UNIVERSITY OF CINCINNATI

Date: 8-May-2010

I, Michael Wilhide , hereby submit this original work as part of the requirements for the degree of: Master of Science in Molecular, Cellular & Biochemical Pharmacology It is entitled:

Student Signature: Michael Wilhide

This work and its defense approved by: Committee Chair: Walter Jones, PhD Walter Jones, PhD

Mohammed Matlib, PhD Mohammed Matlib, PhD

Basilia Zingarelli, MD, PhD Basilia Zingarelli, MD, PhD

Jo El Schultz, PhD Jo El Schultz, PhD

Muhammad Ashraf, PhD Muhammad Ashraf, PhD

5/8/2010 646 Hsp70.1 contributes to the NF-κΒ paradox after myocardial ischemic insults

A thesis submitted to the

Graduate School

of the University of Cincinnati

in partial fulfillment of the

requirement for the degree of

Master of Science (M.S.)

in the Department of Pharmacology and Biophysics

of the College of Medicine

by

Michael E. Wilhide

B.S. College of Mount St. Joseph

2002

Committee Chair: W. Keith Jones, Ph.D.

Abstract

One of the leading causes of death globally is cardiovascular disease, with most of these deaths

related to myocardial ischemia. Myocardial ischemia and reperfusion causes several biochemical

and metabolic changes that result in the activation of transcription factors that are involved in

cell survival and cell death. The transcription factor Nuclear Factor-Kappa B (NF-κB) is associated with cardioprotection (e.g. after permanent coronary occlusion, PO) and cell injury

(e.g. after ischemia/reperfusion, I/R). However, there is a lack of knowledge regarding how NF-

κB mediates cell survival vs. cell death after ischemic insults, preventing the identification of

novel therapeutic targets for enhanced cardioprotection and decreased injurious effects.

The objective of this thesis is to distinguish and determine the mechanisms underlying the

differential effects of NF-κB following ischemic insults. For example, NF-κB-dependent

cardioprotection after PO vs. NF-κB-dependent cell death after I/R. It is hypothesized that NF-

κB is a key signaling integrator that differentially regulates distinct sets of NF-κB-dependent

genes that contribute to cardioprotection or cell death after ischemic insults. Transgenic mice

were used, in which NF-κB activation is genetically blocked in the cardiomyocytes (DN), along with gene expression assays (e.g. microarrays and quantitative real-time PCR (QRT-PCR)) to

determine sets of genes that may contribute to cardioprotection and cell death.

Our results identified 16 genes both up- and down-regulated by NF-κB and after PO, which may

contribute to NF-κB-dependent cardioprotection after PO. In addition, our results revealed 59

genes both up- and down-regulated by NF-κB and after I/R, which may result in NF-κB-

ii dependent cell death after I/R. The main objective is to identify genes that are dysregulated (up-

and down-regulated) between PO and I/R (16 genes regulated by NF-κB and PO vs. 59 genes regulated by NF-κB and I/R). Only one gene was significantly up-regulated by NF-κB after PO and I/R, which is heat shock protein 90kDa alpha (cytosolic), class A member 1 (hsp90aa1).

However, heat shock protein 1A (hspa1a/hsp70.3) and heat shock protein 1B (hspa1b/hsp70.1)

genes are highly up-regulated in response to both ischemic insults. NF-κB significantly up-

regulated hspa1a after PO and hspa1a and hspa1b after I/R. QRT-PCR confirmed that hspa1a

and hspa1b genes are highly up-regulated by both ischemic insults and up-regulated by NF-κB.

In general, heat shock proteins 70 are known to be involved in cell survival and cell death

outcomes. However, there is a lack of information regarding the individual role of Hsp70.1 and

Hsp70.3 after myocardial ischemic insults. Therefore, Hsp70.1 and Hsp70.3 were investigated by

using Hsp70.1/Hsp70.3 double knockout mice and Hsp70.1 single knockout mice. Interestingly,

our results show that Hsp70.1 provided cardioprotection after PO, in contrast to causing cell

injury after I/R; whereas, Hsp70.3 may provide cardioprotection after I/R.

The significance of the research is the identification of unique sets of genes that may underlie the

NF-κB paradox. The novel findings of the thesis are that Hsp70.1 underlies NF-κB-dependent

cardioprotection after PO and NF-κB-dependent cell injurious effects after I/R. Our results

contribute to the understanding of how NF-κB differentially regulates cell survival versus cell

death effects after ischemic stimuli.

iii iv Acknowledgments

I would like to extend thanks to all the people who provided me with their wonderful advice, support, and encouragement during my graduate career at the University of Cincinnati.

First, I would like to thank Dr. W. Keith Jones for the opportunity to do research under his guidance and in his laboratory. I treasure and benefitted from his support, advice, guidance, and encouragement during my graduate career. Dr. Jones is truly a great scientist who is very dedicated to his research and the students in his laboratory. I am very grateful for Dr. Jones’ setting such a high standard for my work and for encouraging me to think critically on research aspects. His commitment of support, mentoring, and advice has guided me through my graduate training and enhanced my professional development.

I would also like to extend my appreciation and thanks to the members of my committee:

Chairperson Dr. W. Keith Jones, Dr. Muhammad Ashraf, Dr. Mohammad Matlib, Dr. Jo El

Schultz, and Dr. Basilia Zingarelli. I am very grateful for their support, encouragement, and dedication to my success as a graduate student throughout my graduate career. I appreciate their guidance in helping me successfully to graduate with a degree. Most importantly, I would like to thank them for their time spent listening and providing advice on my research.

My research would not have been possible without the help of Dr. Xiaoping Ren, who gave his time and expertise in the myocardial ischemia and reperfusion surgical models. Without his involvement, my research would not been accomplished. I enjoyed assisting Dr. Ren during the

v mice surgeries and talking to him about research. He is truly a wonderful senior member of Dr.

Jones’s lab. I am very grateful that I had a chance to work with him and learn from his expertise.

I would also like to thank the members of the genomics and microarray laboratory at the

University of Cincinnati (UC) for their microarray work. In addition, I extend thanks to the members of the statistical genomics and system biology laboratory at UC, especially Drs. Mario

Medvedovic, Maureen Sartor, and Jing Chen who assisted me with microarray analysis. Along with Travis Beckwith, a Ph.D. student in the University of Cincinnati Neuroscience program, who assisted in the editing and proofreading of this thesis.

I appreciate the current and past members of Dr. Jones’s lab, who provided their support and skills that contributed to my research. In addition, I would like to extend my gratitude to the following members of the lab: past Ph.D. student Dr. Maria Brown, Michael Tranter (Ph.D. summer 2010) and Jackie Belew (research assistant). Dr. Brown has provided me with wonderful support and advice during my early graduate career, which I appreciate. Michael Tranter provided me with crtical advice and insights on my research. Jackie Belew has provided me with support and encouragement, along with her critical guidance.

I am grateful for the faculty and staff of the Department of Pharmacology and Cell Biophysics of the University of Cincinnati for all of their support, advice and encouragement during my graduate career. Special thanks to the following people: Nancy Thyberg, Donna Gering, Carol

Ross, Damita Harris, and George Sfryis for their assistance. I would also like to thank the past and current students in the Molecular, Cellular, and Biochemical Pharmacology graduate

vi program for their support during my graduate studies. Also, I would like to thank Dr. Carl

Huether (a colleague of my mother and UC Professor Emeritus Biological Sciences) for providing me support, advice, and encouragement during my last year of graduate school.

I would like to acknowledge the NIH for the predoctoral fellowship and the NIH grants of Dr.

W. Keith Jones that provided me with the support and funding for my research.

Finally, I am very grateful that God has provided me with a wonderful family who has given me unconditional love and support throughout my life. I am very thankful for all the support that my family (my mother, Margaret Wolf; my step father Bill Wolf; my father, Steve Wilhide; and my brother, Brian Wilhide) has given me, especially during my graduate studies.

I would like to dedicate this thesis to my family and in honor of my grandfather, Dr. James D.

Weaver who was a wonderful mentor and inspiration to me.

vii Table of Contents

Abstract ii

Acknowledgment v

Table of Contents viii

List of Figures and Tables xvi

Chapter I: Introduction 1

Section 1. General Background 1

I.1.1 Cardiovascular Disease 1

I.1.2 Myocardial Ischemia 1

I.1.3 Ischemic Injury 1

I.1.4 Ischemia/Reperfusion 3

I.1.5 Reperfusion Injury 5

Calcium Paradox 6

Oxygen Paradox 7

I.1.6 Cell Death 8

Apoptosis 9

Table 1. Differences Between Necrosis and Apoptosis 10

Anti/Pro-Apoptotic Genes 12

Extrinsic Death Receptor-Mediated Pathways 12

Intrinsic Mitochondrial-Dependent Pathway 13

Endoplasmic Reticulum (ER)-Stress Cell Death Pathway 14

Figure 1. Cell Death Pathways 16

viii I.1.7 Cell Death After Ischemia and Ischemia/Reperfusion 20

I.1.8 Summary of Background 21

Figure 2. Summary of Background 23

Section 2. Cellular Response to Ischemic and Reperfusion Stresses 24

I.2.1 Unfolded Protein Response 24

I.2.2 Heat Shock Proteins 26

Hsp90 Family 26

Hsp70 Family 27

Hsp60 Family 29

I.2.3 Inflammatory Response 30

I.2.4 Nitric Oxide Synthesis 31

I.2.5 Summary 32

Section 3. Regulation of Transcription Factors 32

I.3.1 Hypoxia-Inducible factor 33

I.3.2 Heat Shock Factor 34

I.3.3 Activating Protein 1 35

I.3.4 Activating Transcription Factor 35

I.3.5 X-box Protein 1 36

I.3.6 DNA Damage-Induced Transcript 3 36

I.3.7 Nuclear Receptor Subfamily 4, Group A, Member 1 37

I.3.8 Nuclear Factor Interleukin 3 Regulated 37

I.3.9 Nuclear Factor of Activated T-cells 38

I.3.10 Nuclear Factor-Kappa B 38

ix Section 4. Nuclear Factor-Kappa B (NF-κB) 39

I.4.1 Rel Super Family 39

I.4.2 NF-κB Family 40

Figure 3. Rel Super Family 41

I.4.3 Inhibitor Kappa B (IκB) 44

I.4.4 IκB Kinase (IKK) 45

Figure 4. IκB and IΚΚ Structure Domains 46

I.4.5 NF-κB Activation Pathways 48

Figure 5. NF-κB Activation Pathways 49

I.4.6 NF-κB Translocational Modifications 50

I.4.7 Role of TNF-α and NF-κB in vitro 51

I.4.8 Role of TNF-α after PO and I/R 53

I.4.9 Role of NF-κB after PO 54

I.4.10 Role of NF-κB after I/R 54

I.4.11 NF-κB Summary 55

Figure 6. Summary of the NF-κB Section 57

Section 5. Thesis Objectives and Hypothesis 58

Chapter II: Materials and Methods 59

Section 1. Animal Models 59

II.1.1 IκBDN Mice 59

II.1.2 HSP70.1/.3 KO Mice 60

II.1.3 HSP70.1 KO Mice 60

x II.1.4 Genotyping 61

Genomic DNA Isolation 61

DN Mice Genotyping (PCR) 62

Hsp70.1/3 KO Mice Genotyping (PCR) 62

Hsp70.1 KO Mice Genotyping (PCR) 63

Section 2. Myocardial Ischemia Model 63

Section 3. Myocardial Infarct Analysis 64

Section 4. Tissue Isolation 66

II.4.1 Nuclear and Cytoplasmic Extracts 66

II.4.2 Protein Assay 67

II.4.3 Western Blots 68

II.4.4 Western Blot Analysis 69

Section 5. RNA Isolation 70

Section 6. Microarray 71

Figure 7. Gene Microarray Strategy 72

Section 7. Quantitative Real Time PCR (QRT-PCR) 74

Table 2. QRT-PCR Primers 76

Section 8. Statistical Analysis 77

Chapter III: Results 78

Section 1. NF-κB Paradox 78

III.1.1 Role of NF-κB after PO and I/R 78

Figure 8. Infarct Analysis After PO and I/R 79 xi III.1.2 NF-κB-Dependent Cardioprotection after PO 81

Figure 9. Infarct Analysis after PO 82

III.1.3 NF-κB Translocation after PO 83

Nuclear and Cytoplasmic Extracts 83

NF-κB Translocation 84

Figure 10. NF-κB Translocation after PO 85

Section 2. Genes Regulated after PO and I/R, and by NF-κB 87

III.2.1 PO Regulated Genes 87

Table 3. The 20 Most Significantly Regulated Genes after PO 89

Table 4A. The 20 Most Significantly Regulated Gene Ontology 90

Table 4B. The 5 Most Significantly Regulated KEGG Pathways 90

III.2.2 Genes Regulated by NF-κB in Response to PO 91

Table 5. The 20 Most Significantly Regulated Genes 92

Table 6A. The 20 Most Significantly Regulated Gene Ontology 93

Table 6B. Significantly Regulated KEGG Pathways 93

III.2.3 Genes Regulated After PO and by NF-κB 94

Figure 11. Genes Significantly Regulated by PO and NF-κB 95

Table 7. Genes Significantly Regulated by NF-κB and after PO 96

Table 8A. Significantly Regulated GO Categories 97

Table 8B. Significantly Regulated KEGG Pathways 97

III.2.4 I/R Regulated Genes 98

Table 9. 20 Most Significantly Regulated Genes after I/R 99

xii Table 10A. 20 Most Significantly Regulated Gene Ontology 100

Table 10B. 5 Most Significantly Regulated KEGG Pathways 100

III.2.5 Genes Regulated by NF-κB in Response to I/R 101

Table 11. 20 Most Significantly Regulated Genes by NF-κB in 102

Response to I/R

Table 12A. 20 Most Significantly Regulated Gene Ontology 103

Table 12B. 5 Most Significantly Regulated KEGG Pathways 103

III.2.6 Genes Regulated by after I/R and by NF-κB 104

Figure 12. Genes Regulated after I/R and by NF-κB 105

Table 13 Genes Significantly Regulated by after I/R and by NF-κB 106

Table 14A. Significantly Regulated Gene Ontology 109

Table 14B. Significantly Regulated KEGG Pathways 111

III.2.7 Genes Regulated after PO and by NF-κB Compared to 112

Genes Regulated after I/R I/R and by NF-κB

Figure 13. Venn Diagram Genes Regulated by NF-κB and after PO 113

Section 3. Validation of Genes that were Significantly Regulated by NF-κB 114 and after PO and I/R

III.3.1 QRT-PCR Validation 114

Figure 14. Genes Validated by QRT-PCR 116

III.3.2 Hsp70 Western Blot Validation 120

Figure 15. Hsp70 Western Blots 123

III.3.3 Functional Assessment of Hsp70.1 and Hsp70.3 120

xiii Figure 16. Functional Role of Hsp70.1 and Hsp70.3 After PO 124

Figure 17. Functional Role of Hsp70.1 and Hsp70.3 After I/R 125

Chapter IV: Discussion 130

Section 1. Cardiovascular Disease 130

Section 2. NF-κB Paradox

IV.2.1 NF-κB Paradox 130

IV.2.2 NF-κB-Dependent Cardioprotection after PO 133

IV.2.3 NF-κB-Dependent Cell Death after I/R 135

IV.2.4 Summary of NF-κB paradox 136

Figure 18. Summary of NF-κB Paradox 138

Section 3. Genes Regulated after PO and I/R, and by NF-κB 139

IV.3.1 Genes Regulated after PO and by NF-κB 140

Genes Regulated after PO 140

Genes Regulated by NF-κB in Response to PO 144

Genes Regulated after PO and by NF-κB 147

IV.3.2 Genes regulated after I/R and by NF-κB 150

Genes Regulated after I/R 151

Genes Regulated by NF-κB in Response to I/R 152

Genes Regulated after I/R and by NF-κB 153

IV.3.3 Genes Regulated after PO and by NF-κB Compared to 154

xiv Genes Regulated after I/R and by NF-κB

Rationale for Examing for hspa1a and hspa1b Genes 156

Section 4. Validation of Genes Regulated after PO and I/R, and by NF-κB 158

IV.4.1 QRT-PCR Validation 159

PO and NF-κB Gene Validation 159

I/R and NF-κB gene validation 160

IV.4.2 Hsp70 Western Blot Validation 161

IV.4.3 Functional Assessment of Hsp70.1 and Hsp70.3 163

Role of Hsp70.1 and Hsp70.3 After PO 163

Role of Hsp70.1 and Hsp70.3 After I/R 164

Role of Hsp70.1 and Hsp70.3 165

Section 5. Thesis Summary 167

Section 6. Future Research Directions 168

References 173

Appendix 213

xv List of Figures and Tables

Table 1. Differences Between Necrosis and Apoptosis 10

Figure 1 Cell Death Pathways 16

Figure 2 Summary of Background 23

Figure 3. Rel Super Family 41

Figure 4. IκB and IΚΚ Structure Domains 46

Figure 5. NF-κB Activation Pathways 49

Figure 6. Summary of the NF-κB 57

Figure 7. Gene Microarray Strategy 72

Table 2. QRT-PCR Primers 76

Figure 8. Infarct Analysis After PO and I/R 79

Figure 9. Infarct Analysis After PO 82

Figure 10. NF-κB Translocation After PO 85

Table 3. 20 Most Significantly Regulated Genes After PO 89

Table 4A. 20 Most Significantly Regulated Gene Ontology 90

Table 4B. 5 Most Significantly Regulated KEGG Pathways 90

Table 5. 20 Most Significantly Regulated Genes by NF-κB 92

Table 6A. 20 Most Significantly Regulated Gene Ontology 93

Table 6B. Significantly Regulated KEGG Pathways 93

Figure 11. Genes Regulated by PO and NF-κB 95

Table 7. Genes Significantly Regulated by NF-κB and After PO 96

Table 8A. Significantly Regulated Gene Ontology 97

xvi Table 8B. Significantly Regulated KEGG Pathways 97

Table 9. 20 Most Significantly Regulated Genes After I/R 99

Table 10A. 20 Most Significantly Regulated Gene Ontology 100

Table 10B. 5 Most Significantly Regulated KEGG Pathways 100

Table 11. 20 Most Significantly Regulated Genes by NF-κB in Response to I/R 102

Table 12A. 20 Most Significantly Regulated Gene Ontology 103

Table 12B. 5 Most Significantly Regulated KEGG Pathways 103

Figure 12. Genes Regulated by NF-κB and I/R 105

Table 13. Genes Significantly Regulated by NF-κB and After I/R 106

Table 14A. Significantly Regulated Gene Ontology 110

Table 14B. Significantly Regulated KEGG Pathways 111

Figure 13. Venn Diagram: Genes Regulated by NF-κB and After PO 113

Figure 14. Genes Validated by QRT-PCR 116

Figure 15. Hsp70 Western Blots 123

Figure 16. Functional Role of Hsp70.1 and Hsp70.3 After PO 124

Figure 17. Functional Role of Hsp70.1 and Hsp70.3 After I/R 127

Figure 18. Summary of NF-κB Paradox 138

xvii Chapter I: Introduction

I.1 General Backgr ound

I.1.1 Cardiovascular Diseases

Twenty-nine percent of all deaths are from cardiovascular diseases (CVDs), which currently

remain the leading cause of death globally [1]. CVDs are composed of several disorders

affecting the heart and blood vessels, including coronary heart disease, cerebrovascular disease,

peripheral arterial disease, rheumatic heart disease, congenital heart disease, deep vein

thrombosis, and pulmonary embolism [1]. It is estimated that 20% of all deaths in the United

States are due to coronary heart disease (CHD), one of the most common types of CVDs [2].

CHD includes conditions such as acute myocardial ischemia, unstable angina (unpredictable

chest pains), and myocardial infarction [2].

I.1.2 Myocardial Ischemia

Myocardial ischemia is defined as a lack of oxygen resulting from reduced blood flow [3].

Clinically, the narrowing of a coronary artery results from vascular spasms, atherosclerotic

plaque, and thrombotic occlusion resulting in myocardial ischemia [3]. Experimentally,

myocardial ischemia is produced by a ligation or occlusion of a coronary artery in vivo, which is the closest approach to clinical myocardial ischemia [3,4]. Permanent occlusion (PO) is a complete occlusion without reperfusion (prolonged ischemia), which results in cell death and myocardial dysfunction [4].

1 Within minutes of myocardial ischemia, a rapid switch from aerobic or mitochondrial

metabolism to anaerobic glycolysis occurs, resulting in an increased production of lactate and

protons (H+) [5-7]. The increase of H+ results in acidic conditions and activates the Na+/ H+

exchanger, leading to the removal of H+ and pumping in of Na+. This exchange, along with

opening Na+ channels, results in an increase of intracellular Na+ [5-8]. The failure of the

sarcolemmal Na+-K+ ATPase (due to lack of ATP during ischemia) results in high intracellular

Na+ and sarcolemmal depolarization, which leads to the reversal of the Na+/ Ca2+ exchanger [5-

9]. The reversal of the Na+/ Ca2+ exchanger and the open L-type Ca2+ channel contributes to the

increase of intracellular Ca2+ levels [5,9,10]. Under normal conditions, sarcoplasmic reticulum

Ca2+-ATPase (SERCA) uptakes Ca2+ and releases it from the sarcoplasmic reticulum Ca2+

release channel (Ryanodine receptors, RyR) during the contraction-relaxation cycle of the heart

[10]. However, a lack of ATP during ischemia results in a decreased function of the SERCA and increased levels of cytosolic Ca2+ can stimulate sarcoplasmic reticulum (SR) Ca2+ release [9].

The reversal of the Na+/ Ca2+ exchanger, the L-type Ca2+ channel, and SR dysfunction results in

calcium overload [5,9,10]. Calcium overload in the cardiomyocytes results in uncontrolled

hyper-contraction, activation of calcium-dependent proteases, and the opening of the

mitochondrial permeability transition pore (MPTP), resulting in cell death [5,11,12].

I.1.3 Ischemic Injury

Ischemic injury refers to the characteristic patterns of metabolic and ultra-structural changes that

occur during ischemia, leading to cell death [13]. The first 15 minutes of ischemia result in an

increase of lactate, adenosine monophosphate (AMP), inosine, adenosine, hypoxanthine,

xanthine, and H+, while decreases of glycogen, adenosine triphosphate (ATP), adenosine

2 diphosphate (ADP), creatine phosphate, and adenine nucleotide are also observed [6,14]. These metabolic changes result in reduced contraction and leave most of the cells alive, which is referred to as reversible injury [6,14].

Prolonged ischemia lasting from 40 to 60 minutes results in cardiomyocytes exhibiting minimal

(<5%) levels of ATP, termination of anaerobic glycolysis, and increased H+, AMP, lactate, and inosine [6,13-16]. These metabolic changes along with an increase in osmotic load results in mitochondrial swelling, disruption of the sarcolemma, and clumping of nuclear chromatin associated with irreversible injury (necrotic cell death) [6,13-16]. Most of the cardiomyocytes in the subendocardium (central zone) are mostly necrotic following 1 hour of ischemia [6,13-16].

Prolonged ischemia lasting 3 hours has been shown to increase irreversible injury in the subepicardium (peripheral zone), exhibiting necrotic cell death, and displaying contraction bands

(hyper contracted myofibrils) and calcium deposits [6,13-16]. Cells located in the most peripheral zone (the border zone) show less severe injury and are associated with the evolution of injury [13]. Reimer and Jennings coined the term “wavefront phenomenon” to describe the movement of necrosis within the risk region from the subendocardium into the subepicardium after prolonged ischemia [13,16].

I.1.4 Ischemia/Reperfusion (I/R)

After an ischemic event, several clinical therapeutic procedures to reperfuse the myocardium may be employed: thrombolysis, angioplasty, and coronary bypass surgery [17]. The goal of reperfusion is to perfuse the myocardium with oxygen and blood, and to reduce infarct size [17].

Ideally, reperfusion should occur within 2 to 3 hours after the initial ischemic event, which

3 reduces the extent of the myocardial infarction [17]. Myocardial tissue exposed to a transient

ischemic event (reversible ischemic injury) followed by reperfusion may result in a syndrome

called “myocardial stunning” [18-20]. In contrast, myocardium exposed to chronic

hypoperfusion (low flow ischemia) may result in decreased contraction (reversible ischemic

injury), which can be recovered after reperfusion and is known as “myocardial hibernation”

[21,22].

Myocardial stunning is defined as the mechanical dysfunction (reduction of contraction) that

persists after reperfusion without irreversible damage (cell death) despite restoration of normal

coronary flow [18-20]. The mechanical dysfunction is fully reversible despite the length or

severity of the dysfunction, and not the result of cell injury that occurs during reperfusion [18-

20]. Possible factors that are involved in the severity of myocardial stunning are the following: generation of oxygen-derived free radicals, calcium overload, and decreased responsiveness of contraction filaments to calcium [19]. It is hypothesized that the dysfunction is fully reversible by limiting oxidative stress and/or re-synthesis of contractile proteins [19].

Myocardial hibernation is a term that describes a condition in which sustained abnormal contraction occurs as the result of a chronic reduction of blood flow in patients with CHD [21-

23]. However, ventricular function is restored by revascularization (e.g. coronary artery bypass

graft) [21-23]. Hibernating myocardium maintains viability (e.g. lack of irreversible injury) of

the dysfunctional myocardium, which relies on an increased uptake of glucose [22,24]. In 1989,

Rahimtoola hypothesized that chronic hypoperfusion results in a self-protecting down-regulation

of function and metabolism processes, thereby minimizing the energy requirements and

4 preventing irreversible injury (e.g. cell death) [22,24]. The current hypothesis is that chronic

hypoperfusion results in altered metabolism, decreased contraction, changes in Ca2+ homeostasis,

inhibition of cell death, and promotion of cell survival (e.g. increased expression of stress

proteins and angiogenic genes) [22].

Prolonged ischemia followed by reperfusion results in a phenomenon known as “no-reflow”

[14]. Clinical and experimental data have shown no-reflow phenomenon can occur in up to 50% of cases after reperfusion [25]. The clinical definition of no reflow phenomenon is stated as inadequate perfusion of the myocardium after reperfusion of the coronary circulation without vessel obstruction [25]. In humans, no reflow can be the result of susceptibility of coronary microcirculation injury (e.g. ischemic injury and reperfusion injury) [25].

I.1.5 Reperfusion Injury

The term reperfusion injury refers to cell damage or death caused by reperfusion, as distinguished from cell damage or death caused by the preceding ischemic event [26-31]. Other

researchers suggest that reperfusion injury is a broader term, including depressed mechanical

function and events that occur after reperfusion, such as reperfusion arrhythmia, vascular

damage, no-reflow, and myocardial stunning [30,32-34]. Jennings et al. proposed the term reperfusion injury to be defined, as additional cell death that occurs from the metabolic effects of reperfusion and not from persistent ischemia (e.g. no-reflow phenomenon) [30].

In 1960, Jennings and colleagues showed that reperfusion could accelerate cell damage [35,36].

Hearse proposed in 1977 that there are similarities between reperfusion damage and the calcium

5 paradox [32,36,37]. The calcium paradox describes the irreversible contracture (cell injury) that

occurs when extracellular Ca2+ is returned to the myocardium after a Ca2+ free period [32,36,37].

In 1978, Hearse and colleagues described the oxygen paradox, which related to the calcium

paradox in rat hearts [32,38]. The oxygen paradox describes the phenomenon where the

reintroduction of oxygen (e.g. reperfusion or reoxygenation) after a period of no oxygen (e.g.

ischemia or hypoxia) results in an increased level of reactive oxygen species (ROS) and cell

injury (e.g. intensification of contracture bands, disruption of myofibrils, and sarcolemma and

mitochondrial dysfunction) [32,38]. The major constituents of reperfusion injury are the calcium

paradox (calcium overload) and oxygen paradox (oxygen radicals).

Calcium Paradox

An increase of intracellular Ca2+ after an ischemic event results in Ca2+-induced cell injury

[5,11,12]. As discussed earlier, ischemia leads to an increase in Na+ which causes an increase of

intracellular Ca2+ resulting from the reversal of the Na+/ Ca2+ exchanger, L-type Ca2+ channel,

and SR dysfunction (section I.1.2). During ischemia, if the mitochondria maintain a protein

gradient in their inner membrane, an increase in the mitochondrial potential (∆ψm) and an

increased up-take of Ca2+ (Ca2+-uniporters) may be observed [39,40]. The Ca2+ influx into the

mitochondria would lead to the opening of the MPTP; however, during ischemia low pH and a

lack of ATP prevents the opening of the MPTP [39,40].

After reperfusion, if the cardiomyocytes are viable but damaged, two outcomes may occur [39].

For the first outcome, if ATP synthesis is commensurate and recovers from calcium-overload

(excess Ca2+ pumped into the SR, and without mitochondrial Ca2+ overload), the cell may survive

6 [39,40]. However, if ATP levels are unstable (due to mitochondrial damage) and intracellular

Ca2+ remains high (due to SR damage and reversal of the Na+/ Ca2+), increased Ca2+ uptake into the mitochondria will take place [39,40]. The increase of Ca2+ into the mitochondria and increase

of the ∆ψm (respiration and increase in pH) will result in the opening of the MPTP, leading to

cell death [39,40]. Calcium overload also results in Ca2+-mediated hypercontracture, activation of Ca2+-mediated proteases (e.g. Calpain), and Ca2+-dependent endonucleases, which can also lead to cell death [39,40].

Oxygen Paradox

In 1973, Hearse and colleagues described the phenomenon of re-oxygenation damage in which

significant cell damage after reperfusion of the myocardium was observed, eventually leading to

the oxygen paradox theory [41,42]. The reintroduction of oxygen (after ischemia/hypoxia)

results in the formation of oxygen-derived free radicals, which contributes to cell injury

[32,41,43]. During ischemia, reduction of the components of the electron transport chain (ETC)

proximal to cytochrome C1 and reduced activity of anti-oxidant enzymes (superoxidase

dismutase and glutathione peroxidase) results in a low level of ROS [5,32,41,43]. Low levels of

ROS during ischemia could damage the ETC and result in increased ROS production upon

reperfusion due to an inefficient transfer of electrons [5,32,41,43]. The reintroduction of oxygen

(reperfusion) results in a large burst of ROS in the cardiomyocytes [5]. The sources of ROS in

the cardiomyocytes are mostly from the increase in oxygen tension and mitochondrial injury

- (damage to ETC proteins) [5,32,41,43]. Molecular oxygen (O2) gains an electron (e ) that forms a

superoxide anion radical (O2•-), which occurs at complex I (NADH coenzyme-Q reductase) and

complex III (ubiquinoil cytochrome C reductase) in the ETC [5,32,41,43]. The superoxide anion 7 radical (O2•-) is reduced by the univalent pathway resulting in the formation of anion hydrogen peroxide (H2O2), which is longer lasting and more stable than ROS [43]. ROS can also be synthesized by endothelial cells through an enzymatic reaction that involves xanthine oxidase, and from inflammatory cells (e.g. marcophages and neutrophils) that contain NAPDH oxidase

[24,32,41,43]. High levels of ROS initiate myocardial apoptosis, which activates signaling pathways and transcription factors [43,44].

I.1.6 Cell Death

As stated earlier (section I.1.2-I.1.3), ischemia results in dysfunction of the Na+/K+ ATPase, Ca2+ overload, and an increase in osmotic load, causing irreversible injury [6,13-16]. The characteristics of irreversible injury are mitochondrial swelling, disruption of the sarcolemma, and clumping of nuclear chromatin, which resembles necrotic cell death [6,13-16]. The term necrosis refers to the form of cell death that produces cellular swelling, destructive fragmentation and distribution of chromatin irregularly throughout the cytoplasma (karyorrhexis), fragmentation and loss of cytoplasmic structure, and increased inflammation [6,13-16,45-49].

However, in 1995 Majno and Joris proposed the term necrosis as the sum of degradative changes that occur after cell death, and not as a form of cell death itself [13,46-49]. Majno and Joris also used the term oncosis (derived from onkos, meaning swelling) to describe cell death that occurs from cell swelling and karyorrhexis [13,46-48]. In terms of this thesis, the term necrosis will refer to non-apoptotic cell death or accidental cell death as described in Table 1 (Differences

Between Necrosis and Apoptosis) [13,46-49].

8 Apoptosis

Apoptosis, also known as programmed cell death, is a highly regulated process that requires

energy (e.g. ATP) [46,47]. There is a genetic program that encodes both anti- and pro-apoptotic proteins, and the activation of either the extrinsic death receptor-mediated pathway or an intrinsic mitochondrial-dependent pathway leads to apoptotic death [46,47]. Apoptotic pathways lead to the activation of the cysteine-dependent aspartate-directed proteases (caspases), which execute

cell death by DNA fragmentation [48]. Table 1 shows the different morphological and

biochemical features between necrosis and apoptosis, and techniques used to detect necrotic and

apoptotic cells.

9 Table 1. Differences between Necrosis and Apoptosis

Necrosis Apoptosis Morphological Loss of membrane integrity Intact membrane integrity, but Features membrane blebbing

Disruption of chromatin and nuclear Total chromatin at the nuclear fragments throughout the cytoplasm membrane

Cell Swelling Cell Shrinkage

Total cell lysis Fragmentation of cell (smaller cell bodies)

No vesicle formation Formation of apoptotic bodies (membrane bound vesicles)

Mitochondrial swelling Mitochondrial leakage (formation of mitochondrial permeability transition pore) Biochemical Lack of ion homeostasis Activation of apoptotic pathways Features No ATP (energy) required Requires ATP (energy)

Random DNA digestion Non-random DNA fragmentation (oligonucleosomal length fragment)

Blunt ends of DNA fragmentation Double-strand breaks in DNA with (late cell death) staggered ends at the 3’ end (overhangs up to 4 single base at the 3’ ends)

Presence of cytochrome C and apoptosis inducing factor (AIF) in the cytoplasm

Active and cleaved caspases

Phosphatidylserine translocation from the cytoplasmic to the extracellular side of the membrane (early stage of apoptosis

Phagocytosis by macrophages Phagocytosis by macrophages or adjacent cells

Large inflammatory response No inflammatory response

10 Continue Table 1. Differences between Necrosis and Apoptosis

Necrosis Apoptosis

Detection Presence of membrane permeability Absence of membrane permeability Methods via impermeable membrane tracers (antimyosin antibodies, propidium iodide (PI), or ethidium bromide)

Morphological features: cell swelling, Morphological features: cell shrinkage, nuclear alteration patterns, and nuclear alteration patterns, and organelles structure features organelles structure features

DNA gel electrophoresis: diffused DNA gel electrophoresis: random DNA fragmentation (smear) multistranded DNA fragmentation (ladder)

Negative histochemical detection of Positive histochemical detection of double-stranded DNA fragmentation TUNEL that detects specific single (using a specific terminal base overhang at the 3’ ends (e.g. in deoxynucleotidyl transferase dUTP situ DNA ligase) nick end labeling, specifically (TUNEL) which detects specific single base overhang at the 3’ ends only Detection of increased phosphatidylserine in the outer cell Most TUNEL assays can detect both membrane (early stage of apoptosis) blunt DNA breaks (necrosis) and double-strand breaks in DNA with Caspase activation and cleavage (e.g. staggered ends with a 3’ (apoptosis) Western blots)

Increased pro-apoptotic gene expression

References used to create the table:13,46-49.

11 Anti/Pro-Apoptotic Genes

The current molecular regulation of apoptosis in mammalian cells first came from the

discoveries of genes inducing (e.g. ced-3, ced-4) and repressing (e.g. ced-9) cell death in the

nematode Caenorhabditis elegans [50]. The mammalian counterparts to ced-3, ced-4 and ced-9

are the family of proteins known as Bcl-2 [50]. The bcl-2 family consists of several members

that are thought to promote apoptotic cell death (pro-apoptotic genes: bax, bak, bad, bid, bim,

bik, bok, bnip3l, nik and hrk) as well as prevent cell death (anti-apoptotic genes: bcl-2, bcl-xL,

bcl-W, bfl-1, mjcl-1, and a1) [50-53].

Extrinsic Death Receptor-Mediated Pathway

The extrinsic pathway is activated by the binding of cellular death ligands, such as tumor

necrosis factor alpha (TNF-α), fas ligand (Fasl, Apo1l, CD95l), Trail/Apo2l, and Apol3 to their

death domain (DD) receptors such as TNF-receptor 1 (TNFR1), Fas-receptors (FasR), and other death domain receptors (DR): DR3, DR4, DR5 and DR6 (Figure 1A) [50-53]. Binding of death ligands to their DRs results in the formation of a complex called the death-inducing signaling complex (DISC), which is composed of homotypic interactions between the DD and death effector domain (DED) proteins (Figure 1A) [50-53]. For example, Fasl binding to its FasR, or

TNF-α binding to TNFR1, results in receptor trimerization between the DDs and adaptor proteins such as Fas-associated DD protein (FADD) or TNFR1-associated DD (TRADD) (Figure

1A) [50-53]. FADD and TRADD bind to other proteins and recruit caspase-8 or -10 to the complex to be cleaved for full activation (Figure 1A) [50-53]. The active caspase-8 cleaves Bid and caspase-3, which results in cleavage of caspase substrates such as PARP, leading to caspase- dependent apoptotic cell death (Figure 1A) [50-53]. In addition, the TNFR1 and FasR signaling 12 cascade results in activation of transcriptional factors such as nuclear factor kappa-B (NF-κB) and activator protein 1 (AP-1), and the activation of the Jun-N-terminal kinase pathway (JNK pathway) which regulates apoptotic mechanisms [50-53].

Intrinsic Mitochondrial-Dependent Pathway

The opening of the MPTP activates the intrinsic apoptoticpathway [50-54]. Under normal

physiological conditions, the mitochondrial inner membrane is impermeable except for a few

specific metabolites and ions [54]. However, under apoptotic signaling, members of the Bcl-2

family can regulate the MPTP [54]. For example, Bad can bind to both Bcl-2 and Bcl-xL, which

allows Bax/Bak to translocate into the mitochondria and form a mitochondrial pore complex

(Figure 1B) [54]. The opening of the MPTP also results in the release of intermembrane space

proteins such as apoptosis inducing factor (AIF), Smac/DIABLO, and cytochrome C (Figure 1B)

[50-54]. The release of AIF leads to caspase-independent cell death, whereas cytochrome C and

smac/DIABLO leads to the activation of caspase-dependent cell death (Figure 1B) [50-54].

Cytochrome C in the cytoplasm initiates a complex with apoptosis-activating factor (Apaf) and

ATP, which is called the apoptosome [50-54]. The apoptosome recruits and cleaves caspase-9,

resulting in its activation. The active form of caspase-9 leads to the activation of caspase-3,

which cleaves caspase substrates, resulting in caspase-dependent death [50-54]. The release of

Smac/DIABLO into the cytoplasm leads to direct activation of caspase-3 and caspase-dependent

death (Figure 1B) [50-54].

13 Endoplasmic reticulum (ER)-Stress Cell Death Pathway

ER is involved in several functions including protein folding, calcium homeostasis, biosynthesis,

and release of membrane proteins [55,56]. Myocardial ischemia and reperfusion stimuli results in

misfolded proteins, activation of unfolded protein response (UPR), and ER-stress induced cell death [55]. The accumulation of unfolded and misfolded proteins can initiate ER-apoptotic

signaling [55,56]. ER-chaperon glucose-regulated factor 78 (GRP78/Hspa5/BiP) under normal

conditions binds to ER transmembrane sensors proteins (Protein kinase-like ER kinase (PERK); inositol-requiring kinase-1 (IRE-1); and transcription factor activating factor transcription factor

6 (ATF6)) [55,56].

The ER-stress induced cell death pathway involves the releases of IRE-1 from GRP78, which allows IRE-1 to interact with tumor necrosis factor (TNF) receptor associated factor 2 (TRAF2)

(Figure 1C) [55-56]. IRE-1 and TRAF2 activate mitogen-activated protein kinase kinase kinase 5

(MAP3K5/ASK1) [55-56]. Apoptosis signaling-regulated kinase 1 (ASK-1) phosphorylates c-

Jun N terminal kinase (JNK), which increases the transcription and apoptoticfunction of DNA

damage-induced transcript 3 (ddit3/chop/gadd153) (Figure 1C) [55,56]. The gene ddit3 is

induced by the following: UPR, activating transcription factor 2 (ATF2), 4 (ATF4), and 6

(ATF6), and X-box protein 1 (Xbp1) [55,56]. The pro-apoptotic function of Ddit3 is produced by

inhibiting the expression of anti-apoptotic gene bcl-2, induction of pro-apoptotic gene bim, and

translocation of Bim to the ER membrane to activate caspase 12 [55,56]. Translocation of Bax

and Bax to the ER membrane allows the release of Ca2+ into the cytosol, resulting in the opening

of the MPTP, activation of Ca2+-induced cysteine proteases (e.g. Calpain), and activation of

14 calcineurin [55,56]. Calcineurin activates the transcription factor NFAT and its target pro- apoptotic genes (e.g. nr4a1 and fasl) [Figure 1C].

15 Figure 1. Cell Death Pathways.

A. Extrinsic Death Receptor-Mediated Pathway

B. Intrinsic Mitochondrial-Dependent Pathway

16 Figure 1 C. ER-Stress Induced Cell Death Pathway

17 Figure 1. Cell Death Pathways

A. Extrinsic Death Receptor-Mediated Pathway

The binding of death ligands to their cell death receptors (e.g. Fasl binding to FasR, TRAIL1

binding to DR4/5 or TNF-α binding to TNFR1) results in the binding of the receptors to its

adaptor protein (e.g. FADD or TRADD). FADD and TRDD then activate casapse-8, which

activates caspase-3, leading to apoptosis.

B. Intrinsic Mitochondrial-Dependent Pathway

Under apoptotic signaling, Bad binds to Bcl-2 and Bcl-xl, allowing Bax and Bak to

translocate into the mitochondria and form a mitochondrial pore complex. The opening of the

pore results in the release of apoptosis inducing factor-1 (AIF-1), Smac/DIABLO and

cytochrome c. AIF results in caspase-independent cell death. Cytochrome c binds to

apoptosis activating factor (Apaf) to form a complex called the apoptosome, which cleaves

capase-9 and leads to the activation of caspase-3 and apoptosis.

C. ER-Stress Induced Cell Death Pathway

Under normal conditions, GRP78 binds to ER transmembrane sensors proteins (Protein

kinase-like ER kinase (PERK); inositol-requiring kinase-1 (IRE-1); and transcription factor

activating factor transcription factor 6 (ATF6)). The accumulation of unfolded and misfolded

proteins results in the release of GRP78 from the PERK, IRE-1 and ATF6. IRE-1 interacts

with TRAF2, resulting in the activation of JNK and p38/MAPK, which enhances the function

of the pro-apoptotic protein Ddit3. IRE-1 can also interact with capase-12 leading to the

activation of other caspases, resulting in cell death. PERK and ATF6 can result in the

transcription of the pro-apoptotic gene ddit3. The formation of the Bak/Bax pore results in

calcium release from the ER into the cytosol. The excess calcium results in the activation of

18 calcineurin, dephosphorylating NFAT, which becomes active and regulates pro-apoptotic genes (e.g. fasl and nr4a1).

19 I.1.7 Cell Death after Ischemia and Ischemia/Reperfusion

The type of cell death (irreversible injury) occurring after myocardial ischemia is controversial

[13,45]. Multiple studies have detected apoptotic cells (TUNEL and DNA Gel) within two hours after occlusion, with a significant increase in apoptotic cells after four hours of myocardial ischemia [13,45,57-59]. One study using an in vivo mouse model of ischemia suggested that apoptotic cells [TUNEL and DNA Gel] are present from four hours, and up to 48 hours after occlusion [60]. However, theses studies use TUNEL which recognizes most DNA breaks, but does not specifically recognize apoptotic DNA breaks [double-strand breaks in DNA with staggered ends with base pair at 3’]. Therefore, these studies cannot exclude the possibility that necrotic cells are being detected. Other studies have examined various time points after ischemia

(from 10 minutes up to 7 hours after occlusion), employed various animal models (e.g. rat, rabbit, and dog), and used different methods to assess apoptosis and necrosis (Table 1)

[13,45,61-64]. Their results suggest that most of the cell death after ischemia is necrotic and not apoptotic [13,45,61-64].

There is controversy regarding whether there is an increase of cell death after reperfusion in cardiomyocytes [32]. Takashi and Ashraf used an in vivo rat myocardial infarction model to examine both early ischemic injury (ischemia alone) and short ischemia followed by reperfusion

[62]. These investgators found that 10 and 20 minutes of ischemia led to a small percentage (up to 1.4%) of cardiomyocytes undergoing necrosis compared to a prolonged 30 minute ischemia that resulted in a larger increase of necrotic cardiomyocytes (13.1%) [62]. Thirty-minutes of ischemia followed by 120 minutes of reperfusion led to 26.6% of the cells undergoing necrosis, and 12.8% of cells in the risk region undergoing apoptosis [62]. Other studies using an in vivo

20 dog myocardial infarction model showed that 7 hours of ischemia induced necrosis only,

whereas 1 hour of ischemia followed by 6 hours of reperfusion led to both apoptosis and necrosis

[64]. There are several studies that demonstrate that apoptosis increased after a short ischemia followed by reperfusion (30 min ischemia/3-4 hr reperfusion), suggesting that apoptosis contributes to reperfusion injury [65-69]. The current overall interpretation is that both apoptotic and necrotic mechanisms occur together in ischemic cardiomyocytes [13]. Another interpretation is that ischemia could initiate apoptosis, but the process is not completed due to the lack of ATP

supply and consequently, it switches to necrosis [13,62,64].

I.1.8 Summary of Background

Myocardial ischemia results in a rapid switch from aerobic or mitochondrial metabolism to

anaerobic glycolysis, resulting in an increased production of lactate and protons (H+) [6,7,24].

An increase of lactate, AMP, inosine, adenosine, hypoxanthine, xanthine, and H+, and a decrease

of glycogen, ATP, ADP, creatine phosphate, and adenine nucleotide occurs within the first 15

minutes of ischemia [6,14] (Figure 2). These metabolic changes result in reduced contraction and

leave most of the cells alive [6,14]. In contrast, prolonged ischemia lasting from 40 to 60 minutes

results in myocytes exhibiting minimal (<5%) levels of ATP, termination of anaerobic

glycolysis, and increased levels H+, AMP, lactate, and inosine [6,13-15] (Figure 2). These metabolic changes, along with an increase in osmotic load, result in mitochondrial swelling, disruption of the sarcolemma, and clumping of nuclear chromatin that is associated with irreversible injury and necrotic cell death [6,13-15] (Figure 2).

21 In contrast, short ischemia (reversible injury) followed by reperfusion can led to myocardial

stunning or even reperfusion injury (Figure 2). Reperfusion injury is the cell damage or death

that occurs by reperfusion and not by the ischemic insult [26-31]. The main players in reperfusion injury are the ROS and calcium overload which can both result in the opening of the

MPTP, resulting in the activation of caspase and apoptotic cell death. Both myocardial ischemia and reperfusion based apoptotic and necrotic mechanisms can occur together in ischemic cardiomyocytes. Ischemia may also cause apoptosis to occur but the process is not completed due to lack of ATP supply, therefore switching from apoptosis to necrosis [13].

22 Figure 2. Summary of Background

23 I.2 Cellular Response to Ischemic and Reperfusion Stresses

The cardiomyocytes adapt to ischemic and reperfusion stresses by regulating cellular and molecular functions (e.g. unfolded protein response, heat shock proteins, and production of nitric oxide) that contribute to either survival or cell death.

I.2.1 Unfolded Protein Response

ER maintains a high concentration of calcium and an oxidizing environment required for the formation of disulfide bonds and proper folding [55,56,70-72]. The lack of oxygen/energy (e.g. ischemia) or an increase of oxygen free radicals (e.g. during reperfusion) results in disruption of the calcium homeostasis and oxidizing environment, which causes an accumulation of misfolded and unfolded proteins in ER [55,56,70-72]. Upon detection of misfolded proteins, GRP78 releases PERK, IRE1 and ATF6, which initiate the UPR [55,56,70-72].

There are three components to the UPR survival pathway: (1) to reduce protein synthesis, (2) to transcriptional activation of protein chaperones, and (3) to ER-associated degradation [55,56,70-

72]. The first component is the release of PERK from GRP78, which chaperones misfolded proteins. PERK, a Ser/Thr protein kinase, phosphorylates translation initiation factor eIF2α resulting in the inhibition of translation and reducing the accumulation of newly synthesized proteins in the ER [55,56,70-72]. However, the phosphorylation of eIF2α also increases the expression of activator of transcript 4 (ATF4), which can induce certain ER stress response genes to assist in protein folding (e.g. grp78/hspa5, protein disulfide isomerase associated 3,

(pdi3) and serine (or cysteine) peptidase inhibitor, clade H, member 1 (seripinh1, hsp47))

[55,56,70-72]. GRP78 has been shown to display a protective role during ER stress in the heart 24 [73-77]. Pdia3 is a protein that functions as a thiol-disulfide oxidoreductase, and is an ER-

associated chaperone that associates with several other ER chaperones such as GRP78 to assist in folding proteins [78]. Interestingly, Pdia3 is suggested to induce cell death by decreasing GRP78 expression and increase caspase-3 activation [79]. Hsp47 protein is associated with GRP78 and

other ER-associated chaperones to assist in the folding of pro-collagen proteins in the ER [80-

81].

The second component involves the protein IRE1, a transmembrane serine/threonine protein

kinase that cleaves X-box protein 1 (XBP1) mRNA, resulting in an increased expression of

chaperones and proteins involved in ER degradation (e.g. synoviolin, syvn1) [55,56,70-72].

Syvn1 is an E3 ubiquitin ligase that is involved in maintaining ER homeostasis by degrading unfolded proteins accumulated in the ER, and protecting the cells from ER-stress induced cell death [82-84]. The expression of syvn1 has been shown to increase in response to cerebral

ischemia [84].

The third component is the release and translocation of ATF6 from the ER to the Golgi apparatus, where it is cleaved and translocated into the nucleus to induce chaperones [55,56,70-

72]. However, if these adaptive responses fail to relieve ER stress, it switches to the cell death

pathway as described above (section I.1.6 Endoplasmic reticulum (ER)-Stress Cell Death

Pathway).

25 I.2.2 Heat Shock Proteins

In 1962, Dr. Ritossa discovered the “heat shock” response as a puffing pattern in the polytene

chromosomes of Drosophila [85-89]. These days the term “heat shock” is not accurate since

these proteins are known to be up-regulated in response to multiple stimuli such as exposure to

heavy metals, metabolic poisons, ischemia, ischemia/reperfusion, free radicals, inflammation,

and increased temperature [85-89]. Heat shock proteins are involved in several functions ranging

from molecular chaperones inhibiting protein degradation to regulation of cell death under

various insults [89]. Heat shock proteins belong to several families that range in molecular size

between 10 to 150kDa that are present either in nucleus, cytoplasm, and/or mitochondrial, along

with related heat shock proteins found in ER [89]. There are several heat shock families that are

grouped into Hsp110, Hsp90, Hsp70, Hsp60, Hsp40/Dnaj, and small heat shock protein families

[87]. The focus will be on the cytoplasmic/nuclear heat shock proteins 90 (Hsp90) and 70

(Hsp70), along with mitochondrial heat shock proteins (Hsp60 family).

Hsp90 Family

Hsp90 proteins are about 90-kDa molecular mass and are highly conserved molecular

chaperones that have multiple functions ranging from signal transduction, protein folding,

protein degradation, and refolding denatured proteins after stress [90-95]. These proteins are

located in the cytosol, nucleus, endoplasmic reticulum (e.g. 94-kDa glucose-regulated protein

GRP-94) and mitochondria (e.g. tumor necrosis factor receptor-associated protein 1, TRAP1)

[90-95]. The two major cytosolic isoforms of Hsp90 are the inducible form heat shock protein

90, alpha (cytosolic), class A, member 1 (hsp90aa1) and the constitutive form heat shock protein

90, alpha (cytosolic), class B, member 1 (hsp90ab1), which resulted from a gene duplication that

26 occurred about 500 million years ago [90-95]. These two forms of hsp90 have a 93% similarity

between them, and both have the functional motif MEEVD [90-95]. These proteins are

distinguishable from each other since Hsp90ab1 has an absence of 5 amino acids in the N-

terminal domain and changed domain 1 [90-95].

Hsp90aa1/Hsp90ab1 (Hsp90) is known to interact with several hundred target proteins that are involved in a wide range of molecular functions that include metabolism, transcription regulation, cell organization and biogenesis [95]. For example, Hsp90 is known to interact with the following mitochondrial proteins: ATP-sensitive K+ channel, Kir6.2, connexin 43, Cx43 and

translocase of the outer membrane 20, Tom200, and nitric oxide synthesis (NOS) that contributes

to Hsp90 cardioprotection [96-101].

Hsp70 Family

The most conserved protein evolutionarily is Hsp70, which is found in all organisms including

plants and prokaryotic [101-108]. All eukaryotes have more than one Hsp70 gene, and Hsp70 family members have recently been found to be redundant and have specific functions [101-108].

These include the following genes: hspa1a (hsp70-1a, hsp70, hsp72, hsp70-1), hsp70a1b (hsp70-

1b, hsp70, hsp72, hsp70-1), hspa1l (hsp70-1t, hsp70-hom), hspa2 (hsp70-2, hsp70-3, hspa2),

hspa5 (hsp70-5,bip,grp78), hspa6 (hsp70-6, hsp70b), hspa8 (hsc70, hsp70-8, hsp73), and hspa9

(hsp70-9, grp75, mthsp70, mortalin) [101-108]. Most of these Hsp70 proteins are >80%

homology to Hspa1a, except for Hspa9 and Hspa5 which are 52% and 64% homology to Hspa1a

[101-108]. All Hsp70 proteins have highly conserved structure domains that consist of an N-

terminal ATPase domain followed by a middle region with protease sensitive sites, and a peptide

27 binding domain followed by a G/P-rich C-terminal region containing an EEVD-motif that enables proteins to bind co-chaperones and other heat shock proteins [101-108].

There are two inducible heat shock proteins: Hsp70.1 and Hsp70.3, which are highly up- regulated after ischemic insults and regulate both cell survival and death as mentioned below.

There is limited information regarding the individual role of Hsp70.1 and Hsp70.3 following myocardial ischemia, therefore the main focus will be around the Hsp70.1 and Hsp70.3. Hsp70.1 in the mouse is the hspa1b locus, whereas in the human and rat, it is the hspa1a locus [109].

Hsp70.3 in the mouse is the hspa1a locus, whereas in the human and rat, it is the hspa1b locus

[109]. For clarity, the thesis will refer to Hsp70.1 as hspa1b and Hsp70.3 as hspa1a, both genes

are intron-less and are induced by stress [101-109]. In both the mouse and human, the stress

inducible Hsp70 locus encodes hspa1a and hspa1b, which are located in the major

histocompatibility complex (MHC) III region, and are about 7kb apart in a head-to-tail

orientation [110-112]. Hsp70.1 and Hsp70.3 are >99% identical to each other with two amino

acid differences in the human proteins [109-112], whereas in the mouse, Hsp70.1 has one

additional proline amino acid near the C-terminal end [109-113]. The mouse promoters of both

hspa1a and hspa1b have a conserved promoter region up to 300bp upstream from the start site

and a very conserved 5’UTR between each gene [109-113]. However, the 3’UTR is completely different between hspa1a and hspa1b [109-113]. It has been shown that hspa1a and hspa1b can be induced by various stressors, which induces one or both hsp70 forms and has different expression patterns [114-116].

28 Several studies, using various mouse models such as Hsp70.1/.3 KO and Hsp72 transgenic mice

(Hsp70 TG) under various stressors, including myocardial ischemia, suggest that Hsp70 is protective [113-129]. For example, Hsp70.1 and Hsp70.3 have been shown to be cardioprotective following ischemic preconditioning [117]. Hsp70.1 has been shown to be protective following ischemic stroke [109,127], whereas Hsp70.3 has been shown to be cardioprotective following myocardial ischemia preconditioning [113]. It has been suggested that

Hsp70 anti-apoptotic functions are most likely due to its interaction with apoptotic pathways, inhibiting caspase activation and JNK-induced cell death [52,53]. However, in vitro models

over-expressing Hsp70 in T-cells increase cell death by enhancing caspase-activated DNase,

suggesting that Hsp70 is required for caspase-activated DNase (CAD) [52,128,129].

Hsp60 Family

The Hsp60 family consists of mitochondria chaperonins Hsp60 (Hspd1) and Hspe1 (Hsp10), along with the TRiC chaperonin that is a functional equivalent of chaperonin Hsp60/Hsp10, which is localized in the cytosol [52,130-134]. Hspd1 and Hspe1 protein structures are 7- membrane rings arranged in cylindrical structures where ATP-dependent protein folding occurs

[52,130-134]. Hsp60 is mostly found in the mitochondria; however, about 20% of Hsp60 is found in the cytosol [52,130-134]. Cytosolic Hsp60 forms a macromolecular complex with bax and bak, which prevents apoptosis [52,130-136]. After ischemic insults, mitochondria Hsp60 is unchanged; however, cytosolic Hsp60 was found to be translocated into plasma membranes

[52,130-134]. This allows bax to translocate from the cytosol to the mitochondria, resulting in apoptosis [52,130-134]. The Hsp60 in the mitochondria promotes capase-3 activation, resulting in apoptosis [52].

29 I.2.3 Inflammatory Response

In response to ischemia and reperfusion, the cardiomyocytes synthesize and release cytokines

which contribute to several cellular processes that include the following: cell survival or cell

death, cardiac contractility, changes to vascular endothelium, and recruitment of inflammatory

cells [135-140]. Reperfusion results in an augmented inflammatory response that is associated

with improved tissue repair (e.g. healing and scar formation) [135-140]. Cytokines, such as

tumor necrosis factor alpha (TNF-α), interleukins (e.g. IL-1, IL-6), chemokine (e.g. CCL4) and

chemokine C-X-C motif (e.g. CXCL5), are differentially expressed after permanent occlusion

(PO) and ischemia/reperfusion (I/R) [135-140]. Cytokines have been shown to have pleitropic

effects on the cardiomyocytes. For example, TNF-α has been shown to result in both cell

survival and cell death after ischemic insults as discussed in section I.4.7-I.4.8 [141-149]. Other

cytokines (e.g IL-6) have been shown to activate multiple signal transduction pathways (e.g.

Mitogen-Activated Protein Kinase (MAPK) pathways) and leads to activation of multiple

transcriptional factors (e.g. Nuclear factor-kappa B (NF-κB)) that can result in cell survival and

cell death outcomes [135-140]. Chemokines regulate the inflammatory cell’s locomotion and

trafficking, which can mediate myocardium injury and healing processes [135-140]. In contrast, macrophages initiate the wound healing process by removing necrotic/apoptotic cells, secreting growth and cytokines factors, and result in induction of matrix metalloproteinases that are involved in wound healing and scar formation [135-140].

30 I.2.4 Nitric Oxide Synthesis

Nitric oxide (NO) is produced by five-electron oxidation of the terminal guanidine group of L-

arginine, which is catalyzed by the enzyme NO synthesis (NOS) [150-154]. NOS is a

hemoprotein that contains an oxidative domain located in the NH2-domain, and a reductive domain that is located in the COOH domain [150-154]. The reaction to synthesize NO requires co-factors (flavins and tetrahydrobiopterin), molecular oxygen (O2) and NADPH [150-154].

There are three major isoforms of NOS: neuronal NOS (nNOS or NOS-I), inducible NOS (iNOS or NOS-II), and endothelial NOS (eNOS or NOS-III) [150-154]. The two constitutive forms of

NO, nNOS, and eNOS are expressed in neuronal cells in the heart, cardiomyocytes, cardiac endothelium, and vascular endothelial cells respectively [150-154]. The inducible isoform NOS, iNOS, has been shown in cardiomyocytes, cardiac endothelium, and inflammatory cells that infiltrate the myocardium after myocardial infarction [150-154].

Nitric oxide has been suggested to contribute to cardioprotection during myocardial ischemia and reperfusion injury [150-154]. Nitric oxide levels are known to increase within minutes of ischemia via eNOS, and independently from eNOS via xanthine oxidase in the presence of low

oxygen and high concentrations of NADH by producing NO from nitrate [150-154]. Nitric oxide

has been suggested to adapt the cardiomyocytes to ischemic stress by increasing coronary flow

2+ (e.g. angiogenesis and vasodilatation), regulating Ca -ATPase and KATP channels to prevent

Ca2+ overload, and via regulation of prostaglandins and heat shock proteins to mediate

cytoprotective effects [150-154]. In contrast, biradical condensation of NO and oxygen free

- radicals (O2•-) forms ONOO which contributes to protein damage by nitrosylation,

31 mitochondrial dysfunction, and DNA damage that results in reperfusion induced cell death [150-

154].

I.2.5 Summary

Myocardial ischemia and reperfusion results in the expression of genes and proteins that

modulate cellular and molecular functions that help determine the cell fate to live or die.

Myocardial ischemia and reperfusion results in the accumulation of misfolded and unfolded

proteins that initiate ER stress and activate the unfolded protein response. The purpose of the

unfolded protein response is to reduce translation of misfolded proteins, increase translation of

ER chaperones (e.g. heat shock proteins), and remove misfolded proteins by ER-associated

degradation (ERAD). However, if the adaptive response doesn’t relieve ER stress, it can result in

the activation of ER-stress cell death. Both myocardial ischemia and ischemia/reperfusion is

known to result in an increased expression of several heat shock protein genes. Heat shock

proteins have several known functions that regulate the following: protein folding, cell death,

inflammation, nitric oxide synthesis, and regulation of other heat shock proteins. The

cardiomyocytes synthesize and release cytokines in response to ischemia and reperfusion stress to regulate the inflammatory response, which contributes to several cellular processes that

include the following: cell survival or cell death, cardiac contractility, changes to vascular

endothelium, and recruitment of inflammatory cells. Nitric oxide levels are known to increase in

response to ischemia and reperfusion, which mediates cardioprotection during ischemia.

I.3 Regulation of Transcription Factor s

Both ischemia and reperfusion lead to numerous biochemical changes including an imbalance

between ATP/oxygen supply and demand, calcium levels, the production of ROS, metabolic 32 changes, cell death, and the synthesis/release of cytokines and chemokines [51,138]. These

biochemical changes occur initially after myocardial ischemia and reperfusion, and can directly

affect the activation of transcription factors and gene expression [51,155]. Cardiomyocytes adapt

to stress by altering the cardiac protein pattern, mostly through changes in gene expression,

mRNA stability, translation, and protein degradation rates [156]. Transcription factors regulated

by ischemia and reperfusion have been shown to activate gene programs that are associated with

cell survival, cell death, stress response, and regulation of cellular functions [51,155,156].

Induction of gene expression is regulated by transcription factors that bind to their cognate DNA

binding sites on promoter regions of target genes. A group of transcription factors that are

activated by changes in oxygen tension and reactive oxygen species are known as redox-

regulated proteins [51,155,156]. Some of these transcriptional factors are hypoxia-inducible

factor 1 (HIF-1), heat shock factor (HSF), activating protein 1 (AP1), and NF-κB [155-157].

Other transcription factors that are activated by ER-stress and calcium-regulated are nuclear

factor of activated T cells, X-box binding protein 1, DNA-damage-inducible transcript 3 nuclear receptor subfamily 4, group A, member 1, and nuclear factor, interleukin 3 regulated [157-165].

I.3.1 Hypoxia-Inducible Factor

HIF-1 is composed of two subunits (α and β) that are activated by hypoxia and bind to hypoxia

response elements on theirt target gene promoters [156]. Hypoxia leads to an increase of HIF-

1α mRNA and protein levels, along with an increase in DNA binding activity of HIF-1 [156].

HIF-1 is known to regulate several genes that play a pre-emptive protective role against oxidative stress in the hypoxic cardiomyocytes by inducing vascular endothelial growth factor

(VEGF), various genes associated with gluconeogenesis and glycolysis, and heme oxygenase-1 33 (HO-1) [156]. The re-introduction of oxygen and increased level of intracellular concentration of

ROS rapidly lead to decreased activity of HIF-1 [156].

I.3.2 Heat Shock Factor

Heat shock proteins are known to mediate multiple functions in the cell, including their roles as

molecular chaperones to assist in folding and translocation of new proteins [156,157]. Heat

shock proteins are increased in the myocardium in response to ischemia and

ischemia/reperfusion. The increase in heat shock proteins is related to the increased expression of

heat shock protein genes mediated by the transcriptional factor known as heat shock factor

[156,157]. Currently there are four members of the heat shock factor family: HSF1 (the main

HSF), HSF2, HSF4 and HSF5. HSF1 exists in an inactive form, consisting of three monomers

associated with Hsp70 and Hsp90 in the cytoplasm [156,157]. The activation of HSF1 is

mediated by phosphorylation of the HSF1 homotrimer, which then translocates into the nucleus

and binds to heat shock factor binding sites on heat shock protein promoters [156,157].

Phosphorylation of HSF1 is regulated by depletion of ATP and increased activity upon high

levels of ROS [156,157]. The phosphorylation of HSF1 at serine 230 is mediated by

calcium/calmodulin-dependent kinase II (CaMKII) that results in transactivation [157]. In

contrast, the phosphorylation of HSF1 at serine 303 by glycogen synthase kinase-3 (GSK-3), phosphorylation of serine 307 by extracellular signal-regulated kinase (ERK), and phosphorylation of serine 363 by protein kinase C and c-Jun N-terminal kinsae (JNK) all result in inactivation of HSF1 [157].

34 I.3.3 Activating Protein-1

Members of the AP-1 transcriptional factor family include Jun (c-Jun, JunB, and JunD), Fos (c-

Fos, Fosb, and Fra1), and activating transcription factor (ATF) protein families [156-159]. AP-1

factors are homo- or hetero-dimers, the most common of which include Jun/Jun homodimers and

Jun/Fos or Jun/ATF2 heterodimers [156-159]. The activation of AP-1 is dependent on two main

factors: 1) an increase in mRNA expression level of the constituent AP-1 subunits, and 2) the

increase in activity and stability of these same protein subunits, which are regulated by

phosphorylation [156-159]. AP-1 is known to regulate several genes that are involved in the

regulation of apoptosis (e.g. protein 53, p53) and inflammatory genes (e.g. chemokine genes)

[156-159].

I.3.4 Activating Transcription Factor

The activating transcription factor (ATF) family belongs to the super family basic-region leucine

zipper (bZIP) transcription factors that bind to DNA as dimers, which are mediated by a leucine- zipper motif [158,159]. ATF is known to bind to cAMP responsive element (CRE) motifs and is considered to be as a CRE binding protein (CREB) [158,159]. ATF is known to form a heterodimer with AP-1 members. For example, ATF2/Jun, ATF3/Jun, ATF4/Fra-1, ATF4/Fos,

ATF4/Jun, and ATF2/ATF3 [158,159]. ATF/CREB family members (e.g. ATF1, ATF2, ATF3,

ATF4 and ATF6) are known to respond to environmental stress and mediate cellular homeostasis

[158,159]. For example, ATF2 and ATF3 are known to regulate stress-response genes, and

ATF6 regulates transcriptional genes that mediate ER-stress response and UPR [142]. ATF1

modulates transcription in response to intercellular cAMP levels; in contrast, ATF4 acts as a

negative regulator of CRE-dependent transcription [158,159]. ATF1 and ATF2 mediate cell

35 viability and proliferation, whereas ATF3 and ATF4 can indirectly regulate cell survival and cell death, along with ATF6 that indirectly contributes to apoptosis [158,159].

I.3.5 X-box Protein 1

X-box protein 1 (XBP1) is a member of CREB/ATF basic region-leucine zipper family of transcription factors [160,161]. XBP1 was first discovered as an important regulator of the major histocompatibility complex (MHC) class II genes [160,161]. IRE1, one of the three ER-stress sensors, cleaves an intron from the XBP1 transcript in response to ER stress [160,161]. The unsliced XBP1 protein is 267 amino acids; however, the cleavage of the intron produces a 371 amino acid splice protein that results in activation and translocation into the nucleus to regulate

UPR gene expression [160,161]. Active cleaved XBP1 regulates genes that are involved in protein folding, glycosylation, ER-associated degradation (ERAD), and redox metabolism

[160,161].

I.3.6 DNA Damage-Induced Transcript 3

DNA damage-induced transcript 3 (Ddit3) is known by several other names that include C/EBP- homologous protein (CHOP) and growth arrest and DNA damage-inducible protein

(GADD153). Ddit3 is a transcription factor that is a member of the C/EBP family of the bZIP transcription family, which is induced by ER-stress [56]. The promoter of ddit3 contains binding sites for other ER-stress induced transcription factors (e.g. ATF4, ATF6, and XBP1) [56]. The phosphorylation of Ddit3 at serine 78 and 81 by p38 MAPKs results in enhanced transcriptional and apoptotic activity [56]. Hypoxia and amino acid starvation are known to induce ddit3 by the

36 activation of ATF2 [56]. Ddit3 apoptotic functions occur by inhibiting the expression of anti- apoptotic gene bcl-2 and increasing the expression of the pro-apoptotic gene bim [56].

I.3.7 Nuclear Receptor Subfamily 4, Group A, Member 1

Nuclear receptor subfamily 4, group A, member 1 (Nr4a1) is also known as Nur77, TR3 and

NGFI-B [162,163]. Nr4a1 is composed of three domains which are the N-terminal activating function-1 (AF-1) domain, the middle domain consisting of two zinc-finger DNA binding domains, and a C-terminal domain called ligand binding domain [162,163]. There are no known ligands for these nuclear receptors, therefore they are considered as orphan receptors [162,163].

Nr4a1 can bind as monomers to the nerve growth factor-induced clone B (NGFI-B) response element (NBRE), or heterodimerize with the retinoid X receptor (RXR) that binds to death domain receptor 5 domain (DR5) [162,163]. These nuclear receptors have been shown to repress matrix metalloproteinase (MMP)-1 expression and NF-κB [162,163]. Nr4a1 is rapidly increased by stress and cytokines, and activates immediate early genes (e.g. glucose-6-phosphatase)

[162,163]. The phosphorylation of serine 350 by Akt inhibits Nr4a1 DNA binding and transcriptional activity [163]. Nr4a1 is known to be anti-apoptotic when it is located in the nucleus compared to its pro-apoptotic function where it migrates to the mitochondria and binds to bcl-2, triggering cytochrome C release and resulting in apoptosis which is regulated by RXR

[163].

I.3.8 Nuclear Factor Interleukin 3 Regulated

Nuclear factor interleukin 3 regulated (Nfil3) is also known as E4BP4, which is a basic leucine zipper (bZIP) transcription factor that is composed of three polypeptides: hepatic leukaemia

37 factor (TEF), D-box binding protein (DBP) and thyrotroph embryonic factor (TEF) [164]. Nfil3

is known to regulate both anti and pro-apoptotic functions, and is regulated by calcium and

interleukin 3 [164].

I.3.9 Nuclear Factor of Activated T-cells

Nuclear factor of activated T-cells (NFAT) encompasses five proteins (NFAT1-5) which are evolutionarily related to the Rel super family (details in section I.4.1) [165-167].

Ca2+/calcineurin regulates NFAT1-4 (NFAT), whereas NFAT5 is regulated by osmotic stress and

integrin [165-167]. NFAT proteins are phosphorylated and located in the cytoplasm until they

are dephosphorylated by Ca2+/calmodulin-depedent serine phosphatase calcineurin [165-167].

The dephosphorylated NFAT translocates and becomes transcriptionally activated, linking Ca2+

signaling to gene expression [165-167]. NFAT is known to bind to AP-1 members and other transcription factors to regulate gene expression [165-167].

I.3.10 Nuclear Factor Kappa-B

NF-κB is a stress-induced transcriptional factor that is highly associated with various CVDs,

including myocardial ischemia, heart failure, cardiac hypertrophy, and atherosclerosis [51,167].

The main NF-κB subunit in the heart is a heterodimer of p65 and p50 subunits (one each) that

exist bound to inhibitor proteins (IκB), predominantly in the cytoplasm [51,167]. NF-κB

activation occurs when upstream factors phosphorylate IκB proteins, leading to their

ubiquitination and degradation, allowing for increased nuclear translocation of NF-κB dimers

[51,167]. NF-κB is known to regulate over 200 genes that control several different molecular and

cellular functions ranging from pro-apoptotic genes, anti-apoptotic genes, stress responses genes, 38 cell adhesion genes, cytokine-related genes, and calcium handing genes [51,167]. NF-κB has also been shown to mediate cardioprotection and cell injury following ischemic insults [51,167].

I.4 Nuclear Factor Kappa-B

In 1986, Sen and Baltimore first described nuclear factor kappa-B as a B cell nuclear factor that

was bound to the immunoglobulin κ enhancer [168-171]. This group later found that NF-κB

could be induced and activated in other cells in response to various stimuli such as phorbol

esters, tumor nuclear factor alpha (TNF-α), and Interleukin 1 (IL-1) [168-171]. A few years

later, genes were being identified as having functional NF-κB binding sites in their promoters

and as being regulated by NF-κB [168-171]. In 1998, Baeuerle and Baltimore found that NF-κB

was present in an inactive form bound to cytoplasmic inhibitory proteins called IκB [168-171].

Upon stimulation, the release and degradation of IκB from NF-κB resulted in a rapid appearance

of NF-κB in the nucleus, where it regulated gene expression [168-171].

I.4.1 Rel Super Family

NF-κB belongs to the Rel super family that is defined by the Rel domain homology, including

members of the NFAT family (NFAT1-5) (Figure 3A) [165-167]. NF-κB and NFAT both

contain a similar Rel domain (NF-κB) and Rel-similarity domain (RSD) (NFAT) that is

approximately a 300 amino acid DNA binding domain with less than 20% similar sequence

homology; however, they do adapt to similar conformations (Figure 3A) [165-167]. Both Rel and RSD domains contain 10 β-strands and two loops at identical positions to interact with their

DNA binding motif and other transcription factors [165-167]. They are distant relatives and are

39 separated into their own families with their unique activation pathway and dimer formation

(Figure 3) (NFAT family section I.3.9).

I.4.2 NF-κB Family

Currently, there are five members of the NF-κB family: p65 (RelA), c-Rel, RelB, p105/p50 (NF-

κB1) and p100/p52 (NF-κB2) (Figure 3A) [168-180]. They all contain Rel domains that are involved in DNA binding, dimerization, and interactions with IκB (Figure 3A) [168-180]. NF-

κB members p105/p50 (NF-κB1), and p100/p52 (NF-κB2), contain the highly conserved Rel

homology domain (RHD) across NF-κB subunits, and are distinguished by their long C-terminal

domains that contain multiple copies of ankryin repeats that act to inhibit these proteins (Figure

3A) [168-180]. Processing of NF-κB1 (p105/p50) by either proteolysis or possibly by arrested

translocation results in the production of p50 (Figure 3A) [168-180]. Proteolysis of NF-κB2

(p100/p52) results in the p52 subunit, leading to the activation of DNA-binding proteins (Figure

3A) [168-180].

NF-κB members are known to form homodimers (e.g. p50/p50 and p52/p52) or heterodimers

(e.g. p65/p50, RelB/p50, p52/p65, and p52/RelB) [51,167-180]. The p65/p50 dimer is the most

common, and is the most dominant NF-κB dimer in the heart [51,167,180-183]. The p65/p50

binding sequence is 5’-GGGRNNYYCC-3’ whereas the p65/cRel binds to 5’-HGGARNYYCC-

3’; H indicates A, C or T; R is purine; and Y is pyrimidine [51,167-180].

40 Figure 3. Rel Super Family

A.

B.

41 Figure 3. Rel Super Family

A. NF-κB and NFAT Families Structure Domains.

Yellow box RHD (NF-κB) and RSD (NFAT) are the Rel domains that are about 300

amino acids long, which are less then 20% similar sequence homology between RHD and

RSD. The RHD and RSD structures are similar, composed of 10 β-strands and two loops

that are in identical positions to interact with their DNA binding motif.

NF-κB family consists of five members: p65 (RelA), c-Rel, RelB, p105/p50 (NF-κB1),

and p100/p52 (NF-κB2). RelA contains a TA1 and TA2 (conserved region), which are

subdomains of the RelA transactivation domain (TAD). c-Rel TA1 and TA2 are

transactivation domains that are conserved with c-RelA TAD. RelB contains a putative

leucine zipper-like motif (LZ) and transactivated domain (TAD). NF-κB members’

p105/p50 (NF-κB1) and p100/p52 (NF-κB2) have ankyrin domains (ANK) and contain

homology death domains (DD). The black arrow represents where the cleaved sites are.

p105 is cleaved to form p50 and p100 is cleaved to form p52.

NFAT1-4 contains a transactivated domain at the N-terminal (TA1) followed by the

regulatory domains (RD). Calcineurin binds to the first of the domains, and, near the end

of the RD, calcineurin binds to NFAT2 and NFAT4. The inactive NFAT1-4 has multiple

phosphorylations, which calcineurin dephosphorylates. The RSD domain is between the

RD domain and the other C-terminal end activation domain (TA2) in NFAT1-3. NFAT5

only contains the RSD domain.

42 Figure 3. Rel Super Family

B. NF-κB and NFAT Activation Pathway

NFAT1-4 is normally present in the cytoplasm and has multiple phosphorylations in the

RD domain that are regulated by multiple kinases (e.g. glycogen synthase kinase 3 beta

(GSKβ), creatine kinase I and II (CK I, CK II), c-Jun N-terminal kinase (JNK) and p38

mitogen-activated protein kinase (p38). Calcium (Ca2+) and Calmodulin (CaM) result in

the activation of calcineurin which dephosphorylates NFAT1-4, and allows NFAT to

become activated and translocate into the nucleus to form a dimer with AP-1 (Jun/Fos).

NF-κB (p65/p50) is in an inactive form bound to the inhibitor kappa B protein in the

cytoplasm. The activation of inhibitory kappa kinase (IΚΚ) phosphorylates IκB at serine

32 and 36, which results in IκB degradation and translocation of NF-κB into the nucleus.

43

I.4.3 Inhibitor Kappa B (IκB)

IκB family members are IκBα, IκBβ, IκBγ, IκBε, IκBζ, Bcl-3, Drosophila cactus, and NF-κB

members p100 and p105 (Figure 4A) [168-180]. All isoforms of IκB are composed of six to

seven ankyrin repeats which bind to NF-κB (Figure 4A) [168-180]. In addition to ankyrin repeats, both IκBα and IκBβ have two N-terminal serine residues (IκBα: S32 and S36; IκBβ:

S19 and S23) that serve as IκB kinase (IΚΚ) phosphorylation sites, and a C-terminal region containing a 42-amino-acid region called the PEST region which is critical for inhibition of NF-

κB DNA binding [168-180]. IκBα has an additional phosphorylation site at tyrosine 42 (Y42), which is phosphorylated by leukocyte-specific protein tyrosine kinase (p56-luk), spleen tyrosine

kinase (Syk), and V-src sarcoma (Src) [51,167-180]. The predominant IκB in the mouse heart is

the IκBα subunit, which is associated with c-Rel and RelA dimers, and binds at a lower affinity

to RelB/p52 and RelB/p50 dimers [51,167,180-183]. IκBα retains NF-κB in the cytoplasm

through the masking of the nuclear localization sequence and ankryrin repeats of NF-κB

[51,167-180]. The other main IκB subunit is IκBβ, which is associated with c-Rel and RelA

dimers in the cytoplasm [51,167-180]. The activation of NF-κB occurs by up-stream factors that

can result in the activation of IΚΚ, which phosphorylates serine 32 and 36 on IκBα. Τhis results

in the ubiquitination of IκBα, while p65/p50 becomes activated and translocates to the nucleus

(Figure 3B) [51,167-180]. Previous results show that serine 32 and 36 are the main

phosphorylation sites that activate NF-κB after myocardial ischemia and reperfusion (I/R) and

permanent occlusion (PO), and that the tyrosine 42 phosphorylation site does not contribute to

NF-κB activation after I/R or PO [51,181-183].

44 I.4.4 IκB Kinase (IΚΚ)

As mentioned above, NF-κB activation occurs by the activation of IκB Kinase (IΚΚ). IκB kinase

(IΚΚα/β) and a scaffold protein called NF-κB essential modulator (NEMO/IKKγ) mediate the phosphorylation of critical serine residues on IκB proteins (Ser32 and Ser 36 on IκBα), resulting in NF-κB translocation into the nucleus and regulation of gene expression [179,180]. IΚΚα/β is composed of a kinase domain, helix-loop-helix (HLH), leucine zipper (LZ), and NEMO binding domain (NBD) (Figure 4B) [179,180]. NEMO (IKKγ) contains an N-terminal domain that comprises coiled coil region 1 (CC1), a middle domain that consists of coiled coil region 2

(CC2) a leucine zipper motif (LZ), and a C-terminal domain that contains a zinc-finger domain

[179,180]. The phosphorylation of IKKα on serine 176 and 180 by NF-κB inducing kinase

(NIK) and phosphorylation of tyrosine 23 by Akt/PKB result in the activation of IKKα

[179,180]. Phosphorylation of IKKβ on serine 177 and 181 by tumor growth factor-beta kinase 1

(TAK1), and phosphorylation of tyrosine 189 and 199 by c-Src lead to IKKβ activation

[179,180].

45

Figure 4. IκB and IΚΚ Structure Domains A.

B.

46 Figure 4. IκB and IΚΚ Structure Domains

A. IκB Family Structure Domains. All isoforms of IκB are composed of six to seven ankyrin repeats, which bind to NF-κB. In addition to ankyrin repeats, IκBα and IκBβ have two N- terminal serine residues (IκBα: S32 and S36; IκBβ: S19 and S23) that serve as IκB kinase (IΚΚ) phosphorylation sites, and a C-terminal region containing a 42-amino-acid region called the

PEST region, which is critical for inhibition of NF-κB DNA. IκBα has an additional phosphorylation site at tyrosine 42 (Y42), which is phosphorylated by leukocyte-specific protein tyrosine kinase (p56-luk), spleen tyrosine kinase (Syk), and V-src sarcoma (Src). p105/p50 (NF-

κB1) and p100/p52 (NF-κB2) have ankyrin domains (ANK) and contain homology to death domains (DD). The black arrow represents the sites where p105 is cleaved to form p50, and where p100 is cleaved to form p52.

B. IΚΚα/β is composed of a kinase domain, helix-loop-helix (HLH), leucine zipper (LZ), and

NEMO binding domain (NBD). NEMO (IKKγ) contains an N-terminal domain that includes coiled coil region 1 (CC1), a middle domain that consists of coiled coil region 2 (CC2) and a leucine zipper motif (LZ), and a C-terminal domain that contains a zinc-finger domain. The phosphorylation of IKKα on serine 176 and 180 by NF-κB inducing kinase (NIK) and phosphorylation of tyrosine 23 by Akt/PKB results in the activation of IKKα. Phosphorylation of

IKKβ on serine 177 and 181 by tumor growth factor-beta kinase 1 (TAK1), and phosphorylation of tyrosine 189 and 199 by c-Src leads to IKKβ activation.

47 I.4.5 NF-κB Activation Pathway

There are three main NF-κB pathways: the canonical (classical) pathway, two non-canonical pathways (also known as atypical or alternative) pathway, and the p105 pathway (Figure 5). The main NF-κB activation pathway in the cardiomocytes has been shown to be the canonical pathway [51,180-183]. Non-canonical pathways have been shown to be important in the inflammatory response [177,178]. Briefly, the non-canonical pathway can be activated by a subset of TNF family members (LTαβ, CD40L, BAFF) and IKKα/β. This results in p100

cleavage via proteolysis that results in a p52 subunit, which forms a dimer with RelB (p52/RelB

dimer) and translocates into the nucleus (Figure 5) [177,178]. The other atypical pathway is the

p105 pathway, which can be activated by TNF-α and LPS and results in the activation of

IKKα/β [177,178]. The activation of IKKα/β initiates the cleavage of p105 by proteolysis,

resulting in the p50 dimer, which can form homodimers (p50/p50 dimer) and translocate into the

nucleus (Figure 5) [177,178].

Cytokines (e.g. TNF-α, IL-1β) can initiate the canonical pathway of NF-κB by activating the

upstream NF-κB inducing kinase (NIK), which phosphorylates serines 176 and 180 on IΚΚα

[51,167-180]. Active ΙΚΚα/β phosphorylates serines 32 and 36 on IκBα, which results in the

proteasome-mediated degradation of IκBα, and allows the p65/p50 dimer to translocate into the

nucleus (Figures 3 and 5) [51,167-180].

48 Figure 5. NF-κB Activation Pathways

Figure 5. NF-κB Activation Pathways

NF-κB activation can occur in three different pathways. The most common pathway in the heart is the canonical pathway, in which upstream factors (e.g. TNF-α) can activate NIK which phosphorylates IKK. IKK phosphorylates IκB which results in IκB degradation, allowing p65/50 to translocate into the nucleus. The non-canonical pathway activation results in p100 proteolysis, resulting in a p52 subunit which forms a dimer with RelB (p52/RelB dimer) and translocates into the nucleus. The p105 pathway results in the cleavage of p105 by proteolysis to form a p50 dimer, which can form homodimers (p50/p50 dimer) and translocate into the nucleus.

49 I.4.6 NF-κB Translational Modifications

NF-κB subunits are subjected to multiple post-translational modifications that can regulate the transcriptional activity of NF-κB and enhance expression of NF-κB regulated genes [179,180].

The main focus here is on selected p65 post-translational modifications that can influence the

NF-κB translocation and stability. For a complete review of all NF-κB post-translational modifications see review by Perkins [179].

There are multiple serine and tyrosine sites that can be phosphorylated on p65 [179,180]. Three major sites can be phosphorylated in the p65 transactivation domain 1 (TAD1), which are serines

529, 535 and 536 [179,180]. The phosphorylation of serines 529, 535 and 536 by casein kinase II

(CK II), calmodulin-dependent kinase IV (CaMKIV), ΙΚΚ, and ribosomal S6 kinase 1 (RSK1)

results in the enhanced p65 transcriptional activity [179,180]. For example, phosphorylation of

p65 at serine 536 has been shown to be important for LPS-induced TNF-α production in cultured cardiomyocytes [179,180]. In addition, the phosphorylation of p65 at serine 536 by ribosomal S6 kinase 1 (RSK1) been suggested to associate with p65 nuclear translocation [179,180].

Other major sites where p65 phosphorylation may occur are serines 276 and 311, which can be phosphorylated by protein kinase A (PKA), mitogen or stress-activated kinase1 (MSK1), and atypical protein kinase C (PKC) isoform (PKCζ) [179,180]. Phosphorylation of serines 276 and

311 results in p65 modification (e.g. disruption of intermolecular integration between the p65 N and C terminus domains), which enhances the transcriptional activity of p65 and the binding of co-activator p300/CBP [179,180]. There are several other possible p65 phosphorylation sites that may be involved in p65 transcription regulation which are: serines 205, 276, 281, 311, 468 and 50 529; and tyrosines 254, 435 and 505 [179,180]. Currently, there is very limited information about

the phosphorylation of p65 in the heart and a lack of understanding on the role of post-

transcriptional modifications of p65 dur ing myocardial ischemia.

I.4.7 Role of TNF-α and NF-κB in vitro

NF-κB is expressed in various cells in the heart including cardiomyocytes, fibroblasts,

endothelial cells, and vascular smooth muscles [51,167]. However, previous in vivo studies suggest that NF-κB activation mostly occurs in the cardiomyocytes in response to various insults

(e.g. I/R, cytokine-dependent cardiomyopathy) [51,167,181,183,186]. NF-κB activation is

induced by various stimuli (e.g. TNF-α, hypoxia, and oxidative stress) in isolated

cardiomyocytes [51,142-144,167,185-190]. Isolated rat cardiomyocytes induced with TNF-α

resulted in reactive oxygen species (ROS) formation and NF-κB activation after 30 minutes, along with a threefold increase in NF-κB-dependent protein A20 after 24 hours

[143,144,184,188,191]. Cardiomyocytes transfected with human mutated IκBα (S32A,S36A) or

IκB∆N mutant (truncated IκBα, which lacks IκBα phosphorylation sites) failed to induce NF-κB

activation after TNF-α stimulation, and was more sensitive to cell death [143,184,191].

Interestingly, cardiomyocytes transfected with IκB∆N mutant showed no differences in NF-κB-

dependent cardioprotective proteins (e.g. inhibitors of apoptosis: iAP1, iAP2, and xiAP2, along

with Bcl-2 and Bcl-xL) compared to controls treated with TNF-α [191]. These results suggest that TNF-α activates NF-κB and provides cardioprotection, though the mechanism behind NF-

κB-induced protection remains unknown.

51 In contrast, TNF-α-treated rat cardiomyocytes with IKK inhibitor (PS-1145), anti-oxidant

(Trolox), or peptide SN50 (blocks NF-κB translocation) resulted in a significant reduction of

NF-κB activation and apoptotic cells [144,145]. These results suggest that TNF-α induces NF-

κB cell death. Over expression of p50 or p65 (dose-dependent manner) for 24 hours in H9c2 cells treated with or without TNF-α resulted in an increase of apoptoticcell death [145]. TNF-

α treated H9c2 cells that over expressed p50 or p65, along with over expression of mutated

∆205TNFR1 (cytoplasma domain is truncated) reduced NF-κB activation and apoptotic cell death [145]. H9c2 cells over expressing WT TNFR2 resulted in less NF-κB activation, but failed to reduce apoptotic cell death [145]. These results support the conclusion that TNF-α results in NF-κB cell death, which may be partly mediated by TNFR1 downstream signaling, and that TNFR2 reduces NF-κB activation.

Hypoxia activates NF-κB and results in a decrease of apoptotic cell death via inhibiting basal and hypoxia-includible mitochondrial death gene BNIP3 in isolated postnatal rat cardiomyocytes

[185,190]. TNF-α pretreatment during hypoxia prevented cell injury compared to cells that underwent hypoxia without TNF-α treatment [141]. These results suggest that NF-κB and TNF-

α pretreated cells confer resistance to hypoxia stress, which results in cardioprotection

[141,185,190]. Other studies suggest that transcription factors NF-κB and activator protein-1

(AP-1) are activated by oxidative stress (e.g. H2O2, in vitro rat isolated global

ischemia/reperfusion) and mediates cell death [192]. After 120 minutes of global reperfusion, the

expression level of NF-κB-dependent pro-apoptotic protein p53 (p53, transcription factor) was

52 increased, and NF-κB-dependent anti-apoptotic gene bcl-2 was decreased, corresponding to

apoptotic cell death [192].

Summary

Isolated cardiomyocytes or global I/R in the isolated rat hearts indicate that TNF-α leads to the

activation of NF-κB, which may contribute to cardioprotection [143,184,185,187,190,191] or

cell injury [144,145,192].

I.4.8 Role of TNF-α after PO and I/R

Genetic blockade of TNFR1/2 KO resulted in a 40% increase in infarct size compared to WT

mice after 24 hours PO, which suggests that TNFR1/2 mediates cardioprotection [146].

However, the single TNFR1 KO or TNFR2 KO after 24 hours of PO resulted in no difference in infarct size compared to WT mice [146]. This study suggests that TNFR1/2 contributes to cardioprotection after PO.

In contrast, studies using either antibodies against TNF-α (inhibited TNF-α) in mice and rabbits,

or using genetic blockade of TNF-α signaling (TNF-α KO mice, TNFR1/2 KO mice, TNFR1

KO mice) resulted in a significantly smaller infarct compared to either controls or WT mice after

I/R [147-149,167,193]. These studies suggest that TNF-α mediates cell injury, which might

occur through the TNFR1 signaling pathway after I/R. One main factor downstream of both

TNFR1 and TNFR2 is NF-κB. Could NF-κB mediate the TNF-α paradox?

53 I.4.9. Role of NF-κB after PO

As mentioned above, previous studies suggest that TNFR1 and TNFR2 provide cardioprotection after 24 hours PO [146]. The mechanisms behind TNFR1 and TNFR2 cardioprotection are unknown; however, one hypothesis is that NF-κB activation might contribute to the TNF-α cardioprotective effect [146]. This hypothesis was examined using a cardiac-specific

overexpression of a dominant negative IκBα∆Ν mouse in which the first 32 amino acids were

truncated, preventing the critical phosphorylation of key amnio acids (S32, S36) and rendering

the mutant protein resistant to degradation [182]. Genetic blockade of NF-κB activation

(IκBα∆Ν) resulted in a 50% increase in infarct size compared to WT mice after 24 hours PO,

which is most likely due to an increase of apoptotic cells in IκBα∆Ν compared to WT after 3

and 6 hours after PO [182]. Their results were comfirmed by using a similar mouse model (DN)

in which NF-κB activation (S32A, S36A) was blocked in the cardiomyocytes, resulting in a

significant increase in infarct size after 24 hours PO compared to WT mice [51]. These results

strongly support the idea that TNF-α and NF-κB activation result in cardioprotection after PO.

I.4.10 Role of NF-κB after I/R

Briefly, several in vivo studies have assessed the role of NF-κB after I/R employing

pharmacological NF-κB inhibitors and NF-κB-specific oligodeoxynucotide decoys (ODN),

which suggest that NF-κB is cell injurious [51,167,194-202]. Several of the pharmacological

NF-κB inhibitors are non-specific and are known to be either reactive oxygen species (ROS)

scavengers (ROS contributes to reperfusion injury) or inhibit other enzymes that may mediate

cell protection or cell injury (e.g. superoxide dismutase) [51,167,203]. The use of NF-κB-

54 specific ODN might not fully block NF-κB activation, and may interact with other

transcriptional factors that can bind or overlap NF-κB DNA binding sites [51,167]. These

approaches are not completely specific and therefore can lead to misinterpretation of the results

[51,167]. The use of genetic mouse models would be the most appropriate way to examine the

role of NF-κB in vivo during ischemic insults.

In 2001, the Jones group was the first to create a specific cardiac overexpression of a dominant negative IκBα (S32,36A), which blocked NF-κB activation (DN mice) [181]. After 30 minutes ischemia followed by 24 hours of reperfusion, DN mice exhibited a significantly smaller infarct compared to WT [51,167,183]. Another study that used a p50 KO mouse after I/R resulted in a significantly smaller infarct compared to WT [204]. The use of genetic mouse models, pharmacological NF-κB inhibitors, and transcription factor decoys (ODN) all suggest that NF-

κB contributes to cell injury after I/R.

I.4.11 NF-κB Summary

The main subunit of NF-κB in the heart is the p65/p50 dimer, which is suppressed in the cytoplasm by IκB. Activation of NF-κB by upstream factors such as TNF-α, NIK, or protein kinases (MEKK1/4, Akt, MEK1/2) can phosphorylate IKK, resulting in the activation of IΚΚ,

which phosphorylate IκB at serines 32 and 36 (Figure 6). This results in IκB ubiquitination and

degradation, thereby allowing p65/p50 to translocate from the cytoplasm to the nucleus (Figure

6). Post-translational modifications such as phosphorylation can occur in the cytoplasm or the

nucleus. Replacing serine (S) at 32 and 36 with alanine (A) prevents the phosphorylation of IκB,

55 therefore preventing NF-κB activation and translocation (Figure 6). The use of the DN

transgenic mice, which express these mutations specifically in the cardiomyocytes, allows one to

assess the role of NF-κB in the cardiomyocytes. The use of DN mice and other agents has shown

that NF-κB contributes to cell injury after I/R, whereas NF-κB mediates cardioprotection after

PO. However, there is a lack of knowledge regarding how NF-κB mediates cell survival vs. cell death after different ischemic insults. This lack of knowledge is a major roadblock in the identification of novel therapeutic targets for reducing cell death and enhancing cardioprotection in the heart.

56 Figure 6. Summary of the NF-κB section

Figure 6. Summary of the NF-κB section

In summary, upstream factors (e.g. TNF-α, PO and I/R stimuli) result in the phosphorylation of

IKK, which phosphorylates IκB at serine 32 and 36, resulting in the degradation of IκB and allowing p65/p50 to translocate to the nucleus. The mutated IκB protein with S32A and S36A prevents IκB from being degraded and therefore suppressing NF-κB activation and translocation.

The hypothesis is that NF-κB regulates distinct genes that result in cardioprotection after PO or cell injury after I/R. 57 I.5 Thesis Objectives and Hypothesis

The objective of this research was to distinguish and determine the mechanisms that underlie the

differential effects of NF-κB following ischemic insults (e.g. I/R vs. PO), which led to either NF-

κB-dependent cardioprotection or NF-κB-dependent cell death. The hypothesis of this research

is that NF-κB is a key signaling integrator that differentially regulates distinct sets of NF-κB-

dependent genes that contribute to cardioprotection or cell death following ischemic insults. To

test the hypothesis, unique transgenic mice were used in which NF-κB activation was genetically

blocked in the cardiomyocyte (DN) along with gene expression assays (microarrays and

quantitative real-time PCR, QRT-PCR). Understanding how NF-κB regulates cardioprotection

vs. cell death in response to different ischemic stimuli will advance the development of novel and

efficacious therapies for the treatment of ischemic coronary disease. Our results suggested that

Hsp70.1 contributes to the NF-κB-dependent cardioprotection after PO and is involved in NF-

κB-dependent cell death outcome after I/R.

58 Chapter II: Methods and Materials

II.1 Animal Models

Experiments were performed with age (10-16 weeks old) and sex matched animals. Mice were bred and maintained in accordance with institutional guidelines, and the Guide for the Care and

Use of Laboratory Animals (National Institutes of Health, revised 1996) [205]. All procedures and mouse handing techniques were approved by the University of Cincinnati Institutional

Animal Care and Use Committee. The mice were housed in a specific pathogen-free facility, with food and water ad libitum except during surgery.

II.1.1 IκBDN Mice

IκBDN (DN) mice have been fully characterized and demonstrate a blockade of NF-κB after various insults [51,167,181,183]. These mice were created by Dr. Jones in 2001, which express a transdominant human IκBα cDNA that has serine 32 and 36 replaced with alanine

(IκBαS32A,S36A) [181]. This transgene was specifically expressed in cardiomyocytes by using the

α-MyHC promoter [181]. DN mice were maintained on a c57/BL background. The mouse colony was obtained by using DN male breeders along with c57/BL females obtained from

Jackson Laboratory and/or the lab c57 mouse colony. Pups were weaned at post-natal day 21, ear tagged (id tag), and tail clipped (~2cm) for genotyping purposes. Both non-transgenic (WT) and c57 (c57/BL) mice were used as controls for the DN line.

59 II.1.2 HSP70.1/3 KO Mice

Hsp70.1/3 KO (Hspa1b/Hspa1a KO) mice have been fully characterized and demonstrate a lack

of functional hsp70.1 and hsp70.3 genes [206]. The targeted disruption of hsp70.1 and hsp70.3 was accomplished by a targeted vector that contained a deleted 11kb genomic DNA sequence between the 5’end of the hsp70.3 gene to the 3’end of the hsp70.1 gene [206]. Homozygous KO

Hsp70.1/.3 breeders were a kind gift from Dr. Hector R. Wong (Cincinnati Children’s Hospital

Medical Center). Initial breeders were ear tagged, and the first sets of pups were ear tagged and tail clipped to confirm the KO genotype. The breeding colony was maintained by breeding homozygous KO females and males. Hsp70.1/3 KO mice are on the B6/129 background, and control mice for experiments were B6/129 obtained from Jackson Laboratory and/or the lab

B129 mouse colony.

II.1.3 HSP70.1 KO Mice

Hsp70.1 KO (Hspa1b KO) mice have been fully characterized and demonstrate the lack of a

functional hsp70.1 gene [109,116]. The hsp70.1 gene was targeted with a vector that replaced the promoter and some of the coding sequence of hsp70.1 with the neomycin resistance gene (PGK-

neo) expression cassette [109,116]. Hsp70.1 homozygous KO breeders were obtained from

Macrogen (S. Korea). Initial breeders were ear tagged, and the first sets of pups were ear tagged and tail clipped to confirm the homozygous KO. Breeding colony was maintained by breeding

homozygous KO females and males. Hsp70.1 KO mice are on the c57/BL background and

control mice for experiments were c57/BL mice obtained from Jackson Laboratory and/or the lab

c57 mouse colony.

60 II.1.4 Genotyping

Genomic DNA Isolation

Genomic DNA isolation from mouse tail was achieved by adding ~1cm mouse tail to 500µL of

tail isolation buffer [100mM Tris-HCL pH 8.5, 5mM EDT pH 8.0, 200mM NaCl, and 0.2%

SDS] with 20µL of Proteinase K solution (10mg Proteinase K/mL H2O). Tails were cut into

smaller pieces using scissors and incubated overnight at 55°C. An additional 20µL of Proteinase

K (10mg/mL) were added in the morning and allowed to further incubate at 55°C for 2 hours.

After incubation, samples were placed into a phase lock gel tube containing 400µL of Tris

saturated phenol and 100µL of chloroform, and centrifuged at 10,000 g for 5 minutes. The

supernatant was then transferred into a new phase lock gel tube containing 250µL of Tris

saturated phenol and 250µL of chloroform and centrifuged at 10,000 g for 5 minutes. Next, the

aqueous phase (~500µL) was added to a new tube and an equal volume (~500µL) of

isopropranol was mixed in gently. After 5-10 minutes of incubation at room temperature, the

tubes were centrifuged at 10,000 g for 5 minutes. Isopropranol was carefully removed and

500µL of 75% ethanol was added to the DNA pellet and centrifuged at 10,000 g for 10 minutes.

The supernatant was carefully removed and the DNA pellet was allowed to dry (1 hour). The

pellet was then resuspended with 100-300µL of DNase/RNase free water and hydrated at 4°C

overnight. The DNA samples were kept at -20°C.

PCR

Each PCR reaction contained 1µL of DNA sample and 19µL of the PCR master mix. PCR master mix is composed of 15.75µL of Autoclaved Mill Q Water, 2µL of Qiagen 10x PCR

61 Buffer (15mM MgCl2), 0.5µ of dNTP (10mM), 0.25µL of Primer 1 (100pmol), and 0.25µL of

Primer 2 (100pmol).

DN Mice Genotyping (PCR)

Primer Name Primer Sequences Product Size IκBα 491 5’ CACAGCCAGCTCCCAGAAGTGCCTCAGCAATTTC 3’ 300-600bp DN Mice α-check 5411 5’ GAAGCCTAGCCCACACCAGAAATGACAGACAGATC 3’ ∆3 5’ CAACATCCAGGCAGCAAATCTGCG 3’ 300-600bp ∆5 5’ TCTCAGGGAAACCCAAGCAAGTGC 3’ DNA Control

PCR Protocol Step 1: 94°C 4 minutes Step 2: 94°C 30 seconds Step 3: 63°C 30 seconds Step 4: 72°C 1 minute Step 5: Repeat Step 2-4 for 40 cycles Step 6: 72°C 10 minutes Step 7: Hold at 4°C

Hsp70.1/.3 KO Mice Genotyping (PCR)

The PCR protocol for genotyping the Hsp70.1/.3 KO can be found on the Mutant Mouse

Regional Resource Center web site: http://www.mmrrc.org/strains/371/0371.html.

Primer Name Primer Sequences Product Size

Hsp70 KO A primer (NEO 5’ GAACGGAGGATAAAGTTAGG 3’ Hsp70.1/.3 KO primer F12489) 780bp (doublet) Hsp70 KO B primer (the 5’AGTACACAGTGCCAAGACG 3’ reverse 3’ 70-Primer) Hsp70 WT primer A 5’ GTACACTTTAAACCCTCC 3’ WT 454bp (forward hsp70-1 WT primer, F191) Hsp70 WT primer B (reverse 5’ CTGCTTCTCTTGTCTTCG 3’ hsp70-1 WT primer, R644)

PCR Protocol Hsp70 KO: Step 1: 94°C 2 minutes Step 2: 94°C 1 minute Step 3: 58°C 30 seconds Step 4: 72°C 30 seconds Step 5: Repeat Step 2-4 for 35 cycles Step 6: 72°C 7 minutes Step 7: Hold: 4°C.

62 PCR Protocol Hsp70 WT: Step 1: 94°C 2 minutes Step 2: 94°C 1 minute Step 3: 58°C 1 minute Step 4: 72°C 30 seconds Step 5: Repeat Step 2-4 for 35 cycles Step 6: 72°C 7 minutes Step 7: Hold: 4°C.

Hsp70.1 KO Mice Genotyping (PCR)

Primer Name Primer Sequences Product Size

Hsp70.1 KO A Primer 5’ GTCAGCCTCGCTGAGCTTGC 3’ Hsp70.1 KO (forward primer hsp-10) ~1250bp Hsp70.1 KO B Primer 5’ CGAGATCAGCAGCCTCTGTTCC 3’ (Reverse primer (PGK-neo 3’) Hsp70.1 WT A Primer 5’ AGGAGCTGACCCTTAACAGC 3’ Hsp 70.1 WT (forward primer hsp_Sn) ~650bp Hsp70.1 WT A Primer 5’ GTCGTTGGCGATGATCTCC 3’ (reverse primer hsp-Asn)

PCR Protocol Hsp70 WT: Step 1: 94°C 5 minutes Step 2: 94°C 1 minute Step 3: 64°C 2 minutes Step 4: 72°C 1 minute Step 5: Repeat Step 2-4 for 35 cycles Step 6: 72°C 10 minutes Step 7: Hold: 4°C.

II.2 Myocardial Ischemia Model

Myocardial ischemia has been described previously [183,207]. Mice were anesthetized with sodium pentobarbital (100mg/kg IP), intubated with polyethylene 90 tubing, and ventilated using a mini ventilator (Harvard Apparatus, MidiVent Ventilator) to maintain the respiratory rate between 100 and 105 breaths/min [183,207]. Po2, Pco2, blood pH, and body temperature were

maintained within normal limits [208]. Body temperature was maintained around 37°C by using

a heating pad during surgery and recovery periods. A lateral thoracotomy was performed by

making a 1.5cm incision between the second and third ribs to provide access to the left anterior

descending coronary artery (LAD) without distributing the ribs, sternal resection, retraction, and

rotation of the heart [183,207]. Blood loss was minimized (<50µL) by coagulating the vascular 63 bundles in the vicinity area using a micro coagulator (Medical Industries, Inc) [207]. An 8-0 nylon suture was placed approximately 2-4mm from the tip of the left auricle [183,207]. A piece of soft silicon tubing (0.64 mm internal diameter, 1.19 mm outer diameter) was placed between the artery and suture [183,207]. Ischemia was achieved by tightening and tying the suture to press against the coronary artery, resulting in occlusion of the artery [183,207]. Myocardial ischemia was confirmed by visual observation (e.g. cyanosis) and ECG monitoring (e.g. wider

QRS complex, inversion of T wave, and ST segment change). In the permanent occlusion model

(PO), the LAD was permanently occluded and the mouse chest was closed in layers. For the

ischemia/reperfusion (I/R) model, the occlusion was maintained for 30 or 45 minutes before the

suture was untied and left in place [183,207]. Reperfusion was confirmed by visual observation

(e.g. return of color) and ECG monitoring (e.g. reversal effects), followed by closing of the chest

[183,207]. Sham mice were subjected to the same procedures without tightening the suture,

therefore no occlusion occurred [183,207]. All mice were observed after surgery until they

regained full consciousness, and were placed in a warm 100% oxygen chamber to maintain

normal body temperature and respiration during recovery. Polyethylene 90 tubing was removed

once the mice exhibited normal breathing and partial consciousness during the recovery period.

When mice exhibited full consciousness, they were placed back into their cage with wet food on

the bedding.

II.3 Myocardial Infarct Analysis

Mice were euthanized and aortic cannulation with polyehylane-10 tubing occurred at 4 hours, 6 hours, 24 hours PO, or 24 hours after reperfusion [183,207]. Hearts were perfused through the aortic root with 1% triphenyltetrazolium chloride (TTC, pH 7.4), then the suture was re-tied at 64 the site of occlusion and the heart was perfused with a 5% solution of phthalo blue dye

(Heucotech) to distinguish the non-risk region [183,207]. The heart was isolated and placed in the freezer. The frozen heart was cut into 5-7 transverse slices with a razor at or below the occlusion and fixed in 10% neutral-buffered formaldehyde [183,207]. The heart slices were then photographed using an Olympus Camedia C-7070 7.1 MP digital camera fitted with a UR-E2 macro lens. The images were downloaded to a Mac computer, and computerized digital planimetry was performed using NIH image software (ImageJ 1.37v). The risk region for ischemia was determined by the area that stained red and white (TTC), the infarct region was considered to be the white area, and the non-risk region was stained blue (phthalo blue dye)

[183,207]. Risk region, non-risk region, and infarct region were measured using the method of

Fishbein et al. [209]. A Microsoft Excel sheet created by Dr. Xiaoping Ren was used to calculate

the percentage of non-risk, risk, and infarct regions. Each tissue section was weighed, recorded,

and entered into the spreadsheet. The total area, area of risk, infarct area, hole area, and hole area

in the risk region were calculated from ImageJ and entered into the spreadsheet for each section

of the heart. The percent of risk region was calculated by the area of risk over total area. The

weight of the risk region for that section was determined by multiplying the percent of risk

region and tissue selection weight. The percent of infarct area was determined by infarct area

over risk region area, and the weight of infarct area for that section was calculated by

multiplying the weight of risk region and the percent of the infarct area. The percent of total risk

region was determined by the sum of all weights of the risk region over the sum of all section

weights. The percent of total infarct area was calculated by the sum of all infarction weights over

the sum of weight risk.

65 II.4 Tissue Isolation

The mouse chest was opened and the heart was removed and placed in cold 1x PBS. The

ischemic zone (PO and I/R surgery mice) and the analogous region (sham mice) were isolated

from the rest of the heart. Both the ischemic tissue/analogous tissue and the rest of the heart was

flash frozen and stored at -80°C.

For NF-κB activation, mice were injected intraperitoneally with TNF-alpha (0.10µg/g). After 30

minutes, mice were euthanized by CO2 inhalation [183]. The hearts were removed, dissected into

atrial and ventricular sections, flash frozen in liquid N2, and stored at -80˚C [183]. Ventricular samples were processed and used as positive controls.

II.4.1 Nuclear and Cytoplasmic Extracts

Nuclear and cytoplasmic extracts from frozen ischemic tissue or sham tissue were prepared as described previously [183]. Frozen tissue was pulverized using a frozen pulverizer (Fisher) and liquid nitrogen. Frozen powder was put into a pre-frozen 1.5mL tube and weighed. Frozen tissue was homogenized (Ika Ultra-Turrax T8 homogenizer) at low to medium speed in 10x of the tissue weight (i.e. for 20µg tissue, use 200µL) of cold buffer A [10mM Hepes, 1.5mM MgCl2,

10mM KCl, 25µg/uL Leupeptin, 0.2mM Na-Orthovanadate, 0.5mM Dithiothreitol (DTT), 0.1%

(vol/vol) Trition]. Samples were then vortexed for 15 seconds, incubated on ice for 10 minutes,

and vortexed again for 15 seconds. Samples were then centrifuged at 4°C (5,000 g for 10

minutes) and the supernatant (cytoplasm fraction) was placed into a new 1.5ml tube, flash

frozen, and stored at -80°C. Pellet was quickly rinsed with a small amount of cold buffer C and

66 buffer was discarded to remove any leftover cytosol fraction. The pellet was resuspended in 5x of the tissue weight (i.e for 20µg tissue, use 100µL) of cold buffer C [20mM Hepes, 10%

(vol/vol) glycerol, 0.6M KCl, 1.5mM MgCl2, 0.2mM EDTA, 25µg/µL Leupeptin, 0.2mM Na-

Orthovanadate, 0.5mM Phenylmethylsulfonyl (PMSF), 0.5mM DTT, 0.1% (vol/vol) Trition].

Pellet was vortexed for 15 seconds every 10 minutes between the 40 minutes of incubation on ice, followed by being vortexed for 15 seconds before being centrifuged at 4°C (10,000 g for 15 minutes). Supernatant was aliquoted as the nuclear extract, flash frozen, and stored at -80°C. A small aliquot was saved for protein assay.

II.4.2 Protein Assay

Protein concentrations of nuclear and cytoplasm extracts were determined via a BioRad protein assay [RC DC Protein Assay Kit II #500-0122] using bovine serum albumin (BSA) as a standard. Unknown samples were diluted to a 1:5 ratio, and 10 BSA standards were made with concentrations ranging from 0 up to 3µg/µL. A 96-well plate was used with 5µL/well of the standards in duplicate and 5µL/well of the unknown samples in triplicate. Reagent A’ [20µl of

Reagent S to 1ml of reagent A] (25µL/well) was added to standards and unknown samples, and the plate was shaken lightly. Reagent B (200µL/per well) was added to each unknown and standard sample, and the plate was shaken lightly. After 30 minutes of incubation, the plate was read using a plate spectrometer at 750nm. The standards were plotted with the slope and intercept used to determine the unknown protein concentration. Nuclear extract and cytoplasmic extracts were used for Western blots.

67 II.4.3 Western Blots

Nuclear and cytoplasmic extract samples (20-30µg) were prepared by adding 5µL of laemmli sample buffer [62.5mM Tris-HC pH 6.8, 2% SDS, 25% Glycerol, 0.01% (vol/vol) bromophenol blue] and up to 20µL total of 20% Glycerol. One lane on each gel was loaded with 5µL of molecular weight ladder (Precision Plus Protein Standards, BioRad catalog #: 161-0375). The samples were heated at 100°C for 5 minutes and samples were loaded in a 10-12% SDS- polyacrylamide gel. Proteins were transferred to 0.45-µm nitrocellulose (Amersham Bioscience

Hybond-C Extra) or 0.45-µm PVDF membrane (Millipore) and rinsed with 1X TTBS [10mM

Tris-HCL (pH 7.50) and 0.15M NaCl with 0.1% Tween 20], followed by blocking (5% Fat Free

Milk in 1X TTBS or 5% BSA in 1%TTBS for TATA-TBP Ab) for 1hour at room temperature.

Membranes were probed overnight at 4°C with primary antibodies followed by a couple of short rinses of lX TTBS (5-15 minutes), and then probed with secondary antibodies at room temperature for 1-2 hours. After incubation, the membranes were rinsed with three washes of 1X

TTBS followed by adding enhanced chemiluminescence (Perkin Elemr Western Lighting

Chemiluminescence Reagent Plus, catalog #:NEL-104) to detect a signal. The blots were exposed to film (Kodak BioMax Light Film) for various times. Primary antibodies used were the following: 1:5,000-1:10,000 NF-κB p65 (Santa Cruz Sc-372 (C-20) rabbit polyclonal), 1:10,000

GAPDH (Santa Cruz Sc-25778 (FL-335) rabbit polyclonal), 1:50,000-1:100,000 Anti-Actin

(Sigma A2066 rabbit polyclonal), 1:2,000 TATA-TBP (Abcam 818 (1TBP18) mouse monoclonal), 1:1,000 Hsp70/Hsc70 (Santa Cruz Sc-20 (W27) mouse monoclonal), and 1:1,000

Hsp70 (Santa Cruz Sc-66048 (C92F3A-5) mouse monoclonal). Secondary antibodies were

1:10,000 goat-anti-rabbit IgG HRP (Santa Cruz Sc-2054) and 1:5,000-1:10,000 sheep-anti-

68 mouse IgG HRP (Amersham/GE Health NA931V). The membranes were then stained with

Ponceau S dye to assess protein loading and transfer variability.

II.4.4 Western Blot Analysis

Anti-actin antibody was used as a loading control for cytoplasmic (1:50,000) and nuclear extracts

(1:100,000). Nuclear extracts were confirmed by TATA-TBP (nuclear protein) while cytoplasm

extracts were confirmed by GAPDH (cytoplasmic protein) [210]. Random nuclear extracts were

checked for cytoplasm contamination by the presence of GAPDH. Nuclear extracts were

confirmed to be clean of cytoplasm contamination.

The signal intensity/density corresponding to the band of interest was quantified using ImageJ

1.37v. Controls were used to develop a linear range of detection and to verify that signal

intensity/density was within the linear range of detection. In each Western blot run, the average

of all actin bands (loading control) was used to normalize for loading differences within the gel

to the p65 signal intensity/density [211]. Each Western blot had a TNF-α control, which was a

positive control for p65 translocation, and was used to normalize from Western blot to Western

blot. Experiments were repeated at least three times. The sham group had 4 independent samples,

and PO samples had between 3-5 independent samples. Each sample group represented the

average of all samples within that group over WT sham.

69 II.5 RNA Isolation

Total RNA was extracted from the ischemic zone using an RNeasy Mini kit (Qiagen, catalog #:

74104) according to Appendix C (Protocol for Isolation of Total RNA from Heart, Muscle, and

Skin Tissue) in the RNeasy Mini handbook (3rd edition; June 2001). Briefly, 300µL of RLT buffer with β-Mercaptoethanol (10µL /1mL of RLT buffer) was added to the frozen ischemic

tissue along with 590µL of Mill-Q water (3-5mL tubes). The samples were homogenized (Ika

Ultra-Turrax T8 homogenizer) at low to medium speed until uniformly homogenous. This was

followed by the addition of 10µL Proteinase K (20mg/µl) and incubation at 55°C for 10 minutes.

The samples were centrifuged for 3 minutes at 10,000g and the supernatant was transferred to a

new tube. 450µL of 100% ethanol were added to the supernatant and was mixed by pipetting.

Half the volume was added to the RNeasy mini column, placed in a 2mL collection tube, and

centrifuged for 15 seconds at 10,000g; the flow-through was discarded. The other half of the

sample was repeated with flow-through discarded. Buffer RW1 (350µL) was added into the

RNeasy mini column and centrifuged at 10,000g for 15 seconds; the flow-through was discarded.

The RNeasy silica-gel membrane in the column was treated with DNase I solution (DNase I

solution: 10µL DNase I stock solution into 70µL Buffer RDD) and mixed gently for 15 minutes

at room temperature, followed by the addition of 350µL of buffer RW1 into the column. The

RNeasy column was centrifuged at 10,000g for 15 seconds and the collection tube/flow-through

was discarded. RNeasy column was transferred into a new 2.0mL collection tube and 500µL

buffer RPE [Stock buffer RPE was diluted with 4 volumes of 100% ethanol] placed into the

column. The column was centrifuged at 10,000g for 15 seconds and the flow-through was discarded. Additional 500µL of buffer RPE was added into the column and centrifuged at 70 10,000g for 2 minutes, and the collection tube/flow through was discarded. The column was

placed into a new 1.5mL tube, centrifuged at 10,000g for 1 minute, and then the collection

tube/flow-through was discarded. RNeasy column was transferred to a new 1.5mL collection

tube and 30µL of RNase-free water was added to RNeasy silica-gel membrane, which was

centrifuged at 10,000g for 1 minute to elute the RNA. Aliquots of RNA samples were dispensed

into 1.5mL tubes, flash frozen with liquid nitrogen, and stored at -80°C. Total RNA quantity and quality were assessed by optical density (Spectronic Unicam Genesys 10UV) at 260 nm, and

optical density ratios of 260/280 nm and 260/230 nm ratios respectively.

II.6 Microarray

RNA samples (1µg/10µL) were submitted to the University of Cincinnati Microarray Core for

Agilent Bioanalyzer/Nanodrop analysis (Agilent 2100 Bioanalyzer). RNA samples that passessed Agilent Bioanalzyer analysis with an RNA integrity number (RIN) greater then 7 and nanodrop analysis ranging from 1.7 to 2.2 for the 260/280 ratio were used for microarrays. RNA samples were amplified by the University of Cincinnati Microarray Core using Amino Allyl

MessageAMP kit (catalog #1753) from Ambion, based on a modified Eberwine procedure [212]. cDNA synthesis and indirect amino-allyl labeling were performed by the University of

Cincinnati Microarray Core using a modified version of the Brown Lab (Stanford University) protocol [213].

Strategy for DNA microarray analysis of gene expression (Figure 7): Microarray groups (n=4) of wild type (squares) and IκBDN mice (hexagons) were subjected to PO, I/R, or sham surgery.

71 Competitive hybridization to microarrays of labeled cDNA targets generated from 4 separate samples per group was performed with two dye flips performed per group.

Figure 7. Gene Microarray Strategy: WT and IκBDN (DN) mice were subjected to I/R, PO, or sham surgery. NF-κB-dependent genes are defined as genes significantly dysregulated (up- and down-regulated) (P≤0.01 and >1.5 fold) between WT (squares) and DN (hexagons) (blue line/circle). Genes up- and down-regulated by I/R are defined as genes that are significantly dysregulated (P≤0.01 and >1.5 fold) between I/R WT and Sham (red line/circle). Genes up- and down-regulated by PO are defined as genes that are significantly dysregulated (P≤0.01 and >1.5 fold) between WT PO and Sham (green line/circle). Yellow shaded area represents genes that are dysregulated (up- and down-regulated) in I/R and PO and are up- and down-regulated by NF-κB.

72 Microarray chips were MEEBO mouse set v1.05 with 30,060 genes out of 38,467

oligonucleotides (there are mutiple oligonucleotides that have different sequences that are used

to detect the same gene). Microarray hybridization and wash conditions were previously

described [214,215]. Scanning and analysis of microarray slides were done according to protocol for the Axon GenePix Pro 3.0 and 4.0 software.

Statistical analysis was performed by the Medvedovic group, which used R statistical software and the Limma Biocondutor package [216]. Normalization of the data was performed in two steps. The first step was to convert background adjustment intensities to log-transformations and

the differences (M) and averages (A) of the log-transformed values were calculated as M=

log2(X1) – log2(2X) and A=[log2(X1) + log2(X2)]/2, where X1 and X2 denote the Cy5 and Cy3

intensities. Next, the normalization was performed by fitting the array-specific local regression

model of M as a function of A. Normalized log-intensities for the two channels were then

calculated by adding half of the normalized ratio to A for the Cy5 channel, and subtracting half of the normalized ratio from A for the Cy3 channel. Each separate gene was subjected to statistical analysis using the Analysis of Variance model: Yijk = µ + Ai + Sj + Ck + εijk, where Yijk

corresponds to the normalized log-intensity of ith, with jth treatment, and labeled with the Kth dye

(k = 1 for Cy5, and 2 for Cy3). µ is the overall mean log-intensity, Ai is the effect of the ith

array, Sj is the effect of the jth treatment, and Ck is the gene-specific effect of the Kth dyes.

ANOVA models and t-statistics from each comparison were modified by using an intensity-

based empirical Bayes method (IBMT), which resulted in estimated fold changes of the genes

[217].

73 Genes that were significantly up- and down-regulated (P<0.01 and >1.5 fold) by NF-κB, after

PO or I/R, and by NF-κB after PO or I/R, were subjected to in silica functional analysis using

CLustering Enrichment ANalysis (CLEAN) [218]. Briefly, CLEAN is an open-source R package

that performs hierarchical clustering of genes based on their expression profiles and set of

functional categories (e.g. Gene Ontology (GO), Kyoto Encyclopedia of Genes and Genome

(KEGG) pathway) [218]. Functional enrichment for each functional category (GO and KEGG)

was determined by performing Fisher’s Exact Test [218]. CLEAN is a free software that can be

downloaded from the University of Cincinnati Laboratory for Statistical Genomics and System

Biology web site: http://Clusteranalysis.org.

II.7 Quantitative Real-Time PCR (QRT-PCR)

cDNA synthesis was performed using an RNA-to-cDNA kit (Applied Biosystems, P/N:

4387406) according to manufacturer’s instructions. Synthesis of cDNA was carried out using 0.5

µg of total RNA, and optical density was used to determine quantity and quality (as described above for isolated RNA). Total volume of the reaction is 20µL, which is composed of 10µL 2x

RT buffer, 1µL 20x RT enzyme mix, 0.5µg of RNA sample, and RNase/DNase-free water on ice. The reaction sample was incubated at 37°C for 1 hour, followed by incubation at 95°C for 5

minutes. cDNA quantity and quality were assessed by optical density (Spectronic Unicam

Genesys 10UV) at 260 nm, and optical density ratios of 260/280 nm and 260/230 nm ratios

respectively. Samples were stored at -80C for long term or -20C for short term.

74 Quantitative RT-PCR (QRT-PCR) was conducted with a Stratagene MX 3000P machine using a

SYBR Green 2X RT-PCR master mix (Applied Biosystems, P/N: 430915). For all genes, the

thermocycling parameters were 95o C for 8 minutes followed by 40 cycles of 95o C for 15

seconds, and 60oC for 60 seconds (with data collection at the end of 60oC step at each cycle).

This was followed by 95oC for 60 seconds, 60oC for 30 seconds, and then 95oC for 30 seconds.

All reactions were performed in triplicate on each plate with a minimum of three independent

replicates. Gene expression values were calculated using the difference in target gene expression

relative to 18S mRNA using the 2-∆∆Ct method [217].

Primer sequences were determined by using Roche Applied Science Universal Probe Library

Assay Design Software (ProbeFinder Version 2.45 Mouse) (Table 2). Primer sequences were

reconfirmed to be specific for the target gene by using a basic local alignment search tool

(BLAST). Primers were synthesized by Integrated DNA Technologies and hydrated with

DNA/RNAase-free water to 100uM primer concentration. However, the primers for plscr1 were

ordered from Qiagen, which was the QuantiTech® Primer Assay Mm_Plscr1_2_SG. Each

primer set and conditions were confirmed to be within the linear range, and each QRT-PCR

product was run on an agarose gel 1% to confirm the product size.

The optimum conditions for 18s primer were 3µL (20ng/µL cDNA) and 17µL PCR master mix

[10µL 2X RT-PCR master mix, 0.25µL 18S AS primer and 0.25µL 18s S primer, 6.5µL

DNase/RNase free water], and target genes were 5µL (20ng/µL cDNA) and 15µL PCR master mix [10µL 2X RT-PCR master mix, 0.25µL target gene anti-sense primer and 0.25µL target gene sense primer, 4.5µL DNase/RNase free water]. 75 Table 2. QRT-PCR Primers

Primer Name Primer Sequences

18s AS 5’-AGTCCCTGCCCTTTGTACACA-3’ 18s S 5’-CCGAGGGCCTCACTAAACC-3’ hsp70.1 S 5’-GAAGACATATAGTCTAGCTGCCCAGT-3’ hsp70.1 AS 5’-CCAAGACGTTTGTTTAAGACACTTT-3’ hsp70.3 S 5’-GGCCAGGGCTGGATTACT-3’ hsp70.3 AS 5’-GCAACCACCATGCAAGATTA-3’ hsp90aa1 S 5’-GTCTCGTGCGTGTTCATTCA-3’ hsp90aa1 AS 5’-CATTAACTGGGCAATTTCTGC-3’ ndufc1 S 5’-TAGTGCTGCGCTCGTTTTC-3’ ndufc1 AS 5’-TTCGACCGTGTTGAAGAGC-3’ ptx 3 S 5’-CGCTGTGCTGGAGGAACT-3’ ptx 3 AS 5’-GGGAAGAAAATTGCTGTTTCAC-3’

76 II.8 Statistical Analysis

Results are reported as means ± SEM. Unpaired student t-test using the Bonferroni correction and a one-way ANOVA test were used. Differences were considered significant at P≤0.05.

Power analysis (power = 0.95; α = 0.05) was used to ensure proper sample size needed to determine significance.

77 Chapter III: Results

III.1 NF-κB Paradox

III.1.1 Role of NF-κB after PO and I/R

The objective is to determine the role of NF-κB after PO and I/R by assessing infarct

development after 24 hours PO and I/R. After 24 hours PO, DN mice presented with a

significantly larger infarct (83.23%±1.86, n=4, P<0.001) compared to WT mice (62.42%±3.14,

n=7) (Figure 8A). Ischemia for 30 minutes followed by 24 hours of reperfusion in DN mice

resulted in a significantly smaller infarct (5.74%±1.47, n=5, P<0.001) compared to WT mice

(25.58%±1.72, n=12) (Figure 8A). After 45 minutes of ischemia followed by 24 hours of

reperfusion, DN mice exhibited a significantly smaller infarct (20.98%±3.65, n=6, P<0.001)

compared to WT mice (50.50%±2.50, n=10) (Figure 8A).

There were no significant differences in the risk region between 24hr PO (DN: 59.56%±2.05 and

WT: 52.59%±4.42), I/R 30m/24hr (DN: 70.11%±3.17, WT: 65.94±2.91) and I/R 45m/24hr (DN:

62.19%±4.18, WT: 56.05%±2.46). Our results show that NF-κB mediates cardioprotection after

PO, in contrast to being cell injurious after I/R.

78 Figure 8. Infarct analysis after PO and I/R

A.

B.

C.

79 Figure 8. Infarct analysis after PO and I/R.

A. Infarct size (percent of risk region) for WT and DN (blockade of NF-κB) mice subjected to 30

minutes ischemia followed by 24 hours reperfusion, 45 minutes ischemia followed by 24 hours

reperfusion, or 24 hours ischemia. B. Percent of risk region for I/R and PO groups. C.

Representative samples from WT and DN subjected to I/R or PO. The blue area is the non-risk region, the red and white area is the risk region, and the white area is the infarct area.

Bars represent mean ±SEM. n= 4-12. *P≤0.05

80 III.1.2 NF-κB-dependent cardioprotection after PO

The goal of these experiments was to identify the time period in which NF-κB-dependent cardioprotection occurs after PO. DN and WT mice were subjected to 4, 6 or 24 hours PO and infarct size was measured. After 4 hours PO, there were no significant differences (P=0.91) in infarct size between DN mice (69.85%±4.23, n=5) and WT mice (69.35%±2.43, n=4) (Figure

9A). However, DN mice subjected to 6 hours (83.66%±1.54, n=5) or 24 hours PO

(83.23%±1.86, n=4) displayed a significantly larger infarct (P<0.0001) compared to WT mice (6 hours (67.89%±2.68, n=8) or 24 hours PO (62.42%±3.14, n=7) (Figure 9A). DN mice exposed to

4 hours of PO (69.85%±4.23) exhibited a significantly smaller (P<0.001) infarct compared to the

6 hours (83.66%±1.54) and 24 hours PO (83.23%±1.86) (Figure 9A). There were no significant differences in infarct size (P=0.38) after 4 hours (69.35%±4.22), 6 hours (67.89%±2.68), and 24 hours (62.42%±3.14) for WT PO groups (Figure 9A).

There were also no significant differences in percent of area of risk between all PO groups (WT:

4 hrs 60.72%±2.27, 6 hrs 60.10%±2.50, 24 hrs 52.59%±4.42; DN: 4 hrs 63.01%±8.49, 6 hrs

54.62%±1.50, 24 hrs 59.56%±2.05; P=0.19) (Figure 9B). Our results suggest that NF-κB- dependent cardioprotection occurs between 4 to 6 hours after PO.

81 A.

B.

Figure 9. Infarct analysis after PO

A. Infarct size (as percent of risk region) for WT and DN (blockade of NF-κB) mice subjected to

4 hours, 6 hours, or 24 hours PO

B. The percent of risk region for the WT and DN PO groups n=4-8. Bars represent mean ±SEM. *P≤0.05

82 III.1.3 NF-κB Translocation after PO

The goal of these experiments was to determine when NF-κB (p65) translocation from the cytoplasm to nucleus occurs during PO by using Western blots to detect p65 (anti-p65 antibody) in the nucleus. Mice injected with TNF-α (10ug/g) were used as a positive control and the heart

(left ventricle) was processed as nuclear (TNF+ NE) and cytoplasmic extracts (TNF+ CE).

Nuclear and Cytoplasmic Extracts

Nuclear extracts (NE) were confirmed using a TATA-binding protein (TBP) antibody with a

predicted band size of 38kDa [210]. TNF+ NE was probed with the TATA-TBP antibody, which

detects several members of the TATA-TBP family. With this antibody, very faint bands were detected at 35kDa and 50kDa, with a darker band at 13kDa (Figure 10A). The 13kDa band is a

TAFIIAγ subunit, which is a member of the TATA-TBP family and was used as a conformational tool for nuclear extracts [220]. The cytoplasmic extract (CE) had dark double bands between 48-

52kDa and 32-37kDa, and no band at 13kDa (Figure 10A).

The same extracts were examined using an antibody directed against cytoplasmic protein

glyceraldehyde-3-phosphate dehydrogenase (GAPDH) with a predicted band of 37kDa [210].

The TNF + CE showed a very strong band at 37kDa, suggesting that the extract primarily

contains cytoplasmic proteins (Figure 10A). The TNF + NE resulted in no band at 37kDa,

implying the extract to be free of any cytoplasmic contamination (Figure 10A).

83 NF-κB Translocation

A small increase of NF-κB (p65) was present in the nucleus relative to WT sham (sham=1.10) starting at 1 hour after occlusion (1.76±0.30, n=3, P=0.13), followed by a significant increase at

2 hours (2.72±0.62, n=5, P=0.05) (Figure 6B). Steady levels of p65 remained in the nucleus up to 4 hours post coronary occlusion (3hr: 2.96±0.79, n=4, P=0.09 and 4hr: 2.62±0.48, n=4,

P=0.04) (Figure 6B).

84 Figure 10. NF-κB Translocation after PO

A.

B.

85

Figure 10. NF-κB activation and translocation after PO

A. Nuclear extracts (NE) were confirmed by the presence of TATA-TBP, and cytoplasmic

extracts (CE) were confirmed by the presence of GAPDH. NE was demonstrated to be free of

any cytoplasmic contamination by lack of significant GAPDH levels.

B. The graph represents the translocation of p65 into the nucleus for the following groups: TNF-

α (positive control) (3.35±0.39), WT Sham (4 hour) (1.03±0.07), 1 hour PO (1.76±0.13), 2 hour

PO (2.72±0.62), 3 hour PO (2.97±0.79) and 4 hour PO (2.62±0.48), with values plotted as fold over WT sham (sham n= 1). Representative Western blots are below the graph, with p65 band at the top and actin below as a loading control. TNF-α n=1, WT Sham n=4, PO n=3-5. Bars represents mean ±SEM. *P≤0.05

86 III.2 Genes regulated after PO and I/R, and by NF-κB

The goal of these experiments was to determine genes that likely underlie the NF-κB-dependent cardioprotection after PO, and genes that mediate NF-κB-dependent cell injury after I/R.

Microarrays were used to determine the set of genes that are significantly up- and down-

regulated (P<0.01 and >1.5 fold change) after PO (e.g. comparison between WT PO vs. WT

Sham), and genes that are up- and down-regulated by NF-κB in response to PO (e.g. comparison

between WT PO vs. DN PO). The two gene sets (e.g. PO regulated genes vs. NF-κB regulated

genes) were overlapped to identify genes that most likely contribute to the NF-κB-dependent

cardioprotection after PO (Figure 7 and Figure 11). The same approach was used to determine

genes that are likely to be involved in NF-κB-dependent cell injury effect after I/R (Figure 7 and

Figure 12).

Each set of genes was subjected to functional analysis in silica using the CLustering Enrichment

Analysis (CLEAN), which clusters genes into non-hierarchical groups that are associated with functional terms based on gene ontology (GO) functions and Kyoto Encyclopedia of Genes and

Genomes (KEGG) pathway categories [218].

III.2.1 PO Regulated Genes

The aim of these studies was to identify genes significantly up- and down-regulated after PO by comparing WT PO vs. WT sham gene expression profiles using microarrays. After 5 hours PO,

565 genes (595 oligonucleotide probes) were found to be significantly regulated (P<0.01 and

fold change >1.5; WT PO vs. WT Sham). Out of the 565 genes, 435 were significantly up-

87 regulated and 130 were down-regulated after PO. The 20 most significantly regulated genes are

listed in Table 3, several of which were transcription factors (e.g. egr1, fos, fosb, nr4a1, and atf3) and heat shock proteins (e.g. hspa1a, hspa1b, and dnajb1).

Functional annotation of the 565 genes according to GO term resulted in 255 significant GO

categories (P<0.01). The 20 most significantly regulated GO categories are listed in Table 4A,

which included: cell migration, blood vessel development, inflammatory response, and cell

adhesion. There were 16 significantly regulated (P<0.01) KEGG pathways from the 565 genes

The five most significantly regulated KEGG pathways are listed in Table 4B, which included:

MAPK signaling pathway, focal adhesion, and ECM-receptor interaction.

88 Table 3. The 20 Most Significantly Regulated Genes After 5 Hours PO

(WT PO vs. WT Sham: ratios of expression levels between WT PO and WT Sham)

Gene Gene Name Gene Symbol Fold Expr ession P-Values ID WT PO vs. Sham 15511 heat shock protein 1b hspa1b 59.590 1.88E-11 (hsp70.1) 71198 otu domain containing 1 otud1 15.403 1.10E-08 13653 early growth response 1 egr1 16.197 1.39E-08 14281 fbj osteosarcoma oncogene fos 10.588 2.30E-08 193740 heat shock protein 1a hspa1a 5.867 1.06E-07 (hsp70.3) 14573 glial cell line derived neurotrophic gdnf 5.936 1.32E-07 factor 11504 a disintegrin-like and metallopeptidase adamts1 5.775 2.45E-07 (reprolysin type) with thrombospondin type 1 motif, 1 81489 dnaj (hsp40) homolog, subfamily b, dnajb1 8.089 2.55E-07 member 1 213742 inactive x specific transcripts xist 8.837 6.61E-07 14282 fbj osteosarcoma oncogene b fosb 5.876 8.08E-07 16193 interleukin 6 il6 7.400 8.11E-07 15370 nuclear receptor subfamily 4, group a, nr4a1 4.957 1.14E-06 member 1 13615 endothelin 2 edn2 3.335 1.29E-06 12642 cholesterol 25-hydroxylase ch25h 5.691 1.32E-06 83397 a kinase (prka) anchor protein (gravin) akap12 5.126 1.38E-06 12 11910 activating transcription factor 3 atf3 8.447 2.03E-06 20620 polo-like kinase 2 (drosophila) plk2 3.967 2.27E-06 14219 connective tissue growth factor ctgf 4.874 2.28E-06 69564 integrin beta 1 binding protein 3 itgb1bp3 4.401 2.29E-06 50778 regulator of g-protein signaling 1 rgs1 4.362 2.36E-06

89 Table 4A. The 20 most significant regulated gene ontology (GO) categories regulated after

PO (WT PO vs. WT Sham) (# of genes = the number of genes significantly regulated into that category, FDR = False Discovery Rate)

GO Ter m ID GoOTerm Category # of Genes P-Values FDR GO:0016477 Cell migration 35 7.76E-15 4.46E-12 GO:0006950 Response to stress 63 8.17E-15 4.46E-12 GO:0006928 Cell motility 37 1.02E-14 4.46E-12 GO:0051674 Localization of cell 37 1.02E-14 4.46E-12 GO:0009611 Response to wounding 30 2.28E-11 8.00E-09 GO:0001568 Blood vessel development 25 3.97E-11 1.08E-08 GO:0009605 Response to external stimulus 38 5.25E-11 1.08E-08 GO:0001944 Vasculature development 25 5.37E-11 1.08E-08 GO:0048514 Blood vessel morphogenesis 23 5.53E-11 1.08E-08 GO:0050793 Regulation of developmental process 48 3.11E-10 5.47E-08 GO:0009887 Organ morphogenesis 39 3.68E-10 5.88E-08 GO:0048522 Positive regulation of cellular process 51 3.02E-09 4.43E-07 GO:0065008 Regulation of biological quality 49 4.62E-09 6.24E-07 GO:0006954 Inflammatory response 22 5.11E-09 6.41E-07 GO:0002376 Immune system process 42 1.35E-08 1.58E-06 GO:0007155 Cell adhesion 37 2.01E-08 2.08E-06 GO:0022610 Biological adhesion 37 2.01E-08 2.08E-06 GO:0048523 Negative regulation of cellular process 50 3.37E-08 3.29E-06 GO:0006952 Defense response 28 1.13E-07 1.02E-05 GO:0003779 Actin binding 22 1.17E-07 1.02E-05

Table 4B. The 5 most significant regulated KEGG pathway category regulated after PO

(WT PO vs. WT Sham)

KEGG ID KEGG Pathway # of Genes P-Values FDR mmu04010 MAPK signaling pathway 21 6.33E-07 6.46E-05 mmu04510 Focal adhesion 17 2.27E-06 0.0001157 mmu04512 ECM-receptor interaction 9 0.0001411 0.0037895 mmu01430 Cell Communication 11 0.0001486 0.0037895 mmu05219 Bladder cancer 6 0.0003873 0.0079013

90 III.2.2 Genes Regulated by NF-κB in Response to PO

To identify genes up- and down-regulated by NF-κB in response to PO, microarrays

comparisons were performed between WT PO and DN PO (e.g. WT PO vs. DN PO). This

resulted in 254 genes (266 oligonucleotide probes) that were significantly regulated (P<0.01 and

>1.5 fold change) by NF-κB. There were 134 genes that were significantly up regulated, and 120 genes that were significantly down-regulated by NF-κB. The 20 most significantly regulated genes are listed in Table 5.

In silica functional analysis of the 254 genes showed a significant enrichment (P<0.01) for 39

GO categories. The 20 most significantly regulated GO categories are listed in Table 6A, which

included: regulation of endocytosis, regulation of phagocytosis, and negative regulation of Wnt

receptor signaling pathway. There were only two significant (P<0.01) KEGG pathways, which

were metabolism of xenobiotics by cytochrome P450 (P=7.57x10-5) and drug metabolism-

cytochrome P450 (P=0.001) (Table 6B).

91 Table 5. The 20 Most Significantly Regulated Genes by NF-κB (5hr PO)

(WT PO vs. DN PO: ratios of expression levels between WT PO and DN PO)

Gene Gene Name Gene Symbol Fold Expr ession P-Values ID WT PO vs. DN PO 69415 riken cdna 1700025n21 gene 1700025n21rik 7.987 1.60E-06 13088 cytochrome p450, family 2, cyp2b10 -3.261 8.86E-06 subfamily b, polypeptide 10 104183 chitinase 3-like 4 chi3l4 2.568 1.70E-05 22115 testis-specific serine kinase 2 tssk2 -3.654 2.05E-05 97541 glutaminyl-trna synthetase qars -3.987 4.34E-05 104010 cadherin 22 cdh22 -2.544 4.72E-05 18143 neuronal pas domain protein 2 npas2 2.873 0.000109 12350 carbonic anhydrase 3 car3 2.129 0.000121 20311 chemokine (c-x-c motif) ligand 5 cxcl5 2.345 0.000126 56258 heterogeneous nuclear hnrph2 2.406 0.000129 ribonucleoprotein h2 14412 solute carrier family 6 slc6a13 -1.973 0.000171 (neurotransmitter transporter, gaba), member 13 65079 reticulon 4 receptor rtn4r -2.089 0.000225 66438 hepcidin antimicrobial peptide 2 hamp2 -2.557 0.000238 72961 solute carrier family 17 (sodium- slc17a7 -2.775 0.000262 dependent inorganic phosphate cotransporter), member 7 104681 solute carrier family 16 slc16a6 -2.090 0.000294 (monocarboxylic acid transporters), member 6 223527 enhancer of yellow 2 homolog eny2 2.430 0.000385 (drosophila) 20272 sodium channel, voltage-gated, scn7a 2.015 0.000385 type vii, alpha 20558 schlafen 4 slfn4 2.034 0.000404 11829 aquaporin 4 aqp4 -1.956 0.000464 69595 predicted gene, ensmusg00000043 -1.921 0.000603 ensmusg00000043488 488

92 Table 6A. The 20 Most Significant Regulated Gene Ontology (GO) Categories Regulated by NF-κB (WT PO vs. DN PO

GO Ter m ID GO Term Category # of Genes P-Values FDR GO:0030100 Regulation of endocytosis 4 0.0003254 0.13762649 GO:0050764 Regulation of phagocytosis 3 0.0003706 0.13762649 GO:0050766 Positive regulation of phagocytosis 3 0.0003706 0.13762649 GO:0030178 Negative regulation of Wnt receptor signaling 3 0.0009494 0.21154172 pathway GO:0045807 Positive regulation of endocytosis 3 0.0009494 0.21154172 GO:0030246 Carbohydrate binding 9 0.0014216 0.23807679 GO:0006959 Humoral immune response 4 0.0018009 0.23807679 GO:0051050 Positive regulation of transport 4 0.0019385 0.23807679 GO:0006952 Defense response 11 0.0024435 0.23807679 GO:0030111 Regulation of Wnt receptor signaling pathway 3 0.0026957 0.23807679 GO:0051049 Regulation of transport 6 0.0027115 0.23807679 GO:0006950 Response to stress 19 0.0031515 0.23807679 GO:0032879 Regulation of localization 6 0.0036191 0.23807679 GO:0000287 Magnesium ion binding 10 0.0039488 0.23807679 GO:0044275 Cellular carbohydrate catabolic process 4 0.0044377 0.23807679 GO:0006957 Complement activation, alternative pathway 2 0.0045794 0.23807679 GO:0045428 Regulation of nitric oxide biosynthetic process 2 0.0045794 0.23807679 GO:0005525 GTP binding 9 0.0047073 0.23807679 GO:0002541 Activa tion of plasma proteins during acute 3 0.0048034 0.23807679 inflammatory response GO:0006956 Complement activation 3 0.0048034 0.23807679

Table 6B. Significantly Regulated KEGG Pathway Category Regulated by NF-κB (WT PO vs. DN PO)

KEGG ID KEGG Pathway # of Genes P-Values FDR mmu00980 Metabolism of xenobiotics by cytochrome P450 6 7.57E-05 0.00582909 mmu00982 Drug metabolism - cytochrome P450 5 0.0012508 0.04815534

93 II.2.3 Genes regulated by NF-κB and after PO

The goal here is to distinguish genes that are most likely to contribute to the NF-κB-dependent cardioprotection after PO. Therefore, genes were compared to identify significantly up- and down-regulated after PO (WT PO vs. WT Sham) and genes up and down-regulated by NF-κB in response to PO (WT PO vs. DN PO).

A comparison of the 565 genes that were significantly up- and down-regulated (P<0.01 and >1.5

fold change) after PO (section III.2.1) and the 254 genes that were significantly up- and down-

regulated (P<0.01 and >1.5 fold change) by NF-κB (section III.2.2) resulted in identification of

16 genes (out of 17 oligonucleotide probes) (Figure 11). These 16 genes are considered to be the

leading candidates that contribute to the NF-κB-dependent cardioprotective effect after PO

(Table 7). Eleven genes were significantly up-regulated after PO. Eight of them were also up-

regulated by NF-κB (e.g. hspa1a, hsp90aa1, plscr1), and three were down-regulated by NF-κB

(e.g. edn2, myocd) (Table 7). The remaining five genes were significantly down-regulated after

PO. Four of them were down-regulated by NF-κB (e.g. ndufc1, sfil), and one of the genes was

up-regulated by NF-κB (e.g. ankrd9) (Table 7).

The most significant GO-term category (P=1.8x10-5) was associated with regulation of the nitric

oxide biosynthetic process, and included the following genes: heat shock protein 90kDa alpha

(cytosolic), class A member 1 (hsp90aa1), and a pentaxin related gene (ptx3) (Table 8A). The

only significant (P<0.01) KEGG pathway category determined by CLEAN analysis was Antigen

processing and presentation, which included hsp90aa1 and heat shock 70kDa protein 1A

(hspa1a/hsp70.3) (Table 8B).

94

Figure 11. Genes Regulated by PO and NF-κB

565 genes were found to be significantly up- and down-regulated following 5hr PO (green line and green circle, section III.2.1). NF-κB significantly up- and down-regulated 254 genes after

PO (blue line and blue circle, section III.2.2). 16 genes were found to be up- and down-regulated by NF-κB and PO (intersection), which are candidates for the NF-κB cardioprotective network after PO (yellow shaded area).

95 Table 7. Genes Significantly regulated (P<0.01 and >1.5 fold change) after 5hr PO (WT PO vs. WT Sham) and by NF-κB (WT PO vs. DN PO)

The fold change between WT PO vs. WT sham and WT PO vs. DN PO, are ratios of expression levels in the comparsions between the two groups.

Gene ID Gene Name Gene WT PO vs. P-Values WT PO vs. P-Values Symbol WT Sham DN PO 193740 heat shock protein 1a hspa1a 5.86 1.06E-07 2.24 0.002 (hsp70.3) 15519 heat shock protein hsp90aa1 * 3.91 3.33E-06 2.19 0.002 90, alpha (cytosolic), class a member 1 15519 heat shock protein hsp90aa1 * 2.86 8.55E0-5 2.06 0.001 90, alpha (cytosolic), class a member 1 12350 carbonic anhydrase 3 car3 1.74 0.002 2.13 0.0001 67246 riken cdna 2810474o19rik 1.88 0.004 1.69 0.003 2810474o19 gene 22038 phospholipid plscr1 2.10 0.004 1.85 0.006 scramblase 1 16009 insulin-like growth igfbp3 1.57 0.005 1.85 0.005 factor binding protein 3 19288 pentraxin related ptx3 1.68 0.007 1.65 0.001 gene 50781 dickkopf homolog 3 dkk3 1.67 0.009 1.67 0.005 (xenopus laevis) 13615 endothelin 2 edn2 3.33 1.29E-06 -2.66 0.0006 106622 expressed sequence ai605517 2.14 0.0004 -1.76 0.009 ai605517 214384 myocardin myocd 1.91 0.002 -1.97 0.001 74251 ankyrin repeat ankrd9 -1.53 0.009 1.81 0.008 domain 9 66377 nadh dehydrogenase ndufc1 -2.48 0.0002 -1.84 0.008 (ubiquinone) 1, subcomplex unknown, 1 78887 sfi1 homolog, spindle sfi1 -1.76 0.004 -1.97 0.001 assembly associated (yeast) 69595 predicted gene 9783 gm9783 -1.59 0.005 -1.92 0.0006 252973 grainyhead-like 2 grhl2 -1.50 0.008 -1.58 0.008 (drosophila)

*Multiple oligonucleotide probes for the same genes

96 Table 8A. Significant Regulated Gene Ontology (GO) Categories (P<0.01) of the 16 genes

Regulated by NF-κB and after PO

GO Ter m ID GO Term Category P-Values FDR Gene symbol in category GO:0045428 Regulation of nitric oxide biosynthetic 1.80E-05 0.003342 hsp90aa1, ptx3 process GO:0006809 Nitric oxide biosynthetic process 6.11E-05 0.003342 hsp90aa1, ptx3 GO:0046209 Nitric oxide metabolic process 6.11E-05 0.003342 hsp90aa1, ptx3 GO:0051171 Regulation of nitrogen compound 6.82E-05 0.003342 hsp90aa1, ptx3 metabolic process GO:0031328 Positive regulation of cellular 0.000109 0.004308 hsp90aa1, ptx3 biosynthetic process GO:0009607 Response to biotic stimulus 0.000300 0.009805 hsp90aa1, ptx3, plscr1 GO:0044271 Nitrogen compound biosynthetic 0.001324 0.034026 hsp90aa1, ptx3 process GO:0001558 Regulation of cell growth 0.001388 0.034026 igfbp3, myocd GO:0031326 Regulation of cellular biosynthetic 0.001730 0.034793 hsp90aa1, ptx3 process GO:0065008 Regulation of biological quality 0.001865 0.034793 edn2, igfbp3, hspa1a, myocd GO:0016049 Cell growth 0.001952 0.034793 igfbp3, myocd GO:0009891 Positive regulation of biosynthetic 0.002182 0.035652 hsp90aa1, ptx3, myocd process GO:0008361 Regulation of cell size 0.002435 0.036722 igfbp3, myocd GO:0031325 Positive regulation of cellular metabolic 0.003087 0.041599 hsp90aa1, ptx3, myocd process GO:0009893 Positive regulation of metabolic process 0.003183 0.041599 hsp90aa1, ptx3, myocd GO:0051707 Response to other organism 0.005105 0.062378 ptx3, plscr1 GO:0040008 Regulation of growth 0.005410 0.062378 igfbp3, myocd GO:0019229 Regulation of vasoconstriction 0.006526 0.065506 edn2 GO:0009620 Response to fungus 0.007826 0.065506 ptx3 GO:0001933 Negative regulation of protein amino 0.008476 0.065506 igfbp3 acid phosphorylation GO:0051147 Regulation of muscle cell differentiation 0.008476 0.065506 myocd GO:0050764 Regulation of phagocytosis 0.009125 0.065506 ptx3 GO:0050766 Positive regulation of phagocytosis 0.009125 0.065506 ptx3 GO:0002376 Immune system process 0.009451 0.065506 hsp90aa1, ptx3, plscr1 GO:0045595 Regulation of cell differentiation 0.009614 0.065506 hsp90aa1, myocd

Table 8B. KEGG pathways that were sSgnificantly Regulated (P<0.01)

KEGG ID KEGG Pathway P-Values FDR Gene symbol in category mmu04612 Antigen processing and presentation 0.00145426 0.007271 hsp90aa1, hspa1a

97 III.2.4 I/R Regulated Genes

The goal is to use microarray comparisons (e.g. WT I/R vs. WT Sham) to determine genes that are significantly up- and down-regulated after I/R. Microarray comparison between WT I/R (30 minutes ischemia/3 hours of reperfusion) and WT Sham (3.5 hours) resulted in 444 genes (464 oligonucleotide probes) that were significantly up- and down-regulated (P<0.01 and >1.5 fold change) after I/R. Out of these 444 genes, 333 of them were significantly up-regulated. The 20 most significantly regulated genes by I/R are listed in Table 9, which includes several heat shock proteins (e.g. dnajb1, hsp90aa1, hsp110, hspb1, and hspa5).

Functional annotation of the 444 genes resulted in a significant enrichment (P<0.01) for 241 GO categories. The 20 most significantly regulated GO categories are listed in Table 10A, which include: response to stress, blood vessel development, and apoptosis. The GO category heat shock protein binding had a P-value of 0.01. There were 14 significantly regulated (P<0.01)

KEGG pathways from the 444 genes. The five most significantly regulated KEGG pathways are listed in Table 10B.

98 Table 9. 20 Most Significantly (P<0.01 and >1.5 fold change) Regulated Genes after I/R

(30m/3hr)

(WT I/R vs. WT Sham, ratio of expression levels between WT I/R and WT Sham)

Gene Gene Name Gene Symbol Fold Expr ession P-Values ID WT I/R vs. Sham 81489 dnaj (hsp40) homolog, subfamily b, dnajb1 15.167 6.33E-08 member 1 15519 heat shock protein 90kda alpha hsp90aa1 * 7.771 2.79E-06 (cytosolic), class a member 1 15519 heat shock protein 90kda alpha hsp90aa1 * 7.327 2.94E-06 (cytosolic), class a member 1 15505 heat shock protein 110 hsp110 4.577 4.45E-06 216453 retinol dehydrogenase similar rdhs 2.562 4.81E-06 320588 riken cdna c330006p03 gene c330006p03rik 3.522 5.36E-06 23849 kruppel-like factor 6 klf6 2.767 6.43E-06 54409 receptor (calcitonin) activity ramp2 -2.424 7.32E-06 modifying protein 2 12227 b-cell translocation gene 2, anti- btg2 5.167 8.74E-06 proliferative 14190 fibrinogen-like protein 2 fgl2 3.900 1.04E-05 20887 sulfotransferase family 1a, phenol- sult1a1 -2.744 1.12E-05 preferring, member 1 15507 heat shock protein 1 hspb1 4.922 1.35E-05 22437 xin actin-binding repeat containing 1 xirp1 3.400 1.53E-05 72750 amyotrophic lateral sclerosis 2 als2cr13 -2.577 1.53E-05 (juvenile) chromosome region, candidate 13 (human) 66875 riken cdna 1200016b10 gene 1200016b10rik 3.679 1.63E-05 14828 heat shock protein 5 hspa5 2.717 1.69E-05 19288 pentraxin related gene ptx3 5.119 1.74E-05 71198 otu domain containing 1 otud1 6.252 1.74E-05 21685 thyrotroph embryonic factor tef -2.253 1.85E-05 320301 riken cdna e530011l22 gene e530011l22rik 3.696 1.87E-05 14281 fbj osteosarcoma oncogene fos 7.385 1.89E-05

*Multiple oligonucleotide probes for the same genes

99 Table 10A. 20 Most Significantly Regulated Gene Ontology (GO) Categories out of 444 genes regulated after I/R (# of genes= the number of significantly genes regulated into that category, FDR= False Discovery Rate)

GO Ter m ID GO Ter m Category # of Genes P-Values FDR GO:0006950 Response to stress 51 7.34E-13 1.22E-09 GO:0048522 Positive regulation of cellular process 47 5.18E-11 4.30E-08 GO:0050793 Regulation of developmental process 40 1.41E-09 7.83E-07 GO:0001944 Vasculature development 20 3.22E-09 1.16E-06 GO:0048646 Anatomical structure formation 20 3.48E-09 1.16E-06 GO:0043549 Regulation of kinase activity 16 4.78E-09 1.32E-06 GO:0051338 Regulation of transferase activity 16 6.52E-09 1.50E-06 GO:0048514 Blood vessel morphogenesis 18 7.20E-09 1.50E-06 GO:0065009 Regulation of molecular function 24 1.02E-08 1.88E-06 GO:0001568 Blood vessel development 19 1.47E-08 2.22E-06 GO:0050790 Regulation of catalytic activity 22 1.47E-08 2.22E-06 GO:0045859 Regulation of protein kinase activity 15 2.12E-08 2.94E-06 GO:0001525 Angiogenesis 15 3.17E-08 4.05E-06 GO:0006915 Apoptosis 34 5.60E-08 6.38E-06 GO:0051094 Positive regulation of developmental process 22 5.85E-08 6.38E-06 GO:0008219 Cell death 35 6.15E-08 6.38E-06 GO:0012501 Programmed cell death 34 7.72E-08 7.07E-06 GO:0016265 Death 35 7.83E-08 7.07E-06 GO:0046983 Protein dimerization activity 18 8.09E-08 7.07E-06 GO:0002376 Immune system process 34 1.35E-07 1.12E-05

Table 10B. 5 most significantly regulated KEGG pathway categories out of 444 genes regulated after I/R

KEGG ID KEGG Pathway # of Genes P-Values FDR mmu04010 MAPK signaling pathway 20 4.89E-08 5.19E-06 mmu05060 Prion disease 4 6.56E-05 0.003478 mmu04620 Toll-like receptor signaling pathway 8 0.000492 0.013432 mmu04060 Cytokine-cytokine receptor interaction 13 0.000506 0.013432 mmu04612 Antigen processing and presentation 7 0.001001 0.021230

100 III.2.5 Genes Regulated by NF-κB in Response to I/R

The goa was to identify genes that might contribute to the NF-κB-dependent cell death outcome after I/R. Microarray comparisons between WT I/R and DN I/R (e.g. WT I/R vs. DN I/R)

resulted in 301 genes (316 oligonucleotide probes) that were significantly up- and down-

regulated (P<0.01 and >1.5 fold change) by NF-κB in response to I/R. There were 193 genes that

were significantly up-regulated and 108 genes that were significantly down-regulated by NF-κB.

The 20 most significantly NF-κB regulated genes in response to I/R are listed in Table 11.

Several were heat shock protein genes (e.g. hsp110, hspa1b, hspa1a, hsp90aa1, dnajb1,

hsp90ab1, and serpinh1).

Functional in silica analysis of the 301 genes resulted in significant enrichment (P<0.01) for 72

GO categories. The 20 most significantly regulated GO categories are listed in Table 12A, a few

of which are response to stress, unfolded protein binding, muscle development, kinase regulatory

activity, and chemotaxis. The heat shock protein binding GO category P-value is 0.02. There

were 8 significantly regulated KEGG pathways (P<0.01) from the 301 genes. The five most

significantly regulated KEGG pathways are listed in Table 12B.

101 Table 11. 20 Most Significantly Regulated Genes by NF-κB in Response to I/R (30m/3hr)

(WT I/R vs. DN I/R, ratios of expression levels between WT I/R and DN I/R)

Gene Gene Name Gene Symbol Fold Expr ession P-Values ID WT I/R vs. DN I/R 15505 heat shock protein 110 hsp110 3.109 3.96E-07 15511 heat shock protein 1b hspa1b (hsp70.1) 4.103 6.17E-07 320803 riken cdna c130022m03 gene c130022m03rik 3.735 2.95E-06 13616 endothelin 3 edn3 3.081 8.24E-06 338417 secretoglobin, family 1c, member 1 scgb1c1 -2.081 1.39E-05 193740 heat shock protein 1a hspa1a (hsp70.3) 3.091 1.54E-05 12406 serine (or cysteine) peptidase serpinh1 2.190 1.73E-05 inhibitor, clade h, member 1 15519 heat shock protein 90kda alpha hsp90aa1 2.131 1.90E-05 (cytosolic), class a member 1 259118 olfactory receptor 575 olfr575 3.070 2.01E-05 213742 inactive x specific transcripts xist * -4.682 2.55E-05 213742 inactive x specific transcripts xist * -4.899 2.79E-05 107729 ubiquitin, beta-galactosidase ubg 1.970 4.22E-05 related 81489 dnaj (hsp40) homolog, subfamily dnajb1 4.196 4.39E-05 b, member 1 20303 chemokine (c-c motif) ligand 4 ccl4 -1.929 4.51E-05 15516 heat shock protein 90kda alpha hsp90ab1 * 1.946 4.69E-05 (cytosolic), class b member 1 106622 expressed sequence ai605517 ai605517 -2.355 5.18E-05 15516 heat shock protein 90kda alpha hsp90ab1 * 1.971 5.69E-05 (cytosolic), class b member 1 72750 amyotrophic lateral sclerosis 2 als2cr13 -1.948 6.02E-05 (juvenile) chromosome region, candidate 13 (human) 59013 heterogeneous nuclear hnrph1 1.980 7.63E-05 ribonucleoprotein h1 66875 riken cdna 1200016b10 gene 1200016b10rik 2.444 7.88E-05 54409 receptor (calcitonin) activity ramp2 -1.836 8.78E-05 modifying protein 2 241431 xin actin-binding repeat containing xirp2 1.888 9.36E-05 2

*Multiple oligonucleotide probes for the same genes

102 Table 12A. 20 Most significantly regulated gene ontology (GO) categories out of 301 genes regulated by NF-κB

GO Ter m ID GO Term Category # of Genes P-Values FDR GO:0006950 Response to stress 36 7.17E-10 8.92E-07 GO:0051082 Unfolded protein binding 9 3.62E-08 2.25E-05 GO:0006457 Protein folding 11 1.88E-07 7.78E-05 GO:0006986 Response to unfolded protein 5 2.55E-05 0.007930 GO:0051789 Response to protein stimulus 5 0.000126 0.031469 GO:0019887 Protein kinase regulator activity 5 0.000223 0.034876 GO:0048741 Skeletal muscle fiber development 6 0.000224 0.034876 GO:0048747 Muscle fiber development 6 0.000224 0.034876 GO:0014706 Striated muscle development 8 0.000370 0.049706 GO:0003924 GTPase activity 7 0.000431 0.049706 GO:0007517 Muscle development 9 0.000445 0.049706 GO:0042383 Sarcolemma 4 0.000479 0.049706 GO:0019207 Kinase regulator activity 5 0.000625 0.059850 GO:0006984 ER-nuclear signaling pathway 3 0.000918 0.080659 GO:0045445 Myoblast differentiation 4 0.000972 0.080659 GO:0009607 Response to biotic stimulus 9 0.001040 0.080912 GO:0006935 Chemotaxis 6 0.001282 0.081766 GO:0042330 Taxis 6 0.001282 0.081766 GO:0000723 Telomere maintenance 3 0.001314 0.081766 GO:0032200 Telomere organization and biogenesis 3 0.001314 0.081766

Table 12B. 5 most significantly regulated KEGG pathway categories out of 301 genes regulated by NF-κB

KEGG ID KEGG Pathway # of Genes P-Values FDR mmu00650 Butanoate metabolism 4 0.001080 0.065396 mmu04010 MAPK signaling pathway 10 0.001350 0.065396 mmu00280 Valine, leucine and isoleucine degradation 4 0.001904 0.065396 mmu04612 Antigen processing and presentation 5 0.004443 0.106791 mmu04912 GnRH signaling pathway 5 0.005889 0.106791

103 III.2.6 Genes Regulated after I/R and by NF-κB

The objective was to establish genes most likely underlie the NF-κB-dependent cell death

outcome after I/R. The approach was to compare genes that are significantly (P<0.01 and >1.5

fold change) up- and down-regulated after I/R (section III.2.4) vs. significantly (P<0.01 and >1.5 fold change) up- and down-regulated by NF-κB (section III.2.5). The set of 444 genes (464

oligonucleotide probes) that were significantly up- and down-regulated after I/R (WT I/R vs. WT

Sham, section III.2.4) were compared to the 301 genes (316 oligonucleotide probes) that were

significantly up- and down-regulated by NF-κB in response to I/R (WT I/R vs. DN I/R, section

III.2.5) (Figure 9). The comparison between the two sets of genes resulted in 59 genes (62

oligonucleotide probes) that were significantly up- and down-regulated by both I/R and NF-κB

(P<0.01 and >1.5 fold change), which are most likely to mediate the NF-κB-dependent cell

injury effect after I/R (Figure 9).

The 59 genes that were significantly up- and down-regulated by I/R and NF-κB resulted in 61

significant enrichment GO categories (P<0.01) (Table 15A). Several of the GO categories were

associated with protein folding, cell death, regulation of developmental process, and chemotaxis

(Table 15A). Pathway analysis resulted in only four significantly regulated KEGG pathways

(P<0.01), which were Antigen processing and presentation, MAPK signaling pathway, Prion

disease, and Toll-like receptor signaling pathway (Table 15B).

104

Figure 12. Genes Regulated after I/R and by NF-κB

444 genes were found to be significantly up- and down-regulated after I/R (30m,/3hr) (red line and red circle, section III.2.4). NF-κB significantly up- and down-regulated 301 genes in response to I/R (blue line and blue circle, section III.2.5). 16 genes were found to be up- and down-regulated by NF-κB and I/R (intersection), which are candidates for the NF-κB-dependent cell injury network after I/R (yellow shaded area).

105 Table 13. Genes Significantly Regulated after I/R (30m/3hr) (WT I/R vs. WT Sham) and by

NF-κB (WT I/R vs. DN I/R)

The fold change between WT I/R vs. WT sham and WT I/R vs. DN I/R, are ratios of expression levels in the comparisons between the two groups

Gene Gene Name Gene WT I/R vs. P-Values WT I/R vs. P-Values ID Symbol WT Sham DN I/R 81489 dnaj (hsp40) homolog, dnajb1 15.167 6.33E-08 4.196 4.39E-05 subfamily b, member 1 3320 heat shock protein 90kda hsp90aa1 * 7.771 2.79E-06 1.986 9.65E-05 alpha (cytosolic), class a member 1 3320 heat shock protein 90kda hsp90aa1 * 7.327 2.94E-06 2.131 1.90E-05 alpha (cytosolic), class a member 1 15505 heat shock 105kda/110kda hsph1 4.577 4.45E-06 3.109 3.96E-07 protein 1 (hsp110) 216453 retinol dehydrogenase 19 rdh19 2.562 4.81E-06 1.840 0.003935 (rdhs) 320588 riken cdna c330006p03 c330006p0 3.522 5.36E-06 1.512 0.002134 gene 3rik

3315 heat shock 27kda protein 1 hspb1 4.922 1.35E-05 1.656 0.001540 66875 riken cdna 1200016b10 1200016b1 3.679 1.63E-05 2.444 7.88E-05 gene 0rik

14828 heat shock protein 5 hspa5 2.717 1.69E-05 1.871 0.000346 71198 otu domain containing 1 otud1 6.252 1.74E-05 1.664 0.002316 14281 fbj osteosarcoma oncogene fos 7.385 1.89E-05 1.665 0.000252

12301 calcyclin binding protein cacybp 2.087 2.63E-05 1.532 0.003311 18578 phosphodiesterase 4b, camp pde4b 2.575 3.79E-05 1.569 0.001585 specific 3329 heat shock 60kda protein 1 hspd1 2.024 3.93E-05 1.641 0.000384 (chaperonin) 30937 lim and cysteine-rich lmcd1 2.731 4.01E-05 1.552 0.001463 domains 1 15511 heat shock protein 1b hspa1b 22.723 4.42E-05 4.103 6.17E-07 (hsp70.1) 12406 serpinh1 serine (or cysteine) serpinh1 2.437 5.01E-05 2.190 1.73E-05 peptidase inhibitor, clade h, member 1 13198 dna-damage inducible ddit3 1.919 5.24E-05 1.648 0.003076 transcript 3 54720 regulator of calcineurin 1 rcan1 3.081 5.63E-05 1.556 0.001241 21664 pleckstrin homology-like phlda1 4.993 5.77E-05 1.867 0.000782 domain, family a, member 1

106 Continue Table 13. Genes Significantly Regulated after I/R and by NF-κB

Gene Gene Name Gene WT I/R vs. P-Values WT I/R vs. P-Values ID Symbol WT Sham DN I/R 18030 nuclear factor, interleukin 3, nfil3 4.694 6.24E-05 1.569 0.004390 regulated 14827 protein disulfide isomerase pdia3 1.828 6.60E-05 1.869 9.59E-05 associated 3 20867 stress-induced phosphoprotein stip1 1.974 6.92E-05 1.704 0.000286 1 16007 cysteine rich protein 61 cyr61 2.823 9.62E-05 1.724 0.000320 217011 notchless homolog 1 nle1 3.173 9.81E-05 2.336 0.000180 (drosophila) 74126 synovial apoptosis inhibitor 1, syvn1 2.121 0.000134 1.658 0.004773 synoviolin 29810 bcl2-associated athanogene 3 bag3 1.942 0.000143 1.844 0.000313

74840 arginine-rich, mutated in early armet 2.081 0.000203 1.515 0.001632 stage tumors 12226 b-cell translocation gene 1, btg1 * 1.584 0.004448 1.841 0.000233 anti-proliferative 20439 seven in absentia 2 siah2 1.568 0.000274 1.557 0.003359 22190 ubiquitin c ubc 1.616 0.000281 1.534 0.001372 107729 ubiquitin, beta-galactosidase ubg 1.624 0.000282 1.970 4.22E-05 related 12226 b-cell translocation gene 1, btg1 * 1.546 0.000603 1.804 0.000328 anti-proliferative 22187 ubiquitin b ubb 1.594 0.000335 1.820 0.000176 76737 cysteine-rich with egf-like creld2 1.920 0.000368 2.068 0.000456 domains 2 20515 solute carrier family 20, slc20a1 2.134 0.000503 1.637 0.005125 member 1 70686 dual specificity phosphatase dusp16 1.607 0.000621 1.550 0.002003 16 58233 dnaj (hsp40) homolog, dnaja4 1.540 0.000668 1.694 0.000679 subfamily a, member 4 67878 transmembrane protein 33 tmem33 1.588 0.001022 1.556 0.000969 15516 heat shock protein 90 alpha hsp90ab1 1.559 0.001198 1.971 5.69E-05 (cytosolic), class b member 1

20303 chemokine (c-c motif) ligand ccl4 3.149 0.001239 3.149 0.001239 4 81913 bmp and activin membrane- bambi-ps1 1.693 0.001341 1.947 0.000757 bound inhibitor, pseudogene (xenopus laevis) 67379 death effector domain- dedd2 1.515 0.001610 1.909 0.000250 containing dna binding protein 2 15528 heat shock protein 1 hspe1 2.095 0.002005 1.710 0.004999 (chaperonin 10) 241431 xin actin-binding repeat xirp2 1.878 0.002217 1.888 9.36E-05 containing 2

107 Continue Table 13. Genes Significantly Regulated after I/R and by NF-κB

Gene Gene Name Gene WT I/R vs. P-Values WT I/R vs. P-Values ID Symbol WT Sham DN I/R 71371 at rich interactive domain 5b arid5b 2.282 0.002737 1.616 0.000893 (mrf1-like) 13614 endothelin 1 edn1 1.855 0.003909 1.617 0.003912 13800 enabled homolog (drosophila) enah 1.851 0.003983 1.584 0.001847

12226 b-cell translocation gene 1, btg1 * 1.778 0.005047 1.803 0.000316 anti-proliferative 16476 jun oncogene jun 1.693 0.005078 1.513 0.004074 71305 riken cdna 5133401h06 gene 5133401h 2.257 1.97E-05 -1.754 0.000200 06rik

69564 integrin beta 1 binding protein itgb1bp3 3.387 5.72E-05 -1.754 0.00029 3 20311 chemokine (c-x-c motif) cxcl5 3.505 0.000158 -1.691 0.003508 ligand 5 75516 tetratricopeptide repeat ttc32 1.838 0.001661 -1.661 0.005104 domain 32 20201 s100 calcium binding protein s100a8 1.929 0.006348 -1.653 0.008452 a8 (calgranulin a) 54409 receptor (calcitonin) activity ramp2 -2.424 7.32E-06 -1.836 8.78E-05 modifying protein 2 72750 family with sequence fam117b -2.577 1.53E-05 -1.948 6.02E-05 similarity 117, member b (als2cr13) 68453 gpi-anchored hdl-binding gpihbp1 -2.106 3.92E-05 -1.650 0.000506 protein 1 21393 titin-cap tcap -2.076 8.48E-05 -1.548 0.003518 66214 riken cdna 1190002h23 gene 1190002h -1.993 0.000108 -1.742 0.000158 23rik

27387 sh2 domain containing 3c sh2d3c -1.623 0.000182 -1.628 0.009954 66528 riken cdna 2210020m01 gene 2210020m -1.547 0.001270 -1.795 0.001313 01rik

* Multiple oligonucleotide probes for the same genes.

108 Table 14A. GO categories that are Significantly Regulated after I/R and by NF-κB

GO Ter m ID GO Term Category P-Values FDR Gene symbol in category GO:0006950 Response to stress 2.72E-09 1.42E-06 serpinh1, ddit3, edn1, hspa5, hsph1, hspb1, hspa1b, hsp90ab1, hsp90aa1, hspe1, ccl4, cxcl5, ubb, syvn1, dnajb1 GO:0051082 Unfolded protein binding 5.59E-09 1.46E-06 serpinh1, hspd1, hsp90ab1, hsp90aa1, dnaja4, dnajb1 GO:0006457 Protein folding 1.18E-08 2.06E-06 hsph1, hspd1, hsp90ab1, hsp90aa1, hspe1, dnaja4, dnajb1 GO:0042221 Response to chemical stimulus 1.98E-06 0.000258 ddit3, fos, hsp90aa1, cyr61, jun, s100a8, ccl4, cxcl5, syvn1 GO:0048741 Skeletal muscle fiber development 2.49E-05 0.002170 btg1, tcap, rcan1, itgb1bp3 GO:0048747 Muscle fiber development 2.49E-05 0.002170 btg1, tcap, rcan1, itgb1bp3 GO:0006986 Response to unfolded protein 4.66E-05 0.003485 ddit3, hsp90aa1, syvn1 GO:0050793 Regulation of developmental 7.68E-05 0.004282 btg1, ddit3, pdia3, hspa1b, process hsp90aa1, bag3, dedd2, itgb1bp3, syvn1 GO:0006935 Chemotaxis 8.96E-05 0.004282 cyr61, s100a8, ccl4, cxcl5 GO:0042330 Taxis 8.96E-05 0.004282 cyr61, s100a8, ccl4, cxcl5 GO:0045445 Myoblast differentiation 9.01E-05 0.004282 btg1, tcap, itgb1bp3 GO:0051789 Response to protein stimulus 0.000123 0.005394 ddit3, hsp90aa1, syvn1 GO:0007519 Skeletal muscle development 0.000151 0.006079 btg1, tcap, rcan1, itgb1bp3 GO:0046983 Protein dimerization activity 0.000170 0.006382 ddit3, fos, hsp90aa1, jun, nfil3 GO:0006915 Apoptosis 0.000183 0.006403 ddit3, pdia3, hspa1b, siah2, phlda1, bag3, dedd2, syvn1 GO:0012501 Programmed cell death 0.000201 0.006578 ddit3, pdia3, hspa1b, siah2, phlda1, bag3, dedd2, syvn1 GO:0008219 Cell death 0.000260 0.008003 ddit3, pdia3, hspa1b, siah2, phlda1, bag3, dedd2, syvn1 GO:0016265 Death 0.000278 0.008083 ddit3, pdia3, hspa1b, siah2, phlda1, bag3, dedd2, syvn1 GO:0001664 G-protein-coupled receptor binding 0.000320 0.008817 edn1, ccl4, cxcl5 GO:0051085 Chaperone cofactor-dependent 0.000372 0.009395 hsph1, dnajb1 protein folding

109 Continue Table 14A. GO Categories that are Significantly Regulated after I/R and by NF-

κB

GO Ter m ID GO Term Category P-Values FDR Gene symbol in category GO:0014706 Striated muscle development 0.000377 0.009395 btg1, tcap, rcan1, itgb1bp3 GO:0051147 Regulation of muscle cell 0.000439 0.010436 btg1, itgb1bp3 differentiation GO:0006458 'De novo' protein folding 0.000511 0.010974 hsph1, dnajb1 GO:0051084 'De novo' posttranslational 0.000511 0.010974 hsph1 ,dnajb1 protein folding GO:0042981 Regulation of apoptosis 0.000524 0.010974 ddit3, pdia3, hspa1b, bag3, dedd2, syvn1 GO:0043067 Regulation of programmed cell 0.000565 0.011366 ddit3, pdia3, hspa1b, bag3, death dedd2, syvn1 GO:0042692 Muscle cell differentiation 0.000624 0.011994 btg1, tcap ,itgb1bp3 GO:0050790 Regulation of catalytic activity 0.000642 0.011994 btg1, edn1, hspa1b, rcan1, dusp16 GO:0006984 ER-nuclear signaling pathway 0.000672 0.012124 ddit3, hspa5 GO:0006916 Anti-apoptosis 0.000736 0.012837 hspa1b, bag3, syvn1 GO:0007517 Muscle development 0.000982 0.016578 btg1, tcap, rcan1, itgb1bp3 GO:0001569 Patterning of blood vessels 0.001167 0.019079 edn1, cyr61 GO:0065009 Regulation of molecular function 0.001230 0.019507 btg1, edn1, hspa1b, rcan1, dusp16 GO:0009607 Response to biotic stimulus 0.001523 0.023438 ddit3, hspa5, hsp90aa1, syvn1 GO:0048523 Negative regulation of cellular 0.001691 0.025268 btg1, edn1, hspa1b, jun, process bag3, lmcd1, itgb1bp3, syvn1 GO:0007626 Locomotory behavior 0.001752 0.025462 cyr61, s100a8, ccl4, cxcl5 GO:0006939 Smooth muscle contraction 0.002229 0.031509 edn1, pde4b GO:0033554 Cellular response to stress 0.002384 0.032820 ddit3, hspa5 GO:0042493 Response to drug 0.003056 0.040987 fos, jun GO:0030018 Z disc 0.003236 0.042318 hspb1, tcap

GO:0008009 Chemokine activity 0.003611 0.044973 ccl4, cxcl5 GO:0042379 Chemokine receptor binding 0.003611 0.044973 ccl4, cxcl5 GO:0031674 I band 0.004005 0.048723 hspb1, tcap GO:0048468 Cell Development 0.004570 0.054327 btg1, edn1, enah, tcap, rcan1, itgb1bp3 GO:0009880 Embryonic pattern specification 0.005302 0.061628 edn1, cyr61 GO:0035239 Tube morphogenesis 0.005516 0.062715 edn1, enah, cyr61 GO:0031072 Heat shock protein binding 0.005772 0.063400 dnaja4, dnajb1 GO:0043009 Chordate embryonic development 0.005818 0.063400 edn1, enah ,syvn1, nle1 GO:0045454 Cell redox homeostasis 0.006013 0.064189 ddit3, pdia3 GO:0009792 Embryonic development ending in 0.006166 0.064499 edn1, enah, syvn , nle1 birth or egg hatching GO:0030036 Actin cytoskeleton organization 0.006607 0.067755 enah, tcap, xirp2 and biogenesis GO:0001701 In utero embryonic development 0.006839 0.068790 edn1, syvn1, nle1

110 Continue Table 14A. GO Categories that are Significantly Regulated after I/R and by NF-

κB

GO Ter m ID GO Term Category P-Values FDR Gene symbol in category GO:0051716 Cellular response to stimulus 0.007290 0.071940 ddit3, hspa5 GO:0030029 Actin filament-based process 0.008205 0.078971 enah, tcap, xirp2 GO:0043086 Negative regulation of catalytic 0.008391 0.078971 hspa1b, dusp16 activity GO:0009790 Embryonic development 0.008455 0.078971 edn1, enah, cyr61, syvn1, nle1 GO:0051093 Negative regulation of 0.008721 0.079451 hspa1b, bag3, itgb1bp3 developmental process syvn1 GO:0007610 Behavior 0.008811 0.079451 cyr61, s100a8, ccl4, cxcl5 GO:0043066 Negative regulation of apoptosis 0.0090129 0.079894 hspa1b, bag3, syvn1 GO:0043069 Negative regulation of 0.0095764 0.079894 hspa1b, bag3, syvn1 programmed cell death

Table 14B. KEGG pathways that were significant regulated after I/R and by NF-κB

(FDR= False Discovery Rate)

KEGG ID KEGG Pathway P-Values FDR Gene symbol in category mmu04612 Antigen processing and presentation 5.86E-05 0.001407 pdia3, hspa5, hsp90ab1, hsp90aa1 mmu04010 MAPK signaling pathway 0.000382 0.003512 ddit3, fos, hspb1, jun, dusp16 mmu05060 Prion disease 0.000439 0.003512 hspa5, hspd1 mmu04620 Toll-like receptor signaling pathway 0.001881 0.011286 fos, jun, ccl4

111 III.2.7 Genes regulated after PO and by NF-κB compared to genes that are regulated after

I/R and by NF-κB

The objective is to find genes dysregulated (up- and/or down-regulated) by NF-κB, and after PO and I/R. Therefore, the 16 genes up- and down-regulated after PO and by NF-κB (section III.2.3) were compared to the 59 genes that are up- and down-regulated after I/R and by NF-κB (section

III.2.6). This resulted in only one gene between the two groups (Figure 13). The gene hsp90aa1

was up-regulated by NF-κB and up-regulated after both PO and I/R (Figure 13). However, heat

shock protein 1A (hspa1a/hsp70.3) and heat shock protein 1B (hspa1b/hsp70.1) genes are highly

up-regulated in response to both ischemic insults, and NF-κB significantly up-regulated hspa1a

after PO and hspa1b after I/R.

112 A. B.

Figure 13. Venn Diagram of the number of genes that was regulated by NF-κB after PO and I/R

A. The green circle represents 565 genes that were significantly up- and down-regulated after PO.

There were 254 genes that were up- and down-regulated by NF-κB in response to PO (blue

circle). The overlap between the two sets of genes resulted in 16 genes that were up- and down-

regulated by NF-κB and after PO (Table 7). The red circle represents 59 genes that were

significantly up- and down-regulated by both I/R and NF-κB (Table 13). There were only 22

genes that were up- and down-regulated by NF-κB in response to I/R and PO, and three 3 genes

that were regulated after PO and I/R. Only one gene was regulated by NF-κB, and after I/R and

PO. Only 33 genes were uniquely up- and down-regulated after NF-κB and I/R.

B. The red circle represents 444 genes that were significantly up- and down-regulated after I/R, and

the blue circle represents 301 genes that were significantly regulated by NF-κB in response to

I/R. The overlap between the two sets of genes resulted in 59 genes that were significantly up-

and down-regulated by I/R and NF-κB (Table 13). The green circle represents 16 genes that were

significantly up- and down-regulated by both PO and NF-κB (Table 7). The overlap between the

three sets of genes resulted in one gene that was significantly up or down-regulated by both I/R

and NF-κB. There were 3 genes that were up- and down-regulated by I/R, NF-κB, and PO, and 2

genes that were regulated by NF-κB after PO and I/R. Only 10 genes were uniquely regulated by

both NF-κB and PO. 113 III.3. Validation of Genes that were Regulated by NF-κB and after PO or I/R

The goal was to validate genes that were identified from our microarray comparisons that are

involved in either the NF-κB-dependent cardioprotection after PO (e.g. 16 genes up- and down-

regulated by NF-κB and after PO (section III.2.3)) or NF-κB-dependent cell death outcomes after I/R (e.g. 59 genes up- and down-regulated by NF-κB and after I/R (section III.2.5)).

Quantitative real-time PCR (QRT-PCR) was used to validate the expression patterns of genes

(e.g. ptx3, plscr1, hsp90aa1, and hspa1a) that were significantly up-regulated by NF-κB and

after PO, which are suggested to be involved in the regulation of apoptosis or cardioprotection.

In addition, to the gene ndufc1, which was significantly, down-regulated by NF-κB and after PO.

Our main goal was to validate genes that are up- and down-regulated after both ischemic insults

(PO and I/R) and are up- and down-regulated by NF-κB, which were the following genes,

hsp90asa1, hspa1a, and hspa1b.

III.3.1 QRT-PCR Validation

Microarray results suggested ptx3 was significantly up-regulated by NF-κB, and after PO (Table

7 and Figure 14A). QRT-PCR confirmed ptx3 was significantly up-regulated after PO (WT PO

vs. WT Sham, 4.17±0.54, P=0.005); however, it was not significantly up-regulated by NF-κB

(WT PO 4.17±0.54 vs. DN PO 3.87±0.52, P=0.69) (Figure 14A). The expression of plscr1 was

confirmed by QRT-PCR to be significantly up-regulated after PO (WT PO vs. WT Sham,

1.91±0.18, P=0.027) and significantly up-regulated by NF-κB (WT PO 1.91±0.18 vs. DN PO

0.99±0.09, P=0.007) (Figure 14B). Expression level of ndufc1 was predicted by microarrays to be significantly down-regulated after PO, and by NF-κB (Table 7 and Figure 14C). Confirmation of ndufc1 expression being down-regulated after PO was supported by QRT-PCR results (WT

114 PO vs. Sham, 0.56±0.07, P<0.001) (Figure 14C). However, QRT-PCR results suggested that

ndufc1 expression is up-regulated by NF-κB (WT PO 0.56±0.07 vs. DN PO 0.26±0.04, P=0.004)

(Figure 14C).

The mRNA expression levels of hsp90aa1 were identified by microarrays to be up-regulated after PO and I/R, and to be up-regulated by NF-κB (Tables 7 and 14, Figures 14D-E). QRT-PCR confirmed that mRNA levels of hsp90aa1 were significantly up-regulated after PO (WT PO vs.

Sham, 2.00±0.22, P=0.001) and after I/R (WT I/R vs. Sham, 2.83±0.57, P=0.016) (Figure 14D-

E). NF-κB regulation of hsp90aa1 was confirmed by QRT-PCR in response to PO (WT PO

2.00±0.22 vs. DN PO 0.89±0.06, P=0.006); however, QRT-PCR suggested that NF-κB did not

regulate in response to I/R (WT I/R 2.83±0.57 vs. DN I/R 2.25±0.48, P=0.45) (Figure 10D-E).

The two inducible forms of heat shock protein gene 70 (hspa1b) and (hspa1a) were suggested

from the microarrays to be significantly up-regulated after PO and I/R, and by NF-κB (Tables 7

and 15, Figures 14F-I). QRT-PCR confirmed that both hspa1a and hspa1b were significantly up-

regulated after PO and I/R [(hspa1b: WT PO vs. Sham, 91.07±20.18, P=0.001; WT I/R vs. Sham

298.3±65.90, P=0.001), (hspa1a: WT PO vs. Sham, 38.16±5.69, P<0.001; WT I/R vs. Sham

176.2±36.38, P=0.004)] (Figure 14 F-I). NF-κB regulation of hspa1b and hspa1a in response to

PO was confirmed by QRT-PCR (hspa1b: WT PO 91.07±20.18 vs. DN PO 44.32±3.53,

P=0.046; hspa1a: WT PO 38.16±5.69 vs. DN PO 23.24±1.91, P=0.03) (Figure 14 F-I). In

response to I/R, NF-κB appears to produce an increase of hspa1b and hspa1a mRNA levels, as suggested by QRT-PCR (hspa1b: WT I/R 298.3±65.90 vs. DN PO 148.8±44.57, P=0.08;

hspa1a: WT I/R 176.2±36.38 vs. DN PO 72.16±36.80, P=0.07) (Figure 14 F-I).

115 Figure 14. Genes Validated by QRT-PCR

A.

B.

C.

116 Continue Figure 14. Genes Validated by QRT-PCR

D.

E.

Bars correspond to the mean ±SEM. n=4 each microarray group. A. ptx3 n=4-10 B. plscr1 n=4-10 C. ndufc1 n=4-10 D. hsp90aa1 (PO) n=4-10 E. hsp90aa1 (I/R) n=4-10

117 Continue Figure 14. Genes Validated by QRT-PCR

F.

G.

Bars correspond to the mean ±SEM. n=4 each microarray group. QRT-PCR: n=4-10

118 Continue Figure 14. Genes Validated by QRT-PCR

H.

I.

Bars correspond to the mean ±SEM. n=4 each microarray group. QRT-PCR: n=4-10

119 III.3.2 Hsp70 Western Blot Validation

Our results above (section III.3.1) suggest that hspa1a (hsp70.3) and hspa1b (hsp70.1) mRNA

expression is highly induced after PO and I/R. However, mRNA levels do not always correlate

with the protein levels; therefore, the goal is to assess the protein level of hsp70.1 and hsp70.3 by

using Western immunoblotting to examine the protein level in the cytoplasmic and nuclear

extracts. Cytoplasmic extracts from ischemic tissue after 5hours PO or I/R (30 min/4hours)

exhibits Hsp70 protein in all groups, including Hsp70.1 KO and Hsp70.1/.3 KO (Figure 15);

whereas, in the nuclear extracts, there appears to be an increase of Hsp70 present in both WT and

DN mice after PO or I/R compared to WT sham and Hsp70 KO mice (Figure 15). See section

IV.4.2 about the limitations of these experiments with the Hsp70 antibodies to detect Hsp70.1

and Hsp70.3.

III.3.3 Functional Assessment of Hsp70.1 and Hsp70.3

The goal was to assess the role of Hsp70.1 and Hsp70.3 after PO and I/R. To achieve the goal,

Hsp70.1 KO mice and Hsp70.1/Hsp70.3 KO mice were subjected to 24 hours PO or 30 minutes

of ischemia followed by 24 hours of reperfusion. Infarct size was then measured.

After 24 hours PO, Hsp70.1 KO mice (c57) had a significantly larger infarct (84.95%±2.37, n=6,

P<0.001) compared to WT (c57) (62.42%±3.14, n=7 (Figure 16A). There was no difference

(P=0.58) in infarct size between Hsp70.1 KO (c57) (84.95%±2.37) and DN mice (83.23%±1.86,

n=4) subjected to PO (Figure 16A). Hsp70.1/.3 KO (B129) (77.55%±2.66, n=7) mice had a

significantly larger infarct (P<0.05) compared to WT (B129) (64.66%±3.84, n=5) after 24 hours

120 PO (Figure 16A). There were no significant (P=0.06) differences in infarct size between Hsp70.1

KO mice (82.89%±2.87) and Hsp70.1/.3 KO mice (77.55%±2.66).

There were no significant (P=0.79) differences in percent of risk regions between WT (B129)

(69.98%±3.40) and Hsp70.1/.3 KO (B129) (68.34%±5.18) (Figure 16B). There was a significant

(P<0.01) increase in the risk region in Hsp70.1 KO (80.32%±3.40) compared to the WT (c57)

(52.59%±4.42) and DN (c57) (59.56%±2.05). However, the percent of infarct over left ventricle

(infarct/LV) was significantly (P<0.0001) higher in Hsp70.1 KO (c57) (68.29 %±2.73)

compared to WT (c57) (33.10%±3.65) (Figure 16C). There were no significant (P=0.24) differences in the LV weight (mg) between all groups (WT (c57) 55.14±2.17, DN (c57)

54.88±2.12, Hsp70.1 KO (c57) 54.08±0.51, WT (B129) 547.64±3.64, and Hsp70.1/.3 KO

(B129) 65.05±6.34) (Figure 16D). Therefore, the normalized infarct size still supports our

conclusion that Hsp70.1 contributes to cardioprotection after PO.

After I/R, Hsp70.1 KO (c57) (5.31 %±0.94, n=6) mice exhibited a significantly (P<0.001)

smaller infarct compared to WT mice (c57) (25.58%±1.72, n=12) after I/R (Figure 17A). There

were no significant (P=0.80) differences in infarct size between Hsp70.1 KO (c57) mice

(5.31%±0.94) compared to DN mice (c57) (5.74%±1.47, n=5) (Figure 17A). The percent of risk

region was not significantly different (P=0.45) between Hsp70.1 KO (71.65%±4.13), WT (c57)

(65.94%±2.91) and DN (c57) (70.11%±3.17) (Figure 17B). These results support that Hsp70.1

contributes to cell death after I/R.

121 Hsp70.1/.3 KO mice (B129) (39.51%±4.78, n=6) displayed a significantly (P<0.001) larger infarct compared to WT mice (B129) (9.22%±1.39 n=7) after I/R (Figure 17A). There was a

significant (P<0.01) difference in percent of risk region between Hsp70.1/70.3 KO (B129)

(78.37%±4.40) compared to WT (B129) (46.23%±6.75) (Figure 17B).

There was a significant decrease (P<0.001) in percent of infarct/left ventricle in Hsp70.1 (c57)

KO (3.74%±0.81) compared to WT (c57) (17.08 %±1.69) (Figure 17C). Hsp70.1/. 3 KO (B129) mice (30.98%±5.05) exhibited a significantly (P<0.001) larger percent of infarct/left ventricle

compared to WT (B129) (4.78%±0.85) (Figure 17B). There was no significant (P=0.64)

difference in LV weight (mg) between the Hsp70.1 KO (45.40±6.95), WT (c57) (56.20±6.02),

DN (c57) (51.04 ±5.98), and Hsp70.1/70.3 KO (B129) (54.78±4.20) (Figure 17D). However,

there was a significant (P≤0.05) increase in LV weight in the WT (B129) (73.35±6.49) compared

to other groups. (Figure 17D). The normalized infarct size supports our conclusion that Hsp70.1

contributes to cell injury after I/R, and Hsp70.3 might contribute to cardioprotection after I/R.

122 A. B.

C. D.

Figure 15. Cytoplasmic and Nuclear Extracts were probed with Hsp70 using anti-Hsp 70

Antibodies to detect Hsp70.1 and Hsp70.3. A. Cytoplasmic extracts (CE) from Hsp70.1/.3 KO,

Hsp70.1 KO, WT (c57) shams, along with ischemic tissue after 6 hours PO in WT and DN mice.

B. CE from Hsp70 KO, WT Sham (c57), and ischemic tissue isolated from WT and DN mice after 30 minutes of ischemia followed by 4 hours of reperfusion. C. Nuclear extracts (NE) from

Hsp70.1/.3 KO, Hsp70.1 KO, WT Sham (c57) and ischemic tissue after PO in both WT and DN mice. D. NE prepared from Hsp70 KO, WT sham (c57) and tissues isolated after I/R from WT and DN mice. Actin was used as a loading control. See discussion section for limitations using

Hsp70 antibodies to detect Hsp70.1 and Hsp70.3. n=1-3

123 Figure 16. Functional Role of Hsp70.1 and Hsp70.3 after 24hr PO n= 4-7

A.

B.

124 Continue Figure 16. Functional Role of Hsp70.1 and Hsp70.3 after 24 PO n= 4-7

C.

D.

E. Mouse Strain # of mice # of total Sur vival sur vived mice used Rate B129 5 6 83.3% Hsp70.1/.3 KO 7 9 77.7% c57 8 * 9 88.8% DN 5 * 7 71.4% Hsp70.1 KO 7 * 9 77.7%

125 Figure 16. Functional Role of Hsp70.1 and Hsp70.3 after 24hr PO. A. Assessment of infarct size (as a percent of risk region) after 24 hours PO. B. Percent of risk region after 24 hours PO.

C. Percent of Infarct/left ventricle after 24 hours PO. D. LV weight (mg) for for WT (B129),

Hsp70.1/. 3 KO (B129), WT (c57), DN (c57), and Hsp70.1 KO (c57). E. Table showing survival rate for WT (B129), Hsp70.1/. 3 KO (B129), WT (c57), DN (c57), and Hsp70.1 KO (c57).

* Indicates that there was a significant outlier (mean +/-2 st dev) corresponding to LV size for one of the samples, which was not included in the infarct results. All bars correspond to the mean

±SEM. n= 4-7

126 Figure 17. Functional Role of Hsp70.1 and Hsp70.3 after I/R (30m/24hr) n= 5-12

A.

B.

127 Continue Figure 17. Functional Role of Hsp70.1 and Hsp70.3 after I/R (30m/24hr) n= 5-12

C.

D.

E. Mouse Strain # of mice # of total Sur vival sur vived mice used Rate B129 9^ 9 100% Hsp70.1/.3 KO 6 7 85.7% c57 13^ 13 100% DN 5 5 100% Hsp70.1 KO 6 7 85.7% 128

Figure 17. Functional Role of Hsp70.1 and Hsp70.3 after I/R (30m/24hr). A. Assessment of infarct size (as a percent of risk region) after I/R (30m/24hr) B. Percent of risk region after I/R.

C. Percent of Infarct/left ventricle after I/R. D. LV weight (mg) for for WT (B129), Hsp70.1/. 3

KO (B129), WT (c57), DN (c57), and Hsp70.1 KO (c57). E. Table showing survival rate for WT

(B129), Hsp70.1/. 3 KO (B129), WT (c57), DN (c57), and Hsp70.1 KO (c57). ^ Indicates that there was a significant outlier (mean +/-2 st dev) corresponding to percent of infarct size (as a percent of risk region), which was not included in the infarct data. All bars correspond to the mean ±SEM. n= 5-12.

129 Chapter IV: Discussion

IV.1 Cardiovascular Disease

Cardiovascular disease is currently the number one cause of death globally [1]. Most of these

deaths are due to coronary heart disease, which include conditions such as acute myocardial

ischemia [1,2]. Therefore, it is essential to identify novel therapeutic targets for the treatment of

coronary heart disease to reduce mortality.

Within minutes of myocardial ischemia, TNF-α is released from various cells (e.g. resident mass cells, macrophages) and activates the transcription factor NF-κB [221-223]. In addition to I/R injury, NF-κB activation is associated with several cardiovascular pathophysiologies, including heart failure, cardiomyocyte hypertrophy, and dilated cardiomyopathy [51,167,183]. In contrast,

NF-κB activation is cardioprotective after PO [51,167,182]. Understanding the mechanisms regulating NF-κB cardioprotection and cell injurious outcomes will provide novel potential therapeutic targets for enhanced cardioprotection protection and decreased injurious effects.

IV.2 NF-κB Paradox

IV.2.1 NF-κB Paradox

There is controversy regarding the role of NF-κB in cell survival/cell death after ischemic

insults. For example, NF-κB activation is cardioprotective after permanent coronary occlusion

(PO) [51,182]. However, NF-κB activation is also associated with cell death after I/R

[51,167,183,194-202]. The discrepancy between NF-κB being cardioprotective versus causing cell injury might be related to experimental models (PO vs. I/R), specific mouse strains, surgical

130 approaches and techniques, and differences in NF-κB activation patterns [51,182]. To address the controversy regarding the role of NF-κB being cardioprotective after PO or causing cell injury after I/R, a cardiac specific NF-κB genetic blockade model (DN mice) and WT mice under similar conditions (e.g. same surgical model/technique, surgeons, anesthetics, and mice) were used, therefore eliminating any variables that may confound the interpretation of the results.

After 24 hours PO, DN mice had significantly larger infarcts compared to WT (section III.1.1).

In contrast, 30 or 45 minutes of ischemia followed by 24 hours of reperfusion resulted in DN mice having significantly smaller infarcts compared to WT (section III.1.1). These results agree with previous studies that show NF-κB contributes to cardioprotection after PO [51,182] and mediates cell death after I/R [51,167,183,194-202]. The results of our DN model subject to PO or I/R, suggests that the antithetical results of NF-κB are not due to specific mouse strains, differences in surgical models, and surgical technique [51].

The objective of this thesis is to determine the mechanisms that underlie the NF-κB paradox (e.g.

NF-κB–dependent cardioprotection after PO vs. NF-κB–dependent cell death) following ischemic insults. The hypothesis is that the regulation of diverse sets of NF-κB-dependent genes contributes to the mechanistic basis of the differential effect of NF-κB cardioprotection vs. cell death after ischemic stimuli.

131 IV.2.2 NF-κB cardioprotection after PO

Information regarding NF-κB-dependent cardioprotection after PO and the downstream gene targets that affect cell survival is limited, precluding the identification of novel therapeutic targets to enhance cardioprotection during myocardial ischemia. Therefore, understanding NF-

κB-dependent cardioprotection will hopefully result in identification of novel therapeutic targets to enhance cell survival during myocardial ischemic events. Apoptotic and necrotic cell death occurs within 2 to 6 hours after initial ischemia [13,45,57-62,146,182]. However, there is little information regarding when NF-κB-dependent anti-cell death effects occur. Misra et al., showed a significant increase of apoptotic cells in IκBα∆N mice compared to WT after 3 hours PO, with a further increase at 6 hours after PO [182]. These results suggest that NF-κB suppresses apoptotic cell death at 3 and 6 hours after PO; however, the time-course of the NF-κB-dependent

infarct sparing effect had not been previously elucidated. One of the objectives of this thesis was

to determine when NF-κB cardioprotection occurs and is completed. Infarct sizes were examined

in both DN and WT mice 4, 6 and 24 hours after initial occlusion (section III.1.2). There were no

significant differences in infarct size between DN and WT mice after 4 hours of PO, suggesting

that NF-κB does not contribute to cell death or cell survival during the first 4 hours of PO

(section III.1.2). In contrast, DN mice at 6 and 24 hours after PO resulted in a significantly larger

infarct compared to WT mice after 6 and 24 hours PO (section III.1.2). There was no significant

difference in infarct size after 4, 6 or 24 hours PO in WT mice (section III.1.2). Our results

agreed with previous apoptotic studies by Misra et al [182]. In summary, these results suggest that NF-κB cardioprotection is effective between 4 and 6 hours after PO.

132 As mentioned in the introduction (section I.1.3), Reimer and Jennings [16] coined the term

“wavefront phenomenon”, which describes the movement of necrosis from subendocardium

(central zone) to subepicardium (peripheral zone) after prolonged ischemia [13]. After 4 hours of ischemia, one can hypothesize that there is a core of necrotic and apoptotic cells in the subendocardium (central zone) that exhibit irreversible cell injury. Compared to the cardiomyocytes in the subepicardium (peripheral zone), the most peripheral zone (border zone) has not undergone irreversible cell injury within the first 4 hours of ischemia. Prolonged ischemia for 4 to 6 hours could result in cell death in the peripheral and border zone that is associated with the evolution of injury [13]. Our results suggest that the activation of NF-κB may prevent the second wave of cell death occurring in the border zone between 4 to 6 hours PO

(section III.1.2).

Several groups have investigated NF-κB activation for up to 1 hour following ischemia. The data shows significant NF-κB activation beginning 5 to 15 minutes after initiation of global ischemia until up to 1 hour using an isolated rat heart perfusion model [192,224-227]. The major limitation of these studies is the use of a global ischemia model, where it is possible that the stress of the aorta being cannulated and the rat heart being perfused with Krebs-Henseleit buffer to equilibrate the heart may result in early activation of NF-κB and therefore not be a response to ischemia per se. One in vivo coronary artery occlusion model induced NF-κB activation after 10 minutes of ischemia, with an increase in NF-κB activation observed after 30 minutes and 45 minutes of ischemia in the rat heart [225]. In contrast, a study using a rabbit in vivo coronary

133 artery occlusion model showed no NF-κB activation after 30 minutes of ischemia; however, after

10-15 minutes of reperfusion NF-κB activation is detectable [228].

The hypothesis was that NF-κB translocation into the nucleus occurs between 1 to 4 hours after

PO based upon the infarct results, which would explain the observation that NF-κB-dependent cardioprotection occurs within 4 to 6 hours after PO (section III.1.2). NF-κB translocation to the nucleus was assessed by Western blot to quantify the amount of p65 in the nucleus after 1, 2, 3 and 4 hours after PO (section III.1.3). Nuclear extracts were confirmed using a TATA-binding protein (TBP) antibody, which detects the nuclear protein TBP (section III.1.3) [210, 220].

Nuclear and cytoplasmic extracts were probed with an antibody that detects the cytoplasmic protein GAPDH, which was used to confirm the cytoplasmic extract (section III.1.3).

Cytoplasmic extracts contain a large amount of GAPDH, while only a small amount of GAPDH was detected in the nuclear extract, suggesting it was relatively free from cytoplasmic contamination (section III.1.3) [210]. After 1 hour of PO, there was a slight increase (1.76±0.30) in the level of p65 present in the nucleus compared to sham (section III.1.3). However, starting at

2 hours PO, there was a greater increase of p65 levels in the nucleus, with a steady level being present up to 4 hours PO (section III.1.3). Our results suggest that NF-κB is present in the nucleus starting at 2 and up to 4 hours after occlusion. The infarct size results show that NF-κB suppresses cell death between 4 to 6 hours after PO (section III.1.3). Since NF-κB is a transcription factor, it is thought to mediate this protection by affecting expression of downstream genes. In theory then, the regulation of the expression of the genes in question is thought to occur between 4-6 hours after PO; therefore, genes were examined after 5 hours PO.

134 IV.2.3 NF-κB-dependent Cell Death after I/R

Previous studies have shown that apoptotic and necrotic cell death occurs within 2 to 4 hours

after reperfusion [62,65-67]. After 30 minutes of ischemia, followed by 4 hours of reperfusion,

the infarct size was shown to be similar to the infarct size after 24 hours of reperfusion,

suggesting that 4 hours of reperfusion was sufficient time to determine the final extent of

infarction in mice [208]. Several researchers have established that NF-κB activation occurs in a biphasic fashion with the first peak occurring after 15 to 30 minutes of reperfusion, conjectured to be the result of reactive oxygen species generation [51,167,183,224,225,229-233]. This is followed by a second peak occurring 3 hours after reperfusion, which is most likely due to proinflammatory cytokines produced after the first peak of NF-κB activation (aka, NF-κB-

dependent cytokine gene expression) [51,167,183,224,225,229-233].

In theory, the first peak of NF-κB activation must regulate NF-κB-dependent genes that contribute to cell death within the first 4 hours of reperfusion. It has been suggested that the first peak of NF-κB activation upon reperfusion up-regulates pro-apoptotic genes (e.g. p53) and

down-regulates anti-apoptotic genes (e.g. bcl-2) [192]. Several studies suggest that inflammatory cytokine genes (e.g. il-1β, il-6, tnf-α) and other genes (e.g. fasl, icam-1, inos) are up-regulated by

NF-κB following reperfusion, and may contribute to cell injury

[51,167,230,231,232,233,234,235]. However, these studies have only examined a handful of genes, or examined selected genes after inhibition of NF-κB. The complete sets of genes that contribute to NF-κB-dependent cell death after I/R are not fully known. This lack of knowledge results in a roadblock in the identification of novel therapeutic targets for reducing cell death

135 after ischemic insult. There is a critical need for a detailed study to identify sets of genes that

may contribute to NF-κB-dependent cell injury outcomes after I/R. Based upon the available

information, the hypothesis was that these genes would be up-regulated by NF-κB 2-3 hours

after reperfusion. Therefore, genes were examined after 3 hours of reperfusion.

IV.2.4 Summary of NF-κB Paradox

This thesis has determined that NF-κB-dependent cardioprotection does not occur up to 4 hours

PO, however, it is completed by 6 hours after PO (section III.1.2). Our results suggest that NF-

κB translocation into the nucleus begins around 2 hours and remains at a steady level for 4 hours

after PO, resulting in expression of NF-κB-dependent cardioprotective genes (section III.1.3).

NF-κB activation has been documented after reperfusion showing a phase of activation peaking

from 15 to 30 minutes after reperfusion, followed by a second peak starting at 3 hours after

reperfusion [51,167,183,224,225,229-233]. It has been suggested that reperfusion for 4 hours

would result in a fully developed infarct, which suggests that after I/R the first peak of NF-κB

activation regulates cell death by 4 hours of reperfusion [192,208]. A second wave of NF-κB

activation at 3 hours would likely not have time to elicit gene expression with effect upon the

infarct process, which seems complete by 4 hours post-reperfusion. It was hypothesized that NF-

κB activation occurring at 15 to 30 minutes after reperfusion would result in expression of NF-

κB-dependent set of genes that regulate cell death within the first 4 hours after reperfusion

(Figure 18). In contrast, after PO, the cell death in the border and peripheral zones occurs between 4-6 hours after coronary occlusion (section III.1.2). Therefore, there is time for late expression of NF-κB protective genes in this zone, which would have the effect of preserving

136 myocardium. Blockade of NF-κB during PO would thus abrogate this protection, increasing death of cells in this region and increasing infarct size (section III.1.2).

Several computer and theoretical algorithm models were used to predict the kinetics of NF-κB activation and translocation into the nucleus, along with gene expression [236-251]. These mathematical models of NF-κB activation and translocation into the nucleus have shown little or no NF-κB oscillations, resulting in target genes that are continuously induced until the gene- specific mechanisms block the transcription of these genes [250]. Some NF-κB mathematical models suggest that NF-κB oscillations allow only brief expression of immediate early genes, and that the later phase of NF-κB oscillations leads to the expression of late accessible genes, suggesting that NF-κB oscillations are strongly correlated with upstream signaling kinetics and potentially different downstream gene sets [250]. It has been predicted that the kinetics of NF-κB activation or translocation into the nucleus would result in a diverse set of genes [250]. These models are based on algorithm calculations and assumptions that occur in vitro, but they do not take into consideration the complex signaling that occurs in in vivo. However, they are helpful in

understanding the different activation patterns that might result in NF-κB-dependent regulation

of diverse sets of genes. Consequently, the hypothesis states that the effect of NF-κB after two

different ischemic injuries (e.g. ischemic injury (PO) vs. reperfusion injury (I/R)) and the two

different time periods of the cell injury might be related to the kinetics of NF-κB activation and

to the discrete sets of NF-κB-dependent genes activated in each of the two scenarios (Figure 18).

137 Figure 18. NF-κB Paradox Model

The hypothesis was that different patterns of NF-κB activation during PO (monphasic) and I/R

(biphasic) would result in expression of unique sets of NF-κB-dependent genes that contribute to cell injurious outcomes after I/R, and cardioprotection after PO. For example, the first peak of

NF-κB activation within 15 to 30 minutes would result in a unique set of genes that are up- or down-regulated by NF-κB. Prolonged NF-κB being present in the nucleus following 2 hours PO will result in a unique set of genes that are either up- or down-regulated by NF-κB, along with a common set of genes between PO and I/R. Green circles represent genes that are up-regulated by

NF-κB, and red circles represent genes that are down-regulated. Black circles represent genes that are not up- or down-regulated by NF-κB. The black line represents NF-κB regulated by PO, and the dashed line represents NF-κB regulated after I/R.

138 IV.3 Genes regulated after PO and I/R, and by NF-κB

As mentioned earlier (section IV.2), there is a lack of information regarding how NF-κB

contributes to cell survival when compared to the cell death seen after various ischemic insults.

Therefore, there is a critical need to identify NF-κB-dependent genes up- and down-regulated

after PO and I/R that contribute to NF-κB paradox. The goal of this thesis was to determine

genes that underlie the NF-κB-dependent cardioprotection after PO, and genes that are likely to

mediate NF-κB-dependent cell death after I/R. To achieve this goal, microarrays were used to

determine the set of genes up- and down-regulated after PO (WT PO vs. WT Sham) and genes

regulated by NF-κB after PO (WT PO vs. DN PO) (section II.6, section III.2). The overlapping

genes between the two groups are the main candidates for contributing to NF-κB-dependent

cardioprotection after PO (section II.6, section III.2). The same approach was used to determine

genes up- and down-regulated after I/R (WT I/R vs. WT Sham) and genes up- and down- regulated by NF-κB (WT I/R vs. DN I/R) (section II.6, section III.2). The overlapping genes

between the two groups are the main candidates for mediating NF-κB-dependent cell injurious

outcomes (section II.6, section III.2). The use of microarrays and DN mice allow us to examine

the complete profile of genes that are likely to underlie the NF-κB paradox, therefore increasing

the understanding how NF-κB regulates cardioprotection and cell injury outcomes after various

ischemic insults.

139 IV.3.1 Genes Regulated after PO and by NF-κB

The first objective was to identify genes that may be responsible for the NF-κB-dependent cardioprotection following PO. Our results suggest that NF-κB-dependent cardioprotection

occurs between 4 to 6 hours and that NF-κB significantly translocates to the nucleus starting at 2

through 4 hours PO (section III.1.2-1.3). NF-κB-dependent genes are known to be expressed as

early as 60 minutes following NF-κB activation for early targeted genes, while intermediate and

late primary target genes are highly expressed by 3 hours [250,252,253]. Based on these results

mRNA was isolated from ischemic tissue at 5 hours PO in both WT and DN mice, along with the

5 hours PO sham.

Genes regulated after PO

Microarray comparison of mRNA levels between WT PO (5 hours) and WT sham (5 hours) mice resulted in 567 genes (595 oligonucleotide probes) significantly up- or down-regulated (P<0.01

and fold change of >1.5 fold) after PO. The most significantly regulated gene after 5 hours PO

was heat shock protein 1B (hspa1b), along with other highly significant heat shock proteins such

as heat shock protein 1A (hspa1a) and dnaj (hsp40) homology, subfamily B member 1 (dnajb1)

(section III.2.1). It has been shown that hspa1b (Rat hsp72) mRNA levels peak at 4 hours after

PO, and are still highly expressed after 24 hours of ischemia [254]. Hsp70 protein was

moderately present in cardiomyocytes in the ischemic tissue after 4 hours, with a stronger

presence of Hsp70 protein after 24 hours PO [254]. Several heat shock proteins are expressed in

the cardiomyocytes after myocardial ischemia and are known to adapt the heart to ischemic

injury [155,255-260].

140 Several transcription factors were significantly up-regulated after 5 hours PO (section III.2.11).

The most significantly regulated transcription factor was early growth factor 1 (egr1) (section

III.2.1), which has been shown to be expressed after ischemia with a peak expression occurring

at 3 hours PO [155,257,261]. Egr3 regulates inflammatory, chemokine, and adhesion protein

genes in response to ischemia [155,256,257,261,262]. Three members of the transcription factor

family activator protein (AP1) and activating protein factor (ATF) were significantly up-

regulated: fbj osteosarcoma oncogene (fos), fbj osteosarcoma oncogene b (fosb), along with activating transcription factor 3 (atf3) (section III.2.1). These three transcription factors are

known to be up-regulated after ischemia and are involved in regulating various ischemic-related

genes (e.g. inflammatory cytokine genes) [155,156,257]. The other significantly up-regulated transcription factor was nuclear receptor subfamily 4, group A, member 1 (nr4a1), which is a

member of the nuclear receptor family that is known to regulate apoptosis, proliferation, and cell

differentiation (section III.2.1) [263].

Significant gene ontology categories were the following: cell migration, blood vessel

development, inflammatory response, and cell adhesion (section III.2.1). Cell migration and cell adhesion is involved in myocardial ischemia, and plays an important role in the inflammatory

responses [264]. Genes grouped into the functional GO-term categories of cell migration and cell

adhesion were icam2, pecam1, and itga 6/11, which were induced following myocardial

ischemia, and interact with neutrophils [257,264,265]. Several chemokines members (cxcl1/2,

and ccl3/4/7/11) were grouped into the GO-term category inflammatory response. Chemokine

members are involved in myocardial ischemia and regulating neutrophil location in infarct

tissues [135]. Another highly significant GO-term category was blood vessel development, which

141 may relate to angiogenesis for providing infarcted tissue with oxygen and nutrients within the infarct area. Genes grouped into the GO-term category blood vessel development were: edn1, vegfa and tgfb2. These genes are considered to be angiogenic factors and expressed in response to myocardial ischemia [135,257,265].

The most significant KEGG pathway was the mitogen-activated protein kinase (MAPK) signaling pathway. Several genes were grouped into the KEGG pathway MAPK signaling, including genes involved in the c-Jun NH2-terminal kinase (JNK) pathway (e.g. map3k1, map3k8, hspa1a, and dusp1), p38 MAPK pathway (e.g. dusp1, hsp27, and atf4), and extracellular signaling-regulated kinase (ERK) pathway (e.g. dusp1, rps6ka, atf4, myc, and fos).

Both the JNK and p38 MAPK pathways have been suggested to be involved in both cell death and cell survival pathway, whereas the ERK pathway is mostly involved in cell survival following ischemic insults [266]. These three MAPK pathways are known to phosphorylate certain proteins such as Hsp27 and transcription factors (e.g. Myc, Fos, and Atf4) [266].

A few studies have examined gene expression after prolonged ischemia. One study used a rat myocardial ischemia model and found an increase in expression of proinflammatory cytokine genes (e.g. il-1α, il-1β, il-6, and tnf-α) 6 and 12 hours after ischemia [139]. They proposed high levels of proinflammatory cytokines after acute ischemia might be involved in the initiation of wound healing in the necrotic tissue [139]. The following genes: il-1β, il-6, and several chemokine genes were significantly up-regulated after 5 hours PO. Another study found that after 24 hours of ischemia, early growth factor 3 (egr3), along with alpha-myosin heavy chain

(a-mhc) and fetal myosin alkali light chain (mlc), were significantly up-regulated [261]. 142 Myocardial ischemia (2 weeks up to 16 weeks; post myocardial infarction (MI) remodeling

model) in rat myocardium resulted in the up-regulation of several genes that are associated with remodeling (e.g. fibronectin, laminin, fibrillin, fibulin, and decorin), hypertrophy (e.g. atrial natriuretic peptide, anp and brain natriuretic peptide, bnp), and decreased levels of fatty acid

metabolism (e.g. enoyl-coenzyme (coa) isomerase (ehhadh), dienoyl-CoA isomerase (ech1),

hydroxyacyl CoA dehydrogenase (hadha) and acetyl-Coenzyme A acyltransferase 1A (acaa))

[155,267]. Our microarray studies suggest genes associated with remodeling and hypertrophy

were not regulated after 5 hours PO, but genes associated with metabolic processes (e.g. enoyl-

coenzyme A, hydratase, ehhadh and acyl-coenzyme A oxidase 3,pristanoyl, acox3) were down- regulated after 5 hours PO. These genes being down-regulated may indicate a profound change in the metabolic process that is occurring in the ischemic tissue to adapt to lack of ATP.

In summary, our results suggest that several genes associated with metabolic processes were down-regulated after PO. In contrast, several heat shock protein genes (e.g. hspa1b and dnjab1)

and transcription factor genes (e.g. egr1, fos, fosb, nr4a1, and atf3) were highly up-regulated

after PO (section III.2.1). This suggests that the myocardium may adapt to ischemic stress by

down-regulating genes that are involved in metabolism, and up regulating genes involved in cell

survival. There are several highly up-regulated heat shock genes, which are known to regulate

various functions including protein folding, inhibition of apoptosis, protection of cytoskeleton,

and enhanced nitric oxide synthesis [291]. Interestingly, several transcription factors were highly

up-regulated after 5 hours PO, suggesting that multiple genes are being regulated by a network of

transcription factors (section III.2.1). Several genes were grouped into the highly significant GO-

term categories cell migration, blood vessel development, inflammatory response and cell

143 adhesion. Our results suggest that genes involved in heat shock, blood vessel development, and

inflammation might be involved in adapting the myocardium to ischemic stress.

Genes Regulated by NF-κB in Response to PO

Currently, no other groups use a cardiac-specific NF-κB blockade model to investigate NF-κB- dependent genes after acute PO. However, in 2003, Misra et al. used a mouse model in which a

regulator of NF-κB signaling, IκBα, was altered in function to examine NF-κB signaling in

ischemia [182]. Three NF-κB-dependent proteins (Bcl-2, c-IAP1, and c-IAP2) and two other proteins (JNK and MnSOD) were examined after 1 and 3 hours PO in the IκBαDN and WT mice

[182]. After 1 hr PO, the protein levels of Bcl-2 and c-IAP1 were significantly decreased in the

IκBαDN compared to WT mice, with no differences between the two groups after 3 hours PO

[182]. No differences were found in protein levels for c-IAP2, MnSOD, and JNK after 1 and 3 hours PO in WT compared to IκBαDN [182]. This suggests that at least Bcl-2 and c-IAP1 contribute to the NF-κB cardioprotection after PO [182]. However, our results suggest that NF-

κB is not present in the nucleus until 2 hours after PO, and that it mediates cardioprotection

between 4 to 6 hours after PO (section III.1.2-III.1.3). Therefore, there is a lack of information

regarding the NF-κB-dependent cardioprotection after PO, and detailed studies are needed to

identify the mechanisms that regulate NF-κB-dependent cardioprotection after PO.

The objective of this thesis as mentioned earlier (section III.2.3) is to identify genes that are up-

and down-regulated by NF-κB in response to PO. Therefore, microarray were used to find genes associated with NF-κB activation after PO (WT PO vs. DN PO). Microarray comparisons

between WT PO and DN PO resulted in the identification of 134 genes being significantly 144 (P<0.01 and >1.5 fold change) up-regulated, and 120 genes down-regulated by NF-κB in

response to PO (section III.2.2).

The most significant gene ontology categories were regulation of endocytosis, regulation of

phagocytosis, negative regulation of Wnt receptor pathway (section III.2.2). Regulation of

endocytosis and regulation of phagocytosis gene ontology categories included the following

genes: pentraxin related gene (ptx3), signal-regulatory protein beta 1(sirpb1), and

immunoglobulin heavy chain 1a (igh-1a), with stonin2 (ston2) belonging to the regulation of

endocytosis. The role of phagocytes is to defend against invading pathogens by killing and disposing of them in an effective way, along with engulfing apoptotic bodies and cell debris

[268]. Phagocytes engulf particles that are receptor- and actin-dependent, and clathrin- independent for the internalization of large particles [269]. Particles coated with opsonins (which can be complementary components) and immunoglobulins are recognized by phagocytes [269].

The role of Ptx3 is thought to be an additional receptor that macrophages recognize, enhancing the phagocytic activity of macrophages [270]. Particles that are coated with Igh-1a (opsonins) are

targeted for phagocytosis [271]. Another receptor which macrophages recognize for

phagocytosis is Sirpb1 [272]. Ston2 has also been suggested to interact with endocytic adaptor

proteins (AP-2) and clathrin-coated vesicles, which may function for sorting vesicles for

recycling [273]. Our microarray results suggest that NF-κB up-regulated genes are markers for phagocytosis in response to ischemic stress. NF-κB has been previously shown to regulate ptx3

and igh-1a [274,275].

145 The following genes, dickkopf homolog 1 (Xenopus laevis) (dkk3), catenin beta interacting

protein 1 (ctnnbip1), and tax1 (human T-cell leukemia virus type I) binding protein 3 (tax1bp3) were grouped into the GO-term category negative regulation of Wnt receptor signaling pathway.

These three genes appear to be NF-κB-regulated in our model; however, these genes previously

have not been shown to be regulated by NF-κB. Studies suggest that Dkk3 does not function in

Wnt signaling, but the N-terminal does encode a substrate binding subunit called p29 [276].

Dkk3 has been suggested to be both pro-apoptotic[276] and anti-apoptoticby decreasing caspase

activation [277]. Ctnnbip1 is a known inhibitor of beta-catenin and T cell factor (ICAT) [278].

Tax1bp3 is a family member of the PDZ protein, which has PDZ (PSD-95/DLG/ZO-1

homology) domains that are small protein-protein recognition modules localized in cell-cell

contacts sites [279]. These proteins are known to act as a shuttle between signaling complexes

and the nucleus, therefore regulating transcription [279]. Tax1bp3, also known as TIP-1, is

known to bind to β-catenin and inhibits its transcriptional activity [279]. Our microarray results

suggest that NF-κB regulates genes that can interact with β-catenin to inhibit its transcriptional

activity.

In summary, our microarray results suggest that NF-κB up-regulated 134 genes (significantly

increased in WT PO compared to DN PO) and down-regulated 120 genes (significantly decreased in WT PO compared to DN PO). Surprisingly, there were no bcl-2 anti-apoptotic gene

family members regulated by NF-κB after 5 hours PO. Misra et al. suggests Bcl-2 anti-apoptotic

protein family members Bcl-2 and c-IAP1 (NF-κB regulated proteins) contribute to NF-κB cardioprotection after 1 hour PO [182]. In contrast, our results suggest that bcl-2 anti-apoptotic

146 gene family doesn’t contribute to the NF-κB response to 5 hours PO (NF-κB cardioprotection

occurs between 4-6 hours after PO, section I.1.2-I.1.3). The hypothesis was that NF-κB responds

to prolonged ischemia by activating other genes that may adapt to the ischemic stress. For example, genes that are involved in regulation of phagocytosis, one of the most significant GO

term categories, contain the following: ptx3, sirpb1, igh-1a, and ston2. Phagocytosis is the

cellular process in which phagocytes (macrophages) remove necrotic cells and debris from the

infarcted myocardium, promoting tissue repair and scar formation [280,281].

Genes Regulated after PO and by NF-κB

The present objective was to determine genes that are most likely to contribute to the NF-κB-

dependent cardioprotection. To achieve the goal, genes that were significantly up- and down-

regulated after PO (565 genes (section III.2.1)) were compared to genes that were significantly

up- and down-regulated by NF-κB in response to PO (254 genes (section III.2.2)). Comparison

of the two sets of genes (PO up- and down-regulated genes, 565 vs. 254 NF-κB up- and down-

regulated genes) resulted in 16 genes, which are the main genes that possibly contribute to NF-

κB-dependent cardioprotection after PO (section III.2.3). Out of these 16 genes, 11 genes

significantly up-regulated after PO (section III.2.3). Eight of the 11 genes (up-regulated after PO) were also up-regulated by NF-κB, which were the followings: hspa1a, hsp90aa1, car3,

2810474019rik, plscr1, igfbp3, ptx3 and dkk3 (section III.2.3). The other three genes that were

up-regulated after PO were also down-regulated by NF-κB, which were the following: edn2,

ai605517, and myocd (section III.2.3). Five out of the 16 genes regulated after PO and by NF-κB

were down-regulated after PO (section III.2.3). Four of these genes were also down-regulated by

147 NF-κB, which were ndufc1, sfil1, gm9783, and grhl2 (section III.2.3). There was only one gene that was down-regulated after PO, but was up-regulated by NF-κB, which is ankrd9 gene

(section III.2.3).

The most significant (P=1.80E-05) GO-term category was regulation of nitric oxide biosynthesis

processes, which included the genes hsp90aa1 and ptx3 (section III.2.3). Both of these genes are known to be regulated by NF-κB and shown to be up-regulated after ischemic insults [282-286].

Nitric oxide contributes to cardioprotection in the heart by preventing ischemic injury [286].

Hsp90 is known to interact with endothelial nitric oxide synthase (eNOS), which results in an increased production and activity of nitric oxide (NO) leading to cardioprotection [286-289].

Ptx3 is known to increase NO production in macrophages and has been shown to be cardioprotective after PO [283,290].

The antigen processing and presentation pathway was the only KEGG pathway that was significantly regulated after PO and by NF-κB (section III.2.3). There were two genes that were grouped into the antigen processing and presentation pathway, which were hsp90aa1 and hspa1a

(section III.2.3). Heat shock proteins contribute to fundamental immunological roles that

mediate chaperone proteins during antigen processing and are associated with innate immunity

[290]. Hsp90aa1 (Hsp90) and Hspa1a (Hsp70.3) are known to have multiple roles during

myocardial ischemia, such as enhancing protein folding, degradation of abnormal proteins,

inhibiting apoptosis, enhanced NO synthesis, and protection of the cytoskeleton which may

contribute to cardioprotection [291,292].

148 Other interesting genes regulated by NF-κB and PO were the following: car3, plscr1, igfbp1, edn2, and myocd, which were previously unknown to be regulated by NF-κB. Briefly, Car3 is known to maintain pH homeostasis, fatty acid metabolism, and reduce ROS and apoptosis under oxidative stress conditions [293]. Plscr1 is a calcium-binding protein that contributes to the bidirectional movement of phospholipids, which is implicated in early stage apoptotic cell death; it also regulates gene expression related to apoptosis and proinflammatory cytokines [294].

Igfbp1 has been shown to bind to insulin growth factor to promote pro-mitogenic and anti- apoptotic functions [295]. Posttranslational modifications of the protein Igfbp1 have been suggested to mediate nuclear receptors to either induce or inhibit cell death, along with promoting blood vessel development [295,296]. Both edn2 and myocd genes were up-regulated after PO, but down-regulated by NF-κB (section III.2.3). Edn2 is a member of the vasoconstrictor ET peptide family and induces il-6 expression during neuronal differentiation

[296]. Mycod is a transcriptional co-activator expressed in cardiac and smooth muscle cells, along with being a member of the SAP family transcription factor which regulates development and differentiation [297,298].

In summary, our results uncovered 16 genes that are up- and down-regulated after PO and by

NF-κB that are candidates for contributing to the NF-κB-dependent cardioprotection. Out of the

16 genes, eight of them were up-regulated after PO and by NF-κB. Two of these genes

(hsp90aa1 and ptx3) have been previously shown to be up-regulated by ischemia and NF-κB

[282-286]. Hsp90 and Ptx3 have been shown to be cardioprotective following ischemia by enhancing nitric oxide synthesis [282,285-289]. There were two genes (hspa1a and plscr1) that previous studies suggested to be up-regulated by NF-κB (via cytokines induction) and may 149 contribute to the cardioprotection or regulate apoptosis [141,187,294,300,301]. Other genes (e.g.

car3, igfbp3 and dkk3) were identified that have not been shown to be either up- or down-

regulated by NF-κB and/or ischemia before, which might contribute to NF-κB-dependent

cardioprotection.

In addition, there were four genes (e.g. ndufc1, sfi1, gm9783, and grhl2) that are down-regulated by NF-κB and after PO that were not previously shown to be regulated by ischemia and NF-κB.

Our goal was achieved by the identification of known and unknown genes that were regulated by

NF-κB and after PO, which may contribute to the NF-κB-dependent cardioprotection. However, further validation (e.g. QRT-PCR and functional studies using either knockout or transgenic

mice) is needed to determine if these genes contribute to NF-κB-dependent cardioprotection after

PO.

IV.3.2 Genes regulated after I/R and by NF-κB

Our objective was to find a set of genes responsible for the NF-κB-dependent cell injurious

outcomes after I/R. Previous studies have suggested that NF-κB activation occurring within first

15 to 30 minutes contributes to cell death, and that the infarct is completely developed after 4 hours of reperfusion [51,167,183,224,225,229-233]. These findings suggest that NF-κB mediates cell death, and possibly occurs within the first 4 hours of reperfusion. RNA was collected from ischemic tissue after 30 minutes of ischemia followed by 3 hours of reperfusion in both WT and

DN mice, along with WT and DN sham after 3.5 hours (section II.2.5).

150 Genes Regulated after I/R

Microarray comparison between WT I/R vs. WT Sham resulted in 444 genes (333 genes up-

regulated, and 111 genes were down-regulated after I/R) (section III.2.4). Several significantly

up-regulated genes after I/R were heat shock protein genes (e.g. dnajb1, hsp90aa1, hsp110,

hspb1, and hspa5) (section III.2.4). Our results agreed with previous studies that found several heat shock protein genes to be highly up-regulated after I/R [155,254-260].

The most significant GO-term category was response to stress. Fifty-one genes were grouped

into this category. Several of these genes included heat shock protein genes, cell death genes, and

chemokinesis genes (section III.2.4). Heat shock proteins are known to adapt the myocardium to

stress by assisting in multiple functions ranging from regulation of inflammatory cytokines,

reduction in oxidative stress, regulation of apoptosis, protein folding, and chaperone unfolded

proteins [88]. Some of the cell death genes that were up-regulated were grouped into the GO

term category response to stress, which included the genes pdia3 and ddit3, known to be

involved in endoplasmic reticulum (ER) stress and contribute to cell death [302,303]. Several

chemokine genes (e.g. ccl2/4/7 and cxcl2/5) were also grouped into the GO-term category

response to stress. Chemokines are known to be induced in the infarcted heart and contribute to inflammation and the healing processes [280]. Other significant GO term categories were the following: vasculature development (P=3.22E-09) and apoptosis (P=5.60E-08) (section III.2.4).

Several of the genes grouped into the former GO term category were related to blood vessel

development and angiogenesis. Interestingly, there were a couple genes that were down-

regulated after I/R that contribute to apoptosis: caspase-9 (casp9), programmed cell death 4

(pdcd4), bcl2/adenovirus E1B interacting protein 3-like (bnip3l), and several apoptotic genes

151 (e.g. ddit3, pdia3, hspa8, hspa1b and il-6). In summary, our results suggest that there is a set of

I/R up-regulated genes that may be involved in regulating the stress response to adapt the heart to the reperfusion injury, and another set of genes that appear to contribute to cell injury effects.

Genes Regulated by NF-κB in Response to I/R

The goal was to identify genes underlying the NF-κB-dependent cell death outcome following

I/R. Microarray comparison between WT I/R vs. DN I/R resulted in 301 genes that were

significantly up- and down-regulated by NF-κB after I/R (section III.2.5). Several heat shock

protein genes (e.g. hsp110, hspa1b, hspa1a, serpinh1, hsp90aa1, dnajb1, and hsp90ab1) were

significantly up-regulated by NF-κB (section III.2.5). Interestingly, several of these were

significantly up-regulated after I/R. These results suggest that NF-κB might be involved in the

regulation of the heat shock protein family after ischemic stress. Previous studies have shown

that hsp90aa1, hspd1 (hsp60), and hspa1b (hsp70.1) are up-regulated by NF-κB

[130,187,284,300,304-307]. It is hypothesized that NF-κB and other transcription factors (e.g.

AP-1 and HSF] might be involved in the co-regulation of heat shock proteins

[130,187,284,300,304-307]. Both AP-1 and HSF1 are activated following reperfusion

[192,226,227,308-314], which suggests the possibility that an enhanceosome complex (e.g. NF-

κB, AP-1 and HSF complex) may contribute to the expression of heat shock protein genes. Our

data supports that NF-κB is indispensable for regulation of these genes after I/R.

Significant GO-term categories were the following: response to stress, unfolded protein binding,

skeletal muscle fiber development, and chemotaxis (section III.2.5). GO-term categories response

to stress, unfolded protein binding, and chemotaxis included several genes that encode for heat

152 shock proteins or chemokines. Our results agree with previous studies showing NF-κB regulates

several stress response genes and cytokines/chemokines genes which may contribute to NF-κB

cell injury outcomes after I/R [51,252,253].

Genes Regulated after I/R and by NF-κB

The objective of this comparison (I/R-regulated genes vs. NF-κB-regulated genes) was to

identify genes that likely mediate NF-κB-dependent cell death outcome after I/R (section

III.2.6). Microarrays were used to identify genes that were significantly regulated after I/R

(section III.2.4) and genes regulated in response to I/R (section III.2.5). A comparison between

WT I/R and WT Sham resulted in 444 genes significantly up- and down-regulated after I/R

(section III.2.4). In contrast, an examination of WT I/R versus DN I/R resulted in identification

of 301 genes regulated by NF-κB following I/R (section III.2.5). Two sets of genes (I/R regulated gene set vs. NF-κB regulated gene set) were compared, which resulted in 59 genes that

are likely to underlie the NF-κB-dependent cell injurious outcomes (section III.2.6).

Out of these 59 genes, 47 were significantly up-regulated after I/R and by NF-κB included

several heat shock protein genes, transcription factor genes, chemokine genes, and cell death

genes (section III.2.6). Of the remaining 12 genes, five were significantly up-regulated after I/R,

but down-regulated by NF-κB, which included two chemokine genes: s100a8 and cxcl5 (section

III.2.6). Seven of these genes were significantly down-regulated by NF-κB and I/R. Briefly,

some of these genes were itgb1bp3, which is involved in cell differentiation [315], ramp2 is a protein that is known to mediate the calcitonin receptor [316], tcap is known to be involved in

153 heart development [317], sh2d3c is involved in cell migration [318], and ndufc1 is a

mitochondrial protein that is involved with the electron transport system (e.g. transfers electrons

from NADH to ubiquinone) [319]. Significant GO-term categories were the following: response

to stress, unfolded protein binding, protein folding, chemotaxis, and apoptosis (section III.2.6).

Our results suggest that NF-κB-mediated cell injurious outcomes after I/R may be regulated by

the pro-apoptotic genes: ddit3, pdia3, hspa1b, siah2, dded2, and phlda1 (section III.2.6).

Apoptosis is known to contribute to reperfusion injury and infarct development [51,62,65-

67,192,208]. There were several genes that were grouped into the significant GO-term category

unfolded protein binding and protein folding, suggesting that NF-κB is involved in the ER-stress pathway and regulates misfolded proteins, which may trigger cell death. Heat shock proteins are known to result in both anti and pro-apoptotic functions [52,53,131,133,167]. Our goal was achieved by the identification genes that were up- and down-regulated after I/R and by NF-κB, which may contribute to the NF-κB-dependent cell death effects. However, further validation

(e.g. QRT-PCR and functional studies using either knockout or transgenic mice) is needed to

determine if these genes contribute to NF-κB-dependent cell injurious outcomes after I/R.

IV.3.3 Genes regulated after PO and by NF-κB compared to genes regulated after I/R and

by NF-κB.

The main goal (section II.6) was to identify genes that are dysregulated (up- or down-regulated)

between the PO/NF-κB set of genes (section III.2.3) and the I/R/NF-κB set of genes (section

III.2.6). Therefore, the 16 genes up- and down-regulated after PO and by NF-κB (section III.2.3)

were compared to the 59 genes up- and down-regulated after I/R and by NF-κB (section III.2.7). 154 Our hypothesis was that NF-κB regulates different sets of genes after PO and I/R, along with

genes that are up- and down-regulated after both PO and I/R that may responded to stress stimuli

(Figure 18). Only one gene was significantly regulated (either up or down-regulated) by NF-κB

after PO and after I/R, which was hsp90aa1 (section III.2.7). The gene hsp90aa1 was up- regulated after both ischemic insults and was up-regulated by NF-κB in response to both PO and

I/R. There were two other genes, hspa1a and hspa1b that were highly up-regulated after both PO

and I/R. Interestingly, NF-κB significantly (P<0.01 and >1.5 fold change) up-regulated hspa1a

after PO and hspa1a and hspa1b after I/R. There was one gene (ndufc1) that was suggested to be

down-regulated after PO and by NF-κB and was significantly up-regulated by I/R and not up- or down-regulated by NF-κB (section III.2.7). Another gene (cxcl5) was significantly up-regulated

after both PO and I/R, but was significantly down-regulated by NF-κB in response to I/R.

However, most of the genes that were up- and down-regulated by NF-κB in response to either

PO or I/R are uniquely expressed between the two ischemic insults. For example, our results showed apoptotic genes (e.g. syvn1, ddit3, padia3, dedd2, saih2, and bag3) and ubiquitin genes

(e.g. ubb, ubc, and ubg) are up-regulated by NF-κB and I/R, but were not up- or down-regulated after PO and by NF-κB (section III.2.7). In contrast, NF-κB and PO up-regulated genes (e.g.

car3, igfbp3, and dkk3) those were not up- or down-regulated after I/R and by NF-κB in response

to I/R (section III.2.7). In contrast, there were several heat shock protein genes (e.g. hspa1a,

hspa1b, hspb1, dnajb1, and hsp110) and transcription factors (e.g. jun, fos, and nfil3) that were found to be all significantly up-regulated after both PO and I/R (section III.2.7). However, most

155 of these genes (e.g. hspb1, dnajb1, hsp110, jun and fos) were only up-regulated by NF-κB in response to I/R and not up- or down-regulated by NF-κB in response to PO (section III.2.7).

Our results suggested there is a common set of genes that are up-regulated in response to the stress stimuli (PO and I/R). However, NF-κB differentially regulates distinct sets of genes that might contribute to the NF-kB-dependent cardioprotection after PO, compared to NF-kB-

dependent cell injurious outcome after I/R. Mostly likely different sets of genes that are up- and

down-regulated by NF-κB are due to the type of ischemic injury and the kinetics of NF-κB

translocation into the nucleus as hypothesized (Figure 18). The results supported our hypothesis

that NF-κB is a major hub that regulates different sets of genes directly, and that the biological

phenomena (genes proteins) underlie the NF-κB paradox (e.g. the opposite role of NF-κB after

the different ischemic insults) (Figure 18).

Rationale for Examing hspa1a and hspa1b Genes

There are multiple genes as mentioned above that are both up- and down-regulated by NF-κB

and after PO or I/R that would be good candidates for investigation of the function of these gene

products (proteins) after ischemic insults. The main focus was to investigate the biological role

of hspa1b (Hsp70.1) and hspa1a (Hsp70.3). The gene hspa1b was one of the most significant up-

regulated genes after both ischemic insults (PO: P=1.88x10-11 and I/R: P= 4.42x10-5) and was one the most significant (P= 4.10 x10-5) up-regulated genes by NF-κB in response to I/R. In

addition, hspa1b appears to be up-regulated (P= 0.04) by NF-κB in response to PO, but failed

make the to significant cut-off (P<0.01 and >1.5 fold change, section II.6) from the array

156 analysis. The gene hspa1a was one of the most significant (PO: P=1.06x10-7) up-regulated genes

after PO; however, hspa1a was up-regulated (P=0.02) after I/R but failed to make the significant

cut-off (P<0.01 and >1.5 fold change, section II.6). NF-κB significantly up-regulated hspa1a

after PO (P=0.002) and I/R (P=1.54 x10-5).

As mentioned in the background section (section I.2.2), Hsp70 (Hsp70.1/Hsp70.3) have been

shown to be involved in the regulation of cell death [52,53,109,113-129]. For example, several

studies have shown that Hsp70 has anti-apoptotic functions [52,53,109,113-129]. In contrast, other studies have shown overexpression of Hsp70 in T-cells results in increased activity of caspase-activated DNase and cell death, suggesting that Hsp70 is required for caspase-activated

DNase cell death [52,128,129]. DeMeester et al., proposed the “heat shock paradox”, which

states that expression of heat shock proteins “before a pro-inflammatory stimulus” would protect

the cells, however, if inflammatory stimulus occurs “before heat shock protein expression” that

heat shock proteins would result in cell death [340,341]. Several groups have suggested that heat

shock proteins can result in the inhibition of NF-κB activation via inhibiting the activation of

IΚΚ and the stabilization of IκBα resulting in NF-κB inhibition [300,340-343]. Whereas, some groups suggested that heat shock protein paradox underlies the different functions of intercellular versus extracellular release of heat shock proteins [341,343].

Recent studies have suggested that heat shock proteins are released from damaged and drying cells into the extracellular space [341,343]. Hsp70 proteins do not contain a sequence for membrane targeting or localization to membrane bound vesicles for secretory pathways

[341,343]. Some studies have suggested that Hsp70 is released from lysomes and/or exosomes 157 [341,343], whereas some studies have suggested that Hsp70 can interact with

phosphatidylserine/liplid rafts to secreted Hsp70 and resulting in cell death [341,343]. Several

studies proposed that Hsp70 can bind to several inflammatory receptors (e.g. Toll-like receptors),

and binding to antigen-presenting cells (e.g T-cells), therefore increasing expression of proinflammatory cytokines [341,343]. Clinical studies have shown that extracellular hsp70 protein and anti-Hsp70 antibodies levels are increased during myocardial ischemia and in various

cardiovascular diseases [343,344]. There is a lack of information regarding the individual roles

of Hsp70.1 and Hsp70.3 following myocardial ischemia and reperfusion. Understanding the

functional and individual role of Hsp70.1 and Hsp70.3 following myocardial ischemic insults

may help explain both Hsp70 and NF-κB paradox.

IV.4 Validation of genes that were regulated after PO and I/R, and regulated

by NF-κB

Generally, microarrays results are considered to be about 70-90% accurate in identifying genes that are significantly up- and down-regulated, and in detecting the direction of expression.

Therefore, verification analysis of mRNA levels is needed to confirm microarray results

[320,321]. Further, microarrays are not completely quantitative and can under- or over-estimate

gene expression levels. QRT-PCR is considered the best tool for confirmation of microarray

results due to it’s highly sensitive and accurate quantization of mRNA [320-322]. The expression

of mRNA is not always mechanistically meaningful since the relationship between mRNA and

protein levels is variable for different genes [320]. Proteins are known to regulate cellular

processes, which are determined by location and post-translational modifications. Therefore,

158 analyses of protein levels (Western blots) and/or activities are needed [320]. Still, the expression

change in protein levels and/or activity does not establish a biological function [320]. Additional

studies using either loss or gain of function experiments are needed to establish a biological

mechanism [320].

IV.4.1 QRT-PCR Validation

PO and NF-κB genes validation

Our results suggest that 16 genes are likely to contribute to NF-κB-dependent cardioprotection after PO, which includes 8 significantly up-regulated genes after PO and by NF-κB (section

III.2.3). Out of these 8 genes, 4 (hspa1a, hsp90aa1, plscr1, and ptx3), along with hspa1b, were

validated by QRT-PCR to be significantly up-regulated after PO (section III.3.1). The mRNA

expression of plscr1, hsp90aa1, hspa1a, and hspa1b were all confirmed to be significantly up-

regulated by NF-κB, which agreed with the microarray results (section III.3.1). However, the validation of mRNA expression of ptx3 was not significantly regulated by NF-κB (section

III.3.1). There were 4 genes that were significantly down-regulated by NF-κB and after PO; one

of them was ndufc1 (section III.2.3). The mRNA expression level of ndufc1 was confirmed by

QRT-PCR to be significantly down-regulated after PO; however the QRT-PCR results suggested

that NF-κB significantly up-regulated ndufc1 after PO (section III.3.1). Out of the 16 genes, 5 of

the genes were chosen to be validated by QRT-PCR (5/16, 31% of the genes), with the additional

hspa1b being validated as well. All of the genes chosen to be validated by QRT-PCR agreed

with the microarray data expression pattern (5/5, 100%), and only one of the genes was not

shown to be regulated by NF-κB (4/5, 83.3% validation). The validation of PO microarray

159 results by QRT-PCR confirmed expression patterns of genes that were significantly up-regulated by NF-κB and after PO, and confirmed genes that were down-regulated after PO (section

III.3.1).

I/R and NF-κB Genes Validation

There were 59 genes identified by the microarrays to be significantly up- and down-regulated

after I/R and by NF-κB (section III.2.6). QRT-PCR validated hsp90aa1, hspa1a (hsp70.3) and

hspa1b (hsp70.1), which were shown to be significantly up-regulated after I/R (section III.3.1).

In contrast, hsp90aa1 was not significantly regulated by NF-κB after I/R, which disagreed with

the I/R microarray results (section III.3.1). Both hspa1a (hsp70.3) and hspa1b (hsp70.1)

expression levels were decreased by lack of NF-κB activation (DN I/R) compared to NF-κB

activation (WT I/R). These results suggest that both hsp 70 genes are influenced by NF-κB;

however, they are not significantly regulated by NF-κB (section III.3.2). Blockade of NF-κB

activation (DN I/R) resulted in a two-fold decrease in the expression of these genes compared to

WT I/R (section III.3.1). A possible reason they were not significantly regulated by NF-κB in

QRT-PCR results is due to the huge variation between samples in the WT I/R and DN I/R groups

(section III.3.1).

Further validation by QRT-PCR is needed to confirm the I/R microarray results since our results

suggest there is a significant amount of variation in gene expression levels in RNA samples. In

addition, QRT-PCR failed to validate the array results (2/59, 3% of the genes that were chosen to

be validated by QRT-PCR). Two genes, hspa1b and hsp90aa1, along with hspa1a were all

160 confirmed to be up-regulated after I/R, which agreed with the array results (section III.3.1).

However, QRT-PCR did not successfully confirm these genes (hspa1b and hsp90aa1) to be up-

regulated by NF-κB (1/2, 50%), and is more likely due to the huge variation between samples in the WT I/R and DN I/R groups. The quality of the RNA and cDNA, sex, age, reconfirmation of

genotype, and other variables were examined, which showed no trend in the variation of gene

expression levels. This suggests a possible biological variation that needs to be examined.

Expression levels of various genes were determined by microarrays and QRT-PCR to be different, which is likely due to the lack of sensitivity of the microarrays and different probes used to measure gene expression [321].

IV.4.2 Hsp70 Western Blot Validation

QRT-PCR results showed that both hspa1a (hsp70.3) and hspa1b (hsp70.1) were significantly

up-regulated after both ischemic insults, and were regulated by NF-κB (section III.3.1). Further

validatation of the molecular function of these genes was examined by using Hsp70 antibodies to

detect Hsp70 protein levels after PO and I/R (section III.3.2).

Cytoplasmic and nuclear proteins were isolated from ischemic tissues after 5 hours PO or I/R

(30min/4 hours) from WT and DN mice, and analogous tissue was isolated from WT sham,

Hsp70.1/.3 KO, and Hsp70.1 KO mice (section II.4). Western blots were used to detect Hsp70

proteins in cytoplasmic and nuclear extracts (section II.4). Hsp70 protein was detected in all

groups, including Hsp70.1/.3 KO and Hsp70.1 KO in the cytoplasmic extracts (section III.3.2).

In contrast, the nuclear extracts showed an increase in Hsp70 protein levels in both WT and DN

161 mice compared to WT sham, Hsp70.1/.3 KO and Hsp70.1 KO mice (section III.3.2). It has been

suggested that Hsp70.1 and Hsp70.3 can translocate to the nucleus during ischemia [322-325].

There are limitations in examining the two inducible heat shock proteins Hsp70.1 and Hsp70.3

levels using Western blots and antibodies. The first limitation is that Hsp70.1 and Hsp70.3 amino

acid sequences are 99% identical to each other with Hsp70.1 having one additional amino acid

near the C-terminal end; thus it is currently impossible to use Hsp70 antibodies to distinguish between the two isoforms [108,115,116]. The Hsp70 antibodies that were used were suggested to

recognize only the two inducible heat shock proteins Hsp70.1 and Hsp70.3, with a known

epitope to the amino acids 436-503 of the HeLa Hsp70 (section II.4.4). However, Hsp70 protein

was detected in the Hsp70.1/.3 KO and Hsp70.1 KO mice, as well as in our WT sham mice

cytoplasmic extract (section III.3.2). The hypothesis was that the antibody epitope might be

closely related to other constitutively expressed heat shock proteins, such as Hsc70 and Hsp1l.

Our hypothesis was based on the fact that there are several other Hsp70 protein family members

that are highly conserved and located in the cytoplasm [111,324]. For example, heat shock

protein 70 cognate (Hsc70) and heat shock protein 1, like (Hspa1l) are constitutively expressed,

located in the cytoplasm, and display a high homology (>80%) to Hsp70.1 and Hsp70.3

[111,324]. Therefore, the antibodies epitope were compared to the amino acid sequences of

Hsc70 and Hsp1L using Basic Local Alignment Search Tool (BLAST), which showed a 98%

similarity between the protein and the antibody.

Our Western blot results confirm that Hsp70 antibodies are not specific for Hsp70.1 or Hsp70.3 in the mouse heart (section III.3.2). This is due to the large amount of conservation between

162 Hsp70s and due to the fact that “Hsp70.1/70.3 specific antibodies” commercially available are highly conserved to heat shock protein 70 cognate (Hsc70) and heat shock protein 1, like

(Hspa1l) which are constitutively expressed in the heart. Therefore, it would be difficult to obtain an accurate expression level for Hsp70.1 and Hsp70.3 protein levels in the cytoplasmic and nuclear extracts. One possible way to overcome the Hsp70 antibody lack of selectivity would be creating a transgene or a recombinant protein that expressed the Hsp70.1 and Hsp70.3 with a protein epitope tag (e.g. poly-His tag or fluorescence tags) that is specific to Hsp70.1 and

Hsp70.3 and using specific antibodies that would recognize part of the protein and protein tag.

However, there are limitations expressing a transgene with the protein tag sequence or recombinant protein with a tag might alter the protein cellular localization, function, and expression levels. Our main goal is to determine the biological role of Hsp70.1 and Hsp70.3 after

PO and I/R, in which Hsp70.1/.3 KO and Hsp70.1 KO mice were used to assess the role after PO and I/R.

IV.3.3 Functional assessment of Hsp70.1 and Hsp70.3

The Role of Hsp70.1 and Hsp70.3 After PO

The role of Hsp70.1 after PO was assessed by using Hsp70.1 KO (c57) mice exposed to a 24 hours PO. This resulted in a significant increase in infarct size compared to WT (c57) mice

(section III.3.3). There were no significant differences in infarct size between the Hsp70.1 KO

(c57) and DN (c57) mice (section III.3.3). Our results suggest that Hsp70.1 is a likely contributor to the NF-κB-dependent cardioprotection observed after PO (section III.3.3). Hsp70.1/.3 KO were used to assess the role of Hsp70.3 after PO (since, the Hsp70.3 KO was unavailable to us).

The results showed that Hsp70.1/.3 KO (B129) had a significantly larger infarct compared to WT

163 (B129) mice (section III.3.3). Hsp70.1/.3 KO (B129) had a slightly smaller infarct (not

significant, P=0.06) compared to Hsp70.1 KO (c57) (section III.3.3). Our results show that

Hsp70.1 is cardioprotective. The relative contribution of Hsp70.3 after PO appears that it might

not mediate cell injury or cardioprotection after PO. Future studies are needed by using knockout

technologies (e.g. Hsp70.3 KO mice or siRNA) to examine the role of Hsp70.3 after PO.

There were significant differences in risk region between Hsp70.1 KO (c57) and WT (c57)

(section III.3.3). Sometimes the area of risk region can vary from mouse-to-mouse, which can

occur due to the specific mouse strain and other possible factors (e.g. differences in coronary branching patterns) even when the suture is placed at the same exact location [326-329].

However, the percent of infarct over left ventricle (infarct/LV) was significantly different between Hsp70.1 KO (c57) and WT (c57) with no differences in LV size observed (section

III.3.3). Therefore, the normalized infarct size still supports our conclusion that Hsp70.1

contributes to cardioprotection after PO. Our survival rate for the surgery (section III.3.3) was

between 71.4% (DN Mice) up to 88.8% (WT mice). There was no difference in the survival rate

between Hsp70.1 KO (77.7%) or Hsp70.1/.3 KO (77.7%) (section III.3.3).

The Role of Hsp70.1 and Hsp70.3 After I/R

The role of Hsp70.1 and Hsp70.3 was examined after I/R in both Hsp70.1 KO mice and

Hsp70.1/.3 KO mice (section III.3.3). The role of Hsp70.1 after I/R was assessed by using

Hsp70.1 KO (c57) mice. Our results indicated that Hsp70.1 KO had a significantly smaller infarct compared to WT (c57) control (section III.3.3). These results demonstrate that Hsp70.1

164 mediates cell death after I/R. Hsp70.1 KO (c57) mice had a slightly larger infarct, but not significantly different compared to DN (c57) mice (section III.3.3, Figure 17A). Furthermore, there was a significant difference (P<0.001) in percent of infarct/left ventricle between Hsp70.1

KO and WT (Figure 17C). There were no significant differences in percent of risk region and LV size between the WT (c57), DN (c57) and Hsp70.1 KO (c57) (Figure 17B/D). Our results suggested that Hsp70.1 contributes to the cell injurious effect after I/R.

Hsp70.1/.3 KO (B129) subjected to a 30 minute ischemia followed by 24 hours of reperfusion resulted in a significantly larger infarct compared to WT (B129) and Hsp70.1 KO (c57) (section

III.3.3, Figure 17A). However, Hsp70.1/.3 KO (B129) mice exhibited a significantly larger percent of risk region compared to WT (B129) (Figure 17B). There was also a significant increase in percent of infarct/left ventricle in Hsp70.1/.3 KO compared to WT (Figure 17C), suggesting that Hsp70.3 might be cardioprotective after I/R. However, the LV size of B129 was significantly higher compared to the Hsp70.1/.3 KO LV size (Figure 17D), therefore confounding the interpretation that Hsp70.3 might underlie cardioprotection after I/R. Future studies are needed to determine the role of Hsp70.3 after I/R. Our survival rate following I/R was between 85.7% (Hsp70.1 KO and Hsp70.1/70.3 KO mice) up to 100% (WT and DN mice)

(section III.3.3). Our results suggest there is a trend implying that Hsp70.1 KO (after PO) and

Hsp70.1/70.3 KO (after I/R) mice have a higher risk region compared to controls.

Role of Hsp70.1 and Hsp70.3

In summary, the thesis used Hsp70.1 KO and Hsp70.1/.3 KO together to assess the role of

Hsp70.1 and Hsp70.3 after acute PO and I/R in infarct development (section III.3.3). Our results

165 clearly demonstrate that Hsp70.1 contributes to cardioprotection after PO (section III.3.3). In

contrast, our results after I/R suggest that Hsp70.1 contributes to cell injury, whereas Hsp70.3

contributes to cardioprotection (section III.3.3). Previous studies from our laboratory using

Hsp70.1 KO and Hsp70.1/.3 KO after ischemic precondition (IPC) propose that Hsp70.3, not

Hsp70.1, provided cardioprotection after IPC [113].

Several studies induced heat shock in various animal models (e.g. rat, mouse, and rabbit) before

I/R resulting in a reduction of infarct size compared to controls, suggesting that heat shock

proteins (Hsp70) may prevent I/R injury [332-335]. Other studies using either transgenic mice

(Hsp70 TG), overexpressing rat inducible Hsp70 (hsp70i/hspa1a/hsp70.1), Hsp70.1 KO mice, or

Hsp70.1/.3 KO mice suggest that Hsp70.1 and Hsp70.3 provides protection following various

cerebral and myocardial ischemic insults (e.g. PO, I/R, and ischemic precondition, IPC)

[109,117,127,337-339]. However, none of these studies have used an Hsp70.1 KO or Hsp70.3

KO and Hsp70.1/.3 KO together to assess the individual roles of the two Hsp70’s. Interestingly, our results (section III.3.3) using both Hsp70.1 KO and Hsp70.1/.3 KO suggest that Hsp70.1 and

Hsp70.3 contribute to different outcomes after ischemic insults (e.g. Hsp70.1 contributes to NF-

κB-dependent cardioprotective after PO and NF-κB-dependent cell injurious after I/R, in

contrast to Hsp70.3 providing cardioprotection after I/R).

Our results are novel in showing that Hsp70.1 and Hsp70.3, despite only one amino acid difference, contribute to different outcomes after ischemic insults (section III.3.3) [113]. The mechanisms behind the differential outcomes of Hsp70.1 and Hsp70.3 are not known. Published studies have suggested that Hsp70.1 and Hsp70.3 are differentially expressed in response to

166 various stresses [114,115]. For example, Hsp70.1 mRNA levels increased more slowly and were sustained over time compared to Hsp70.3 mRNA levels, which were induced quickly and were short-lived in response to retinal photic injury [114]. Our results show that Hsp70.1 was highly expressed after both ischemic insults, and that Hsp70.3 expression levels were much lower then

Hsp70.1 (section III.3.1). One possible mechanism might be related to the kinetics and induction of Hsp70.1 and Hsp70.3 proteins. Future studies are needed to examine the other possibilities that are mentioned briefly in section IV.6.

IV.5 Thesis Summary

The objective of this thesis was to distinguish and identify NF-κB-dependent genes underlying differential effects of the NF-κB blockade upon myocardial cell death and survival after PO and

I/R. The hypothesis was that NF-κB differentially regulates distinct sets of genes that contribute to cardioprotection after PO and cell death after I/R. Our results suggest that NF-κB mediated cardioprotection occurs between 4 to 6 hours after PO, and that a significant amount of NF-κB is present in the nucleus starting at 2 hours and remaining in the nucleus up to 4 hours after PO

(section III.1). NF-κB activation occurs within 15 to 30 minutes after reperfusion and the infarct is fully established after 4 hours of reperfusion [192,208]. Gene microarray analyses were used to delineate the NF-κB-dependent genes that are associated with the likely time periods of these

NF-κB-dependent effects by using a gene expression comparison (sections II.6, III.2.3, and

III.2.6).

167 Our microarray results identified 16 genes that are likely to be involved in NF-κB-dependent

cardioprotection after PO (section III.2.3) and 59 genes that may contribute to NF-κB-dependent

cell death after I/R (section III.2.6). QRT-PCR validated that hspa1a (hsp70.3) and hspa1b

(hsp70.1) were significantly up-regulated after ischemic insults, and blockade of NF-κB resulted

in a two fold decrease in expression levels. Functional studies using Hsp70.1/.3 KO and Hsp70.1

KO after ischemic insults showed that Hsp70.3 may provide cardioprotection after I/R in contrast

to Hsp70.1, which mediated NF-κB-dependent cell death outcome after I/R (section III.3.3).

Hsp70.1 was shown to contribute to the NF-κB-dependent cardioprotection effect after PO

(section III.3.3). Our studies supported the hypothesis that NF-κB is a master switch that

regulates genes that are involved in cardioprotection after PO and also regulates genes involved

in cell death after I/R. The significance of the research was the identification of unique sets of

genes that may underlie the NF-κB paradox, and the novel results suggesting that Hsp70.1

underlies NF-κB-dependent cardioprotection after PO and NF-κB-dependent cell injurious

effects after I/R. In addition, our results are clinically relevant since extracellular Hsp70 proteins

are highly secreted during myocardial infarction, which may result in protection or increase cell

injury. Future studies are needed to examine how Hsp70.1 contributes to cardioprotective and

cell injurious outcomes following ischemic insults (section IV.6).

IV.6 Future Research Directions

The thesis results provide some details about the mechanisms underlying the NF-κB-paradox,

but also promotes several new questions, a few of which are discussed briefly. Future studies to

address these questions will enhance and extend the information obtained from this thesis.

168

1. The biggest question resulting from the thesis is: How does Hsp70.1 contribute to the

cardioprotective effect after PO and mediate cell injury following I/R? One possible

mechanism is based on the binding of Hsp70.1 to different binding partners. Hsp70 is

known to bind to several co-chaperones (e.g. Hsp110, Hsp90, Hsp40/Dnaj, Stip1, and

Bag3) [345,346]. Interestingly, Hsp70 activity is regulated by its co-chaperones. For

example, Hsp70 binding to co-chaperones (e.g. Bag3) has been proposed to form into

a complex that can result in protein degradation, while the binding of co-chaperones

(e.g. Stip1, Hsp40/Dnaj) can result in protein folding complex [345,346]. Hsp110 is

known to inhibit Hsp70/Hsc70 ATPase activity and suggested to suppress the

aggregation of denatured proteins [346]. One might want to examine Hsp70 binding

partners after I/R and PO since I/R and NF-κB up-regulated several co-chaperones

compared to PO [section III.2.7].

In addition to examining the binding partners of Hsp70.1 and Hsp70.3, it would be

beneficial to examine the location of these proteins both intercellular and extracellular

during myocardial ischemia along with the binding partners, which may determine

the location of the protein and alter its function.

2. Our results suggested that hspa1a and hspa1b are up-regulated by NF-κB and the

absence of NF-κB activation during myocardial ischemia results in a 2-3 fold

decrease in expression of these genes. These results suggested that NF-κB and other

transcription factors might be involved in the expression of these genes as mentioned

in background section (I.3) and discussion section (IV.3.2). Some of the possible

169 transcription factors are HSF1 (activated by ischemic insults), along with the

following transcription factors, Fos, Fosb, Jun, ATF3 (AP-1 subunits) and Egr1that

were up-regulated by either PO, I/R and NF-κB. Promoter analysis suggests that

hspa1a and hspa1b promoters contain NF-κB, AP-1, HSF and Egr1 binding sites. It

would be beneficial to examine the binding of NF-κB, AP-1, HSF and Egr1 binding

to the promoters during ischemic insults and compare the transcription factor

complex that binds during PO vs. I/R along with the comparison in WT and DN mice.

These experiments can be achieved by using chromatin Immunoprecipitation

techniques (ChIP).

3. The thesis results suggest that NF-κB translocation/activation is different between the

two ischemic insults. Future studies should try to address the mechanisms that result

in NF-κB translocation into the nucleus starting at 2 hours after PO, and remain in the

nucleus up to 4 hours. In contrast, after reperfusion NF-κB translocation peaks within

15 to 30 minutes and declines until the second peak starting at 3 hours after

reperfusion. One possible interesting mechanism would be examining the post-

translational modifications such as the phosphorylation of various serine amino acids

that are thought to enhance NF-κB translocation, activation, and nuclear stability

[179]. Do the post-translational modifications and different ΙκB regulators result in

different activation periods of NF-κB, and result in the formation of a unique

enhanceosome complex (binding of multiple transcription factors) that regulates a

particular set of genes?

170 4. Microarray analysis of the 16 genes that were up- and down-regulated by NF-κB and

PO suggest that hsp90aa1 and ptx3 are involved in the regulation of nitric oxide,

which is known to be cardioprotective. It would be useful to determine if nitric oxide

contributes to the NF-κB-dependent cardioprotection via Hsp90aa1 and Ptx3. The use

of nitric oxide pharmacological inhibitors and genetic models (KO mice) would be

helpful to determine if nitric oxide contributes to cardioprotection after PO. In

addition, pharmacological inhibitors and genetic models (KO mice) could be used to

assess the role of Hsp90 and Ptx3 in the production of nitric oxide. Our results have

identified three genes (car3, plscr1 and igfbp1) that are up-regulated by NF-κB and

PO. There are no previous studies examining the role of these genes after myocardial

ischemia. These genes would be interesting to follow up on since they are suggested

to regulate apoptotic cell death (section VI.3.1).

5. Interestingly, the gene ndufc1 was found to be down-regulated after PO, and

regulated by NF-κB in response to PO. In addition, ndufcl has also been shown to be

up regulated after I/R and not regulated by NF-κB in response to I/R. Ndufc1 is a

mitochondrial protein that is part of the electron transport system (e.g. transfers

electrons from NADH to ubiquinone) [319]. There is very limited information about

the gene or protein. An intriguing hypothesis is that down-regulating the gene might

be cardioprotective by decreasing the amount of electrons transferred, therefore

preventing ROS production (section I.1.5).

6. The microarray results showed 59 genes that are regulated by both NF-κB and after

I/R; however further validation (e.g. QRT-PCR, Western blots, and gain or loss of 171 functional studies) is needed to confirm other genes that contribute to the NF-κB-cell injurious effects. Genes of interest would be heat shock proteins and cell death genes that were identified from the arrays (section III.2.6)

172 References

[1] World Health Organization Cardiovascular diseases (CVDs) Fact sheet N°317 Updated

September 2009. http://www.who.int/mediacentre/factsheets/fs317/en/index.html

[2] Lloyd-Jones D, Adams R, Carnethon M, De Simone G, Ferguson TB, Flegal K, Ford E, Furie

K, Go A, et al. (2009). Heart Disease and Stroke Statistics 2009 Update: A Report From the

American Heart Association Statistical Committee and Stroke Statistics Subcommittee.

Circulation. 119:e21-e181.

[3] Gasser R, Schafhalter-Zoppoth I, Schwarz T, Eber B, Koppel H, Lechieitner P, Puschendorf

B, Diensti F, Klein W. (1995). Cyclic phenomena in early myocardial infarction. Acta Med

Austriaca. 22(4):69-72.

[4] Zacharowski K, Zacharowski P, Reingruber S, Petzelbauer P. (2006). Fibrin(ogen) and its fragments in the pathophysiology and treatment of myocardial infarction. J Mol Med. 84(6):469-

77.

[5] Murphy E, Steenbergen C. (2008). Mechanism Underlying Acute Protection From Cardiac

Ischemia-Reperfusion Injury. Physiol Rev. 88:581-609.

[6] Jennings RB, Reimer KA. (1981). Lethal myocardial ischemic injury. Am J Pathol.

102(2):241-55.

[7] Allen DG, Xiao XH. (2003). Role of the cardiac Na+/H+ exchanger during ischemia and reperfusion. Cardiovasc Res. 57(4):934-41.

[8] Slepkov ER, Rainey JK, Sykes BD, Fliegel L. (2007). Structural and functional analysis of

the Na+/H+ exchanger. Biochem J. 401(3):623-33.

173 [9] Zucchi R, Ronca F, Ronca-Testoni S. (2001). Modulation of sarcoplasmic reticulum function:

a new strategy in cardioprotection? Pharmacol Ther. 89(1):47-65.

[10] Talukder MA, Zweier JL, Periasamy M. (2009). Targeting calcium transport in ischemic

heart disease. Cardiovasc Res. 84(3):345-52.

[11] Matsumura Y, Saeki E, Otsu K, Morita T, Takeda H, Hori M, Kusuoka H. (2001).

Intercellular calcium level required for calpain activation in a single myocardial cell. J Mol Cell

Cardiol. 33(6):1133-42.

[12] Atsma DE, Bastiaanse EM, Jerzwski A, Van der Valk LJ, Van der Laarsie A. (1995). Role

of calcium-activated neutral protease (calpain) in cell death in cultured neonatal rat

cardiomyocytes during metabolic inhibition. Circ Res. 76(6):1071-8.

[13] Buja LM. (2005). Myocardial ischemia and reperfusion injury. Cardiovasc Pathol.

14(4):170-5.

[14] Jennings RB, Reimer KA. (1991). The cell biology of acute myocardial ischemia. Annu Rev

Med. 42:225-46.

[15] Reimer KA, Ideker RE. (1987). Myocardial ischemia and infarction: anatomic and

biochemical substrates for ischemic cell death and ventricular arrhythmias. Hum Pathol.

18(5):462-75.

[16] Reimer KA, Jennings RB. (1979). The "wavefront phenomenon" of myocardial ischemic cell death. II. Transmural progression of necrosis within the framework of ischemic bed size

(myocardium at risk) and collateral flow. Lab Invest. 40(6):633-44.

[17] Burke AP, Virmani R. (2007). Pathophysiology of Acute Myocardial Infarction. Med Clin N

Am. 91:553-572.

[18] Bolli R. (1990). Mechanism of myocardial “stunning”. Circulation. 82(3):723-38.

174 [19] Bolli R, Marban E. (1999). Molecular and cellular mechanisms of myocardial stunning.

Physiol Rev. 79(2):609-34.

[20] Pomblum VJ, Korbmacher B, Cleveland S, Sunderdiek U, Klocke RC, Schipke JD. (2010).

Cardiac stunning in the clinic: the full picture. Interact Cardiovasc Thorac Surg. 10(1):86-91.

[21] Ross J Jr. (1995). Myocardial hibernation, stunning, or both? Basic Res Cardiol. 90(1):41-3.

[22] Depre C, Vatner SF. (2005). Mechanisms of cell survival in myocardial hibernation. Trends

Cardiovasc Med. 15(3):101-10.

[23] Rahimtoola SH. (1994). Chronic myocardial hibernation. Circulation. 89(4):1907-8.

[24] Rahimtoola SH. (1989). The hibernating myocardium. Am Hea r t J . 117(1):211-21.

[25] Niccoli G, Burzotta F, Galiuto L, Crea F. (2009). Myocardial No-Reflow in Humans. J Am

Coll Cardiol. 54(4):281-92.

[26] Zweir JL, Flaherty JT, Weisfeldt MI. (1987). Direct measurement of free radical generation

following reperfusion of ischemic myocardium. Proc Natl Acad Sci USA. 84:1404-1407.

[27] Nayler WG, Elz JS. (1986). Reperfusion injury: laboratory artifact or clinical dilemma?

Circulation. 74(2):215-21.

[28] Hearse DJ. (1977). Reperfusion of the ischemic myocardium. J Mol Cell Cardiol. 9(8):605-

16.

[29] Nayler WG. (1983). Calcium and cell death. Eur Heart J. 4 Suppl C:33-41.

[30] Jennings RB, Reimer KA, Steenbergen C. (1986). Myocardial ischemia revisited: The

osmolar load, membrane damage, and reperfusion. J Mol Cell Cardiol. 18:769-780.

[31] Jolly SR, Kane WJ, Bailie MB, Adrams GD, Lucchesi BR. (1984). Canine myocardial reperfusion injury. Its reduction by the combined administration of superoxide dismutase and catalase. Circ Res. 54(3):277-85.

175 [32] Opie LH. (1989). Reperfusion Injury and Its Pharmacology Modification. Circulation.

80(4):1049-1062.

[33] Follette DM, Fey K, Buckberg GD, Helly JJ Jr, Steed DL, Froglia RP, Maloney JV Jr.

(1981). Reducing postischemic damage by temporary modification of reperfusate calcium, pot assium, pH, and osmolarity. J Thorac Cardiovasc Surg. 82(2):221-38.

[34] Lazar HL, Buckberg GD, Manganaro AJ, Becker H, Maloney JV Jr. (1980). Reversal of

ischemic damage with amino acid substrate enhancement during reperfusion. Surgery.

88(5):702-9.

[35] Jennings RB, Sommers HM, Smyth GA, Flack HA, Linn H. (1960). Myocardial necrosis induced by temporary occlusion of a coronary artery in the dog. Arch Pathol. 70:68-78.

[36] Allen DG, Orchard CH. (1987). Myocardial contraction function during ischemia and

hypoxia. Circ Res. 60(2):153-68.

[37] Hearse DJ. (1977). Reperfusion of the ischemic myocardium. J Mol Cell Cardiol. 9(8):605-

16.

[38] Hearse DJ, Humphrey SM, Bullock GR. (1978). The oxygen paradox and the cacium

paradox: two facets of the same problem? J Mol Cell Cardiol. 10(7):641-68.

[39] Dong Z, Saikumar P, Weinberg JM, Venkatachaiam MA. (2006). Calcium in cell injury and

death. Annu Rev Pathol. 1:405-34.

[40] Halestrap AP. (2006). Calcium, mitochondria and reperfusion injury: a pore way to die.

Biochem Soc Trans. 34(Pt 2):232-7.

[41] Hess ML, Manson NH. (1984). Molecular oxygen: friend and foe. The role of the oxygen

free radical system in the calcium paradox, the oxygen paradox and ischemia/reperfusion injury.

J Mol Cell Cardiol. 16(11):969-85.

176 [42] Hearse DJ, Chain EB. (1973). Effect of glucose on enzyme release from, and recovery of,

the anoxic myocardium. Recent Adv Stud Cardiac Struct Metab. 3:763-72.

[43] Misra MK, Sarwat M, Bhakuni P, Tuteja R, Tuteja N. (2009). Oxidative stress and ischemic

myocardial syndromes. Med Sci Monit. 15(10):RA209-219.

[44] Zhao ZQ. (2004). Oxidative stress-elicited myocardial apoptosis during reperfusion. Curr

Opin Pharmacol. 4(2):159-65.

[45] Krijnen PA, Nijmeijer R, Meijer CJ, Visser CA, Hack CE, Niessen HW. (2002). Apoptosis

in myocardial ischemia and infarction. J Clin Pathol. 55(11):801-11.

[46] Majno G, Joris I. (1995). Apoptosis, oncosis, and necrosis. An overview of cell death. Am J

Pathol. 146(1):3-15.

[47] Buja LM, Entman ML. (1998). Modes of myocardial cell injury and cell death in ischemic heart disease. Circulation. 98(14):1355-7.

[48] Clerk A, Cole SM, Cullingford TE, Harrison JG, Jormakka M, Valks DM. (2003).

Regulation of cardiac myocyte cell death. Pharmacol Ther. 97(3):223-61.

[49] Van Cruchten S, Van Den Broeck W. (2002). Morphological and biochemical aspects of

apoptosis, oncosis and necrosis. Anat Histol. Embryol. 31(4):214-23.

[50] Regula KM, Ens K, Kirshenbaum LA. (2003). Mitochondria-assisted cell suicide: a license

to kill.. J Mol Cell Cardiol. 35(6):559-76.

[51] Jones WK, Brown M, Wilhide M, He S, Ren X. (2005) NF-κΒ in Cardiovascular Disease:

Diverse and Specific Effects of a “General” Transcriptional Factor? Cardiovasc Toxicol.

5(2):183-202.

[52] Arya R, Mallik M, Lakhotia SC. (2007). Heat shock genes- integrating cell survival and

death. J Biosci. 32(3):595-610.

177 [53] Beere HM. (2005). Death versus survival: functional interaction between the apoptotic and

stress-inducible heat shock protein pathways. J Clin Invest. 115(10):2633-9.

[54] Halestrap AP, Clarke SJ, Javadov SA. (2004). Mitochondrial permeability transition pore

opening during myocardial reperfusion—a target for cardioprotection. Cardiovasc Res.

61(3):372-85.

[55] Minamino T, Kitakaze M. (2010). ER Stress in cardiovascular disease. J Mol Cell Cardiol.

48(6):1105-10.

[56] Xu C, Bailly-Maitre G, Reed JC. (2005). Endoplasmic reticulum stress: cell life and death

decisions. J Clin Invest. 115(10):2656-64.

[57] Kajstura J, Cheng W, Reiss K, Clark WA, Sonnenblick EH, Krajewski S, Reed JC, Olivetti

G, Anversa P. (1996). Apoptotic and necrotic myocyte cell deaths are independent contributing

variables of infarct size in rats. Lab Invest. 74(1):86-107.

[58] Anversa P, Cheng W, Liu Y, Leri A, Redaelli G, Kajstura J. (1998). Apoptosis and

myocardial infarction. Basic Res Cardiol. 93 Suppl 3:8-12.

[59] Fliss H, Gattinger D. (1996). Apoptosis in ischemic and reperfused rat myocardium. Circ

Res. 79(5):949-56.

[60] Bialik S, Geenen DL, Sasson IE, Cheng R, Horner JW, Evans SM, Lord EM, Koch CJ,

Kitsis RN. (1997). Myocyte apoptosis during acute myocardium infarction in the mouse localizes

to hypoxic regions but occurs independently of p53. J Clin Invest. 100(6):1363-72.

[61] Freude B, Masters TN, Robicsek F, Fokin A, Kostin S, Zimmermann R, Ulmann C,

Lorenz-Meyer S, Schaper J. (2000). Apoptosis is initiated by myocardial ischemia and executed

during reperfusion. J Mol Cell Cardiol. 32(2):197-208.

178 [62] Takashi E, Ashraf M. (2000). Pathologic assessment of myocardial cell necrosis and

apoptosis after ischemia and reperfusion with molecular and morphological markers. J Mol Cell

Cardiol. 32(2):209-24.

[63] Gottlieb RA, Burieson KO, Kloner RA, Bablor BM, Engler RL. (1994). Reperfusion injury

induces apoptosis in rabbit cardiomyocytes. J Clin Invest. 94(4):1621-8.

[64] Zhao ZQ, Nakamura M, Wang NP, Wilcox JN, Shearer S, Ronson RS, Guyton RA, Vinten-

Johansen J. (2000). Reperfusion induces myocardial apoptoticcell death. Cardiovasc Res.

45(3):651-60.

[65] Stein AB, Bolli R, Guo Y, Wang OL, Tan W, WuWJ, Zhu X, Zhu Y, Xuan YT. (2007). The

late phase of ischemic preconditioning induces a prosurvival genetic program that results in

marked attenuation of apoptosis. J Mol Cell Cardiol. 42(6):1075-85.

[66] Wang NP, Bufkin BL, Nakamura M, Zhao ZQ, Wilcox JN, Hewan-Lowe KO, Guyton RA,

Vinten-Johansen J. (1999). Ischemic preconditioning reduces neutrophil accumulation and

myocardial apoptosis. Ann Thorac Surg. 67(6):1689-95.

[67] Nakamura M, Wang NP, Zhao ZQ, Wilcox JN, Thourani V, Guyton RA, Vinten-Johansen J.

(2000). Preconditioning decreases Bax expression, PMN accumulation and apoptosis in

reperfused rat heart. Cardiovasc Res. 45(3):661-70.

[68] Yue TL, Ma XL, Wang X, Romanic AM, Liu GL, Louden C, Gu JL, Kumar S, Poste G,

Ruffolo RR Jr, Feuerstein GZ. (1988). Possible involvement of stress-activated protein kinase

signaling pathway and Fas receptor expression in prevention of ischemia/reperfusion-induced

cardiomyocyte apoptosis by carvedilol. Circ Res. 82(2):166-74.

179 [69] Piot CA, Martini JF, Bui SK, Wolfe CL. (1999). Ischemic preconditioning attenuates

ischemia/reperfusion-induced activation of caspases and subsequent cleavage of poly (ADP-

ribose) polymerase in rat hearts in vivo. Cardiovasc Res. 44(3):536-42.

[70] Kim R, Emi M, Tanabe K, Murakami S. (2006). Role of the unfolded protein response in cell death. Apoptosis. 11(1):5-13.

[71] Glembotski CC. (2008). The role of the unfolded protein response in the heart. J Mol Cell

Cardiol. 44(3):453-9.

[72] Szegezdi E, Duffy A, O’Mahoney ME, Logue SE, Mylotte LA, O’brien T, Samali A.

(2006). ER stress contributes to ischemia-induced cardiomyocytes apoptosis. Biochem Biohys

Res Commun. 349(4):1406-11.

[73] Fu HY, Minamino T, Tsukamoto O, Sawada T, Asai M, Kato H, Asano Y, Fujita M,

Takashima S, Hori M. (2008). Overexpression of endoplasmic reticulum-resident chaperone

attenuates cardiomyocytes death induced by proteasome inhibition. Cardiovasc Res. 79(4):600-

10.

[74] Pan YX, Ren AJ, Zheng J, Rong WF, Chen H, Yan XH, Wu C, Yuan WJ, Lin L. (2007).

Delayed cytoprotection induced by hypoxic preconditioning in cultured neonatal rat

cardiomyocytes: role of GRP78. Life Sci. 81(13):1042-9.

[75] Thuerauf DJ, Marcinko M, Gude N, Rubio M, Sussman MA, Glembotski CC. (2006).

Activation of the unfolded protein response in infracted mouse heart and hypoxic cultured

cardiac myocytes. Circ Res. 99(3):275-82.

[76] Shintani-Ishida K, Nakajima M, Uemura K, Yoshida K. (2006). Ischemic preconditioning

protects cardiomyocytes against ischemic injury by inducing GRP78. Biochem Biophys Res

Commun. 345(4):1600-5.

180 [77] Pan XY, Lin L, Ren AJ, Pan XJ, Chen H, Tang CS, Yuan WJ. (2004). HSP70 and GRP78

induced by endothelin-1 pretreatment enhance tolerance to hypoxia in cultured neonatal rat

cardiomyocytes. J Cardiovasc Pharmacol. 44 suppl 1:S117-20.

[78] Okudo H, Kato H, Arakaki Y, Urade R. (2005). Cooperation of ER-60 and BiP in the

oxidative refolding of denatured proteins in vitro. J Biochem. 138(5):773-80.

[79] Xu D, Perez RE, Rezaiekhaligh MH, Bourdi M, Trung WE. (2009). Knockdown of Erp57

increases BiP/GRP78 induction and protects against hyperoxia and tunicamycin-induced apoptosis. Am J Physiol Lung Cell Mol Physiol. 297(1):L44-51.

[80] Ferreira LR, Norris K, Smith T, Hebert C, Sauk JJ. (1996). Hsp47 and other ER-resident molecular chaperones form heterocomplexes with each other and with collagen type IV chains.

Connect Tissue Res. 33(4):265-73.

[81] Ferreira LR, Norris K, Smith T, Hebert C, Sauk JJ. (1994). Association of Hsp47, Grp78,

and Grp94 with procollagen supports the successive or coupled action of molecular chaperones.

J Cell Biochem. 56(4):518-26.

[82] Tsuchimochi K, Yagishita N, Yamasaki S, Amano T, Kato Y, Kawahara K, Aratani S, et al.

(2005). Identification of a crucial site for synoviolin expression. Mol Cell Biol. 25(16):7344-56.

[83] Kaneko M, Ishiguro M, Nilnuma Y, Uesugi M, Nomura Y. (2002). Human HRD1 protects

against ER stress-induced apoptosis through ER-associated degradation. FEBS Lett. 532(1-

2):147-52.

[84] Qi X, Okuma Y, Hosoi T, Kaneko M, Nomura Y. (2004). Induction of murine HRD1 in experimental cerebral ischemia. Brian Res Mol Brain Res. 130(1-2):30-8.

[85] Ritossa F. (1996). Discovery of the heat shock response. Cell Stress Chaperones. 1(2):97-

98.

181 [86] Ritossa F. (1962). A new puffing pattern induced by temperature shock and DNP in

Drosphila. Experientia. 18:571-573.

[87] Tousi-Shamaei A, Halcox JP, Henderson B. (2007). Stressing the obvious? Cell stress and cell stress proteins in cardiovascular diseases. Cardiovascular Research. 74:19-28.

[88] Benjamin IJ, McMillan R. (1998). Stress (Heat Shock Proteins) Molecular Chaperones in

Cardiovascular Biology and Disease. Circ Res. 83:117-132.

[89] Craig EA. (1985). The heat shock response. Crit Rev Biochem. 18:239-80.

[90] Chen B, Piel WH, Gui L, Bruford E, Monteiro A. (2005). The HSP90 family of genes in human genome: Insights into their divergence and evolution. Genomics. 86:627-637.

[91] Krone PH, Sass JB. (1994). Hsp90a and Hsp90b genes are present in the zebrafish and are

differentially regulated on developing embryos. Biochem. Biophys. Res. Commun. 204:746-752.

[92] Csermely P, Schaider T, Soti C, Prohaszka G, Nardai G. (1998). The 90-kDa molecular

chaperone family: Structure, function, and clinical applications. A comprehensive review.

Pharmacol. Ther. 79:129-168.

[93] Rebbe NF, Ware J, Bertina RM, Modrich P, Stafford DW. (1987). Nucleotide sequence of a

cDNA for a member of the human 90-kDa heat-shock protein family. Gene. 53:235-245.

[94] Hoffmann T, Hovemann B. (1988). Heat-shock proteins, Hsp84 and Hsp86, of mice and men: Two related genes encode formerly identified tumor-specific transplantation antigens.

Gene. 74(2)491-501.

[95] DeZwaan DC, Freeman BC. (2008). HSP90 The Rosetta stone for cellular protein

dynamics? Cell Cycle. 7(8):1006-1012.

[96] Jiao JD, Garg V, Yang B, Hu K. (2008). Novel functional role of heat shock protein 90 in

ATP-sensitive K+ channel-mediated hypoxic preconditioning. Cardiovasc Res. 77(1):126-33.

182 [97] Shi Y, Hutchins W, Ogawa H, Chang GC, Pritchard KA Jr, Zhang C, Khampang P, Lazar J,

Jacob HJ, Raflee P, Baker JE. (2005). Increased resistance to myocardial ischemia in the Brown

Norway vs. Dahl S rat: role of nitric oxide synthase and Hsp90. J Mol Cell Cardiol. 38(4):625-

35.

[98] Wei Q, Xia Y. (2005). Roles of 3-phosphoinositide-dependent kinase 1 in the regulation of

endothelial nitric-oxide synthase phosphorylation and function by heat shock protein 90. J Biol

Chem. 280(18):10861-6.

[99] Chen JX, Meyrick B. (2004). Hypoxia increases Hsp90 binding to eNOS via PI3K-Akt in

porcine coronary artery endothelium. Lab Invest. 84(2):182-90.

[100] Yoshida M, Xia Y. (2003). Heat shock protein 90 as an endogenous protein enhancer of inducible nitric-oxide synthase. J Biol Chem. 278(38):36953-8.

[101] Rodriguez-Sinovas A, Boengier K, Cabestrero A, Gress P, Morente M, Ruiz-Meana M,

Miro E, Totzeck A, Heusch G, Schulz R, Garcia-Dorado D. (2006). Translocation of connexin

43 to the inner mitochondrial membrane of cardiomyocytes through the heat shock protein 90-

dependent TOM pathway and its importance for cardioprotection. Circ Res. 99(1):93-101.

[102] Daugaard M, Rohde M, Jaattela M. (2007). The heat shock protein 70 family: Highly

homologues proteins with overlapping and distinct functions. FEBS Lett. 581:3702-3710.

[103] Lindquist S, Craig EA. (1988). The heat shock proteins. Ann. Rev. Genet. 22:631-677.

[104] Gupta RS, Singh B. (1994). Phylogenetic analysis of 70 kD heat shock protein sequences

suggests a chimeric origin for the eukaryotic cell nucleus. Curr. Biol. 4:1104-1114.

[105] Hunt C, Morimoto R. (1985). Conserved features of eukaryotic hsp70 genes relieved by

comparison with the nucleotide sequence of human hsp70. Proc. Natl. Acad. Sci. USA. 82:6455-

6459.

183 [106] Tavaria M, Gabriele TK, Kola I, Anderson RL. (1996). A hitchhicker’s guide to human

Hsp70 family. Cell Stress Chaperon. 1:23-28.

[107] Bukau B, Weissman J, Horwich A. (2006). Molecular charperones and protein quality

control. Curr. Biol. 8:393-405.

[108] Hartl FU. (1996). Molecular chaperones in cellular protein folding. Cell. 125:443-451.

[109] Lee SH, Kim M, Yoon BW, Kim YJ, Ma SJ, Roh JK, Lee JS, Seo JS. (2001). Targeted

hsp70.1 Disruption Increases Infarction Volume After Focal Cerebral Ischemia in Mice. Stroke.

32:2905-2912.

[110] Gorzowski JJ, Eckerley CA, Halgren RG, Mangurten AB, Phillips B. (1995). Methylation-

associated Transcriptional Silencing of the Major Histocompatibility Complex-linked hsp70

Genes in Mouse Cell Lines. JBC. 45(10):26940-26949.

[111] Milner CM, Campbell DR. (1990). Structure and expression of the three MHC-linked

HSP70 genes. Immunogenetics. 32:242-251.

[112] Wu B, Hunt C, Morimoto R. (1985). Structure and Expression of the Human Gene

Encoding Major Heat Shock Protein. Mol. Cell. Biol. 5(2):330-341.

[113] Tranter M, Ren X, Wilhide ME, Chen J, Sartor M, Medvedovic M, WK Jones. (2010).

Gene Microarray Identification of NF-κB-driven cardioprotective gene programs; Hsp70.3 but

not Hsp70.1 contributes to cardioprotection after Late Ischemic Preconditioning. J Mol Cell

Cardiol. Submitted

[114] Kim JH, Kim JH, Yu YS, Jeong SM, Kim KW. (2005). Protective effect of heat shock

proteins 70.1 and 70.3 on retinal photic injury after systemic hyperthermia. Korean J ophthamol.

19(2):116-21.

184 [115] Lee JS, Seo JS. (2002). Differential expression of two stress-inducible hsp70 genes by various stressors. Exp Mol Med. 34(2):131-6.

[116] Shim EH, Kim J 2nd, Bang ES, Heo JS, Lee JS, Kim EY, Lee JE, Park WY, Kim SH,

Smithies O, et al. (2002). Target disruption of hsp70.1 sensitizes to osmotic stress. EMBO

Reports 3(9):857-861.

[117] Hampton CR, Shimamoto A, Rothnie CL, Griscavage-Ennis J, Chong A, Dix DJ, Verrier

ED, Pohlman TH. (2003). HSP70.1 and -70.3 are required for late-phase protection induced by ischemic mouse hearts. Am J Phsyiol Heart Circ Physiol. 285(2):H866-74.

[118] Kim YK, Suarez J, McDonough PM, Boer C, Dix DJ, Dillman WH. (2006). Deletion of

the inducible 70-kDa heat shock protein genes in mice impairs cardiac contractile function and

calcium handing associated with hypertrophy. Circulation. 113(22):2589-97.

[119] Trost SU, Omens JH, Karlon WJ, Meyer M, Mestril R, Covell JW, Dillmann WH. (1998).

Protection against myocardial dysfunction after a brief ischemic period in transgenic mice of the heart to ischemic injury. J Clin Invest. 101:855-862.

[120] Marber MS, Mestrill R, Chi SH, Sayen MR, Yellon DM, Dillmann WH. (1995).

Overexpression of the rat inducible 70-kD heat strss protein in a transgenic mouse increases the resistance of the heart to ischemic injury. J Clin Invest 95:1446-1456.

[121] Plumier JC, Ross BM, Currie RW, Angelidis CE, Kazlaris H, Kollias G, Pagoulatos GN.

(1995). Transgenic mice expressing the human heat shock protein 70 have improved post-

ischemic myocardial recovery. J Clin Invest. 95:1854-1860.

[122] Okubo S, Wildner O, Shah MR, Chelliah JC, Hess ML, Kukreja RC. (2001). Gene transfer

of heat-shock protein 70 reduces infarct size in vivo after ischemia/reperfusion in the rabbit heart.

Circulation. 103:877-881.

185 [123] Mestril R, Giordano FJ, Conde AG, Dillmann WH. (1996). Adenovirus-mediated gene

transfer of a heat shock protein 70 (hsp 70i) protects against simulated ischemia. J Mol Cell

Cardiol. 28:2351-2358.

[124] Zheng Z, Kim JY, Ma H, Lee JF, Yenari MA. (2008). Anti-inflammatory effects of the 70 kDa heat shock protein in experimental stroke. J Cereb Blood Flow Metab. 28(1):53-63.

[125] Matsumori Y, Northington FJ, Hong SM, Kayama T, Sheldon RA, Vexler ZS, Ferriero

DM, Weinstein PR, Liu J. (2006). Reduction of caspase-8 and -9 cleavage is associated with increased c-FLIP and increased binding of Apraf-1 and Hsp70 after neonatal hypoxia/ischemic

injury in mice overexpressing Hsp70. Stroke. 37(2):507-12.

[126] Tsuchiya D, Hong S, Matsumori Y, Shiina H, Kayama T, Swanson RA, Dillman WH, Liu

J, Panter SS, Weinstein PR. (2003). Overexpression of rat heat shock protein 70 is associated

with reduction of early mitochondrial cytochrome C release and subsequent DNA fragmentation

after permanent focal ischemia. J Cereb Blood Flow Metab. 23(6):718-27.

[127] Lee SH, Kwon HM, Kim YJ, Lee KM, Yoon BW. (2004). Effects of hsp70.1 gene knockout on the mitochondrial apoptotic pathway after focal cerebral ischemia. Stroke.

35(9):2195-9.

[128] Liu QL, Kishi H, Ohtsuka K, Muraguchi A. (2003). Heat shock protein 70 binds caspase-

activated DNase and enchances its activity in TCR-stimulated T cells. Blood. 102(5):1788-96.

[129] Liossis SN, Ding XZ, Kiang JG, Tsokos GC. (1997). Overexpression of the heat shock

protein 70 enhances the TCR-CD-3 and Fas/Apo-1/CD95-mediated apoptotic cell death in Jurkat

T cells. J Immunol. 158(12):5688-75.

[130] Wang Y, Chen L, Hagiwara N, Knowlton AA. (2010). Regulation of heat shock protein 60 and 72 expression in the failing heart. J Mol Cell Cardiol. 48(2):360-6.

186 [131] Gupta S, KnowltonAA. (2002). Cytosolic heat shock protein 60, hypoxia and apoptosis.

Circulation. 106(21):2727-33.

[132] Kirchhoff SR, Gupta S, KnowltonAA. (2002). Cytosolic heat shock protein 60, apoptosis,

and myocardial injury. Circulation. 105(24):2899-904.

[133] Gupta S, KnowltonAA. (2005). HSP60, Bax, apoptosis and the heart. J Cell Mol Med.

9(1):51-8.

[134] Knowlton AA, Srivatsa U. (2008). Heat-shock protein 60 and cardiovascular disease a

paradoxical role. Future Cardiol. 4(2):151-61.

[135] Frangogiannis NG, Smith CW, Entman ML. (2002). The inflammatory response in myocardial infarction. Cardiovasc Res. 53(1):31-47.

[136] Nian M, Lee P, Khaper N, Liu P. (2004). Inflammatory cytokines and postmyocardial

infarction remodeling. Circ Res. 94(12):1543-53.

[137] Herskowitz A, Choi S, Ansari AA, Wesserlingh S. (1995). Cytokine mRNA expression in postischemic/reperfused myocardium. Am J Pathol. 146(2):419-28.

[138] Deten A, Volz HC, Briest W, Zimmer HG. (2002). Cardiac cytokine expression is

upregulated in the acute phase after myocardial infarction. Experimental studies in rats.

Cardiovasc Res. 55(2):329-450.

[139] Deten A, Volz HG, Briest W, Zimmer HG. (2003). Differential cytokine expression ion myocytes and non-myocytes after myocardial infarction in rats. Mol Cell Biochem. 242(1-2):47-

55.

[140] Kukielka GL, Youker KA, Michael LH, Kumar AG, Ballantyne CM, Smith CW, Entman

ML. (1995). Role of early reperfusion in the induction of adhesion molecules and cytokines in

previously ischemic myocardium. Mol Cell Biochem. 147(1-2):5-12.

187 [141] Nakano M, Knowlton AA, Dibbs Z, Mann DL. (1998). Tumor Necrosis factor-alpha confers resistance to hypoxic injury in the adult mammalian cardiac myocyte. Circulation.

97(14):1392-400.

[142] Bergmann MW, Loser P, Dietz R, von Harsdorf R. (2001). Effect of NF-kappa B

inhibition on TNF-alpha-induced apoptosis and downstream pathways in cardiomyocytes. J Mol

Cell Cardiol. 33(6):1223-32.

[143] Higuchi Y, Otsu K, Nishida K, Hirotani S, Nakayama H, Yamaguchi O, Matsumura Y,

Ueno H, Tada M, Hori M. (2002). Involvement of reactive oxygen species-mediated NF-kappa B

activation in TNF-alpha-induced cardiomyocytes hypertrophy. J Mol Cell Cardiol. 34(2):233-40.

[144] Dhingra S, Sharma AK, Arora RC, Siezak J, Singal PK. (2009). IL-10 atteniates TNF-

alpha-induced NF KappaB pathway activation and cardiomyocytes apoptosis. Cardiovasc Res.

82(1):59-66.

[145] Hamid T, Gu Y, Ortines RV, Bhattacharya C, Wang G, Xuan YT, Prabhu SD. (2009).

Divergent tumor necrosis factor receptor-related remodeling responses in heart failure: role of

nuclear factor-kappaB and inflammatory activation. Circulation. 119(10):1386-97.

[146] Kurrelmeyer KM, Michael LH, Baumgarten G, Taffet GE, Peschon JJ, Sivasubramanian

N, Entman ML, Mann DL. (2000). Endogenous tumor necrosis factor protects the adult cardiac myocyte against ischemic-induced apoptosis in a murine model of acute myocardial infarction.

Proc Natl Acad Sci USA. 97(10):5456-61.

[147] Maekawa N, Wada H, Kanda T, Niwa T, Yamada Y, Saito K, Fujiwara H, Sekikawa K,

Seishima M. (2002). Improved myocardial ischemia/reperfusion injury in mice lacking tumor

necrosis factor-alpha. J Am Coll Cardiol. 39(7):1229-35.

188 [148] Li CL, Jiang J, Fan QY, Fu GS, Wang JA, Fan VM. (2009). Knockout of the tumor

necrosis factor a receptor 1 gene can up-regulate erythropoietin receptor during myocardial ischemia-reperfusion. Chin Med J. 122(5):566-70.

[149] Flaherty MP, Guo Y, Tiwari S, Rezazadeh A, Hunt G, Sanganalmarth SK, Tang XL, Bolli

R, Dawn B. (2008). The role of TNF-a receptors p55 and p75 in acute myocardial

ischemia/reperfusion injury and late preconditioning. J Mol Cell Cardiol. 45(6):735-41.

[150] Manukhina EB, Downey HF, Mallet RT. (2006). Role of nitric oxide in cardiovascular adaptation to intermittent hypoxia. Exp Biol Med. 231(4):343-65.

[151] Wright KL, Ward SG. (2000). Interactions between phosphatidlylinositol 3-kinase and nitric oxide: explaining the paradox. Mol Cell Biol Res Commum. 4(3):137-43.

[152] Takimoto Y, Aoyama T, Keyamura R, Shinoda E, Hattori R, Yui R, Sasayama S. (2000).

Differential expression of three types of nitric oxide synthesis in both infracted and non- infracted heart left ventricles after myocardial infarction in the rat. Int J Cardiol. 76(2-3):135-

145.

[153] Zweier JL, Samouilov A, Kuppusamy P. (1999). Non-enzymatic nitric oxide synthesis in biological systems. Biochim Biophys Acta. 1411(2-3):250-62.

[154] Kitakaze M, Node K, Takashima S, Asanuma H, Asakura M, Sanada S, Shinozaki Y, Mori

H, Sato H, Kuzuya Tm, Hori M. (2001). Role of cellular acidosis in production of nitric oxide in canine ischemic myocardium. J Mol Cell Cardiol. 33(9):1727-37.

[155] Simkhovich BZ, Kloner RA, Poizat C, Marjoram P, Kedes L. (2003) Gene expression

profiling- a new approach in the study of myocardial ischemia. Cardiovascular Pathology

12:180-185.

189 [156] Piacentini L. Karliner JS. (1999). Altered gene expression during hypoxia and

reoxygenation of the heart. Pharmacol Ther. 83(1):21-37.

[157] Holmberg CI, Tran SE, Eriksson JE, Sistonen L. (2002). Multiple phosphorylation

provides sophisticated regulation of transcription factors. Trends Biochem Sci. 27(12):619-27.

[158] Hai T, Curran T. (1991). Cross-family dimerization of transcription factors Fos/Jun and

ATF/CREB alters DNA binding specifitciy. Proc Natl Acad Sci USA. 88(9):3720-4.

[159] Persengiev SP, Green MR. (2003). The role of ATF/CREB family members in cell growth, survival and apoptosis. Apoptosis. 8(3):225-8.

[160] Glimcher LH. (2010). XBP1: the last two decades. Ann Rheum Dis. 69 Suppl:1:i67-71.

[161] Clauss IM, Chu M, Zhao JL, Glimcher LH. (1996). The basic domain/leucine zipper

protein hXBP-1 preferentially binds to and transactivates CRE-like sequences containing anm

ACGT core. Nucleic Acids Res. 24(10):1855-64.

[162] Pols T, Bonta Pi, de Vries CJ (2008). NR4A nuclear orphan receptors: protective in vascular disease. Curr Opin Lipidol. 18(5):515-20.

[163] Zhang XK. (2007). Targeting Nur77 translocation. Expert Opin Ther Targets. 11(1):69-

79.

[164] Cowell IG. (2002). E4BP4/NFIL3, a PAR-related bZIP factor with many roles. Bioessays.

24(11):1023-9.

[165] Hogan PG, Chen L, Nardone J, Rao A. (2003). Transcriptional regulation by calcium,

calcineurin, and NFAT. Genes Dev. 17(18):2205-32.

[166] Serfling E, Bererich-Siebelt F, Avots A, Chuvpilo S, Klein-Hessing S, Jha MK, Kondo E,

Pagel P, Schulze-Luehrmann J, Palmetshofer A. (2004). NFAT and NF-kappaB factors-the distant relatives. Int J Biochem Cell Biol. 36(7):1166-70.

190 [167] Jones WK, Brown M, Ren X, He S, McGuinness M. (2003). NF-κB as an Integrator of

Diverse Signaling Pathways: The Heart of Myocardial Signaling? Cardiovasc Toxicol. 3:229-

253.

[168] Baldwin A Jr. (1996). THE NF-κB AND IκB PROTEINS: New Discoveries and Insights.

Annu. Rev. Immunol. 14:649-81.

[169] Sen R, Baltimore D. (1986). Multiple nuclear factors interact with the immunoglobulin enhancer sequences. Cell. 46:705-16.

[170] Baeuerle P, Baltimore D. (1988). IkB: a specific inhibitor of the NF-κB transcription

factor. Science. 242:540-46.

[171] Sen R, Baltimore D. (1986). Inducibility of κ immunoglobulin enhancer-binding protein

NF-κB by a post-translational mechanism. Cell. 47:921-28.

[172] Parry G, Mackman N. (1994). A set of inducible genes expressed by activated human

monocytic and endothelial cells contain κB-like sites that specifically bind c-Rel-p65

heterodimers. J. Biol. Chem. 269:20,823-25.

[173] Gilmore TD. (2005). Introduction of NF-κB: players, pathways, perspectives. Oncogene.

25:6680-6684.

[174] Baeuerle P, Henkel T. (1994). Function and activation of NF-κB in the immune system.

Annu. Rev. Immunol. 12:141-79.

[175] Siebenlist U, Franzoso G, Brown K. (1994). Structure, regulation and function of NF-κB.

Annu. Rev. Immunol. 10:405-55.

[176] Beg A, Baldwin A. (1993). The IκB proteins: multifunctional regulators of Rel/NF-κB transcriptional factors. Genes Dev. 7:2051,l64-70.

191 [177] Sun SC, Ley SC. (2008). New insights into NF-κB regulation and function. Trends in

Immunology. 29(10):469-478.

[178] Beinke S, Lay SC. (2004). Functions of NF-κB1 and NF-κB2 in immune cell biology.

Biochem. J. 382:393-409.

[179] Perkins ND. (2006). Post-translational modifications regulating the activity and function of

the nuclear factor kappa B pathway. Oncogene. 25:6717-6730.

[180] Hall G, Hasday J, Rogers TB. (2006). Regulating the regulator: NF-κB signaling in heart. J

Mol Cell Cardiol. 41:580-591.

[181] Dawn B, Xuan YT, Marian M, Flaherty MP, Murphree SS, Smith TL, Bolli R, Jones WK.

(2001). Cardiac-specific Abrogation of NF-KappaB activation in mice by transdominant expression of a mutant Ikappa-Balpha. J Mol Cell Cardiol. 33:161-173.

[182] Misra A, Haudek SB, Knuefermann P, Vallejo JG, Chen ZJ, Michael LH,

Sivasubramanian N, Olson EN, Entman ML, Mann DL. (2003). Nuclear factor-kappaB protects

the adult cardiac myocyte against ischemia-induced apoptosis in a murine mode of acute

myocardial infarction. Circulation. 108(25):3075-3078.

[183] Brown M, McGuiness M, Wright T, Ren X, Wang Y, Boivin GP, Hahn H, Feldman AM,

Jones WK. (2005). Cardiac-specific blockade of NF-kappaB in cardiac pathophysiology:

differences between acute and chronic stimuli in vivo. Am J Physiol Heart Circ Physiol.

289(1):H466-76.

[184] Mustapha S, Kirshner A, De Moissac D, Kirshenbaum LA. (2000). A direct requirement of

nuclear factor-kappa B for suppression of apoptosis in ventricular myocytes. Am J Physiol Heart

Circ Physiol. 279(3):H939-45.

192 [185] Baetz D, Regula KM, Ens K, Shaw J, Kothari S, Yurkova N, Krishenbaum LM. (2005).

Nuclear factor-kappaB-mediated cell survival involves transcriptional silencing of the

mitochondrial death gene BNIP3 in ventricular myocytes. Circulation. 112(24):3777-85.

[186] Haudek SB, Bryant DD, Giroir BP. (2001). Differential regulation of myocardial NF kappa

B following acute or chronic TNF-alpha expression. J Mol Cell Cardiol. 33:1263-1271.

[187] Nakano M, Knowlton AA, Dibbs Z, Mann DL. (1998). Tumor Necrosis factor-alpha

confers resistance to hypoxic injury in the adult mammalian cardiac myocyte. Circulation.

97(14):1392-400.

[188] Nakamura K, Fushimi K, Kouchi H, Mihara K, Miyazaki M, Ohe T, Namba M. (1998).

Inhibitory effects of antioxidants on neonatal rat cardiac myocytes hypertrophy induced by tumor

necrosis factor-alpha and angiotensin II. Circulation. 98(8):794-9.

[189] Matsui H, Ihara Y, Fujio Y, Kunisada K, Akira S, Kishimoto T, Yamauchi-Takihara K.

(1999). Induction of interleukin (IL)-6 by hypoxia is mediated by nuclear factor (NF)-kappa B and NF-IL6 in cardiac myocytes. Cardiovasc Res. 42(1):104-12.

[190] Regula KM, Baetz D, Kirshenbaum LA. (2004). Nuclear factor-kappaB represses hypoxia-

induced mitochondrial defects and cell death of ventricular myocytes. Circulation.

110(25):3795-802.

[191] Bergmann MW, Loser P, Dietz R, von Harsdorf R. (2001). Effect of NF-kappa B

inhibition on TNF-alpha-induced apoptosis and downstream pathways in cardiomyocytes. J Mol.

Cell Cardiol. 33(6):1223-32.

[192] Maulik N, Sasaki H, Addya S, Das DK. (2000). Regulation of cardiomyocyte apoptosis by

redox-sensitive transcription factors. FEBS Lett. 485(1):7-12.

193 [193] Beiosjorow S, Bolle I, Duschin A, Heusch G, Schulz R. (2003). TNF-alpha antibodies are

as effective as ischemic preconditioning in reducing infarct size in rabbits. Am J Physiol Heart

Circ Physiol. 284(3):H927-30.

[194] Morishita R, Sugimoto T, Aoki M, Kida I, Tomita N, Moriguchi A, Maeda K, Sawa Y,

Keneda Y, Higaki J, Ogihara T. (1997). In vivo transfection of cis element “decoy” against

nuclear factor kappa-B binding site prevents myocardial infarction. Nat Med. 3(8):894-899.

[195] Irem SO, Eyer CL, Smith JR, Anderson AC. (1991). Protective effects of selected

sulfhydryl containing compounds against global ischemia in isolated perfused rat hearts. Proc

West Pharmacol Soc.

[196] Sawa Y, Morishita R, Suzuki K, Kagisaki K, Kaneda Y, Maeda K, Kadoba K, Matsuda H.

(1997). A novel strategy for myocardial protection using in vivo transfection of cis element

'decoy' against NFkappaB binding site: evidence for a role of NFkappaB in ischemia-reperfusion

injury. Circulation. 96(Suppl):II-280-4.

[197] Kim JW, Jin YC, Kim YM, Rhie S, Kim HJ, Seo HG, Lee JH, Ha LY, Chang KC. (2009).

Daidzein administration in vivo reduces myocardial injury in a rat ischemia/reperfusion model by

inhibiting NF-kappaB activation. Life Sci. 84(7-8):227-34.

[198] Meili-Butz S, Niermann T, Fasler-Kan E, Barbosa V, Butz N, John D, Brink M, Buser PT,

Zaugg CE. (2008). Dimethyl fumarate, a small molecule drug for psoriasis, inhibits Nuclear

Factor-kappa B and reduces myocardial infarct size in rats. Eur J Pharmacol. 586(1-3):251-8.

[199] Moss NC, Stansfield WE, Willis MS, Tang RH, Selzman CH. (2007). IKKbeta inhibition attenuates myocardial injury and dysfunction following acute ischemia-reperfusion injury. Am J

Physiol Heart Circ Physiol. 293(4):H2248-53.

194 [200] Onai Y, Sazuki J, Kakuta T, Maejima Y, Haraguchi G, Fukasawa H, Muto S, Itai A, Isobe

M. (2004). Inhibition of IKappaB phosphorylation in cardiomyocytes attenuates myocardial

ischemia/reperfusion injury. Cardiovasc Res. 63(1):51-9.

[201] Squadrito F, Deodato B, Squadrito G, Seminara P, Passaniti M, Venuti FS, Giacca M,

Minutoli L, Adamo EB, Beliomo M, Marini R, Galeano M, Marini H, Altavila D. (2003). Gene transfer of IkappaB alpha limits infarct size in a mouse model of myocardial ischemia- reperfusion injury. Lab Invest. 83(8):1097-104.

[202] Pye J, Ardeshirpour F, McCain A, Bellinger DA, Merricks E, Adams J, Elliott PJ, Pien C,

Fischer TH, Baldwin AS Jr, Nichols TC. (2003). Proteasome inhibition ablates activation of NF-

kappa B in myocardial reperfusion and reduces reperfusion injury. Am J Physiol Heart Circ

Physiol. 284(3):H919-26.

[203] Biagini G, Sala D, Zini I. (1995). Diethyldithiocarbamate, a superoxide dismutase

inhibitor, counteracts the maturation of ischemic-like lesions caused by endothelin-1 intrastriatal

injection. Neurosci. Letter. 190(3):212-6.

[204] Frantz S, Tilmanns J, Kuhienocordit PJ, Schmidt I, Adamek A, Dienesch C, Thum T,

Gernodakis S, Ertl G, Bauewrsachs J. (2007). Tissue-specific effects of nuclear factor kappaB subunit p50 on myocardial ischemia-reperfusion injury. Am J Pathol. 171(5):507-12.

[205] REVISED GUIDE FOR THE CARE AND USE OF LABORATORY ANIMALS NIH

GUIDE, Volume 25, Number 28, August 16, 1996.

[206] Hunt CR, Dix DJ, Sharma GG, Pandita RK, Gupta A, Funk M, Pandita TK. (2004).

Genomic Instability and Enhanced Radiosensitivity in Hsp70.1- and Hsp70.3-Deficient Mice.

Mol Cell Biol. 24(2):889-911.

195 [207] Ren X, Wang Y, Jones WK. (2004). TNF-alpha is required for late ischemic

preconditioning but not for remote preconditioning of trauma. J. Surg. Res 121:120-129.

[208] Guo Y, Jones WK, Xuan YT, Tang XL, Bao W, Wu WJ, et al. (1999). The late phase of

ischemic preconditioning is abrogated by targeted disruption of the inducible NO synthase gene.

Proc Natl Acad Sci USA. 96:11507–11512.`

[209] Fishbein MC, Meerbaum S, Rit J, Lando U, Kanmatsuse K, Mercier JC, et al. (1981).

Early phase acute myocardial infarct size quantification: validation of the triphenyl tetrazolium

chloride tissue enzyme staining technique. Am Hea r t J . 101:593–600.

[210] Dansithong W, Wolf CM, Darkar P, Paul S, Chiang A, Holt I, Morris GE, Branco D,

Sherwood MC, Comai L, Berul CI, Reddy S. (2008). Cytoplamsmic CUG RNA Foci Are

Insufficient to Elicit Key DM1 Features. PLoS ONE. 3(12):e3968.

[211] Higuchi Y, Chan TO, Brown MA, Zhang J, DeGeorge BR, Funakoshi H, Gibsion G,

McToiernan CF, Kubota T, Jones WK, Feldman AM. (2006). Cardioprotection afforded by NF-

κB ablation is associated with activation of Akt in mice overexpressing TNF-α. Am J Physiol

Heart Circ Physiol. 290:590-598.

[212] Van Gelder RN, von Zastrow ME, Yool A, Dement WC, Barchas JD, Eberwine JH.

(1990). Amplified RNA synthesized from limited quantities of heterogeneous cDNA. Proc Natl

Acad Sci U S A. 87:1663-1667.

[213] DeRisi J, Penland L, Brown PO, Bittner ML, Meltzer PS, Ray M, Chen Y, Su Ya, Trent

JM. (1996). Use of a cDNA microarray to analyse gene expression patterns in human cancer. Nat

Genet. 14:457-460.

[214] Hegde P. Qi R, Abernathy K, Gay C, Dharap S, Gaspard R, Hughes JE, Snesrud E, Lee N,

Quackenbush J. (2000). A concise guide to cDNA microarray analysis. Biotechniques. 29:548-

196 550.

[215] Sartor M, Schwanekamp J, Halbleib D, Mohamed I, Karyala S, Medvedovic M, Tomlinson

CR. (2004). Microarray results improve significantly as hybridization approaches equilibrium.

Biotechniques. 36:790-796.

[216] Smyth GK. (2004). Linear models and empirical bayes methods for assessing differential

expression in microarray experiments. Stat Appl Genet Mol Biol. 3:Article3.

[217] Sartor MA, Tomlinson CR, Wesselkamper SC, Sivaganesan S, Leikauf GD, Medvedovic

M. (2006). Intensity-based hierarchical Bayes method improves testing for differentially

expressed genes in microarray experiments. BMC Bioinformatics. 7:538.

[218] Freudenberg JM, Joshi VK, Hu Z, Medvedovic M. (2009). CLEAN: CLustering

Enrichment ANalysis. BMC Bioinformatics.10:234.

[219] Livak KJ, Schmmittgen TD. (2001). Analysis of relative gene expression data using real-

time quantitative PCR and the 2(-Delta Delta C(T)) Method. Methods. 25(4):402-8.

[220] Teichmann M, Wang Z, Martinez E, Tjernberg A, Zhang D, Vollmer F, Chait BT, Roeder

RG. (1999). Human TATA-binding protein-related factor-2 (hTRF2) stably associates with

hTFIIA in HeLa cells. Proc Natl Acad Sci USA. 96(24):13720-5.

[221] Gilles S, Zahler S, Welsch U, Sommerhoff CP, Becker BF. (2003). Release of TNF-alpha

during myocardial reperfusion depends on oxidative stress and is prevented by mast cell

stabilizers. Cardiovasc Res. 60(3):608-15.

[222] Dorge H, Schultz R, Belosjorow S, Post H, van de Sand A, Konietzka I, Frede S, Hartung

G. (2002). Coronary microembolization: the role of TNF-alpha in contractile dysfunction. J Mol

Cell Cardiol. 34:51-62.

197 [223] Schulz R, Heusch G. (2009). Tumor Necrosis Factor-a and Its Receptors 1 and 2: Yin and

Yang in Myocardial Infarction? Circulation. 119:1355-1357.

[224] Li C, Browder W, Kao RL. (1999). Early activation of transcription factor NF-kappaB

during ischemia in perfused rat heart. Am J Physiol. 276(2 Pt 2):H543-52.

[225] Li C, Kao RL, Ha T, Kelley J, Browder IW, Williams DL. (2001). Early activation of

IKKbeta during in vivo myocardial ischemia. Am J Physiol Heart Circ Physiol. 280(3):H1264-71

[226] Sasaki H, Galang N, Maulik N. (1999) Redox regulation of NF-kappaB and AP-1 in

ischemic reperfused heart. Antioxid Redox Signal 1(3):317-24.

[227] Shames BD, Barton HH, Reznikov LL, Cairns CB, Banerjee A, Harken AH, Meng X.

(2002). Ischemia alone is sufficient to induce TNF-alpha mRNA and peptide in the myocardium.

Shock. 17(2):114-119.

[228] Kis A, Yellon DM, Baxter GF. (2003). Role of nuclear factor-κB activation in acute

ischemia-reperfusion injury in myocardium. Br J Phamacol. 138(5):894-900.

[229] Chandrasekar B, Freeman GL. (1997). Induction of nuclear factor kappaB and activation

protein 1 in postischemic myocardium. FEBS Lett. 401(1):30-4.

[230] Chandrasekar B, Streitman JE, Colston JT, Freeman GL. (1998). Inhibition of nuclear

factor kappa B attenuates proinflammatory cytokine and inducible nitric-oxide synthesis

expression in postischemic myocardium. Biochim Biophys Acta. 1406(1):91-106.

[231] Chandrasekar B, Colston JT, Geimer J, Cortez D, Freeman GL. (2000). Induction of

nuclear factor kappaB but not kappaB-responsive cytokine expression during myocardial reperfusion injury after neutropenia. Free Radic Biol. Med. 28(11):1579-88.

198 [232] Lille ST, Lefier SR, Mowlavi A, Suchy H, Boytle EM Jr, Farr AL, Su CY, Frank N,

Mulligan DC. (2001). Inhibition of the initial wave of NF-kappaB activity in rat muscle reduces

ischemia/reperfusion injury. Muscle Nerve. 24(4):534-41.

[233] Valen G, Yan ZQ, Hansson GK. (2001). Nuclear factor kappa-B and the heart. J Am Coll

Cardiol. 38(2):307-14.

[234] Kubota T, Miyagishima M, Frye CS, Alber SM, Bounoutas GS, Kadokami T, Watkins SC,

McTieman CF, Feldman AM. (2001). Overexpression of tumor necrosis factor-alpha activates

both anti- and pro-apoptotic pathways in the myocardium. J Mol Cell Cardiol. 33(7):13431-44.

[235] Hiasa G, Hamada M, Ikeda S, Hiwada K. (2001). Ischemic preconditioning and

lipopolysaccharide attenuate nuclear factor-kappaB activation and gene expression of

inflammatory cytokines in the ischemia-reperfused rat heart. Jpn Circ J. 65(11):984-90.

[236] Hoffmann A, Levchenko A, Scott ML, Baltimore D. (2002). The IkappaB-NF-kappaB

signaling module: temporal control and selective gene activation. Science. 298(5596):1241-5.

[237] Lipniacki T, Paszek P, Brasier AR, Luxon B, Kimmel M. (2004). Mathematical model of

NF-kappaB regulatory module. J Theor Biol. 228(2):195-215.

[238] Krishna S, Jensen MH, Sneppen K. (2006). Minimal model of spiky oscillations in NF-

kappaB signaling. Proc Natl Acad Sci USA. 103(29):10840-5.

[239] Nelson DE, Ihekwaba AE, Elliott M, Johnson JR, Gibney CA, Foreman BE, Nelson G, See

V, Horton CA, Spiller DG, et al. (2005). Oscillations in NF-kappaB signaling control the

dynamics of gene expression. Science. 306(5696):704-8.

[240] Cheong R, Hoffmann A, Levchenko A. (2008). Understanding NF-kappaB signaling via mathematical modeling. Mol Syst Biol. 4:192.

199 [241] Kim D, Kolch W, Cho KH. (2009). Multiple roles of the NF-kappaB signaling pathway

regulated by coupled negative feedback circuits. F ASEB J . 23(9):2796-802.

[242] Hoffmann A, Natoli G, Ghosh G. (2006). Transcriptional regulation via the NF-kappaB signaling module. Oncongene. 25(51):6706-16.

[243] Basak S, Kim H, Kearns JD, Tergaonkar V, O’Dea E, Werner SL, Benedict CA, Ware CF,

Ghosh G, Verman IM, Hoffmann A. (2007). Cell. 128(2):369-81.

[244] Brasier AR. (2006). The NF-kappaB regulatory network. Cardiovasc Toxicol. 6(2):111-30.

[245] Barken D, Wang CJ, Kearns J, Cheong R, Hoffmann A, Levchenko A. (2005). Comment on “Oscillations in NF-kappaB signaling control the dynamics of gene expression”. Science.

308(5718):52.

[246] Hayden MS, Ghosh S. (2008). Shared principles in NF-kappaB signaling. Cell.

132(3):344-62.

[247] Lipniacki T, Kimmel M. (2007). Deterministic and stochastic models of NFkappaB

pathway. Cardiovasc Toxicol. 7(4):215-34.

[248] Mather W, Bennett MR, Hasty J, Tsimring LS. (2009). Delay-induced degrade-and-fire oscillations in small genetic circuits. Phys Rev Letter. 102(6):068105.

[249] Bratsun D, Volfson D, Tsimring LS, Hasty J. (2005). Delay-induced stochastic oscillations in gene regulation. Proc Natl Acad Sci USA. 101(41):14593-8.

[250] Sung MH, Salvatore L, De Lorenzi R, Indrawan A, Pasparakis M, Hager GL, Bianchi ME,

Agresti A. (2009). Sustained oscillations of NF-kappaB produce distinct genome scanning and

gene expression profiles. PLoS One. 4(9):e7163.

[251] Nelson DE, See V, Nelson G, White MR. (2004). Oscillations in transcription factor

dynamics: a new way to control gene expression. Biochem Soc Trans. 32(Pt 6):1090-2.

200 [252] Tian B, Nowak DE, Brasier AR. (2005). A TNF-induced gene expression program under

oscillatory NF-kappaB control. BMC Genomics 6:137.

[253] Tian B, Nowak DE, Jamaluddin M, Wang S, Brasier AR. (2005). Identification of direct

genomic targets downstream of the nuclear factor-kappaB transcription factor mediating tumor necrosis factor signaling. J Biol Chem. 289(17):17435-48.

[254] Yu H, Yokoyama M, Asano G. (1999). Time Course of Expression and Localization of

Heat Shock Protein 72 in the Ischemic and Reperfused Rat Heart. Jpn Circ J. 63:278-287.

[255] Currie RW. (1987). Effects of ischemia and perfusion temperature on the synthesis of

stress-induced (heat shock) proteins in isolated and perfused rat hearts. J Mol Cell Cardiol.

19(8):795-808.

[256] Plumier JC L, Robertson HA, Currie RW. (1996). Differential Accumulation of mRNA for

Immediate Early Genes and Heat Shock Genes in Heart After Ischemic Injury. J Mol Cell

Cardiol. 28:1251-1260.

[257] Simkhovich BZ, Marjoram P, Poizat C, Kedes L, Kloner RA. (2003). Brief episode of ischemia activates protective genetic program in rat heart: a gene chip study. Cardiovasc Res.

59(2):450-9.

[258] Mehta HB, Popovich BK, Dillman WH. (1988). Ischemia induces changes in level of

mRNAs coding for stress protein 71 and creatine kinase M. Circ Res. 63(3):512-7.

[259] Das DK, Maulik N, Moraru Il. (1995). Gene expression in acute myocardial stress.

Induction by hypoxia, ischemia, reperfusion, hyperthermia and oxidative stress. J Mol Cell

Cardiol. 27(1):181-93.

201 [260] Cumming VE, Heads RJ, Watson A, Latchmann DS, Yellon DM. (1996). Differential

protection of primary rat cardiomyocytes by transfection of specific heat stress proteins. J Mol

Cell Cardiol. 28:2343-2349.

[261] Lyn D, Liu X, Bennett NA, Emmett NL. (2000). Gene expression profile in mouse myocardium after ischemia. Physiol Genomics. 2:93-100.

[262] Yan SF, Fujita T, Lu J, Okada K, Zou YS, Mackman N, Pinsky DJ, Stern DM. (2000).

Egr-1, a master switch coordinating upregulation of divergent gene families underlying ischemic

stress. Nature Medicine. 6(12):1355-1361.

[263] Martinez-Gonzalez J, Badimon L. (2005). The NR4A subfamily of nuclear receptors: new

early genes regulated by growth factors in vascular cells. Cardiovasc Res. 65:609-618.

[264] Jordan JE, Zhao ZQ, Vinten-Johansen J. (1999). The role of neutrophils in myocardial

ischemia-reperfusion injury. Cardiovasc Res. 43(4):860-78.

[265] Das DK, Maulik N. (2006). Cardaic genomic response following preconditioning stimulus.

Cardiovasc Res. 70(2):254-63.

[266] Ravingerova T, Barancik M, Strniskova M. (2003). Mitogen-activated protein kinases: A

new therapeutic target in cardiac pathology. Mol Cell Biochem. 247:127-138.

[267] Stanton LW, Garrard LJ, Damm D, Garrick BL, Lam A, Kapoun AM, Zheng Q, Protter

AA, Schreiner GF, White RT. (2000). Altered patterns of gene expression in response to myocardial infarction. Circ Res. 86(9):939-45.

[268] Babior BM. (2000). Phagocytes and oxidative stress. Am J . Med. 109(1):33-44.

[269] Muklherjee S, Ghosh RN, Maxfield FR. (1997). Endocytosis. Physiol Rev. 77(3):759-803.

202 [270] Diniz SN, Nomizo R, Cisalpino PS, Teleria MM, Brown GD, Mantovani A, Gordon S,

Reis LF, Dias AA. (2004). PTX3 function as opsonin for the dectin-Independent internalization of zymosan by macrophages. J Leukoc Biol. 75(4):649-56.

[271] Hazenbos WL, Gessner JE, Hofhuis FM, Kuipers H, Meyer D, Heijnen IA, Schmidt RE,

Sandor M, Capel PJ, Daeron M, et al. (1996). Impaired IgG-dependent anaphylaxis and Arthus

reaction in Fc gamma Rlll (CD16) deficient mice. Immunity. 5(2):181-8.

[272] Hayashi A, Ohnishi H, Okazawa H, Nakazawa S, Ikeda H, Motegi S, Aoki N, Kimura S,

Mikuni M, Matozaki T. (2004). Positive regulation of phagocytosis by SIRPbeta and its

signaling mechanism in marcophages. J Biol Chem. 279(28):29450-60.

[273] Walther K, Dirili MK, Jung N, Haucke V. (2004). Functional dissection of the interactions

of stonin 2 with the adaptor complex AP-2 and synaptotagmin. Proc Natl Acad Sci USA.

101(4):964-9.

[274] Altmeyer A, Klampfer L, Goodman AR, Vilcek J. (1995). Promoter structure and transcriptional activation of the murine TSG-14 gene encoding a tumor necrosis factor/interleukin-1-inducible pentraxin protein. J Biol Chem. 270(43):25584-90.

[275] Dryer RL, Covey LR. (2005). A novel NF-kappa B-regulated site within the human I gamma 1 promoter requires p300 for optimal transcriptional activity. J Immunol. 175(7):4499-

507.

[276] Niehrs C. (2006). Function and biological roles of the Dickkopf family of Wnt modulators.

Oncogene. 25(57):7469-81.

[277] Nakamura RE, Hunter DD, Yi H, Brunken WJ, Hackam AS. (2007). Identification of two

novel activates of Wnt signaling regulator Dickkopf3 and characterization of its expression in the

mouse retina. BMC Cell Biol. 8:52.

203

[278] Satoh K, Kasai M, Ishidao T, Tago K, Ohwada S, Hasegawa Y, Senda T, Takada S, Nada

S, Nakamura T, Akiyama T. (2004). Anteriorization of neural fate by inhibitor of beta-catenin

and T cell factor (ICAT), a negative regulator of Wnt signaling. Proc Natl Acad Sci USA.

101(21):8017-21.

[279] Kanamori M, Sandy P, Marzinotto S, Benetti R, Kai C, Hayashizaki Y, Schneiuder C,

Suzuki H. (2003). The PDZ protein tax-interacting protein-1 inhibits beta-catenin transcriptional activity and growth of colorectal cancer cells. J Biol Chem. 278(40):38758-64.

[280] Frangogiannis NG. (2008). The immune system and cardiac repair. Pharmacol Res.

58(2):88-111.

[281] Lambert JM, Lopez EF, Lidsey ML. (2008). Marcophage roles following myocardial

infarction. Int J Cardiol. 130(2):147-58.

[282] Basile A, Sica A, d’Aniello E, Breviario F, Garrido G, Castellano M, Mantovani A, Introna

M. (1997). Characterization of the promoter for the human long pentraxin PTX3. Role of NF-

kappaB in tumor necrosis factor-alpha and interleukin-1beta regulation. J Biol Chem.

272(13):8172-8.

[283] Sailo M, Chimenti S, De Angelis N, Molla F, Nebuloni M, Pasqualini F, Latini R,

Garlanda C, Mantovani A. (2008). Cardioprotective function of the long pentraxin PTX3 in acute myocardial infarction. Circulation. 117(8):1055-64.

[284] Ammirante M, Rosati A, Gentilella A, Festa M, Petrella A, Marzullo L, Pascale M,

BellsarioMA, Leone A, Turco MC. (2008). The activity of hsp90 alpha promoter is regulated by

NF-kappa B transcription factors. Oncogene. 27(8):1175-8.

204 [285] Griffin TM, Valdez TV, Mestril R. (2004). Radicocol activates heat shock protein

expression and cardioprotection in neonatal rat cardiomyocytes. Am J Physiol Heart Circ

Physiol. 287(3):H1081-8.

[286] Shi Y, Baker JE, Zhang C, Tweddell JS, Su J, Prittchard KA Jr. (2002). Chronic hypoxia

increases endothelial nitric oxide synthase generation of nitric oxide by increasing heat shock

protein 90 association and serine phosphorylation. Circ Res. 91(4):300-6.

[287] Fortana J, Fulton D, Chen Y, Fairchild TA, McCabe TJ, Fujita N, Tsuruo T, Sessa WC.

(2002). Domain mapping studies reveal that the M domain of hsp90 serves as a molecular scaffold to regulate Akt-dependent phosphorylation of endothelial nitric oxide synthase and NO release. Circ Res. 90(8):866-73.

[288] Kupatt C, Dessy C, Hinkel R, Raake P, Daneau G, Bouzin C, Boekstegers P, Feron O.

(2004). Heat shock protein 90 transfection reduces ischemia-reperfusion-induced myocardial

dysfunction via reciprocal endothelial NO synthase serine 1177 phosphorylation and threonine

495 dephosphorylation. Arterioscler Thromb Vasc Biol. 24(8):1435-41.

[289] Manukhina EB, Downey HF, Mallet RT. (2006). Role of nitric oxide in cardiovascular

adaptation to intermittent hypoxia. Exp Biol Med. 231(4):343-65.

[290] Dias AA, Goodman AR, Dos Santos JL, Gomes RN, Altmeyer A, Bozza PT, Horta MF,

Vilcek J, Reis LF. (2001). TSG-14 transgenic mice have improved survival to endotozemia and to CLP-induced sepsis. J Leukoc Biol. 69(6):928-36.

[291] Srivastava P. (2002). Roles of heat shock proteins in innate and adaptive immunity. Nat

Rev Immunol. 2(3):185-94.

[292] Latchman DS. (2001). Heat shock proteins and cardiac protection. Cardiovas Res.

51(4):637-46.

205 [293] Kim G, Lee TH, Wetzel P, Geers C, Robinson MA, Myers TG, Owens JW, Wehr NB,

Eckhaus MW, Gros G, Wynshaw-Boris A, Levine RL. (2004). Carbonic anhydrase III is not

required in the mouse for normal growth, development, and life span. Mol Cell Biol.

24(22):9942-7.

[294] Lu B, Sims PJ, Wiedmer T, Moser AH, Shigenaga JK, Grunfield C, Feingold KR. (2007).

Expression of the phospholipid scramblase (PLSCR1) gene family during the acute phase

response. (2007). Biochim Biophys Acta. 1177(9):1777-85.

[295] Lofqvist C, Niklasson A, Engstrom E, Friberg LE, Camacho-Hubner C, Ley D, Borg J,

Smith LE, Hellstrom A. (2009). A pharmacokinetic and dosing study of intravenous insulin-like

growth factor-I and IGF-binding protein-3 complex to preterm infants. Pediatr Res. 65(5):574-9.

[296] Chang KH, Chan-Ling T, McFarland EL, Afzal A, Pan H, Baxter LC, Shaw LC, Caballero

S, Sengupta N, Li Calzi S, et al. (2007). IGF binding protein-3 regulates hematopoietic stem cell and endothelial precursor cell function during vascular development. Proc Natl Acad Sci USA.

104(25):10595-600.

[297] Kotuke-Nara, Saida K. (2006). Endothelin-2/vasoactive intestinal contractor: regulation of

expression via reactive oxygen species induced by CoCl2, and Biological activities including

neurite outgrowth in PC12 cells. ScientificWorldJournal. 6:176-86.

[298] Huang J, Min Lu M, Cheng L, Yuan LJ, Zhu X, Stout T AL, Chen M, li J, Parmacek MS.

(2009). Myocardin is required for cardiomyocyte survival and maintenance of heart function.

Proc Natl Acad Sci USA. 106(44):18734-9.

[299] Du KL, Ip HS, Li J, Chen M, Dandre F, Lu MM, Owens GK, Parmacek MS. (2003).

Myocardin is critical serum response factor cofactor in the transcriptional program regulating

smooth muscle cell differentiation. Mol Cell Biol. 23(7):2425-37.

206 [300] Hamilton KL, Mbai FN, Gupta S, Knowlton AA. (2004). Estrogen, heat shock proteins,

and NFkappaB in human vascular endothelium. Arterloscler Thromb Vasc Biol. 24(9):1628-33.

[301] Hamilton KL, Gupta S, Knowlton AA. (2004). Estrogen and regulation of heat shock

protein expression in female cardiomyocytes: cross-talk with NF kappa B signaling. J Mol Cell

Cardiol. 36(4):577-84.

[302] Panaretakis T, Joza N, Modjtahedi N, Tesniere A, Vitale I, Durchschlag M, Fimia GM,

Kepp O, Placentini M, Froehlich KU, et al. (2008). The co-translocation of ERp57 and

calreticulin determines the immunogenicity of cell death. Cell Death Differ. 15(9):1499-509.

[303] Oyadomari S, Koizumi A, Takeda K, Gotoh T, Akira S, Araki E, Mori M. (2002).

Targeted disruption of the Cop gene delays endoplasmic reticulum stress-mediated diabetes. J

Clinic Invest. 109(4):525-32.

[304] Stice JP, Knowlton AA. (2008). Estrogen, NFkappaB, and the heat shock response. Mol

Med. 14(7-8):517-27.

[305] Knowlton AA. (2006). NFkappaB, heat shock proteins, HSF1, and inflammation.

Cardiovasc Res. 69(1):7-8.

[306] Cornelussen RN, van Nieuwenhoven FA, Snoeckx LH, Knowlton AA. (2001). Presence of heat shock protein 72 in cardiomyocytes after heat stress. Circulation. 104(22):E123.

[307] Nakano M, Knowlton AA, Yokoyama T, Lesslauer W, Mann DL. (1996). Tumor necrosis

factor-alpha-induced expression of heat shock protein 72 in adult feline cardiac myocytes. Am J

Physiol. 270(4 Pt 2):H1231-9.

[308] Yeh CH, Chen TP, Wang YC, Lin YM, Lin PJ. (2009). HO-1 activation can attenuate

cardiomyocytic apoptosis via inhibition of NF-kappaB and AP-1 translocation following cardiac

global ischemia and reperfusion. J Surg Res. 155(1):147-56.

207 [309] Jancso G, Lantos J, Borsiczky B, Szanto Z, Roth E. (2004). Dynamism of NF-kappaB and

AP-1 activation in the signal transduction of ischemic myocardial preconditioning. Eur Surg Res.

36(3):129-35.

[310] Zingarelli B, Hakw PW, O’Connor M, Denenberg A, Wong HR, Kong S, Aronow BJ.

(2004). Differential regulation of activator protein-1 and heat shock factor-1 in myocardial

ischemia and reperfusion injury: role of poly (ADP-ribose) polymerase-1. Am J Physiol Heart

Circ Physiol. 286(4):H1408-15.

[311] Zingarelli B, Hake PW, Yang Z, O’Connor M, Demneberg A, Wong HR. (2002). Absence of inducible nitric oxide synthase modulates early reperfusion-induced NF-kappaB and AP-1 activation and enhances myocardial damage. F AEB J . 16(3):327-42.

[312] Li C, Ha T, Liu L, Browder W, Kao RL. (2000). Adenosine prevents activation of

transcription factor NF-kappa B and enhances activator protein-1 binding activity in ischemic rat

heart. Surgery. 127(2):161-9.

[313] Maulik N, Goswami S, Galang N, Das DK. (1999). Differential regulation of Bcl-2, AP-1,

and NF-kappaB on cardiomyocytes apoptosis during ischemic stress adaptation. FEBS Lett.

4432(3):331-6.

[314] Peng M, Huang L, Xie ZJ, Huang WH, Askari A. (1995). Oxidant-induced activation of

nuclear factor-kappa B and activator protein-1 in cardiac myocytes. Cell Mol Biol Res.

41(3):189-97.

[315] Li J, Mayne R, Wu C. (1999). A novel muscle-specific beta 1 intergrin binding protein

(MIBP) that modulates myogenic differentiation. J Cell Biol. 147(7):1391-8.

208 [316] Dackor R, Fritz-Six K, Smithes O, Caron K. (2007). Receptor activating-modifying

proteins 2 and 3 have distinct physiological functions from embryogenesis to old age. J Biol

Chem. 282(25):18094-9.

[317] Gregorip CC, Trombitas K, Center T, Stier G, Kunke K, Suzuki K, Obermayr F, Herrmann

B, Granzier H, Sorimachi H, Labeit S. (1998). The NH2 terminus of titin spans the Z-disc: its interaction with a novel 19-kDa ligand (T-cap) is required for sarcomeric integrity. J Cell Biol.

143(4):1013-27.

[318] Dail M, Kalo MS, Seddon JA, Cote JF, Vuori K, Pasquale EB. (2004). SHEP1 function in cell migration is impaired by a single amino acid mutation that disrupts association with the scaffolding protein cas but not with Ras GTPases. J Biol Chem. 279(40):41892-902.

[319] Loeffen JL, Triepels RH, van den Heuvel LP, Schuelke M, Buskens CA, Smeets RJ,

Trijbels JM, Smeitink JA. (1998). cDNA of eight nuclear encoded subunits of

NADH:ubiquinone oxidoreductase: human complex I cDNA characterization completed.

Biochem Biophys Res Commun. 253(2):415-22.

[320] Cook SA, Rosenzweig A. (2002). DNA microarrays: inplications for cardiovascular

medicine. Circ Res. 91(7):559-64.

[321] Draghici S, Khatri P, Ekiund AC, Szallasi Z. (2006). Reliability and reproducibility issues

in DNA microarray measurements. Trends Genet. 22(2):101-9.

[322] Provenzano M, Mocellin S. (2007). Complementary techniques: validation of gene

expression data by quantitative real time PCR. Adv Exp Med Biol. 593:66-73.

[323] Knowlton AA. (1999). Mutation of amino acids 246-251 alters nuclear accumulation of

human heat shock protein (HSP) 72 with stress, but does not reduce viability. J Mol Cell

Cardiol. 31(3):523-32.

209 [324] Voss MR, Gupta S, Stice JP, Baumgarten G, Lu L, Tristan JM, Knowlton AA. (2005).

Effect of mutation of amino acids 246-251 (KRKHKK) in HSP72 on protein synthesis and recovery from hypoxic injury. Am J Physiol Heart Circ Physiol. 289(6):H2519-25.

[325] Lewis MJ, Pelham HR. (1985). Involvement of ATP in the nuclear and nucleoloar

functions of the 70 kd heat shock protein. EMBO J. 4(12):3137-43.

[326] Brown CR, Martin RL, Hansen WJ, Beckmann RP, Welech WJ. (1993). The constitutive and stress inducible forms of hsp70 exhibit functional similarities and interact with one another in an ATP-dependent fashion. J Cell Biol. 120(5):1101-12.

[327] Lygate C. (2007). Letter to editor: Infarct size measurements are critically important

comparing interventions affecting ventricular remodeling. Am J Physiol Heart Circ Physiol.

203:H3221.

[328] Doevendans PA, Daemen MJ, de Muinck ED, Smits JF. (1998). Cardiovascular phenotype

in mice. Cardiovascular Research. 39:34-49.

[329] Ahn D, Cheng L, Moon C, Spurgeon H, Lakatta EG, Talan MI. (2004). Induction of

myocardial infarcts of a predictable size and location by branch pattern probability-associated coronary ligation in C57BL/6 mice. Am J Physiol Heart Circ Physiol. 286:H1201-H1207.

[330] Llyod M, Entman ML, Hartley CJ, Youker KA, Zhu J, Hall SR, Hawkins HK, Berens K,

Ballantyne CM. (1995). Heart Circ. Physiol. 269(38):H2147-HF2154.

[331] Rajdev S, Hara K, Kokubo Y, Mestrill R, Dillmann W, Weinstein PR, Sharp FR. (2000).

Mice overexpressing rat heat shock protein 70 are protected against cerebral infarction. Ann

Neurol. 47(6):782-91.

210 [332] Donnelly T, Slevers RE, Vissern FL, Wlech WJ, Wolfe CL. (1992). Heat shock protein

induction in rat hearts. A role for improved myocardial salvage after ischemia and reperfusion?

Circulation. 85(2):769-78.

[333] Marber MS, Latchman DS, Walker JM, Yellon DM. (1993). Cardiac stress protein

elevation 24 hours after brief ischemia or heat stress is associated with resistance to myocardial

infarction. Circulation. 88(3):1264-72.

[334] Currie RW, Tanguay RM, Kingma JG Jr. (1993). Heat-shock response and limitation of tissue necrosis during occlusion/reperfusion in rabbit hearts. Circulation. 87(3):963-71.

[335] Yellon DM, Latchman DS. (1992). Stress proteins and myocardial protection. J Mol Cell

Cardiol. 24(2):113-24.

[336] Walker DM, Pasini E, Kucukoglu S, Marber MS, Iliodromitis E, Ferrari R, Yellon DM.

(1993). Heat stress limits infarct size in the isolated perfused rabbit heart. Cardiovasc Res.

27(6):962-7.

[337] Marber MS, Mestril R, Chi SH, Sayen MR, Yellon DM, Dillmann WH. (1995). Over

expression of the rat inducible 70-kD heat stress protein in a transgenic mouse increases the

resistance of the heart to ischemic injury. J Clinic Invest. 95(4):1446-56.

[338] Plumier JC, Ross BM, Currie RW, Angelidis CE, Kazlaris H, Kollas G, Pagoulatos GN.

(1995). Transgenic mice expressing the human heat shock protein 70 have improved post-

ischemic myocardial recovery. J Clinc Invest. (95):1854-60.

[339] Trost SU, Omens JH, Karlon WJ, Meter M, Mestrill R, Covell JW, Dillman WH. (1998).

Protection against myocardial dysfunction after a brief ischemic period in transgenic mice

expressing inducible heat shock protein 70. J Clin Invest. 101(4):855-62.

211 [340] DeMeester SL, Buchman TG, Cobb JP. (2001). The heat shock paradox: does NF-kB

determine cell fate? F ASEB J . 15, 270-274.

[341] Chen Y, Voegelio TS, Liu PP, Noble EG, Currie RW. (2007). Heat Shock Paradox and a

New Role of Heat Shock Proteins and their Receptors as Anti-Inflammation Targets.

Inflammation & Allergy- Drug Targets. 6:91-100.

[342] Giffard RG, Han RQ, Emery JF, Duan M, Pittet JF. (2008). Regulation of apopototic and

inflammatory cell signaling in cerebral ischemia- the complex roles of Heat Shock Protein 70.

Anesthesiology. 109(2):339-348.

[343] Zhang X, Xu Z, Zhou L, Chen Y, He M, Cheng L, Hu FB, Tanguay RM, Wu T. (2010).

Plasma levels of Hsp70 and anti-Hsp70 antibody predict risk of acute coronary syndrome. Cell

Stress Chaperones. (Epub ahead of print 2010 Mar 19).

[344] Hohfeld J, Cyr DM, Patterson C. (2001). From the cradle to the grave: molecular

chaperones that may choose between folding and degradation. EMBO Rep. 2(10):885-90.

[345] Yamagishi Y, Ishihara K, Hatayama T. (2004). Hsp105 alpha suppresses Hsc70 chaperone

activity by inhibiting Hsc70 ATPase activity. J Biol Chem. 279(40):41727-33.

212 Appendix

Awards

National Research Service Award (NRSA) NIH Predoctoral F31 Fellowship

7/2005-7/2009

Graduate Student Travel Award Winner

American Society for Pharmacology and Experimental Therapeutics (ASPET).

Experimental Biology 2008 Meeting in San Diego.

Publications

Wilhide ME, Tranter M, Ren X, Chen J, Sartor M, Medvedovic M, Jones WK. (2010).

Hsp70.1 contributes to a NF-kappa B-dependent cardioprotection after myocardial ischemia.

In Preparation

Tranter M, Ren X, Wilhide ME, Chen J, Sartor M, Medvedovic M, Jones WK. (2010). Gene

Microarray Identification of NF-κB driven cardioprotective gene programs; Hsp70.3 but not

Hsp70.1 contributes to cardioprotection after Late Ischemic Preconditioning. In Press J Mol

Cell Cardiol

Wilhide ME, Jones WK. (2006). Potential therapeutic gene for the treatment of ischemic

disease: Ad2/hypoxia-inducible factor-1 alpha (HIF-1)/VP16 enhances B-type natriuretic peptide

gene expression via HIF-1-responsive element. Mol Pharmacol. 69:1773-8.

Jones WK, Brown M, Wilhide M, He S, Ren X. (2005). NF-kappa B in Cardiovascular Disease:

Diverse and Specific of a “General” Transcription Factor. Cardiovasc Toxicol. (5)2:183-202.

213 Poster Presentations

Wilhide ME, Ren X, Tranter M, Jones WK. Heat Shock Protein 70 in Myocardial Ischemia: Isoform Specific Roles? Experimental Biology 2009. April 18-22, 2009. New Orleans, LA.

Tranter M, Ren X, Wilhide ME, Jones WK. The HSP70.3 isoform of HSP70, but not HSP70.1, contributes to NF-kappaB-dependent cardioproection of late ischemic preconditioning. Experimental Biology 2009. April 18-22, 2009. New Orleans, LA.

Wilhide ME, Ren X, Sartor M, Medvedovic M, Aronow B, Jones WK. NF-κB-dependent gene expression networks regulate cell survival after myocardial infarction. International Society for Heart Research North American Section 2008. June 17-20, 2008. Cincinnati, OH

Wilhide ME, Tranter M, Ren X, Jones WK. NF-κB orchestrates gene expression associated with myocardial infarction and protection. Experimental Biology 2008. April 5-9, 2008. San Diego, CA

Tranter M, Wilhide ME, Liu Y, Ren X, Reineke T, Jones WK. Non-viral delivery of therapeutic nucleic acids to investigate the role of transcriptional networks in ischemic heart. Experimental Biology 2008. April 5-9, 2008. San Diego, CA

214