summary: This protein is a component of the heterogeneous nuclear ribonucleoprotein (hnRNP) complexes which provide the substrate for the processing events that pre-mRNAs undergo before becoming functional, translatable mRNAs in the cytoplasm. Mediates pre-mRNA alternative splicing regulation. Inhibits, together with CUGBP1, insulin receptor (IR) pre-mRNA exon 11 inclusion in myoblast. Binds to the IR RNA. Binds poly(RG) (By similarity). [UniProtKB/Swiss-Prot Function] This product is to be used for laboratory only. Not for diagnostic or therapeutic use. View online » ©2021 OriGene Technologies, Inc., 9620 Medical Center Drive, Ste 200, Rockville, MD 20850, US 1 / 1.
Load more

Recommended publications
  • HNRPH1 (HNRNPH1) (NM 005520) Human Tagged ORF Clone Product Data
    OriGene Technologies, Inc. 9620 Medical Center Drive, Ste 200 Rockville, MD 20850, US Phone: +1-888-267-4436 [email protected] EU: [email protected] CN: [email protected] Product datasheet for RC201834 HNRPH1 (HNRNPH1) (NM_005520) Human Tagged ORF Clone Product data: Product Type: Expression Plasmids Product Name: HNRPH1 (HNRNPH1) (NM_005520) Human Tagged ORF Clone Tag: Myc-DDK Symbol: HNRNPH1 Synonyms: hnRNPH; HNRPH; HNRPH1 Vector: pCMV6-Entry (PS100001) E. coli Selection: Kanamycin (25 ug/mL) Cell Selection: Neomycin This product is to be used for laboratory only. Not for diagnostic or therapeutic use. View online » ©2021 OriGene Technologies, Inc., 9620 Medical Center Drive, Ste 200, Rockville, MD 20850, US 1 / 6 HNRPH1 (HNRNPH1) (NM_005520) Human Tagged ORF Clone – RC201834 ORF Nucleotide >RC201834 ORF sequence Sequence: Red=Cloning site Blue=ORF Green=Tags(s) TTTTGTAATACGACTCACTATAGGGCGGCCGGGAATTCGTCGACTGGATCCGGTACCGAGGAGATCTGCC GCCGCGATCGCC ATGATGTTGGGCACGGAAGGTGGAGAGGGATTCGTGGTGAAGGTCCGGGGCTTGCCCTGGTCTTGCTCGG CCGATGAAGTGCAGAGGTTTTTTTCTGACTGCAAAATTCAAAATGGGGCTCAAGGTATTCGTTTCATCTA CACCAGAGAAGGCAGACCAAGTGGCGAGGCTTTTGTTGAACTTGAATCAGAAGATGAAGTCAAATTGGCC CTGAAAAAAGACAGAGAAACTATGGGACACAGATATGTTGAAGTATTCAAGTCAAACAACGTTGAAATGG ATTGGGTGTTGAAGCATACTGGTCCAAATAGTCCTGACACGGCCAATGATGGCTTTGTACGGCTTAGAGG ACTTCCCTTTGGATGTAGCAAGGAAGAAATTGTTCAGTTCTTCTCAGGGTTGGAAATCGTGCCAAATGGG ATAACATTGCCGGTGGACTTCCAGGGGAGGAGTACGGGGGAGGCCTTCGTGCAGTTTGCTTCACAGGAAA TAGCTGAAAAGGCTCTAAAGAAACACAAGGAAAGAATAGGGCACAGGTATATTGAAATCTTTAAGAGCAG TAGAGCTGAAGTTAGAACTCATTATGATCCACCACGAAAGCTTATGGCCATGCAGCGGCCAGGTCCTTAT
    [Show full text]
  • Genetic and Pharmacological Approaches to Preventing Neurodegeneration
    University of Pennsylvania ScholarlyCommons Publicly Accessible Penn Dissertations 2012 Genetic and Pharmacological Approaches to Preventing Neurodegeneration Marco Boccitto University of Pennsylvania, [email protected] Follow this and additional works at: https://repository.upenn.edu/edissertations Part of the Neuroscience and Neurobiology Commons Recommended Citation Boccitto, Marco, "Genetic and Pharmacological Approaches to Preventing Neurodegeneration" (2012). Publicly Accessible Penn Dissertations. 494. https://repository.upenn.edu/edissertations/494 This paper is posted at ScholarlyCommons. https://repository.upenn.edu/edissertations/494 For more information, please contact [email protected]. Genetic and Pharmacological Approaches to Preventing Neurodegeneration Abstract The Insulin/Insulin-like Growth Factor 1 Signaling (IIS) pathway was first identified as a major modifier of aging in C.elegans. It has since become clear that the ability of this pathway to modify aging is phylogenetically conserved. Aging is a major risk factor for a variety of neurodegenerative diseases including the motor neuron disease, Amyotrophic Lateral Sclerosis (ALS). This raises the possibility that the IIS pathway might have therapeutic potential to modify the disease progression of ALS. In a C. elegans model of ALS we found that decreased IIS had a beneficial effect on ALS pathology in this model. This beneficial effect was dependent on activation of the transcription factor daf-16. To further validate IIS as a potential therapeutic target for treatment of ALS, manipulations of IIS in mammalian cells were investigated for neuroprotective activity. Genetic manipulations that increase the activity of the mammalian ortholog of daf-16, FOXO3, were found to be neuroprotective in a series of in vitro models of ALS toxicity.
    [Show full text]
  • Open Data for Differential Network Analysis in Glioma
    International Journal of Molecular Sciences Article Open Data for Differential Network Analysis in Glioma , Claire Jean-Quartier * y , Fleur Jeanquartier y and Andreas Holzinger Holzinger Group HCI-KDD, Institute for Medical Informatics, Statistics and Documentation, Medical University Graz, Auenbruggerplatz 2/V, 8036 Graz, Austria; [email protected] (F.J.); [email protected] (A.H.) * Correspondence: [email protected] These authors contributed equally to this work. y Received: 27 October 2019; Accepted: 3 January 2020; Published: 15 January 2020 Abstract: The complexity of cancer diseases demands bioinformatic techniques and translational research based on big data and personalized medicine. Open data enables researchers to accelerate cancer studies, save resources and foster collaboration. Several tools and programming approaches are available for analyzing data, including annotation, clustering, comparison and extrapolation, merging, enrichment, functional association and statistics. We exploit openly available data via cancer gene expression analysis, we apply refinement as well as enrichment analysis via gene ontology and conclude with graph-based visualization of involved protein interaction networks as a basis for signaling. The different databases allowed for the construction of huge networks or specified ones consisting of high-confidence interactions only. Several genes associated to glioma were isolated via a network analysis from top hub nodes as well as from an outlier analysis. The latter approach highlights a mitogen-activated protein kinase next to a member of histondeacetylases and a protein phosphatase as genes uncommonly associated with glioma. Cluster analysis from top hub nodes lists several identified glioma-associated gene products to function within protein complexes, including epidermal growth factors as well as cell cycle proteins or RAS proto-oncogenes.
    [Show full text]
  • Transcriptional Recapitulation and Subversion Of
    Open Access Research2007KaiseretVolume al. 8, Issue 7, Article R131 Transcriptional recapitulation and subversion of embryonic colon comment development by mouse colon tumor models and human colon cancer Sergio Kaiser¤*, Young-Kyu Park¤†, Jeffrey L Franklin†, Richard B Halberg‡, Ming Yu§, Walter J Jessen*, Johannes Freudenberg*, Xiaodi Chen‡, Kevin Haigis¶, Anil G Jegga*, Sue Kong*, Bhuvaneswari Sakthivel*, Huan Xu*, Timothy Reichling¥, Mohammad Azhar#, Gregory P Boivin**, reviews Reade B Roberts§, Anika C Bissahoyo§, Fausto Gonzales††, Greg C Bloom††, Steven Eschrich††, Scott L Carter‡‡, Jeremy E Aronow*, John Kleimeyer*, Michael Kleimeyer*, Vivek Ramaswamy*, Stephen H Settle†, Braden Boone†, Shawn Levy†, Jonathan M Graff§§, Thomas Doetschman#, Joanna Groden¥, William F Dove‡, David W Threadgill§, Timothy J Yeatman††, reports Robert J Coffey Jr† and Bruce J Aronow* Addresses: *Biomedical Informatics, Cincinnati Children's Hospital Medical Center, Cincinnati, OH 45229, USA. †Departments of Medicine, and Cell and Developmental Biology, Vanderbilt University and Department of Veterans Affairs Medical Center, Nashville, TN 37232, USA. ‡McArdle Laboratory for Cancer Research, University of Wisconsin, Madison, WI 53706, USA. §Department of Genetics and Lineberger Cancer Center, University of North Carolina, Chapel Hill, NC 27599, USA. ¶Molecular Pathology Unit and Center for Cancer Research, Massachusetts deposited research General Hospital, Charlestown, MA 02129, USA. ¥Division of Human Cancer Genetics, The Ohio State University College of Medicine, Columbus, Ohio 43210-2207, USA. #Institute for Collaborative BioResearch, University of Arizona, Tucson, AZ 85721-0036, USA. **University of Cincinnati, Department of Pathology and Laboratory Medicine, Cincinnati, OH 45267, USA. ††H Lee Moffitt Cancer Center and Research Institute, Tampa, FL 33612, USA. ‡‡Children's Hospital Informatics Program at the Harvard-MIT Division of Health Sciences and Technology (CHIP@HST), Harvard Medical School, Boston, Massachusetts 02115, USA.
    [Show full text]
  • Supplementary Table 1
    Supplementary Table 1 Name Class Description SU-8 CAN SU-8 Homo sapiens apoptosis related protein APR-4 mRNA, partial cds. AF144054 Apoptosis [AF144054] 3,300 BM023129 ie79h07.x1 Melton Normalized Human Islet 4 N4-HIS 1 Homo sapiens cDNA clone IMAGE:5673444 3' similar to SW:BUB3_MOUSE Q9WVA3 MITOTIC CHECKPOINT PROTEIN BM023129 Cell cycle BUB3 ;, mRNA sequence [BM023129] 0.332 TAGLN2 Differentiation Homo sapiens transgelin 2 (TAGLN2), mRNA [NM_003564] 3.349 HSPC065 Heat shock Homo sapiens HSPC065 protein (HSPC065), mRNA [NM_014157] 3.102 Homo sapiens chemokine (C-C motif) ligand 19 (CCL19), mRNA CCL19 Ligand [NM_006274] 3.800 THC2045396 Membrane O00429 (O00429) Dynamin-like protein, partial (16%) [THC2045396] 0.131 AW075437 xb23c01.x1 NCI_CGAP_Kid13 Homo sapiens cDNA clone IMAGE:2577120 3' similar to WP:C17G10.8 CE16861 FAT-3: AW075437 Metabolism ALCOHOL DEHYDROGENASE ;, mRNA sequence [AW075437] 0.314 Homo sapiens 3-hydroxyanthranilate 3,4-dioxygenase (HAAO), mRNA HAAO Metabolism [NM_012205] 4.733 3.885 Homo sapiens abhydrolase domain containing 9 (ABHD9), mRNA ABHD9 Metabolism [NM_024794] 3.689 NPEPL1 Metabolism Homo sapiens aminopeptidase-like 1 (NPEPL1), mRNA [NM_024663] 3.837 4.054 Homo sapiens pyridoxine 5'-phosphate oxidase (PNPO), mRNA PNPO Metabolism [NM_018129] 3.978 Homo sapiens solute carrier family 27 (fatty acid transporter), member SLC27A1 Metabolism 1 (SLC27A1), mRNA [NM_198580] 3.066 RIB2_HUMAN (P04844) Dolichyl-diphosphooligosaccharide--protein glycosyltransferase 63 kDa subunit precursor (Ribophorin II) (RPN-II) THC2159243
    [Show full text]
  • Ultraconserved Elements Are Associated with Homeostatic Control of Splicing Regulators by Alternative Splicing and Nonsense-Mediated Decay
    Downloaded from genesdev.cshlp.org on September 24, 2021 - Published by Cold Spring Harbor Laboratory Press Ultraconserved elements are associated with homeostatic control of splicing regulators by alternative splicing and nonsense-mediated decay Julie Z. Ni,1 Leslie Grate,1 John Paul Donohue,1 Christine Preston,2 Naomi Nobida,2 Georgeann O’Brien,2 Lily Shiue,1 Tyson A. Clark,3 John E. Blume,3 and Manuel Ares Jr.1,2,4 1Center for Molecular Biology of RNA and Department of Molecular, Cell, and Developmental Biology, University of California at Santa Cruz, Santa Cruz, California 95064, USA; 2Hughes Undergraduate Research Laboratory, University of California at Santa Cruz, Santa Cruz, California 95064, USA; 3Affymetrix, Inc., Santa Clara, California 95051, USA Many alternative splicing events create RNAs with premature stop codons, suggesting that alternative splicing coupled with nonsense-mediated decay (AS-NMD) may regulate gene expression post-transcriptionally. We tested this idea in mice by blocking NMD and measuring changes in isoform representation using splicing-sensitive microarrays. We found a striking class of highly conserved stop codon-containing exons whose inclusion renders the transcript sensitive to NMD. A genomic search for additional examples identified >50 such exons in genes with a variety of functions. These exons are unusually frequent in genes that encode splicing activators and are unexpectedly enriched in the so-called “ultraconserved” elements in the mammalian lineage. Further analysis show that NMD of mRNAs for splicing activators such as SR proteins is triggered by splicing activation events, whereas NMD of the mRNAs for negatively acting hnRNP proteins is triggered by splicing repression, a polarity consistent with widespread homeostatic control of splicing regulator gene expression.
    [Show full text]
  • View of All NF-Κb Post-Translational Modifications See Review by Perkins [179]
    UNIVERSITY OF CINCINNATI Date: 8-May-2010 I, Michael Wilhide , hereby submit this original work as part of the requirements for the degree of: Master of Science in Molecular, Cellular & Biochemical Pharmacology It is entitled: Student Signature: Michael Wilhide This work and its defense approved by: Committee Chair: Walter Jones, PhD Walter Jones, PhD Mohammed Matlib, PhD Mohammed Matlib, PhD Basilia Zingarelli, MD, PhD Basilia Zingarelli, MD, PhD Jo El Schultz, PhD Jo El Schultz, PhD Muhammad Ashraf, PhD Muhammad Ashraf, PhD 5/8/2010 646 Hsp70.1 contributes to the NF-κΒ paradox after myocardial ischemic insults A thesis submitted to the Graduate School of the University of Cincinnati in partial fulfillment of the requirement for the degree of Master of Science (M.S.) in the Department of Pharmacology and Biophysics of the College of Medicine by Michael E. Wilhide B.S. College of Mount St. Joseph 2002 Committee Chair: W. Keith Jones, Ph.D. Abstract One of the leading causes of death globally is cardiovascular disease, with most of these deaths related to myocardial ischemia. Myocardial ischemia and reperfusion causes several biochemical and metabolic changes that result in the activation of transcription factors that are involved in cell survival and cell death. The transcription factor Nuclear Factor-Kappa B (NF-κB) is associated with cardioprotection (e.g. after permanent coronary occlusion, PO) and cell injury (e.g. after ischemia/reperfusion, I/R). However, there is a lack of knowledge regarding how NF- κB mediates cell survival vs. cell death after ischemic insults, preventing the identification of novel therapeutic targets for enhanced cardioprotection and decreased injurious effects.
    [Show full text]
  • Analysis of Molecular Events Involved in Chondrogenesis and Somitogenesis by Global Gene Expression Profiling
    Technische Universit¨at Munc¨ hen GSF-Forschungszentrum Neuherberg Analysis of Molecular Events Involved in Chondrogenesis and Somitogenesis by Global Gene Expression Profiling Matthias Wahl Vollst¨andiger Abdruck der von der Fakult¨at Wissenschaftszentrum Weihen- stephan fur¨ Ern¨ahrung, Landnutzung und Umwelt der Technischen Univer- sit¨at Munc¨ hen zur Erlangung des akademischen Grades eines Doktors der Naturwissenschaften genehmigten Dissertation. Vorsitzender: Univ.-Prof. Dr. A. Gierl Prufer¨ der Dissertation: 1. Hon.-Prof. Dr. R. Balling, Technische Uni- versit¨at Carlo-Wilhelmina zu Braunschweig 2. Univ.-Prof. Dr. W. Wurst Die Dissertation wurde am 29. Oktober 2003 bei der Technischen Univer- sit¨at Munc¨ hen eingereicht und durch die Fakult¨at Wissenschaftszentrum Wei- henstephan fur¨ Ern¨ahrung, Landnutzung und Umwelt am 14. Januar 2004 angenommen. ii Zusammenfassung Um die molekularen Mechanismen, welche Knorpelentwicklung und Somito- genese steuern, aufzukl¨aren, wurde eine globale quantitative Genexpressions- analyse unter Verwendung von SAGE (Serial Analysis of Gene Expression) an der knorpelbildenden Zelllinie ATDC5 und an somitischem Gewebe, pr¨apariert von E10.5 M¨ausen, durchgefuhrt.¨ Unter insgesamt 43,656 von der murinen knorpelbildenden Zelllinie ATDC5 gewonnenen SAGE Tags (21,875 aus uninduzierten Zellen und 21,781 aus Zellen, die fur¨ 6h mit BMP4 induziert wurden) waren 139 Transkripte un- terschiedlich in den beiden Bibliotheken repr¨asentiert (P 0.05). 95 Tags ≤ konnten einzelnen UniGene Eintr¨agen zugeordnet werden
    [Show full text]
  • Ultraconserved Elements in the Human Genome
    R EPORTS 16. L. Shen, K. L. Rock, Proc. Natl. Acad. Sci. U.S.A. 101, J. Immunol. 171, 5668 (2003). Supporting Online Material 3035 (2004). 22. N. P. Restifo et al., J. Immunol. 154, 4414 (1995). www.sciencemag.org/cgi/content/full/304/5675/1318/ 17. S. P. Schoenberger et al., J. Immunol. 161, 3808 (1998). 23. We thank B. Buschling, D. Tokarchick, and A. Schell DC1 18. M. L. Albert, B. Sauter, N. Bhardwaj, Nature 392,86 for technical assistance. We are grateful to M. Epler Materials and Methods b (1998). and S. Tevethia for their generous gift of D - Figs. S1 and S2 19. M. Bellone et al., J. Immunol. 159, 5391 (1997). NP366-374 tetramers. This work was supported in part References and Notes 20. J. W. Yewdell, C. C. Norbury, J. R. Bennink, Adv. by a Wellcome Prize Traveling Fellowship and U.S. Immunol. 73, 1 (1999). Public Health Service grants, and NIH grant AI- 21. A. Serna, M. C. Ramirez, A. Soukhanova, L. J. Sigal, 056094-01 to C.C.N. 3 February 2004; accepted 14 April 2004 with the dog genome, which was estimated Ultraconserved Elements in the using reads from the National Center for Biotechnology Information (NCBI) trace ar- Human Genome chive (477/481 ϭ 99.2% of the elements aligning at an average of 99.2% identi- Gill Bejerano,1* Michael Pheasant,3 Igor Makunin,3 ty).Thus, it appears that nearly all of these Stuart Stephen,3 W. James Kent,1 John S. Mattick,3 ultraconserved elements may have been un- David Haussler2* der extreme negative selection in many spe- cies for more than 300 million years, and There are 481 segments longer than 200 base pairs (bp) that are absolutely some of them for at least 400 million years.
    [Show full text]
  • Coexpression Networks Based on Natural Variation in Human Gene Expression at Baseline and Under Stress
    University of Pennsylvania ScholarlyCommons Publicly Accessible Penn Dissertations Fall 2010 Coexpression Networks Based on Natural Variation in Human Gene Expression at Baseline and Under Stress Renuka Nayak University of Pennsylvania, [email protected] Follow this and additional works at: https://repository.upenn.edu/edissertations Part of the Computational Biology Commons, and the Genomics Commons Recommended Citation Nayak, Renuka, "Coexpression Networks Based on Natural Variation in Human Gene Expression at Baseline and Under Stress" (2010). Publicly Accessible Penn Dissertations. 1559. https://repository.upenn.edu/edissertations/1559 This paper is posted at ScholarlyCommons. https://repository.upenn.edu/edissertations/1559 For more information, please contact [email protected]. Coexpression Networks Based on Natural Variation in Human Gene Expression at Baseline and Under Stress Abstract Genes interact in networks to orchestrate cellular processes. Here, we used coexpression networks based on natural variation in gene expression to study the functions and interactions of human genes. We asked how these networks change in response to stress. First, we studied human coexpression networks at baseline. We constructed networks by identifying correlations in expression levels of 8.9 million gene pairs in immortalized B cells from 295 individuals comprising three independent samples. The resulting networks allowed us to infer interactions between biological processes. We used the network to predict the functions of poorly-characterized human genes, and provided some experimental support. Examining genes implicated in disease, we found that IFIH1, a diabetes susceptibility gene, interacts with YES1, which affects glucose transport. Genes predisposing to the same diseases are clustered non-randomly in the network, suggesting that the network may be used to identify candidate genes that influence disease susceptibility.
    [Show full text]
  • Supplemental Table 3 Two-Class Paired Significance Analysis of Microarrays Comparing Gene Expression Between Paired
    Supplemental Table 3 Two‐class paired Significance Analysis of Microarrays comparing gene expression between paired pre‐ and post‐transplant kidneys biopsies (N=8). Entrez Fold q‐value Probe Set ID Gene Symbol Unigene Name Score Gene ID Difference (%) Probe sets higher expressed in post‐transplant biopsies in paired analysis (N=1871) 218870_at 55843 ARHGAP15 Rho GTPase activating protein 15 7,01 3,99 0,00 205304_s_at 3764 KCNJ8 potassium inwardly‐rectifying channel, subfamily J, member 8 6,30 4,50 0,00 1563649_at ‐‐ ‐‐ ‐‐ 6,24 3,51 0,00 1567913_at 541466 CT45‐1 cancer/testis antigen CT45‐1 5,90 4,21 0,00 203932_at 3109 HLA‐DMB major histocompatibility complex, class II, DM beta 5,83 3,20 0,00 204606_at 6366 CCL21 chemokine (C‐C motif) ligand 21 5,82 10,42 0,00 205898_at 1524 CX3CR1 chemokine (C‐X3‐C motif) receptor 1 5,74 8,50 0,00 205303_at 3764 KCNJ8 potassium inwardly‐rectifying channel, subfamily J, member 8 5,68 6,87 0,00 226841_at 219972 MPEG1 macrophage expressed gene 1 5,59 3,76 0,00 203923_s_at 1536 CYBB cytochrome b‐245, beta polypeptide (chronic granulomatous disease) 5,58 4,70 0,00 210135_s_at 6474 SHOX2 short stature homeobox 2 5,53 5,58 0,00 1562642_at ‐‐ ‐‐ ‐‐ 5,42 5,03 0,00 242605_at 1634 DCN decorin 5,23 3,92 0,00 228750_at ‐‐ ‐‐ ‐‐ 5,21 7,22 0,00 collagen, type III, alpha 1 (Ehlers‐Danlos syndrome type IV, autosomal 201852_x_at 1281 COL3A1 dominant) 5,10 8,46 0,00 3493///3 IGHA1///IGHA immunoglobulin heavy constant alpha 1///immunoglobulin heavy 217022_s_at 494 2 constant alpha 2 (A2m marker) 5,07 9,53 0,00 1 202311_s_at
    [Show full text]
  • RNA Binding Density on X-Chromosome Differing from That on 22 Autosomes in Human
    RNA Binding Density on X-chromosome Differing from that on 22 Autosomes in Human LV Zhanjun*, LU Ying**, SONG Shuxia*, ZHAI Yu*,WANG Xiufang * *Department of Laboratory Animal, Hebei Medical University, Shijiazhuang 050017, China **Center for Theoretic Biology Peking University, Peking 100871, China Abstract To test whether X-chromosome has unique genomic characteristics, X-chromosome and 22 autosomes were compared for RNA binding density. Nucleotide sequences on the chromosomes were divided into 50kb per segment that was recoded as a set of frequency values of 7-nucleotide (7nt) strings using all possible 7nt strings (47=16384). 120 genes highly expressed in tonsil germinal center B cells were selected for calculating 7nt string frequency values of all introns (RNAs). The binding density of DNA segments and RNAs was determined by the amount of complement sequences. It was shown for the first time that gene-poor and low gene expression X-chromosome had the lowest percentage of the DNA segments that can highly bind RNAs, whereas gene-rich and high gene expression chromosome 19 had the highest percentage of the segments. On the basis of these results, it is proposed that the nonrandom properties of distribution of RNA highly binding DNA segments on the chromosomes provide strong evidence that lack of RNA highly binding segments may be a cause of X-chromosome inactivation. Key works: X-chromosome inactivation; intron RNA; DNA sequence composition; nucleotide string; Introduction Among placental mammals, the basic features of X-chromosome inactivation (XCI) are well established (BAILEY et al. 2000, OKAMOTO et al. 2000). XCI is the distinct difference between X-chromosome and autosomes.
    [Show full text]