DOCSLIB.ORG

View of All NF-Κb Post-Translational Modifications See Review by Perkins [179]

Total Page：16

File Type：pdf, Size：1020Kb

Download full-text PDF Read full-text
View of All NF-Κb Post-Translational Modifications See Review by Perkins [179] UNIVERSITY OF CINCINNATI Date: 8-May-2010 I, Michael Wilhide , hereby submit this original work as part of the requirements for the degree of: Master of Science in Molecular, Cellular & Biochemical Pharmacology It is entitled: Student Signature: Michael Wilhide This work and its defense approved by: Committee Chair: Walter Jones, PhD Walter Jones, PhD Mohammed Matlib, PhD Mohammed Matlib, PhD Basilia Zingarelli, MD, PhD Basilia Zingarelli, MD, PhD Jo El Schultz, PhD Jo El Schultz, PhD Muhammad Ashraf, PhD Muhammad Ashraf, PhD 5/8/2010 646 Hsp70.1 contributes to the NF-κΒ paradox after myocardial ischemic insults A thesis submitted to the Graduate School of the University of Cincinnati in partial fulfillment of the requirement for the degree of Master of Science (M.S.) in the Department of Pharmacology and Biophysics of the College of Medicine by Michael E. Wilhide B.S. College of Mount St. Joseph 2002 Committee Chair: W. Keith Jones, Ph.D. Abstract One of the leading causes of death globally is cardiovascular disease, with most of these deaths related to myocardial ischemia. Myocardial ischemia and reperfusion causes several biochemical and metabolic changes that result in the activation of transcription factors that are involved in cell survival and cell death. The transcription factor Nuclear Factor-Kappa B (NF-κB) is associated with cardioprotection (e.g. after permanent coronary occlusion, PO) and cell injury (e.g. after ischemia/reperfusion, I/R). However, there is a lack of knowledge regarding how NF- κB mediates cell survival vs. cell death after ischemic insults, preventing the identification of novel therapeutic targets for enhanced cardioprotection and decreased injurious effects. The objective of this thesis is to distinguish and determine the mechanisms underlying the differential effects of NF-κB following ischemic insults. For example, NF-κB-dependent cardioprotection after PO vs. NF-κB-dependent cell death after I/R. It is hypothesized that NF- κB is a key signaling integrator that differentially regulates distinct sets of NF-κB-dependent genes that contribute to cardioprotection or cell death after ischemic insults. Transgenic mice were used, in which NF-κB activation is genetically blocked in the cardiomyocytes (DN), along with gene expression assays (e.g. microarrays and quantitative real-time PCR (QRT-PCR)) to determine sets of genes that may contribute to cardioprotection and cell death. Our results identified 16 genes both up- and down-regulated by NF-κB and after PO, which may contribute to NF-κB-dependent cardioprotection after PO. In addition, our results revealed 59 genes both up- and down-regulated by NF-κB and after I/R, which may result in NF-κB- ii dependent cell death after I/R. The main objective is to identify genes that are dysregulated (up- and down-regulated) between PO and I/R (16 genes regulated by NF-κB and PO vs. 59 genes regulated by NF-κB and I/R). Only one gene was significantly up-regulated by NF-κB after PO and I/R, which is heat shock protein 90kDa alpha (cytosolic), class A member 1 (hsp90aa1). However, heat shock protein 1A (hspa1a/hsp70.3) and heat shock protein 1B (hspa1b/hsp70.1) genes are highly up-regulated in response to both ischemic insults. NF-κB significantly up- regulated hspa1a after PO and hspa1a and hspa1b after I/R. QRT-PCR confirmed that hspa1a and hspa1b genes are highly up-regulated by both ischemic insults and up-regulated by NF-κB. In general, heat shock proteins 70 are known to be involved in cell survival and cell death outcomes. However, there is a lack of information regarding the individual role of Hsp70.1 and Hsp70.3 after myocardial ischemic insults. Therefore, Hsp70.1 and Hsp70.3 were investigated by using Hsp70.1/Hsp70.3 double knockout mice and Hsp70.1 single knockout mice. Interestingly, our results show that Hsp70.1 provided cardioprotection after PO, in contrast to causing cell injury after I/R; whereas, Hsp70.3 may provide cardioprotection after I/R. The significance of the research is the identification of unique sets of genes that may underlie the NF-κB paradox. The novel findings of the thesis are that Hsp70.1 underlies NF-κB-dependent cardioprotection after PO and NF-κB-dependent cell injurious effects after I/R. Our results contribute to the understanding of how NF-κB differentially regulates cell survival versus cell death effects after ischemic stimuli. iii iv Acknowledgments I would like to extend thanks to all the people who provided me with their wonderful advice, support, and encouragement during my graduate career at the University of Cincinnati. First, I would like to thank Dr. W. Keith Jones for the opportunity to do research under his guidance and in his laboratory. I treasure and benefitted from his support, advice, guidance, and encouragement during my graduate career. Dr. Jones is truly a great scientist who is very dedicated to his research and the students in his laboratory. I am very grateful for Dr. Jones’ setting such a high standard for my work and for encouraging me to think critically on research aspects. His commitment of support, mentoring, and advice has guided me through my graduate training and enhanced my professional development. I would also like to extend my appreciation and thanks to the members of my committee: Chairperson Dr. W. Keith Jones, Dr. Muhammad Ashraf, Dr. Mohammad Matlib, Dr. Jo El Schultz, and Dr. Basilia Zingarelli. I am very grateful for their support, encouragement, and dedication to my success as a graduate student throughout my graduate career. I appreciate their guidance in helping me successfully to graduate with a degree. Most importantly, I would like to thank them for their time spent listening and providing advice on my research. My research would not have been possible without the help of Dr. Xiaoping Ren, who gave his time and expertise in the myocardial ischemia and reperfusion surgical models. Without his involvement, my research would not been accomplished. I enjoyed assisting Dr. Ren during the v mice surgeries and talking to him about research. He is truly a wonderful senior member of Dr. Jones’s lab. I am very grateful that I had a chance to work with him and learn from his expertise. I would also like to thank the members of the genomics and microarray laboratory at the University of Cincinnati (UC) for their microarray work. In addition, I extend thanks to the members of the statistical genomics and system biology laboratory at UC, especially Drs. Mario Medvedovic, Maureen Sartor, and Jing Chen who assisted me with microarray analysis. Along with Travis Beckwith, a Ph.D. student in the University of Cincinnati Neuroscience program, who assisted in the editing and proofreading of this thesis. I appreciate the current and past members of Dr. Jones’s lab, who provided their support and skills that contributed to my research. In addition, I would like to extend my gratitude to the following members of the lab: past Ph.D. student Dr. Maria Brown, Michael Tranter (Ph.D. summer 2010) and Jackie Belew (research assistant). Dr. Brown has provided me with wonderful support and advice during my early graduate career, which I appreciate. Michael Tranter provided me with crtical advice and insights on my research. Jackie Belew has provided me with support and encouragement, along with her critical guidance. I am grateful for the faculty and staff of the Department of Pharmacology and Cell Biophysics of the University of Cincinnati for all of their support, advice and encouragement during my graduate career. Special thanks to the following people: Nancy Thyberg, Donna Gering, Carol Ross, Damita Harris, and George Sfryis for their assistance. I would also like to thank the past and current students in the Molecular, Cellular, and Biochemical Pharmacology graduate vi program for their support during my graduate studies. Also, I would like to thank Dr. Carl Huether (a colleague of my mother and UC Professor Emeritus Biological Sciences) for providing me support, advice, and encouragement during my last year of graduate school. I would like to acknowledge the NIH for the predoctoral fellowship and the NIH grants of Dr. W. Keith Jones that provided me with the support and funding for my research. Finally, I am very grateful that God has provided me with a wonderful family who has given me unconditional love and support throughout my life. I am very thankful for all the support that my family (my mother, Margaret Wolf; my step father Bill Wolf; my father, Steve Wilhide; and my brother, Brian Wilhide) has given me, especially during my graduate studies. I would like to dedicate this thesis to my family and in honor of my grandfather, Dr. James D. Weaver who was a wonderful mentor and inspiration to me. vii Table of Contents Abstract ii Acknowledgment v Table of Contents viii List of Figures and Tables xvi Chapter I: Introduction 1 Section 1. General Background 1 I.1.1 Cardiovascular Disease 1 I.1.2 Myocardial Ischemia 1 I.1.3 Ischemic Injury 1 I.1.4 Ischemia/Reperfusion 3 I.1.5 Reperfusion Injury 5 Calcium Paradox 6 Oxygen Paradox 7 I.1.6 Cell Death 8 Apoptosis 9 Table 1. Differences Between Necrosis and Apoptosis 10 Anti/Pro-Apoptotic Genes 12 Extrinsic Death Receptor-Mediated Pathways 12 Intrinsic Mitochondrial-Dependent Pathway 13 Endoplasmic Reticulum (ER)-Stress Cell Death Pathway 14 Figure 1. Cell Death Pathways 16 viii I.1.7 Cell Death After Ischemia and Ischemia/Reperfusion 20 I.1.8 Summary of Background 21 Figure 2. Summary of Background 23 Section 2. Cellular Response to Ischemic and Reperfusion Stresses 24 I.2.1 Unfolded Protein Response 24 I.2.2 Heat Shock Proteins 26 Hsp90 Family 26 Hsp70 Family 27 Hsp60 Family 29 I.2.3 Inflammatory Response 30 I.2.4 Nitric Oxide Synthesis 31 I.2.5 Summary 32 Section 3.
Load more

Recommended publications
  • Table S1 the Four Gene Sets Derived from Gene Expression Profiles of Escs and Differentiated Cells
    Table S1 The four gene sets derived from gene expression profiles of ESCs and differentiated cells Uniform High Uniform Low ES Up ES Down EntrezID GeneSymbol EntrezID GeneSymbol EntrezID GeneSymbol EntrezID GeneSymbol 269261 Rpl12 11354 Abpa 68239 Krt42 15132 Hbb-bh1 67891 Rpl4 11537 Cfd 26380 Esrrb 15126 Hba-x 55949 Eef1b2 11698 Ambn 73703 Dppa2 15111 Hand2 18148 Npm1 11730 Ang3 67374 Jam2 65255 Asb4 67427 Rps20 11731 Ang2 22702 Zfp42 17292 Mesp1 15481 Hspa8 11807 Apoa2 58865 Tdh 19737 Rgs5 100041686 LOC100041686 11814 Apoc3 26388 Ifi202b 225518 Prdm6 11983 Atpif1 11945 Atp4b 11614 Nr0b1 20378 Frzb 19241 Tmsb4x 12007 Azgp1 76815 Calcoco2 12767 Cxcr4 20116 Rps8 12044 Bcl2a1a 219132 D14Ertd668e 103889 Hoxb2 20103 Rps5 12047 Bcl2a1d 381411 Gm1967 17701 Msx1 14694 Gnb2l1 12049 Bcl2l10 20899 Stra8 23796 Aplnr 19941 Rpl26 12096 Bglap1 78625 1700061G19Rik 12627 Cfc1 12070 Ngfrap1 12097 Bglap2 21816 Tgm1 12622 Cer1 19989 Rpl7 12267 C3ar1 67405 Nts 21385 Tbx2 19896 Rpl10a 12279 C9 435337 EG435337 56720 Tdo2 20044 Rps14 12391 Cav3 545913 Zscan4d 16869 Lhx1 19175 Psmb6 12409 Cbr2 244448 Triml1 22253 Unc5c 22627 Ywhae 12477 Ctla4 69134 2200001I15Rik 14174 Fgf3 19951 Rpl32 12523 Cd84 66065 Hsd17b14 16542 Kdr 66152 1110020P15Rik 12524 Cd86 81879 Tcfcp2l1 15122 Hba-a1 66489 Rpl35 12640 Cga 17907 Mylpf 15414 Hoxb6 15519 Hsp90aa1 12642 Ch25h 26424 Nr5a2 210530 Leprel1 66483 Rpl36al 12655 Chi3l3 83560 Tex14 12338 Capn6 27370 Rps26 12796 Camp 17450 Morc1 20671 Sox17 66576 Uqcrh 12869 Cox8b 79455 Pdcl2 20613 Snai1 22154 Tubb5 12959 Cryba4 231821 Centa1 17897
    [Show full text]
  • HNRPH1 (HNRNPH1) (NM 005520) Human Tagged ORF Clone Product Data
    OriGene Technologies, Inc. 9620 Medical Center Drive, Ste 200 Rockville, MD 20850, US Phone: +1-888-267-4436 [email protected] EU: [email protected] CN: [email protected] Product datasheet for RC201834 HNRPH1 (HNRNPH1) (NM_005520) Human Tagged ORF Clone Product data: Product Type: Expression Plasmids Product Name: HNRPH1 (HNRNPH1) (NM_005520) Human Tagged ORF Clone Tag: Myc-DDK Symbol: HNRNPH1 Synonyms: hnRNPH; HNRPH; HNRPH1 Vector: pCMV6-Entry (PS100001) E. coli Selection: Kanamycin (25 ug/mL) Cell Selection: Neomycin This product is to be used for laboratory only. Not for diagnostic or therapeutic use. View online » ©2021 OriGene Technologies, Inc., 9620 Medical Center Drive, Ste 200, Rockville, MD 20850, US 1 / 6 HNRPH1 (HNRNPH1) (NM_005520) Human Tagged ORF Clone – RC201834 ORF Nucleotide >RC201834 ORF sequence Sequence: Red=Cloning site Blue=ORF Green=Tags(s) TTTTGTAATACGACTCACTATAGGGCGGCCGGGAATTCGTCGACTGGATCCGGTACCGAGGAGATCTGCC GCCGCGATCGCC ATGATGTTGGGCACGGAAGGTGGAGAGGGATTCGTGGTGAAGGTCCGGGGCTTGCCCTGGTCTTGCTCGG CCGATGAAGTGCAGAGGTTTTTTTCTGACTGCAAAATTCAAAATGGGGCTCAAGGTATTCGTTTCATCTA CACCAGAGAAGGCAGACCAAGTGGCGAGGCTTTTGTTGAACTTGAATCAGAAGATGAAGTCAAATTGGCC CTGAAAAAAGACAGAGAAACTATGGGACACAGATATGTTGAAGTATTCAAGTCAAACAACGTTGAAATGG ATTGGGTGTTGAAGCATACTGGTCCAAATAGTCCTGACACGGCCAATGATGGCTTTGTACGGCTTAGAGG ACTTCCCTTTGGATGTAGCAAGGAAGAAATTGTTCAGTTCTTCTCAGGGTTGGAAATCGTGCCAAATGGG ATAACATTGCCGGTGGACTTCCAGGGGAGGAGTACGGGGGAGGCCTTCGTGCAGTTTGCTTCACAGGAAA TAGCTGAAAAGGCTCTAAAGAAACACAAGGAAAGAATAGGGCACAGGTATATTGAAATCTTTAAGAGCAG TAGAGCTGAAGTTAGAACTCATTATGATCCACCACGAAAGCTTATGGCCATGCAGCGGCCAGGTCCTTAT
    [Show full text]
  • 1 Supporting Information for a Microrna Network Regulates
    Supporting Information for A microRNA Network Regulates Expression and Biosynthesis of CFTR and CFTR-ΔF508 Shyam Ramachandrana,b, Philip H. Karpc, Peng Jiangc, Lynda S. Ostedgaardc, Amy E. Walza, John T. Fishere, Shaf Keshavjeeh, Kim A. Lennoxi, Ashley M. Jacobii, Scott D. Rosei, Mark A. Behlkei, Michael J. Welshb,c,d,g, Yi Xingb,c,f, Paul B. McCray Jr.a,b,c Author Affiliations: Department of Pediatricsa, Interdisciplinary Program in Geneticsb, Departments of Internal Medicinec, Molecular Physiology and Biophysicsd, Anatomy and Cell Biologye, Biomedical Engineeringf, Howard Hughes Medical Instituteg, Carver College of Medicine, University of Iowa, Iowa City, IA-52242 Division of Thoracic Surgeryh, Toronto General Hospital, University Health Network, University of Toronto, Toronto, Canada-M5G 2C4 Integrated DNA Technologiesi, Coralville, IA-52241 To whom correspondence should be addressed: Email: [email protected] (M.J.W.); yi- [email protected] (Y.X.); Email: [email protected] (P.B.M.) This PDF file includes: Materials and Methods References Fig. S1. miR-138 regulates SIN3A in a dose-dependent and site-specific manner. Fig. S2. miR-138 regulates endogenous SIN3A protein expression. Fig. S3. miR-138 regulates endogenous CFTR protein expression in Calu-3 cells. Fig. S4. miR-138 regulates endogenous CFTR protein expression in primary human airway epithelia. Fig. S5. miR-138 regulates CFTR expression in HeLa cells. Fig. S6. miR-138 regulates CFTR expression in HEK293T cells. Fig. S7. HeLa cells exhibit CFTR channel activity. Fig. S8. miR-138 improves CFTR processing. Fig. S9. miR-138 improves CFTR-ΔF508 processing. Fig. S10. SIN3A inhibition yields partial rescue of Cl- transport in CF epithelia.
    [Show full text]
  • Synergistic Targeting of the Regulatory and Catalytic Subunits of Pi3kd in Mature B-Cell Malignancies Jeffrey D
    Published OnlineFirst December 15, 2017; DOI: 10.1158/1078-0432.CCR-17-2218 Cancer Therapy: Preclinical Clinical Cancer Research Synergistic Targeting of the Regulatory and Catalytic Subunits of PI3Kd in Mature B-cell Malignancies Jeffrey D. Cooney1, An-Ping Lin1, Daifeng Jiang1, Long Wang1, Avvaru N. Suhasini1, Jamie Myers1, ZhiJun Qiu1, Albert Wol€ fler2, Heinz Sill2, and Ricardo C.T. Aguiar1,3,4 Abstract Purpose: Aberrant activation of the B-cell receptor (BCR) is loss-of-function were used to map multiple signaling inter- implicated in the pathogenesis of mature B-cell tumors, a mediaries downstream of the BCR. concept validated in part by the clinical success of inhibitors Results: Roflumilast elevates the intracellular levels of of the BCR-related kinases BTK (Bruton's tyrosine kinase) and cyclic-AMP and synergizes with idelalisib in suppressing PI3Kd. These inhibitors have limitations, including the paucity tumor growth and PI3K activity. Mechanistically, we show of complete responses, acquired resistance, and toxicity. Here, that roflumilast suppresses PI3K by inhibiting BCR-mediated we examined the mechanism by which the cyclic-AMP/PDE4 activation of the P85 regulatory subunit, distinguishing itself signaling axis suppresses PI3K, toward identifying a novel from idelalisib, an ATP-competitive inhibitor of the catalytic mechanism-based combinatorial strategy to attack BCR-depen- P110 subunit. Using genetic models, we linked the PDE4- dency in mature B-cell malignancies. regulated modulation of P85 activation to the oncogenic Experimental
    [Show full text]
  • Effects of PDE4 Pathway Inhibition in Rat Experimental Stroke
    J Pharm Pharm Sci (www.cspsCanada.org) 17(3) 362 - 370, 2014 Effects of PDE4 Pathway Inhibition in Rat Experimental Stroke Fan Yang1, Rachita K. Sumbria2,4, Dong Xue2, Chuanhui Yu2, Dan He2, Shuo Liu1 Annlia Paganini-Hill2, Mark J. Fisher1,2,3 1 Departments of Anatomy & Neurobiology, 2 Neurology,and 3 Pathology & Laboratory Medicine, University of California, Irvine, California; 4 Department of Biopharmaceutical Sciences, School of Pharmacy, Keck Graduate Institute, Claremont, California Received, April 15, 2014; Revised, July 16, 2014; Accepted July 17, 2014; Published, July 17, 2014. ABSTRACT - PURPOSE: The first genomewide association study indicated that variations in the phosphodiesterase 4D (PDE4D) gene confer risk for ischemic stroke. However, inconsistencies among the studies designed to replicate the findings indicated the need for further investigation to elucidate the role of the PDE4 pathway in stroke pathogenesis. Hence, we studied the effect of global inhibition of the PDE4 pathway in two rat experimental stroke models, using the PDE4 inhibitor rolipram. Further, the specific role of the PDE4D isoform in ischemic stroke pathogenesis was studied using PDE4D knockout rats in experimental stroke. METHODS: Rats were subjected to either the ligation or embolic stroke model and treated with rolipram (3mg/kg; i.p.) prior to the ischemic insult. Similarly, the PDE4D knockout rats were subjected to experimental stroke using the embolic model. RESULTS: Global inhibition of the PDE4 pathway using rolipram produced infarcts that were 225% (p<0.01) and 138% (p<0.05) of control in the ligation and embolic models, respectively. PDE4D knockout rats subjected to embolic stroke showed no change in infarct size compared to wild-type control.
    [Show full text]
  • Genetic and Pharmacological Approaches to Preventing Neurodegeneration
    University of Pennsylvania ScholarlyCommons Publicly Accessible Penn Dissertations 2012 Genetic and Pharmacological Approaches to Preventing Neurodegeneration Marco Boccitto University of Pennsylvania, [email protected] Follow this and additional works at: https://repository.upenn.edu/edissertations Part of the Neuroscience and Neurobiology Commons Recommended Citation Boccitto, Marco, "Genetic and Pharmacological Approaches to Preventing Neurodegeneration" (2012). Publicly Accessible Penn Dissertations. 494. https://repository.upenn.edu/edissertations/494 This paper is posted at ScholarlyCommons. https://repository.upenn.edu/edissertations/494 For more information, please contact [email protected]. Genetic and Pharmacological Approaches to Preventing Neurodegeneration Abstract The Insulin/Insulin-like Growth Factor 1 Signaling (IIS) pathway was first identified as a major modifier of aging in C.elegans. It has since become clear that the ability of this pathway to modify aging is phylogenetically conserved. Aging is a major risk factor for a variety of neurodegenerative diseases including the motor neuron disease, Amyotrophic Lateral Sclerosis (ALS). This raises the possibility that the IIS pathway might have therapeutic potential to modify the disease progression of ALS. In a C. elegans model of ALS we found that decreased IIS had a beneficial effect on ALS pathology in this model. This beneficial effect was dependent on activation of the transcription factor daf-16. To further validate IIS as a potential therapeutic target for treatment of ALS, manipulations of IIS in mammalian cells were investigated for neuroprotective activity. Genetic manipulations that increase the activity of the mammalian ortholog of daf-16, FOXO3, were found to be neuroprotective in a series of in vitro models of ALS toxicity.
    [Show full text]
  • The C-Terminal GGAP Motif of Hsp70 Mediates Substrate Recognition And
    ARTICLE cro The C-terminal GGAP motif of Hsp70 mediates substrate recognition and stress response in yeast Received for publication, March 2, 2018, and in revised form, August 30, 2018 Published, Papers in Press, September 18, 2018, DOI 10.1074/jbc.RA118.002691 Weibin Gong (宫维斌)‡1, Wanhui Hu (胡万辉)‡§1,2, Linan Xu (徐利楠)¶1, Huiwen Wu (吴惠文)‡§3,SiWu(吴思)‡§, Hong Zhang (张红)‡§, Jinfeng Wang (王金凤)‡, Gary W. Jones¶4, and X Sarah Perrett‡§5 From the ‡National Laboratory of Biomacromolecules, Chinese Academy of Sciences Center for Excellence in Biomacromolecules, Institute of Biophysics, Chinese Academy of Sciences, Beijing 100101, China, the §University of the Chinese Academy of Sciences, Beijing 100049, China, and the ¶Department of Biology, Maynooth University, Maynooth, W23 W6R7, Kildare, Ireland Edited by Ursula Jakob The allosteric coupling of the highly conserved nucleotide- containing GGAP and GGAP-like tetrapeptide repeats, can and substrate-binding domains of Hsp70 has been studied directly bind to Ure2, the Hsp40 co-chaperone Ydj1, and ␣-sy- intensively. In contrast, the role of the disordered, highly vari- nuclein, but not to the SUMO-like protein SMT3 or BSA. Dele- Downloaded from able C-terminal region of Hsp70 remains unclear. In many tion or substitution of the Ssa1 GGAP motif impaired yeast cell eukaryotic Hsp70s, the extreme C-terminal EEVD motif binds tolerance to temperature and cell-wall damage stress. This study to the tetratricopeptide-repeat domains of Hsp70 co-chaper- highlights that the C-terminal GGAP motif of Hsp70 is impor- ones. Here, we discovered that the TVEEVD sequence of Sac- tant for substrate recognition and mediation of the heat shock charomyces cerevisiae cytoplasmic Hsp70 (Ssa1) functions as a response.
    [Show full text]
  • Haploinsufficiency of Cardiac Myosin Binding Protein-C in the Development of Hypertrophic Cardiomyopathy
    Loyola University Chicago Loyola eCommons Dissertations Theses and Dissertations 2014 Haploinsufficiency of Cardiac Myosin Binding Protein-C in the Development of Hypertrophic Cardiomyopathy David Barefield Loyola University Chicago Follow this and additional works at: https://ecommons.luc.edu/luc_diss Part of the Physiology Commons Recommended Citation Barefield, David, "Haploinsufficiency of Cardiac Myosin Binding Protein-C in the Development of Hypertrophic Cardiomyopathy" (2014). Dissertations. 1249. https://ecommons.luc.edu/luc_diss/1249 This Dissertation is brought to you for free and open access by the Theses and Dissertations at Loyola eCommons. It has been accepted for inclusion in Dissertations by an authorized administrator of Loyola eCommons. For more information, please contact [email protected]. This work is licensed under a Creative Commons Attribution-Noncommercial-No Derivative Works 3.0 License. Copyright © 2014 David Barefield LOYOLA UNIVERSITY CHICAGO HAPLOINSUFFICIENCY OF CARDIAC MYOSIN BINDING PROTEIN-C IN THE DEVELOPMENT OF HYPERTROPHIC CARDIOMYOPATHY A DISSERTATION SUBMITTED TO THE FACULTY OF THE GRADUATE SCHOOL IN CANDIDACY FOR THE DEGREE OF DOCTOR OF PHILOSOPHY PROGRAM IN CELL AND MOLECULAR PHYSIOLOGY BY DAVID YEOMANS BAREFIELD CHICAGO, IL AUGUST 2014 Copyright by David Yeomans Barefield, 2014 All Rights Reserved. ii ACKNOWLEDGEMENTS The completion of this work would not have been possible without the support of excellent mentors, colleagues, friends, and family. I give tremendous thanks to my mentor, Dr. Sakthivel Sadayappan, who has facilitated my growth as a scientist and as a human being over the past five years. I would like to thank my dissertation committee: Drs. Pieter de Tombe, Kenneth Byron, Leanne Cribbs, Kyle Henderson, and Christine Seidman for their erudite guidance of my project and my development as a scientist.
    [Show full text]
  • Transcriptomic and Proteomic Profiling Provides Insight Into
    BASIC RESEARCH www.jasn.org Transcriptomic and Proteomic Profiling Provides Insight into Mesangial Cell Function in IgA Nephropathy † † ‡ Peidi Liu,* Emelie Lassén,* Viji Nair, Celine C. Berthier, Miyuki Suguro, Carina Sihlbom,§ † | † Matthias Kretzler, Christer Betsholtz, ¶ Börje Haraldsson,* Wenjun Ju, Kerstin Ebefors,* and Jenny Nyström* *Department of Physiology, Institute of Neuroscience and Physiology, §Proteomics Core Facility at University of Gothenburg, University of Gothenburg, Gothenburg, Sweden; †Division of Nephrology, Department of Internal Medicine and Department of Computational Medicine and Bioinformatics, University of Michigan, Ann Arbor, Michigan; ‡Division of Molecular Medicine, Aichi Cancer Center Research Institute, Nagoya, Japan; |Department of Immunology, Genetics and Pathology, Uppsala University, Uppsala, Sweden; and ¶Integrated Cardio Metabolic Centre, Karolinska Institutet Novum, Huddinge, Sweden ABSTRACT IgA nephropathy (IgAN), the most common GN worldwide, is characterized by circulating galactose-deficient IgA (gd-IgA) that forms immune complexes. The immune complexes are deposited in the glomerular mesangium, leading to inflammation and loss of renal function, but the complete pathophysiology of the disease is not understood. Using an integrated global transcriptomic and proteomic profiling approach, we investigated the role of the mesangium in the onset and progression of IgAN. Global gene expression was investigated by microarray analysis of the glomerular compartment of renal biopsy specimens from patients with IgAN (n=19) and controls (n=22). Using curated glomerular cell type–specific genes from the published literature, we found differential expression of a much higher percentage of mesangial cell–positive standard genes than podocyte-positive standard genes in IgAN. Principal coordinate analysis of expression data revealed clear separation of patient and control samples on the basis of mesangial but not podocyte cell–positive standard genes.
    [Show full text]
  • Analysis and Interpretation of Next-Generation Sequencing Data for the Identification of Genetic Variants Involved in Cardiovascular Malformation
    Analysis and interpretation of next-generation sequencing data for the identification of genetic variants involved in cardiovascular malformation Darren T. Houniet For the degree of Doctor of Philosophy Newcastle University Faculty of Medical Sciences Institute of Genetic Medicine February 2013 Abstract Congenital cardiovascular malformation (CVM) affects 7/1000 live births. Approximately 20% of cases are caused by chromosomal and syndromic conditions. Rare Mendelian families segregating particular forms of CVM have also been described. Among the remaining 80% of non-syndromic cases, there is a familial predisposition implicating as yet unidentified genetic factors. Since the reproductive consequences to an individual of CVM are usually severe, evolutionary considerations suggest predisposing variants are likely to be rare. The overall aim of my PhD was to use next generation sequencing (NGS) methods to identify such rare, potentially disease causing variants in CVM. First, I developed a novel approach to calculate the sensitivity and specificity of NGS data in detecting variants using publicly available population frequency data. My aim was to provide a method that would yield sound estimates of the quality of a sequencing experiment without the need for additional genotyping in the sequenced samples. I developed such a method and demonstrated that it provided comparable results to methods using microarray data as a reference. Furthermore, I evaluated different variant calling pipelines and showed that they have a large effect on sensitivity and specificity. Following this, the NovoAlign-Samtools and BWA-Dindel pipelines were used to identify single base substitution and indel variants in three pedigrees, where predisposition to a different disease appears to segregate following an autosomal dominant mode of inheritance.
    [Show full text]
  • Pirfenidone Is Renoprotective in Diabetic Kidney Disease
    BASIC RESEARCH www.jasn.org Pirfenidone Is Renoprotective in Diabetic Kidney Disease ʈ Satish P. RamachandraRao,*†‡ Yanqing Zhu,‡ Timothy Ravasi,§ Tracy A. McGowan,‡ Irene Toh,‡ Stephen R. Dunn,‡¶ Shinichi Okada,*† Michael A. Shaw,** and Kumar Sharma*†‡ *Center for Renal Translational Medicine, Division of Nephrology-Hypertension, Department of Medicine, and ʈ §Department of Bioengineering, Jacobs School of Engineering, University of California, San Diego, Scripps NeuroAIDS Preclinical Studies Centre, and †Veterans Administration San Diego Healthcare System, La Jolla, California, ‡Center for Novel Therapies in Kidney Disease, Department of Medicine, ¶Cancer Genomics Facility, Kimmel Cancer Center, and **Proteomics and Mass Spectrometry Core Facility, Department of Cancer Biology, Thomas Jefferson University, Philadelphia, Pennsylvania ABSTRACT Although several interventions slow the progression of diabetic nephropathy, current therapies do not halt progression completely. Recent preclinical studies suggested that pirfenidone (PFD) prevents fibrosis in various diseases, but the mechanisms underlying its antifibrotic action are incompletely understood. Here, we evaluated the role of PFD in regulation of the extracellular matrix. In mouse mesangial cells, PFD decreased TGF-␤ promoter activity, reduced TGF-␤ protein secretion, and inhibited TGF-␤–induced Smad2-phosphor- ylation, 3TP-lux promoter activity, and generation of reactive oxygen species. To explore the therapeutic potential of PFD, we administered PFD to 17-wk-old db/db mice for 4 wk. PFD treatment significantly reduced mesangial matrix expansion and expression of renal matrix genes but did not affect albuminuria. Using liquid chromatography with subsequent electrospray ionization tandem mass spectrometry, we iden- tified 21 proteins unique to PFD-treated diabetic kidneys. Analysis of gene ontology and protein–protein interactions of these proteins suggested that PFD may regulate RNA processing.
    [Show full text]
  • (12) Patent Application Publication (10) Pub. No.: US 2016/0289762 A1 KOH Et Al
    US 201602897.62A1 (19) United States (12) Patent Application Publication (10) Pub. No.: US 2016/0289762 A1 KOH et al. (43) Pub. Date: Oct. 6, 2016 (54) METHODS FOR PROFILIING AND Publication Classification QUANTITATING CELL-FREE RNA (51) Int. Cl. (71) Applicant: The Board of Trustees of the Leland CI2O I/68 (2006.01) Stanford Junior University, Palo Alto, (52) U.S. Cl. CA (US) CPC ....... CI2O 1/6883 (2013.01); C12O 2600/112 (2013.01); C12O 2600/118 (2013.01); C12O (72) Inventors: Lian Chye Winston KOH, Stanford, 2600/158 (2013.01) CA (US); Stephen R. QUAKE, Stanford, CA (US); Hei-Mun Christina FAN, Fremont, CA (US); Wenying (57) ABSTRACT PAN, Stanford, CA (US) The invention generally relates to methods for assessing a (21) Appl. No.: 15/034,746 neurological disorder by characterizing circulating nucleic acids in a blood sample. According to certain embodiments, (22) PCT Filed: Nov. 6, 2014 methods for S. a Nial disorder include (86). PCT No.: PCT/US2O14/064355 obtaining RNA present in a blood sample of a patient Suspected of having a neurological disorder, determining a S 371 (c)(1), level of RNA present in the sample that is specific to brain (2) Date: May 5, 2016 tissue, comparing the sample level of RNA to a reference O O level of RNA specific to brain tissue, determining whether a Related U.S. Application Data difference exists between the sample level and the reference (60) Provisional application No. 61/900,927, filed on Nov. level, and indicating a neurological disorder if a difference 6, 2013.
    [Show full text]