USOO8182996 B2

(12) United States Patent (10) Patent No.: US 8,182,996 B2 Bergeron et al. (45) Date of Patent: May 22, 2012

(54) COMPOSITIONS AND METHODS FOR 5,523,217 A 6/1996 Lupski et al. DETECTING IKLEBSIELLA PNEUMONIAE 5,541.308 A * 7/1996 Hogan et al...... 536,231 5,574,145 A 1 1/1996 Barry et al. 5,595,874. A 1/1997 Hogan et al. (75) Inventors: Michel G. Bergeron, Quebec (CA); 5,599,665 A 2f1997 Barbieri et al. Maurice Boissinot, Quebec (CA); Ann 5,627,275 A 5, 1997 Ro11 Huletsky, Quebec (CA); Christian 5,652,102 A 7/1997 Fratamico et al. Ménard, Quebec (CA); Marc Ouellette, 5,708, 160 A 1/1998 Goh et al. 5,866,336 A * 2/1999 Nazarenko et al...... 435/6 Quebec (CA); Francois J. Picard, 5,994,066 A 1 1/1999 Bergeron et al. Quebec (CA); Paul H. Roy, Quebec 6,001,564. A 12/1999 Bergeron et al. (CA) 6,037,130 A * 3/2000 Tyagi et al...... 435/6 6,582,908 B2 6/2003 Fodor et al. (73) Assignee: Geneohm Sciences Canada Inc., 6,610,836 B1* 8/2003 Breton et al...... 536,231 Quebec (CA) 2003. O180733 A1 9/2003 Bergeron et al. 2004/O185478 A1 9/2004 Bergeron et al. 2005, OO42606 A9 2/2005 Bergeron et al. (*) Notice: Subject to any disclaimer, the term of this 2006/026381.0 A1 11/2006 Bergeron et al. patent is extended or adjusted under 35 2007/OOO9947 A1 1/2007 Bergeron et al. U.S.C. 154(b) by 63 days. 2007/0105129 A1 5/2007 Bergeron et al. 2009/0047671 A1 2/2009 Bergeron et al. (21) Appl. No.: 11/842,141 2009.0053702 A1 2/2009 Bergeron et al. 2009.0053703 A1 2/2009 Bergeron et al. 2009.0068641 A1 3/2009 Bergeron et al. (22) Filed: Aug. 21, 2007 2010/0267012 A1 10/2010 Bergeron et al. FOREIGN PATENT DOCUMENTS (65) Prior Publication Data CA 2052822 4f1992 EP O133 288 2, 1985 US 2012/0058487 A1 Mar. 8, 2012 EP O133 671 3, 1985 EP O 272009 6, 1988 Related U.S. Application Data EP O 277 237 A1 8, 1988 EP O 297 291 B1 1, 1989 (63) Continuation of application No. 1 1/236,785, filed on EP O 337 896 10, 1989 Sep. 27, 2005, which is a continuation of application EP O 364. 255 4f1990 No. 10/089,177, filed as application No. EP O 438 115 A2 7, 1991 PCT/CAO0/01 150 on Sep. 28, 2000, now abandoned. EP O133 671 7, 1991 (Continued) (30) Foreign Application Priority Data OTHER PUBLICATIONS Sep. 28, 1999 (CA) ...... 2283458 Bucket al. Biotechniques, 1999, 27:528-536.* May 19, 2000 (CA) ...... 2307010 Christensen et al. FEMS Microbiology letters. 1998. 161: 89-96.* Abdulkoarim, F. et al., “Homologous Recombination between that of Genes of Salmonella typhirmulum, ” J. Mol. Biol. 260.506-522. (51) Int. Cl. Academic Press (1996). CI2O I/68 (2006.01) Altschal, et al. “Basic Local Alignment Search Tool.” J. Mol.Biol. CI2P 19/34 (2006.01) 215: 403-410 (1990). C7H 2L/02 (2006.01) Amann, R. et al., “B-Subunit of ATP-synthase; a Useful Marker for C7H 2L/04 (2006.01) Studying the Phylogenetic Relationship of Eubacteria.” Journal of General tollosobiotogy 134: 22I5-2821, Soddy for General (52) U.S. Cl...... 435/6.15:435/6.1; 435/6.11: 435/6.12: Microbiology (1988). 435/91.2:536/23.7:536/24.32:536/24.33 Anborgh, P. et al., “New Antibiotic that acts specifically on the (58) Field of Classification Search ...... None GTP-bound form of elongation FactorTu.” The EMBO.J., vol. 10, No. See application file for complete search history. 4:779-784, IRL Press (1991). (56) References Cited (Continued) Primary Examiner — Carla Myers U.S. PATENT DOCUMENTS (74) Attorney, Agent, or Firm — Knobbe Martens Olson & 4,816,389 A 3, 1989 Sansonetti et al. Bear 5,030,556 A 7, 1991 Beaulieu et al. 5,041,372 A 8/1991 Lampel et al. (57) ABSTRACT 5,084,565 A 1/1992 Parodos et al. Four highly conserved genes, encoding translation elongation 5,089,386 A 2f1992 Stackebrandt et al. factor Tu, translation elongation factor G, the catalytic Sub 5,162,199 A 11/1992 Stern et al. unit of proton-translocating ATPase and the RecA recombi 5,232,831 A 8, 1993 Milliman et al. 5,292.874 A 3, 1994 Milliman nase, are used to generate species-specific, genus-specific, 5,298,392 A 3, 1994 Atlas et al. family-specific, group-specific and universal nucleic acid 5,334.501 A 8, 1994 Adams et al. probes and amplification primers to rapidly detect and iden 5,389,513 A 2/1995 Baquero et al. tify algal, archaeal, bacterial, fungal and parasitical patho 5,401,631 A 3, 1995 Lane et al. gens from clinical specimens for diagnosis. The detection of 5.437,978 A 8, 1995 Ubukata et al. associated antimicrobial agents resistance and toxin genes are 5,472,843. A 12/1995 Milliman 5,476,929 A 12/1995 Briles et al. also under the scope of the present invention. 5,523,205 A 6, 1996 Cossart et al. 9 Claims, 17 Drawing Sheets US 8,182,996 B2 Page 2

FOREIGN PATENT DOCUMENTS Brenner, D.J. et al., “Polynucleotide Sequence Divergence Among EP O 466 251 1, 1992 Strainsof Escherichia coli and Closely Related Organisms,” Journal EP O466 251 1, 1992 of Bacteriology, vol. 109, No. 3: 953-965, American Society for EP O 527 628 A1 2, 1993 Microbiology (1972). EP O337 896 7, 1993 Brenner, D.J. et al., “Enterobacter gergoviae sp. nov: a New Species EP O 577 523 1, 1994 ofEnterobacteriacae Found in Clinical Specimens and the Environ EP O 630973 A2 12, 1994 EP O 652291 A1 5, 1995 ment.” International Journal of Systematic Bacteriology, vol.30, No. EP O 695 803 A2 2, 1996 1: 1-6, Society for General Microbiology (1980). EP O 761815 3, 1997 Brenner D.J. et al., “Attempts to Classify Herbicola Group— EP O 786 519 7/1997 Enteroacter agglomerans Strains by Deoxyribonucleic Acid EP O 804 616 11, 1997 Hybridzation and Phenotype Tests.” International Journal of FR 2584419 A1 1, 1987 SystematicBacteriology, vol. 34, No. 1: 4-55, Society for General FR 2599743 A1 12, 1987 Microbiology (1984). FR 2636O75 3, 1990 FR 2685,334 A1 6, 1993 Brenner, D.J. et al., “Enterobacter asburiae sp. nov., a New Species FR 2686604 A1 7, 1993 Found in Clinical Specimens, and Reassignment of Erwinia dis FR 2699539 A1 6, 1994 solvens and Erwinia nimipressuralis to the Genus Enterobacter as JP 06-054700 3, 1994 Enterobacter dissolvens comb, nov. and Enterobacter nimipressoalis JP 06-090798 4f1994 comb. nov.” Journal of Clinical Microbiology, vol. 23, No. 6: 114 JP 06-165681 6, 1994 120, American Society for Microbiology (1986). JP O7-O67657 3, 1995 JP O7-209294 8, 1995 Brenner, D.J., “Introduction to the Family Enterobacteriaceas, in WO WO 90,14444 11, 1990 Balows, A. et al: “The Prokaryotes, A Handbook on the Biology of WO WO91,08305 6, 1991 Bacteria: Ecophysiology, Isolation, Identification, Applications'. WO WO91f11531 8, 1991 2nd Edition, vol. III, Chapter 141, p. 2673-2695,Springer-verlag WO WO91f16454 10, 1991 (1992). WO WO91, 18926 12/1991 Brenner, D.J. Additional Genera of Enterobacteriaceae', in Balows, WO WO92fO3455 3, 1992 A. et al. “The Prokaryotes, A Handbook on the Biology of WO WO92/11273 7, 1992 WO WO92, 14488 9, 1992 Bacteria: Ecophysiology, Isolation, Identification, Applications'. 2nd WO WO93,03186 2, 1993 Edition,vol. III, Chapter 155, p. 2922-2937. Springer-Verlag (1992). WO WO93/1224.5 6, 1993 Brenner. D.J., “Calssification of Citrabacteria by DNA Hybridiza WO WO94f02645 2, 1994 tion: Designation of Citrobacter farneri sp. nov. Citrobacter WO WO94f17205 8, 1994 youngae sp. nov. Citrobacter braolai sp. nov. Citrobacter WO WO95/OO650 1, 1995 werkmaniisp. nov. Citrabactersedlakfisp. nov. and Three Unnamed WO WO95/09025 4f1995 Citrobacter Genomospecies.” International Journal of Systematic WO WO95/20055 7, 1995 WO WO 96.00298 1, 1996 Bacteriology, vol.43, No. 4645-658, Society for General Microbiol WO WO96,02648 2, 1996 ogy (1993). WO WO96,08582 3, 1996 Brenner, D.J., “Biochemical Identification of Citrobacter Species WO WO96, 18745 6, 1996 Defined by DNA Hybridization and Description of Citrobacter gil WO WO 98.2O157 5, 1998 lenil sp. nov. (Formerly Citrobacter Genomospecies 10) and WO WO99,24059 5, 1999 Citrobacter murltriae sp. nov. (Formerly Citrobacter Genomspecies WO WOOOf 14274 3, 2000 II)” Journal of Clinical Microbiology, vol. 37, No. 8: 2619-2624, WO WOO1,23604 4/2001 American Society for Microbiology (1999). WO WO 2004/055205 T 2004 Caldas, T.D. et al., “Chaperone Properties of Bacterial Elongation OTHER PUBLICATIONS FactorEF-Tu.” The Journal of Biological Chemistry, vol. 273, No. 19: Anderson, R.C., et al. (1998). “Micro Total Analysis Systems 98.” 11478-1 1482, American Society for Biochemistry and Molecular Kluwer Academic Publishers, Dordreoht, The Netherlands, pp. Biology (1998). 11-16, 221-224. Carrino, J.J., et al. (1997), “Ligation-Based Nucleic Acid Probe Belay, N. et al., “Methanogenic Bacteria from Human Dental Methods,” in Nucleic Acid Amplification Technology. Application to Plaque.” Applied and Environmental Microbiology, vol. 54, No. 2: Disease Diagnosis, Eaton Publishing, Boston, MA. pp. 61-123. 600-603, American Society for Microbiology (1988). Cha, R.S., and Thilly, W.G. (1995) “Specificity, Efficienty, and Bercovier, H. et al., “Intra- and Interspecies Relatedness of Yersinia Fidelity of PCR” in PCR Primer; A Laboratory Manual, Dieffenbach, pestis by DNA Hybridization and Its Relationship to Yersinia C.W., and Dveksler, G.S., eds. pp. 37-51, 53-62, 143-155, Cold pseudotubercuiosis.” Current Microbiology, vol. 4: 225-229, Spring Harbor Laboratory Press, Plainview, NY. Springer International (1980). Chen, K. et al., “Broad Range DNA probes for detecting and Berg, et al. Development of an amplification and hybridization assay amplifyingeubacterial nucleic acids.” FEMS Microbiology Letters, for the specific and sensitive detection of Mycoplasma fermenians 57:19-24, Elsevier/North Holland (1989). DNA. Molecular and Cellular Probes. 10:7-14 (1996). Chin, N.H.L. et al., “Mass Spectrometry of Nucleic Acids.” Clinical Bergeron, M.G. et al., “Diagnosing Bacterial Infectious Diseases In Chemistry,45. No. 9:1578, American Association for Clinical Chem OneHour: An Essential Upcoming Revolution.” Infection 23, No. 2: istry (1999). 5-8, Verlagsgesellschaft Otto Spatz (1995). Christenson, H. et al., “Phylogenetic relationships of Salmonella Bergeron, M.G. et al., “Preventing Antibiotic Resistance through based on DNA sequence comparison ofatp D encoding thef Subunit Rapid Genotypic Identification of Bacteria and of Their antibiotic of ATP synthase.” FEMS Microbiology Letters, 161: 89-96, Elsevier/ Resistance Genes in the Clinical Microbiology Laboratory.” Journal North Holland (1998). of Clinical Microbioloty, vol. 36, No. 8: 2169-2172, American Soci Cilja, V. et al., “Sequence Heterogeneities Among 16S Ribosornal ety for Microbiology (1998). RNA Sequences, and Their Effect on Phylogenetic Analyses at the Berkenkamp, S. et al., “Infrared MALDI Mass Spectrometry of Species Level.” Mol. Biol. Evol., 13(3): 451-461, Society for Molecu Large Nucleic Acids.” Science, vol. 281:260-262, American Asso lar Biology and Evolution (1996). ciation for the Advancement of Science (1998). Clayton, R.A. et al., “Intraspecific Variation in Small, Subunit rRNA Brenner, D.J. et al., “Polynucleotide Sequence Relatedness Among Sequences in GenBank: Why Single Sequences May Not Adequately ThreeGroups of Pathogenio Escherichia coli Strains.” Infection and Represent ProkaryoticTaxa.” International Journal of Systematic Immunity, vol. 6, No. 3:308-315. American Soceity for Microbiol Bacteriology, vol. 45, No. 3:59, Society for General Microbiology ogy (1972). (1995). US 8,182,996 B2 Page 3

Cousineau, B. et al., “On the Origin of Protein Synthesis Factors: A Ibrahim A. et al. (1993). “The phylogeny of the genus Yersinia based Gene Duplication/Fusion Model.” J. Mol. Evol. 45:661 on 16S rDNA sequences.” FEMS Microbiology Letters 114: 173-178 670,Springer-Verlag (1997). and correction published in FEMS Microbiology Letters 116 (1994) Crolzé J. (1995), “Les Méthodes automatisées d identification des at p. 243, IRL Press. bacteries a laube de 1995.” La Lettre de 1 Infectiologue, Tornek, No. Iwabe, N. et al., “Evolutionary relationship ofarchaebacteria, 4:109-113, Fivactis Media & Akoa. eubacteria, and eukaryotes inferred from phylogenetto trees of dupli Dickey, R.S. et al., “Ernended Descriptions of Enterobacter cancero cated genes.” Proc. Natl. Acad. Sci. USA, vol. 86: 9355-9359. enus comb. nov. Formerly Erwiniar cancerogena).” International National Academy of Sciences (1989). Journal of systematic Bacteriology, vol. 38, No. 4:371-374, Society Izard, D. et al., “Deoxyribonucicic Acid Relatedness Between Enterobacter cloacae and Enterobacter arnnigenus sp. for General Microbiology (1988). nov.” International Journal of Systematic Bacteriology, vol. 31: Egholm M. et al., “PNA hybridizes to complementaryol 35-42, Society for General Microbiology (1981). ligonucleotides obeying the Watson-Crick hydrogen-bonding rules.” Janda, J.M. et al., “Prototypal Diarrheagenic Strains of Hafnia alvei Nature vol. 365: 566-568, Nature Publishing Co. (1993). Are actually Members of the Genus Escherichia.” Journal of Clinical Farmer, J.J. et al., “Enterobacter salazakii: A New Species of Microbiology, vol. 37: 2399-2401, American Society for Microbiol "Enterobacteriaceau' Isolated from Clinical Specimens.” Interna ogy (1999). tional Journal of Systematic Bacteriology, vol. 30, No. 3: 569-584. Kellogg, D.E. et al., “TaqStart Antibody(TM): 'Hot Start PCR Society for General Microbiology (1980). Facilitated by a Neutralizing Monoclonal Antibody Directed Against Farmer, JJ, et al., (1985), "Biochemical Identification of New Spe Taq DNA Polymerase.” BioTechniques, vol. 16: 1134-1134, Eaton cies and Biogroups of Enterobacteriaceae Isolated from Clilnical Pulishing Company (1994). Specimens,” Journal of Clinical Microbiology, vol. 21, No. 1: 46-76, Kimura, M., “A Simple Method for Estimating Evolutionary Rates of American Society for Microbiology (1985). Base Substitutions Through Comparative Studies of Nucleotide Farmer J.J. et al., “Escheriachia fergusonil and Enterobacter Sequences.” J. Mol.Evol., vol. 16: 111-120, Springer-Verlag (1980). taylarae, Two New Species of Enterobacteriaceae Isolated from Kitch.T. et al., “Evaluation of RapID on E System for Identification of Clinical Specimens,” Journal of Clinical Microbiology, vol. 21, No. 379 Strains in the Family Enterobaciariaceae and Oxidase-Negative, 1: 77-81, American Society for Microbiology (1985). Gram-Negative Nonfermenters,” Journal of Clinical Microbiology, Farmer, J.J., “Proposed Rewording of Rule 10C of the vol. 32: 931-934, American Society for Microbiology (1994). Kloos, W.E. et al., “Simplified Scheme for Routine Identification of BacteriologicalCode.” International Journal of Systematic Bacteriol Human Staphylococcus Species,” Journal of Clinical Microbiology, ogy, vol. 35. No. 2, p. 222, Society for General Microbiology (1985). vol. 1: 82-88, American Society for Microbioloty (1975). Filer, D. et al., “Duplication of the tuf Gene, which encodes peptide Koenig C. et al., “Analyses of the FlashTrack DNA Probe and chain elongation factortu, is widespread in gram-negative bacteria.” UTIscreen Bioluminescence Tests for Bacteriuria.” Journal of Clini Journal of Bacteriology, vol. 148, No. 3:006-1011, American Society cal Microbiology, vol.30: 342-343, American Society for Microbiol for Microbiology (1981). ogy (1992). Fischer, D. et al., “Preducting structures for genome proteins.” Curr. Koshkin, A.A. et al., “LNA (Locked Nucleic Acids): Synthesis of the Opin. Struct. Biol. 9: 208-211, Current Biology (1999). Adenine, Cytosine, Guanine, 5-Methylcytosine, Thymine and Uracil Flores N. et al., “Recovery of DNA from Agurose Gels Stained with Bicyclonucleoside Monomers, Oligomerisation, and Unprecedented ethylene Blue.” Circle Reader Service No. 138, vol. 13:203-5, The Nucleic Acid Recognition.” Tetrahedron 54; 3607-3630, Pergamon Scientist (1992). Press (1998). Fox, G.E. et al., “How close is close: 16SrRNA Sequence identify Livak K.J. et al., “Oligonucleotides with Fluroescent Dyes at Oppo may not be sufficient to guarantee species Identify.” International site Ends Provide a Quenched Probe System Useful for Detecting Journal of Systematic Bacteriology, vol. 42, No. 1: 166-170, Society PCR Product and Nucleic Acid Hybridization.” PCR Methods and for General Microbiology (1992). Applications, vol. 4: 357-362, Cold Spring Harbor Laboratory Press Gavini, F. et al. “Transfer of Enterobacter agglomerous (Beljeriuck (1995). 1888) Ewing and Fife 1972 toPantoea geninov, as Pantoea Ludwig, W. et al., “Complete Nucleotide sequences of agglomerans comb.nov.and Description of Pantoea dispersa sp. Seveneubacteral genes coding for the elongation factorTu: Func tional, structural and phylogenetic evaluations.” Archives of Nov.”International Journal of Systematic Bacteriology, vol.39, No. Microbiology, vol. 153: 241-247. Springer-Verlag (1990). 3:337-345, Society for General Microbiology (1989). Miller, R.V. et al., “General Microbiology oftecA: Environmental Gogarten, J.P. et al. (1989), “Evolution of the vacuolar H+ATPase: and Evolutionary Significance.” Annu. Rev. Microbiol. 44:365-394. Implication for the origin ofeukaryotes.” Proc. Natl. Acad. Sci. USA, Annual Reviews, Inc. (1990). vol. 86: 6661-6665, National Academy of Sciences (1989). Mollet, C. et al., “rpoB sequence analysis as a novel basis for bacterial Greer, J., “Comparative Modeling of Homologous Proteins.” Meth identification.” Molecular Microbioloty, 26:1005-1011, Blackwell ods in Enzymology, vol. 202: 239-252, Academic Press (1991). Scientific Publications (1997). Grunberg-Manago, M., “Regulation of the Expression of Murakami, et al. "Identification of methicillin-resistant strains of Aminoactyl-tRNA Synthetases and Translation Factors'. in Staphylococci by polymerase chain reaction.” Journal of Clinical Neidhart, F.C. Ed. “Escherichia coli and Salmonella, Cellular and Microbioloty, 29(10): 2240-2244 (1991). Molecular Biology', 2nd Ed., vol. 1, ASM Press, Washington, DC, p. Nelson, N. et al., “The evolution of H+ ATPases', TIBS 14:113 1432-1457 (1996). 116, Elsevier (1989). Guex N. et al., “Protein modelling for all.” TIBS 24: 364 Nichols, R. et al., “A universal nucleoside for use of ambiguous sites 367.Elsevier (1999). in DNA rpimers.” Letters to Nature, 369: 492-493, Nature Publishing Gupta, R.S., “Protein Phylogenics and Signature Sequences: A Reap Co. (1994). praisal of Evolutionary Relationships among Archaebacteria, Pezzlo, M.T. et al., “Detection of Bacteriurla and Pyuria by Eubacteria, Eukaryotes.” Microbiology and Molecular Biology URISCREEN, a Rapid Enzymatic Screening Test”, Journal of Clini Reviews, vol. 62, No. 4: 1435-1941. American Society for Microbiol cal Microbioloty, 30:680-684, American Society for Microbiology ogy (1998). (1992). Hedegaard, J. et al., “Identification of Enterobacterlaoeae by partial Porcella, S.F. et al., “Identification of an EF-Tu protein that sequencing of the gene encoding translation initiation factor 2. Inter isperiplasm-associated and processed in Neissteria gonorrhoeae'. national Journal of Systematic Bacteriology, 49:1531-1538, Society Microbiology 142:2481-2489, Plenium Press (1996). for General Microbioloty (1999). Reeve, J.H., “Guest Commentary: Archaebacteria Then ... Archacs Hill, C.W. et al., “Inversions between ribosomal RNA genes of Now (Are There Really No Archaeal Pathogens?),” Journal of Bac Escherichia coli, ' Proc. Natl. Acad.Sci. USA, vol. 78, No. 11: teriology, 181:3613-3617. American society for Microbiology 7069-7072, National Academy of Sciences (1981). (1999). US 8,182,996 B2 Page 4

Relmaa, D.A., and Persing, D.H., (1996) "Genotypic Methods for York, M.K. et al., “Evaluation of the autoSCAN-WIA Rapid System Microbial Identification.” In PCR Protocols for Emerging Infectious for Identification and Susceptibility Testing o Gram-Nagative Fer Diseases, a Supplement to Diagnostic Molecular Microbioloty and mentative Bacilli.” Journal of Clinical Microbiology, 30(1):2903 Applications, ASM Press, Washington, DC pp. 3-31. 2910, American Society for Microbiology (1992). Sali, A., “Modelling mutations and homologous proteins. Current Abe et al., A Sensitive Method for the Detection of Enterotoxigenic Opinion Biotechnology 6:437-451, Current Biology (1995). Escherichia coli by the Polymerase Chain Reaction Using Multiple Sanchez, R. et al., “Advances in comparative protein-structure Primer Pairs, Zentralbl Bakteriol. (1992) 277(2): 170-8 (Abstract). modelling.” Curr. Opin. Struct. Biol. 7:206-214. Current Biology Akaboshi et al., Nucleotide sequence of the recA gene of Proteus (1997). mirabilis, Nucleic Acids Res. (1989) 17(11): 4390-4390. Saraste, M.M. et al., “The alp operon: nucleotide sequence of the An et al., The Nucleotide Sequence of tufB and four nearby trNA Structural Genes of Escherichia coli. Gene, (1980) 12(1-2): 33-39. genes for they, B and Osubunits of Escherichia coli ATP synthase.” Ashimoto et al., Molecular epidemiology of Staphylococcus spp. Nucleic Acids Research 9:5287-5296, Oxford University Press contamination in the ward environment: study on mecA and fema (1981). genes in methicillin-resistant strains, Kasenshogaku Zasshi (1995) Sela, S. et al., “Duplication of the tuf Gene: a New Insight into the 69: 15-20. Phylogeny ofEubacteria.” Journal of Bacteriology, 171:581-584. Bäckman et al., Evaluation of an Extended Diagnostic PCRAssay for American Society for Microbiology (1989). Detection and Verification of the Common Causes of Bacterial Men Selander, R.K. et al., “Evolutionary Genetics opf Salmonella ingitis in CSF and other Biological Samples, Mol Cell Probes (1999) enterica” In Escherichia coli and Salmonella Cellular and Molecular 13: 49-60. Biology, 2nd Edition, vol. 2, 147:2691-2707, American Society for Bei et al., Multiplex PCR amplification and immobilized capture Microbioloty (1996). probes for detection of bacterial pathogens and indicators in water, Sharma, N.K. et al., “Identification of Yersinia Species by the API Mol. Cell. Probes (1990) 4: 353–365. 20E.” Journal of Clinical Microbioloty, 28:1443-1444, American Bellet al., Outer Membrane Protein H1 of Pseudomonas aeruginosa: Society for Microbiology (1990). Purification of the Protein and Cloning and Nucleotide Sequence of Sproer, C. et al., “The phylogenetic position of Serratia, Buttiauxella the Gene, J Bacteriol. (1989) 171(6): 3211-3217. and Some other genera of the family Entgerobacterfacae''. Interna Bentley et al., Development of PCR-based Hybridization Protocol tional Journal of Systematic Acteriology, 49: 1433-1438, Society for for Identification of Streptococcal Species, JClin Microbiol. (1995) General Microbiology (1999). 33(5): 1296-1301. Stackebrandt, E, et al., “Taxonomic Note: A Place for DNA-DNA Black et al., Detection of streptococcal pyrogenic exotoxin genes by Reassociation and 16S rRNA Sequence Analysis in the Present Spe a nested polymerase chain reaction, Mol. Cell. Probes, 7 (1993) cies Definition in Bacteriology”. International Journal of Systematic 255-259. Bacteriology, 44:846-849, Society for General Microbiology (1994). Brakstadet al., Detection of Staphylococcusa aureus by Polymerase Stager C.E. et al., “Automated systems for Identification of Micro Chain Reaction Amplification of the nuc Gene, J. Clin Microbiol. organisms’. Clinical Microbiology Reviews, 5:342-327. American (1992)30(7): 1654-1660. Soceity for Microbiology (1992). Brakstad et al., Comparison of Various Methods and Reagents for Stark, R.P. et al., "Baceriuria in the Catheterized Patient'. The New Species Identification of Staphylococcus aureus Positive or Negative England Journal of Medicine, 311:560-464, Massachusetts Medical for the mecA Gene, APMIS (1993) 101 (9):651-654. Soceity (1984). Brakstad et al., Multiplex Polymerase Chain Reaction for Detection Stelgerwalt, A.G. et al., “DNA relatedness among species of of Genes for Staphylococcus aureus Thermonuclease and Methicillin Enterobacter and Serratia, Can. J. Microbiol. 22:131-137, National Resistance and Correlation with Oxacilin Resistance, APMIS(1993) Research Council of Canada (1975). 101 (9): 681-688. Takezaki, N. et al., “Phylogenetic Test of the Molecular Clock Brakstad et al., Direct Identification of Staphylococcus aureus in andLinearized Trees.” Mol. Biol. Evol. 12(5):823-833, University of blood cultures by detection of the gene encoding the thermostable Chicago Press (1995). nuclease or the gene product, APMIS (1995) 103: 209-218. Tang.Y.-W., et al. (1999), "Molecular Detection and Identification of Bremaud et al Genetic and molecular analysis of the tRNA-tufB Microorganisms,” in Manual of Clinical Microbioloty, 7th Edition, operon of the myxobacterium Stigmatella aurantiaca, Nucleic Acids ASM Press, Washington, DC pp. 215-244. Res. (1995)23(10): 1737-1743. Taylor, W.R., “Remotely related sequences and structures: analysis Brenner et al., Encoded combinatorial chemistry, Proc Natl AcadSci, and predictivemodelling.” Trends Biotechnol. 12(5):154-158, USA (1992) 89: 5381-5383. Elsevier Science Publishers (1994). Brisson-Noël et al. Evidence for natural gene transfer from gram Tenover, F.C., and Unger, E.R.,(1993), "Nuclelo Acid Probes for positive cocci to Escherichia coli, J Bacteriol. (1988) 170(4): 1739 Detection and Identification of Infectious Agents.” in Diagnostic 1745. Molecular Microbiology. Principles and Applications, American Buck, et al., Design Strategies and Performance of Custom DNA Society for Microbiology, Washington, DC pp. 3-87. Sequencing Primers, Biotechniques (1999). 27(3): 528-536. Vigenboom, E. et al., “Three tuf like genes in the kirromycin pro Carlin et al., Monoclonal antibodies specific for elongation factor Tu ducer Streptomyces ramoscissioms', microbiology, 14):983-998. and complete nucleotide sequence of the tufgene in Mycobacterium Plenum Press (1994). tuberculosis, Infect Immun. (1992) 60(8): 3136-3142. Wang, R. et al., “Phylogenetin analysis and identification of Shigella Chamberland et al., Antibiotic susceptibility profiles of 941 gram spp. by molecular probes'. Molecular and Cellular Probes, 11:427 negative bacteria isolated from Septicemi patients throught Canada: 432, Academic Press (1997). The Canadian Study Group, Clin Infect Dis. (1992) 15(4): 615-628. Watson, J.D. et al., (1987) “Molecular Biology of the Gene', 4th Chen et al., Transcription and expression of the exotoxin a gene of Edition, The Benjamin/CummingPublishing Company, Inc., Menlo Pseudomonas aeruginosa, Gen Microbiol. (1987) 133 (11): 3081 Park, CA, pp. 431–462. 3091. Weaver, G.A. et al., “Incidence of methanogenic bacteria in a Cleuziat et al., Specific detection of Escherichia coli and Shigella sigmoidoscopy population: an association of nethanogenic bacteria species using fragments of genes coding for b-glucuronidase, FEMS and diverticulosis.' Gut 27:698-704, British Medical Association Microbiol. Letters, (1990) 72: 315-322. (1986). Cormican et al., Multiplex PCR for identifying mycobacterial iso Westin, L., et al., “Anchored multiplex amplification on a microelec lates, J. Clin Pathol. (1995) 48:203-205. tronic chip array.” Nature Biotechnology, 18:199-204. Nature Pub Cote et al. Molecular Typing of Haemophilus influenzae. Using a lishing Co. (2000). DNA Probe and Multiplex PCR, Mol Cell Probes, (1994)8(1): 23-37. Whitcombe, D. et al., “Detection of PCR products using self Deneer et al., Species-Specific Detection of Listeria monocytogens probingamplicons and fluorescence.” Nature Biotechnology, 17:804 by DNA amplification, Appl. Envion Mircobiol. (1991) 57(2): 606 807, Nature Publishing Co. (1999). 609. US 8,182,996 B2 Page 5

Designer PCR. The advertisement from Research Genetics. Nucleic Griffin et al., Eds. PCR Technology—Current Innovations; Shar Acids Res. 22(15), Aug. 11, 1994. rocks, Chapter 2: The Design of Primers for PCR; CRC Press (1994) Dieffenbach et al. Eds. PCR Primer: A laboratory manual, Kwok et 5-11. al., Design and use of mismatched and degenerate primers, Cold Guay et al., Detection of the Pathogenic Parasite Toxoplasma gondii Spring Harbor Laboratory Press (1995) pp. 143-155. by Specific Amplification of Ribosomal Sequences Using Dopazo, et al., A Computer Program for the Design of PCR Primers Comultiplex Polymerase Chain Reaction, J. Clin Microbiol. (1993) for Diagnosis of Highly Variable Genomes, J Virol Meth. (1993) 31(2): 203-207. 41: 157-165. Gutierrez et al., Point Mutations that Reduce the Expression of Drmanac et al., DNA Sequence Determination by Hybridization: A malPQ, a Positively Controlled Operon of Escherichia coli, J Mol strategy for efficient large-scale sequencing, Science (1993) 260: Biol. (1984) 177(1): 69-86. 1649-1652. Horii et al., Organization of the recA Gene of Escherichia coli, Proc Dutilh et al., Specific Amplifications of a DNA Sequence Common Natl AcadSci USA. (1980) 77(1): 313-317. Toall Chylamydia trachomatis Serovars using the Polymerase Chain Hotomi et al., Detection of Haemophilus influenzae in Middle Ear of Reaction, Res Microbiol., (1989) 140: 7-16. Otitis Media with Effusion by Polymerase Chain Reaction, Int J Dutka-Malen et al., Sequence of the vanC gene of Enterococcus Pediatr Otorhinolaryngol. (1993)27(2): 19-26. gallinarum BM4174 encoding a D-alanine: D-alanine ligase-related Houard, et al. Specific Identification of Bordetella pertussis by the protein necessary for Vancomycin resistance, Gene (1992) 112: Polymerase Chain Reaction, Res Microbio. (1989) 140: 477-487. 53-58. Hynes et al., PCR. Amplification of Streptococcal DNA Using Crude Dutka-Malenet al., Detection of Glycopeptide Resistance Genotypes Cell Lysates, FEMS Microbiol Lett. (1992)94: 139-142. and Identification to the Species Level of Clinically Relevant Innis et al., Eds. Statistical Refinement of Primary Design Param Enterococci by PCR, J Clin Microbiol. (1995)31(1): 24-27. eters, PCR Applications; Beasley et al., Statistical refinement of East et al., Cloning and Sequence Determination of six Staphylococ primer design parameters, Academic Press (1999) Chapter 5: 55-71. cus aureaus betalactamasses and their expression in Escherichia coli Johnson, et al. Urinary Tract Infections in Women: Diagnosis and and Staphylococcus aureus, J Gen Microbiol. (1989) 135(4): 1001 Treatment, Ann Intern Med. (1989) 111: 906-917. 15. Kamla, (1994) Database EMPRO EMBLAC: Z34275. Edwards et al., Multiplex PCR: Advantages, Development, and Kaper et al., Pathogenicity islands and Other Mobile Genetic Ele Applications, PCR Meth. Appl. (1994) 3: 565-575. ments of Diarrheagenic Escherichia coli, Am Soc Microbio. (1999) Emori et al. An Overview of Nosocomial Infections, Including the 3: 33-58. Role of Microbiology Laboratory. Clin Microbiol Rev. (1993) 6(4): Kaufhold et al., Identical Genes Confer High-Level Resistance to 428-442. Gentamicin upon Enterococcus faecalis, Enterococcus faecium, and Evers et al., Sequence of the vanB and ddl Genes Encoding Streptococcus agalactiae, Antimicrob Agents Chemother. (1992) D-alanine:D-lactate and D-alanine:D-alanine Ligases in 36(6): 1215-1218. Vancomycin-resistant Enterococcus faecalis V583. Gene. (1994) Kearns et al., Rapid Detection of Methicillin-Resistant Staphylococci 140(1): 97-102. by Multiplex PCR, J Hosp Infect. (1999)43: 33-37. Experimental Protocol concerning Enablement of EP-B1804 616 Khan et al., Detection of Pseudomonas aeruginosa from Clinical and signed by Martin Gagnon/Marc Ouellette on Mar. 24, 2004. Environmental Samples by Amplification of the Exotoxin A Gene Eykyn et al., The Causative Organisms of Septicaemia and Their Using PCR, Appl Environ Microbiol. (1994) 60(10): 3739-3745. Epidemiology. J Antimicrob Chemother. (1990) 25 Suppl C: 41-58. Kong et al., Co-detection of Three Species of Water-borne Bacteria Figueroa et al., Multiplex Polymerase Chain Reaction based Assay by Multiplex PCR, Marine Pollution Bulletin, (1995) 31 (4-12): for the Detection of Babesia bigemina, Babesia bovis andAnaplasma 317-324. marginale DNA in Bovine Blood, Vet Parasit., (1993) 50: 69-81. Kwok et al., Avoiding False Positive with PCR, Nature (1989) 339: Fischer et al., Mannitol-specific Phosphoenolpyruvate-dependent 237-238. Phosphotransferase System of Enterococcus faecalis: Molecular Le Bouguenec et al., Rapid and Specific Detection of the pap, afa, and Cloning and Nucleotide Sequences of the Enzyme III' Gene and Sfa Adhesin-encoding Operons in Uropathogenic Escherichia coli the Mannitol-1-phosphate Dehydrogenase Gene, Expression in Strains by Polymerase Chain Reaction, J. Clin Microbiol. (1992) Escherichia coli, and Comparison of the Gene Products with Similar 30(5): 1189-1193. Enzymes, J Bacteriol. (1991) 173(12): 3709-3715. Li et al., Identification of Bordetella pertussis Infection by Shared Fleischmann et al., Whole-genome Random Sequencing and Assem primer PCR, J. Clin Microbiol., (1994) 32(3): 783-789. bly of Haemophilus influenzae Rd. Science (1995) 269(5223): 496 Loechel et al., Nucleotide Sequence of the tuf Gene from 512. Mycoplasma genitalium, Nucleic Acids Res. (1989) 17(23): 10127. Fratamico et al., Detection of Escherichia coli O157:H7 by multiplex Lowe et al., Nucleotide Sequence of the Aliphatic Amidase Regulator PCR, J Clin Microbiol., (1995) 33(8): 2188-2191 Gene (amiR) of Pseudomonas aeruginosa, FEBS Lett. (1989) 246 Friedlandet al., Development of a Polymerase Chain Reaction Assay (1-2): 39-43. to Detect the Presence of Streptococcus pneumoniae DNA, Diagn Ludwig et al., (1994) Database EMPRO. EMPBL AC:X76863, Microbio Infect Dis. (1994) 20(4): 187-193. X76866, X76867, X76871, X76872. Gannon et al., Rapid and Sensitive Method for Detection of Shiga Ludwig et al., Phylogenetic relationships of Bacteria based on com like Toxin-producing Escherichia coli in Ground Beef Using the parative sequence analysis of elongation factor Tu and ATP-synthase Polymerase Chain Reaction. Appl Env Microbiol. (1992) 58(12): B-subunit genes, Antonie von Leeuwenhoek (1993) 64:285-305. 3809-3815. Malloy et al., Detection of Borrelia Burgdorferi Using Polymerase Gehaetal. Multiplex PCR for Identification of Methicillin-Resistant Chain Reaction, J Clin Microbiol. (1990), 28(6): 1089-1093. Staphylococci in the Clinical Labortory, J. Clin Microbiol. (1994), McIntosh et al., Detection of Pseudomonas aeruginosa in Sputum 32(7): 1768-72. from Cystic Fibrosis Patients by the Polymerase Chain Reactions, GenBANKGI: 147581 online Sep. 14, 1992 retrieved on Oct. 12, Mol Cell Probes (1992) 6(4): 299-304 Abstract. 2008), retrieved from http://www.ncbi.nlm.nik.gov/entrez/ McMillin et al., Simultaneous Detection of Toxin A and Toxin B viewerfcgi? 147581:OLDID: 114614 (4 pages). Genetic Determinants of Clostridium difficile Using the Multiplex Gillespie et al., Detection of Streptococcus pneumoniae in sputum Polymerase Chain Reaction, Can J Microbiol. (1992) 38: 81-83. samples by PCR, J Clin Microbiol. (1994) 32(5): 1308-11. Monod et al., Sequence and Properties of pIM13: A Macrollide Gray et al., Cloning, Nucleotide Sequence, and Expression in lincosamide-streptogramin B resistance Plasmid from Bacillus Escherichia coli of the Exotoxin A Structural Gene of Pseudomonas subtilis, J Bacteriol. (1986) 167(1): 138-147. aeruginosa, Proc Natl AcadSci USA. (1984) 81(9): 2645-2649. Murphy et al., (1986) Database EMPRO. EMBL. ACX03216. Greisen et al., PCR Primers and Probes for the 16S rRNA Gene of O'Callaghan et al., Development of a PCR Probe Test for Identifying Most Species of Pathogenic Bacteria, Including Bacteria Found in Pseudomonas aeruginosa and Pseudomonas (Burkholderia) Cerebospinal Fluid, J. Clin Microbiol. (1994) 32(2): 335-351. cepacia, J Clin Pathol. (1994) 47(3): 222-226. US 8,182,996 B2 Page 6

Ohama et al., Organization and Codon Usage of the Streptomycin Tyler et al., Streptococcal Erythrogenic Toxin Genes: Detection by Operon in Microcuccus luteus, a Bacterium with a High Genomic Polymerase Chain Reaction and Association with Disease in Strains G+C Content, J Bacteriol. (1987) 169(10): 4770-4777. Isolated in Canada from 1940 to 1991, J. Clin Microbiol. (1992) Olcén et al., Rapid Diagnosis of Bacterial Meningitis by a 30(12): 3127-3131. Seminested PCRStrategy, ScandJ Infect Dis. (1995)27(5): 537-539. Ubukata et al., Rapid Detection of the mecA Gene in Methicillin Ouellette et al., Precise Insertion of Antibiotic Resistance Determi resistant Staphylococci by Enzymatic Detection of Polymerase nants into Tn21 like Transposons: Nucleotide Sequence oftheOXA-1 Chain Reaction Products, JClin Microbiol. (1992)30(7): 1728-1733. f5-lactamase Gene, Proc Natl Acad Sci. USA (1987) 84: 7378-7383. Ueyama et al., High Incidence of Haemophilus influenzae in Palm et al., Evolution of Catalytic and Regulatory Sites in Nasopharyngeal Secretions and Middle Ear Effusions as Detected by Phosphorylases, Nature (1985)313(6002): 500-502. PCR, J. Clin Microbiol. (1995) 33(7): 1835-1838. Perlee, et al. (1993) Database EMPRO EMBL, Translation elonga Unal et al., Detection of Methicillin-Resistant Staphylococci by tion factor EF-Tu of Borrelia burgdorferi—CA:L23125. Using the Polymerase Chain Reaction, J. Clin Microbio. (1992) Pezzlo, Detection of Urinary Tract Infections by Rapid Methods, 1685-1691. Clin Microbiol Rev. (1988) 1(2): 268-280. van Ketel, Detection of Haemophilus influenzae in Cerebrospinal Podbielski, Streptococcus agalactiae Camp Gene. Submitted to Fluids by Polymerase Chain Reaction DNA Amplification, J Med Genbank database on Mar. 22, 1993, Accession No. 72754. Microbiol. (1990) 33: 271-276. Podzorski et al., Molecular Detection and Identification of Microor Vannuffel et al., Specific Detection of Methicillin-Resistant ganisms in Manual of Clinical Microbiology, (1995) ASM Press, pp. Staphylococcus Species by Multiplex PCR. J. Clin Microbiology, 130-157. (1995) 2864-2867. Pollard et al., A Polymerase Chain Reaction (PCR) Protocol for the Wang et al. A 16S rDNA-based PCRMethod for Rapid and Specific Specific Detection of Chlamydia spp., Mol Cell Probes... (1989) 3: Detection of Clostridium perfringens in Food, Mol Cell Probes 383-389. (1994) 8(2): 131-137. Post et al., Molecular Analysis of Bacterial Pathogens in Otitis Media Watson et al., Molecular Biology of the Gene, 4th Ed. The Genetic with Effusion, JAMA (1995) 273(20): 1598-1604. Code: The Benjamin/Cummings Publishing Company, Inc., (1976) Priebe, et al., Nucleotide Sequence of the hexa Gene for DNA Mis Chapter 15, pp. 339-358. match Repair in Streptococcus pneumoniae and Homology of hexa Way et al., Specific Detection of Salmonella spp. By Multiplex Polymerase Chain Reaction, App Environ Microbiol. (1993) 59(5): to mutS of Escherichia coli and Salmonella typhimurium. J. 1473-1479. Bacteriol. (1988) 170: 190-196. Weickmann and Weickmann, Reference D34, European Opposition Pritchard et al., Possible Insertion Sequences in a Mosaic Genome for EP 0804616Spezifität der Primer, Annex II: Specific and ubiqui Organization Upstream of the Exotoxin A Gene in Pseudomonas tous primers for DNA amplification, 11 pages, (Sep. 13, 2007). aeruginosa, J Bacteriol. (1990) 172(4): 2020-2028. Weickmann and Weickmann, Reference D35, European Opposition Radström et al., Detection of Bacterial DNA in Cerebrospinal Fluid for EP 0804616, Vergleich: Bacterial species: Escherichia coli, 1 p. by an Assay for Simultaneous Detection of Neisseria meningitidis, (Sep. 13, 2007). Haemophilus influenzae, and Streptococci Using a Seminested PCR Weickmann and Weickmann, Reference D40, European Opposition Strategy, J. Clin Microbiol. (1994) 32(11): 2738-2744. for EP 0804616, Comparison of Sequences TRP0O3 and TRP004 of Rosa et al., A Specific and Sensitive Assay for the Lyme Disease W093/1224.5 with Seq ID No. 5 of EP 804616 (Sep. 13, 2007). Spirochete Borrelia burgdorferi Using the Polymerase Chain Reac Weickmann and Weickmann, Reference D43, European Opposition tion, J Infect Dis. (1989) 160(6): 1018-1028. for EP 0804616Comparison of Sequence E. coli malPQ operon, Rosa et al., Polymerase Chain Reaction Analyses Identify Two Dis 5'-end of Gutierrez et al., J. MoI. Biol. 177(1) (1984) 69-86 with Seq tinct Classes of Borrelia Burgodorferi, J. Clin Microbiol. (1991) ID No. 6 (glycogen phosphorylase) of EP804616; of Sequence E.coli 29(3): 524-532. recA gene, 5'-region of Zhao et al., Mol.Gen. Genet. 222(2-3) (1990) Rudolph et al., Evaluation of Polymerase Chain Reaction for Diag 369-376 with Seq ID No. 7 of EP804616, and of exotoxin A gene of nosis of Pneumococcal Pneumonia, JClin Microbiol. (1993)31(10): Chen et al., J. Gen. Microbiol. 133(11) (1987) 3081-3091 with Seq 2661-2666. ID No. 18 of EP 804616 (Sep. 13, 2007). Ryffel et al., Sequence Comparison of mecA Genes Isolated from Weickmann and Weickmann, Reference D49, European Opposition Methicillin-resistant Staphylococcus aureus and Staphylococcus for EP 0804616, Vergleich (Sequence Comparison) der Seq ID No. epidermidis, Gene (1990) 94(1): 137-8. 26 (Haemophilus influenzae omp P1 gene) aus EP804616 und Sonde Sambrook et al., Eds. Molecular Cloning: A Laboratory Manual, 2nd 106baus EP804616 mit Primer Homplund Homp3 aus Cote S. Etal. Ed. Cold Spring Harbor Laboratory Press, (1989) pp. 1.21-1.52. Mol. Cell. Probes (Feb. 1994) 8:23-37 (Sep. 13, 2007). 9.31-9.62, 10.1-10.70, and 11.1-11.61. Weickmann and Weickmann, Reference D50, European Opposition Sanger et al., DNA Sequencing with Chain-Terminating Inhibitors, for EP 0804616, Vergleich der Seq ID No. 27 (Haemophilus PN.A.S. (1977)74(12):5463-5467. influenzaetransformation gene cluster)und Primer 154 b/w 155bund Schaechter et al., Mechanisms of Microbial Disease. The Enteric Sonde 107b aus EP804616 mit Primer Htra3aus Cote S. et al., Mol. Bacteria: Diarrhea and Dysentery, Dept Microbiol Immunol. (1989), Cell. Probes (Feb. 1994) 8:23-37. 17: 256-265. Weickmann and Weickmann, Reference D52, European Opposition Shaw et al., Isolation, Characterization, and DNA Sequence Analysis for EP 0804616, Comparison of Seq ID No. 8 to 21 of EP577523 with of an ACC(6')-II Gene from Pseudomonas aeruginosa, Antimicro neuraminidase nanA of Streptococcus pneumoniae (cf. Seq ID No. Agents Chimo. 33(12): 2052-2062. 35 of EP804616). Silvestrini et al., Nitrite Reductase from Pseudomonas aeruginosa: Weickmann and Weickmann, Reference D54, European Opposition Sequence of the Gene and the Protein, FEBS Lett. (1989) 254(1-2): for EP 0804616, Comparison of Seq ID No. 1 and Primers YR2 and 33-38. YR6 of FR2686604 with primers Seq ID No. 141 and 142 of Spierings et al., Characterization of the Citrobacter freundii phoE EP804616 (Sep. 13, 2007). Gene and Development of C. freundii-specific Oligonucleotides, Weickmann and Weickmann, Reference D56, European Opposition FEMS Microbiol. Letters (1992) 99:199-204. for EP 0804616, Vergleich der Seq ID No. 33 (Streptococcus Stacy-Phipps et al. Multiplex PCR Assay and Simple Preparation pyogenes Exotoxin A gene) aus EP804616 und Primern Seq ID Nos. Method for Stool Specimans Detect Enterotoxigenic Escherichia 143 bzw. 144b (EP804616) mit speA-Primern P1-P4 aus Black C.M. Coli DNA during Course of Infection, JClin Microbio. (1995).33(5): et al., Mol. Cell. Probes (1993) 7:255-259 und speA-primern SPEA 1054-1059. 1, SPEA-2 aus Tyler S.D. et al., J.Clin.Microbiol. Dis. (1992) Su et al., Nucleotide Sequence of the Gelatinase Gene (gelE) from 30:3127-3131 (Sep. 13, 2007). Enterococcus faecalis subsp. Liquefaciens, Infect. Immun. (1991) Weickmann and Weickmann, Reference D58, European Opposition 59(1): 415-420. for EP 0804616, References for target genes (Sep. 13, 2007). US 8,182,996 B2 Page 7

Weickmann and Weickmann, Reference D72, European Opposition Paradis et al., The Potential of EF-Tu Sequences for Identification of for EP 0804616Vergleich der Seq ID Nos. 18 und 20 (Pseudomonas Clinically Important Enterobacteriaceae Species (Sep. 1999) 39: aeruginosa) aus EP804616 und der entSprechenden Probesequenzen 227; Abstract 1574. Seq ID Nos. 87-90 und 94 +95 mit Primer und Probesequenzen Post et al., Development and Validation of a Multiplex PCR-based ETA1-ETA7 aus Khan et al., Appl. Environment. Microbiol. Oct. Assay for the Upper Respiratory Tract Bacterial Pathogens 1994. Haemophilus influenzae, Streptococcus pneumoniae, and Moraxella White et al., The Polymerase Chain Reaction: Clinical Applications, catarrhalis, (1996) 1(1): 29-39. Adv. Clin Chem. (1992) 29:161-196. Zhanel et al., Antimicrobial Resistance in Haemophilus influenzae Wilson et al., Detection of Enterotoxigenic Staphlococcus aureus in Dried Skimmed Milk: Use of the Polymerase Chain Reaction for and Moraxella catarrhalis Respiratory Tract Isolates: Results of the Amplification and Detection of Staphylococcal Enterotoxin Genes Canadian Respiratory Organizm Susceptibility Study, 1997 to 2002, entB and entCI and the Thermonuclease Gene nuc. Appl Environ Antimicrob Agents Chemother. (Jun. 2003)47(6): 1875-1881. Microbiol. (1991) 1793-1798. Ako-Nai et al., The Characterisation of Clinical Isolates of Wittwer et al., Rapid Cycle DNA Amplification: Time and Tempera Staphylococcus aureus in Ile-Ife, Nigeria, J Med Microbiol. (1991) ture Optimization, Biotechniques (1991) 10(1): 76-83. 34: 109-112. Yanofsky et al. The Complete Nucleotide Sequence of the Bongaerts et al. In Vitro Activities of BAYY3118, Ciprofloxacin, Tryptophan Operon of Escherichia coli. Nucleic Acids Res. (1981) Ofloxacin, and Fleroxacin against Gram-Positive and Gram-Nega 9(24): 6647-6668. tive Pathogens from Respiratory Tract and Soft Tissue Infections, Yoshikawa et al., Bacillus subtilis Genes for RNA Polymerase beta Antimicro Agents Chemother. (Sep. 1993) 37(9):2017-2019. Subunit, Ribosomal Proteins L 12 and S7, Elongation Factors G and Derecola et al. A 5-Year Surveillance Study of 44.691 Isolates of Tu and Ribosomal Proteins S10 and L3, EMBL. AC: D64127. Sub Haemophilus influenzae Project Beta-Alert 1993-1997, Antimicro mitted to DDB/EMBL/Genbank database on Apr. 14, 1995. Agen Chemothera. (Jan. 1999) 43(1):185-186. Zakrewska-Czerwinska et al., Identification of Staphylococcus GenBANK Accession No. M37185, Enterococcus faecalis epidermidis. Using a 16S rRNA-directed Oligonucleotide Probe, Gelatinase (gelE) Gene, Complete CDS (Apr. 1993). FEMS Microbiol Lett. (1992) 100: 51-58. GenBANK Accession No. Z26902, Phylogenetic Analysis. Using Zambardi et al., Laboratory Diagnosis of Oxacillin Resistance in 16S rDNA Sequencing of Staphylococci (Oct. 1993). Staphylococcus aureus by a Multiplex-polymerase Chain Reaction Guzmnan et al., Role of Adherence in Pathogenesis of Enterococcus Assay, Diagn Microbiol Infect Dis. (1994) 19:25-31. Zhang et al., Cloning, Sequencing, and Expression in Escherichia faecalis Urinary Tract Infection and Endocarditis, Infect Immun. coli of the Gene Encoding a 45-Kilodalton Protein, Elongation Factor (Jun. 1989) 57(6): 1834-1838. Tu, from Chlamydia trachomatis Serovar F. J. Bacteriol. (1994) Izumiya et al., Characterization of Multidrug-Resistant Salmonella 176(4): 1184-1187. enterica Serovar Typhimurium Isolated in Japan, J. Clin Microbio. Zhao et al., DNA Sequence Analysis of the recA Genes from Proteus (Jul 2001) 39(7): 2700-2703. vulgaris, Etwinia carotovora, Shigella flexneri and Escherichia coli Jenkins, F. J. Basic Methods for the Detection of PCR Products, B/r, Mol Gen Genet. (1990) 222(2-3): 369-376. Genome Res. (Apr. 1994)3:S77-S82. International Search Report dated Jul. 1, 1998 from PCT/CA97/ Jordá, et al. Diagnosis of Nosocomial Pneumonia in Mechanically 00829, filed Nov. 4, 1997. Ventilated Patients by the Blind Protected Telescoping Catheter, International Search Report dated Apr. 12, 2002 from PCT CA00/ Intensive Care Med. (1993) 19:377-382. 0 1 150, filed Sep. 28, 2000. Kim et al., Simultaneous Detection by PCR of Escherichia coli, Aragón et al., Increase in?-lactam-resistant Proteus mirabilis Strains Listeria monocytogenes and Salmonella typhimurium in Artificially due to CTX-M- and CMY-type as well as New VEB-and Inhibitor Inoculated Wheat Grain, Interl J Food Microbio. (Apr. 2006) resistant TEM-type B-Iactamases, J Antimicro Chemother. (2008) 111:21-25. 61: 1029-1032. Lewis et al., Emergence of Clinical Isolates of Staphylococcus aureus Bagley et al., Significance of Fecal Coliform-positive Klebsiella, Resistant to Gentamicin and Correlation of Resistance with App Environ Microbio. (May 1977) 33(5): 1141-1148. Bacteriophage Type, (Mar. 1978) 137(3): 314-317. Duncan, Susceptibility of 1,500 Isolates of Pseudomonas aeruginosa Miller et al., Community Acquired Lobar Pneumonia in Patients with to Gentamicin, Carbenicillin, Colistin, and Polymyxin B, Antimicro Agents Chemother. (Jan. 1974) 5(1): 9-15. HIV Infection and AIDS, Thorax (Apr. 1994) 49:367–368. Feizabadi, Drug Resistant Patterns of Enterococci Recovered from Neu, Harold C. The Crisis in Antibiotic Resistance, Science (Aug. Patients in Tehran During 2000-2003, Letters to the Editor; Int J 1992) 257:1064-1073. Antimicrob Agents (2004) 24: 521-522. Powers, Robert D., New Directions in the Diagnosis and Therapy of Fenoll et al., Serotype Distribution and Antimicrobial Resistance of Urinary Tract Infections, (1991) Am J ObstetGynecol., 164: 1387 Streptococcus pneumoniae Isolates Causing Systemic Infections in 1389. Spain, 1979-1989, (1991) 13: 56-60. Betzlet al., Identification of Lactococci and Enterococci by Colony Higashide et al., Methicillin-resistant Staphylococcus saprophyticus Hybridization with 23S rRNA-Targeted Oligonucleotide Probes, Isolates Carrying Staphylococcal Cassette Chromosome mec Have Appl Environ Microbio. (Sep. 1990) 56(9):2927-2929. Emerged in Urogenital Tract Infections, Antimicrob Agents Ehrlich et al., Eds. PCR-Based Diagnosis in Infectious Disease, Chemother. (Jun. 2008) 52(6): 2061-2068. Chapters 1,3, Blackwell Scientific Publications (1994), pp. 3-18 and Madico et al., Touchdown Enzyme Time Release-PCR for Detection 45-55. and Identification of Chlamydia trachomatic, C. pneumoniae, and C. Mitsuhashi M., Technical Report: Part 2. Basic Requirements for psittaci Using the 16S and 16S-23S Spacer rRNA Genes, J. Clin Designing Optimal PCR Primers, JClin Lab Anal., (1996) 10: 285 Microbiol. (Mar. 2000) 38(3): 1085-1093. 293. Metherell et al., Rapid, sensitive, mircobial detection by gene ampli Bei et al., Detection of coliform bacteria and Escherichia coli by fication using restriction endonuclease target sequences, Mol Cell multiplex polymerase chain reaction: Comparison with defined Sub Probes (1997) 11:297-308. strate and plating methods for water quality monitoring, Appl NCBI Blast: Nucleotide Sequence, Attachment for Sequence Com Environ Microbio. (Aug. 1991) 57(8): 2429-2432. parison between 5'-CCAGCTGTATTAGAAGTA-3' from Seq ID No. Cebula, et al., Simultaneous identification of strains of Escherichia 9 and Genomes of Bacteria bacillus cereus Q1 and AH187. (online: coli Serotype O157:H7 and their shiga-like toxin type by mismatch Apr. 12, 2009) 1 page. amplification mutation assay-multiplex PCR. J. Clin Microbio. (Jan. NCBI Blast: Nucleotide Sequence, Attachment for Sequence Com 1995) 33(1): 248-250. parison between 5'CTGAACATTATCTTTGAT-3' from Seq ID Frankel et al., Multi-gene amplification: simultaneous detection of No. 10 and Complete Genome of Streptococcus Mutans UA159, three virulence genes in diarrhoeal stool, Mol Microbio. (1989) (online: Apr. 12, 2009) 1 page. 3(12): 1729-1734. US 8,182,996 B2 Page 8

GenBank Accession No. FJ858146. Enterococcus faecium Strain Bergeron, M.G. et al., “Diagnosing Bacterial Infectious Diseases in QSE32 fsr Operon, Complete Sequence; and GelE (gelE) and SprE One Hour: An Essential Upcoming Revolution.” Infection 23, No. (sprE) Genes, Complete CDS. (Nov 2009) http://www.ncbi.nlm.nih. 2:5-8, Verlagsgesellschaft Otto Spatz (1995). gov/nuccore/226938234. Bergeron, M.G. et al., “Preventing Antibiotic Resistance through GenBank Accession No. AP000565, Homo Sapiens Genomic DNA, Rapid Genotypic Identification of Bacteria and of Their antibiotic Chromosome 21O22, clone:f79A10, D21S226-AML Region, Com Resistance Genes in the Clinical Microbiology Laboratory.” Journal plete Sequence, (Nov. 1999) http://www.ncbi.nlm.nih.gov/nuccore? of Clinical Microbiology, vol. 36, No. 8:2169-2172, American Soci 6O15482. ety for Microbiology (1998). Haas et al., Universal PCR primers for detection of phytopathogenic Berkenkamp, S. et al., “Infrared MALDI Mass Spectrometry of Agrobacterium strains, App Environ Microbio. (Aug. 1995) 61 (8): Large Nucleic Acids.” Science, vol. 281 260-262, American Asso ciation for the Advancement of Science (1998). 2879-2884. Birnboim, H.C. And Doly, J., Nucleic Acids Research, p. 1513-1523, Harth et al., Epidemiology of Vibrio parahaemolyticus Outbreaks, Oxford University Press (1979). Southern Chile, Emerg Infect Dis. (Feb. 2009) 15(2): 163-168 and Brenner, D.J. et al., “Polynucleotide Sequence Relatedness Among GenBank Accession No. EU185084 downloaded from http://ncbi. Three Groups of Pathogenic Escherichia coli Strains.” Infection and nlm.nih.gov/nuccore/158524083. Immunity, vol. 6, No. 3: 308-315. American Society for Microbiol Kaltenboecket al., Two-step polymerase chain reactions and restric ogy (1972). tion endonuclease analyses detect and differentiate Ompa DNA of Brenner, D.J. et al., “Polynucleotide Sequence Divergence Among Chlamydia spp., J. Clin Microbio. (May 1992) 30(5): 1098-1104. Strains of Escherichia coli and Closely Related Organisms,” Journal Lucotte et al. A multiple primer pairs polymerase chain reaction for of Bacteriology, vol. 109, No. 3:953-965, American Society for the detection of human genital papillomavirus types, Mol Cell Probes Microbiology (1972). (1993) 7: 339-344. Brenner, D.J. et al., “Enterobacter gergoviae sp. nov.: a New Species Opposition Brief by Infectio Diagnostic (I.D.I.) Inc. dated Sep. 14. of Enterobacteriaceae Found in Clinical Specimens and the Envi 2007 from EP Application No. 95931 109.3, filed Sep. 12, 1995. ronment.” International Journal of Systematic Bacteriology vol. 30, Opposition Brief by Roche Diagnostics GmbH dated Sep. 21, 2007 No. 1: 1-6, Society for General Microbiology (1980). from EP Application No. 95931 109.3, filed Sep. 12, 1995. Brenner, D.J. et al., “Escherichia vulneris: a New Species of Reply Brief by Roche Diagnostics GmbH dated Jan. 29, 2008 to Enterobacteriaceae Associated with Human Wounds,” Journal of Clinical Microbiology, vol. 15, No. 6: 1133-1140, American Society Opposition Brief by I.D.I. from EP Application No. 95931 109.3, for Microbiology (1982). filed Sep. 12, 1995 (w/English translation). Brenner D.J. et al., “Attempts to Classify Herbicola Group Reply Briefby I.D.I. dated Apr. 1, 2008 to Roche's Appeal Brief from Enterobacter agglomerans Strains by Deoxyribonucleic Acid EP Application No. 95931 109.3, filed Sep. 12, 1995. Hybridization and Phenotypic Tests.” International Journal of Sys EPONotice of Summons to Oral Proceedings and Preliminary Opin tematic Bacteriology, vol. 34, No. 1:4-55, Society for General ion dated May 20, 2010 from EP Application No. 95931 109.3, filed Microbiology (1984). Sep. 12, 1995. Brenner, D.J. et al., “Enterobacter asburiae sp. nov., a New Species Reply Brief by I.D.I. dated Sep. 6, 2010 to Summons/Preliminary Found in Clinical Specimens, and Reassignment of Erwinia dis Opinion from EP Application No. 95931 109.3, filed Sep. 12, 1995. solvens and Erwinia nimipressuralis to the Genus Enterobacter as Reply Brief by Roche dated Sep. 6, 2010 to Summons/Preliminary Enterobacter dissolvens comb. nov. and Enterobacter nimipres Opinion from EP Application No. 95931 109.3, filed Sep. 12, 1995 suralis comb. nov.” Journal of Clinical Microbiology, vol. 23, No. (w/English translation). 6:114-120, American Society for Microbiology (1986). EPO Notice of Decision of Appeal dated Oct. 6, 2010 from EP Brenner, D.J., “Introduction to the Family Enterobacteriaceae', in Application No. 95931 109.3, filed Sep. 12, 1995. Balows, A. et al: “The Prokaryotes, A Handbook on the Biology of Abdulkarim, F. et al., “Homologous Recombination between the tuf Bacteria: Ecophysiology, Isolation, Identification, Applications'. Genes of Salmonella typhimurium,'J. Mol. Biol. 260:506-522. Aca 2nd Edition vol. III, Chapter 141, p. 2673-2695, Springer-Verlag demic Press (1996). (1992). Altschul, S.F. et al., “Basic Local Alignment Search Tool.” J. Mol. Brenner, D.J. "Additional Genera of Enterobacteriaceae' in Balows, Biol. 215:403-410, Academic Press (1990). A. et al. “The Prokaryotes, A Handbook on the Biology of Bacteria: Amann, R. et al., "B-Subunit of ATP-synthase: a Useful Marker for Ecophysiology, Isolation, Identification, Applications'. 2nd Edition, Studying the Phylogenetic Relationship of Eubacteria.” Journal of vol. III, Chapter 155, p. 2922-2937, Springer-Verlag (1992). General Microbiology 134: 2815-2821, Society for General Brenner, D.J., “Classification of Citrabacteria by DNA Hybridiza Microbiology (1988). tion: Designation of Citrobacter fatmeri sp. nov. Citrobacter Aminov, et al. “Cloning, sequencing and complementation analysis youngae sp. nov, Citrobacter braakii sp. nov. Citrobacter Werkmanii of the recA gene from Prevotella ruminicola.” FEMS Microbiology sp. nov. Citrobacter sedlaki sp. nov. and Three Unnamed Letters. 144:53-59 (1996). Citrobacter Genomospecies.” International Journal of Systematic Anborgh, P. et al., “New antibiotic that acts specifically on the GTP Bacteriology, vol.43, No.4: 645-658, Society for General Microbiol bound form of elongation factor Tu.” The EMBO J., vol. 10, No. ogy (1993). 4:779-784, IRL Press (1991). Brenner, D.J., “Biochemical Identification of Citrobacter Species Anderson, R.C., et al. (1998). “Micro Total Analysis Systems Defined by DNA Hybridization and Description of Citrobacter gil '98.”Kluwer Academic Publishers, Dordrecht, The Netherlands, pp. lenii sp. nov. (Formerly Citrobacter Genomospecies 10) and 11-16, 221-224. Citrobacter murliniae sp. nov. (Formerly Citrobacter Genomospe Belay, N. et al., “Methanogenic Bacteria from Human Dental cies 11)” Journal of Clinical Microbiology, vol. 37, No. 8: 2619 Plaque.” Applied and Environmental Microbiology, vol. 54, No. 2624, American Society for Microbiology (1999). 2:600-603, American Society for Microbiology (1988). Caldas, T.D. et al., “Chaperone Properties of Bacterial Elongation Belay N. et al., “Methanogenic Bacteria in Human Vaginal Samples.” Factor EF-Tu.” The Journal of Biological Chemistry, vol. 273, No. Journal of Clinical Microbiology, vol. 28 No. 7:1666-1668, Ameri 19:11478-11482, American Society for Biochemistry and Molecular can Society for Microbiology (1990). Biology (1998). Bercovier, H. et al., “Infra- and Interspecies Relatedness of Yersinia Carrino, J.J., et al. (1997), “Ligation-Based Nucleic Acid Probe pestis by DNA Hybridization and Its Relationship to Yersinia Methods,” in Nucleic Acid Amplification Technologies. Application pseudotuberculosis.” Current Microbiology, vol. 4: 225-229, to Disease Diagnosis, Eaton Publishing, Boston, MA. pp. 61-123. Springer International (1980). Cha, R.S., and Thilly, W.G. (1995) “Specificity, Efficiency, and Berg, et al. Development of an amplification and hybridization assay Fidelity of PCR” in PCR Primer; A Laboratory Manual, Dieffenbach, for the specific and sensitive detection of Mycoplasma fementans C.W., and Dveksler, G.S., eds., pp. 37-51, 53-62, 143-155, Cold DNA. Molecular and Cellular Probes. 10:7-14 (1996). Spring Harbor Laboratory Press, Plainview, NY. US 8,182,996 B2 Page 9

Chen, K, et al., “Broad range DNA probes for detecting and ampli Gogarten, J.P. et al. (1989), “Evolution of the vacuolar H+ATPase: fying eubacterial nucleic acids.” FEMS Microbiology Letters, 57:19 Implication for the origin of eukaryotes.” Pros. Natl. Acad. Sci. USA, 24, Elsevier/North Holland (1989). vol. 86: 6661-6665, National Academy of Sciences (1989). Chiu, N.H.L. at al., “Mass Spectrometry of Nucleic Acids.” Clinical Greer, J., “Comparative Modeling of Homologous Chemistry, 45, No. 9:1578, American Association for Clinical Chem Proteins.”Methods in Enzymology, vol. 202: 239-252, Academic istry (1999). Press (1991). Christensen, H. at al., “Phylogenetic relationships of Salmonella Grunberg-Manago, M., "Regulation of the Expression of Aminoacyl based on DNA sequence comparison of aipD encoding the f subunit tRNA Synthetases and Translation Factors', in Neidhart, F.C. Ed. of ATP synthase.” FEMS Microbiology Letters, 161: 89-96, Elsevier/ "Escherichia coli and Salmonella, Cellular and Molecular Biology”. North Holland (1998). 2nd Ed., vol. 1, ASM Press, Washington, DC, p. 1432-1457 (1996). Cilia, V. et al., “Sequence Heterogeneities Among 16S Ribosomal Guex N. et al., “Protein modelling for all.” TIBS 24: 364-367, RNA Sequences, and Their Effect on Phylogenetic Analyses at the Elsevier (1999). Species Level.” Mol. Biol. Evol., 13(3):451-461, Society for Molecu Gupta, R.S., “Protein Phylogenies and Signature Sequences: A lar Biology and Evolution (1996). Reappraisal of Evolutionary Relationships among Archaebacteria, Clayton, R.A. et al., “Intraspecific Variation in Small, Subunit rRNA Eubacteria, and Eukaryotes.” Microbiology and Molecular Biology Sequences in GenBank: Why Single Sequences May Not Adequately Reviews, vol. 62, No.4: 1435-1491, American Society for Microbiol Represent Prokaryotic Taxa.” International Journal of Systematic ogy (1998). Bacteriology, vol. 45, No. 3:59, Society for General Microbiology Hart, D.L. et al., “The Population Genetics of Escherichia coli.” Ann. (1995). Rev. Genet., 18: 31-68, Annual Reviews, Inc. (1984). Cousineau, B. et al., “On the Origin of Protein Synthesis Factors: A Hedegaard, J. et al., “Identification of Enterobacteriaceae by partial Gene Duplication/Fusion Model.” J. Mol. Evol. 45: 661-670, sequencing of the gene encoding translation initiation factor 2. Inter Springer-Verlag (1997). national Journal of Systematic Bacteriology, 49:1531-1538, Society Croizé J. (1995), “Les méthodes automatisees d identification des for General Microbiology (1999). bacteries a 1 aube de 1995.” La Lettre del Infectiologue, Tomek, No. Hill, C.W. et al., “Inversions between ribosomal RNA genes of 4:109-113, Vivactis Media & Akoa, Abstract. Only. Escherichia coli. Proc. Natl. Acad. Sci. USA, vol. 78, No. 11: Dickey, R.S. et al., “Emended Descriptions of Enterobacter cancero 7069-7072, National Academy of Sciences (1981). enus comb. nov. Formerly Erwinia cancerogena).”International Jour Ibrahim A. et al. (1993). “The phylogeny of the genus Yersinia based on I6S rDNA sequences.” FEMS Microbiology Letters 114: 173-178 nal of systematic Bacteriology, vol. 38, No. 4: 371-374. Society for and correction published in FEMS Microbiology Letters 116 (1994) General Microbiology (1988). at p. 243, IRL Press. Egholm M. et al., “PNA hybridizes to complementary Iwabe, N. et al., “Evolutionary relationship of archaebacteria, oligonucleotides obeying the Watson-Crick hydrogen-bonding eubacteria, and eukaryotes inferred from phylogenetic trees of dupli rules.” Nature vol. 365: 566-568, Nature Publishing Co. (1993). cated genes.” Proc. Natl. Acad. Sci. USA, vol. 86: 9355-9359. Ehrlich, G.D. et al. (1994), "PCR-Based Diagnostics in Infectious National Academy of Sciences (1989). Disease”. Blackwell Scientific Publications, Boston, MA. pp. 6-18, Izard, D. et al., “Deoxyribonucleic Acid Relatedness Between 47-55. Enterobacter cloacae and Enterobacter amnigenus sp. nov.” Inter Fani. R. et al., “Use of random amplified polymorphic DNA (RAPD) national Journal of Systematic Bacteriology, vol. 31:35-42, Society for generating specific DNA probes for Microorganisms. Molecular for General Microbiology (1981). Ecology, 2: 243-250, Blackwell Scientific Publications (1993). Janda, J.M. et al., “Prototypal Diarrheagenic Strains of Hafnia alvei Farmer, J.J. et al., “Enterobacter sakazakii: A New Species of Are actually Members of the Genus Escher Ichia.” Journal of Clinical ''Enterobacteriaceae" Isolated from Clinical Specimens.” Interna Microbiology, vol. 37: 2399-2401, American Society for Microbiol tional Journal of Systematic Bacteriology, vol. 30, No. 3:569-584. ogy (1999). Society for General Microbiology (1980). Kellogg, D.E. et al., “TaqStart Antibody(TM): 'Hot Start PCR Farmer, J.J. et al., (1985). "Biochemical Identification of New Spe Facilitated by a Neutralizing Monoclonal Antibody Directed Against cies and Biogroups of Enterobacteriaceae Isolated from Clinical Taq DNA Polymerase.” BioTechniques, vol. 16: 1134-1137, Eaton Specimens,” Journal of Clinical Microbiology, vol. 21, No. 1: 46-76, Publishing Company (1994). American Society for Microbiology (1985). Kimura, M., “A Simple Method for Estimating Evolutionary Rates of Farmer J.J. et al., “Escherichiafergusonii and Enterobacter taylorae, Base Substitutions Through Comparative Studies of Nucleotide Two New Species of Enterobacteriaceae Isolated from Clinical Sequences.” J. Mol. Evol., vol. 16: 111-120, Springer-Verlag (1980). Specimens,” Journal of Clinical Microbiology, vol. 21, No. I: 77-81. Kitch.T. et al., “Evaluation of RapID on E System for Identification of American Society for Microbiology (1985). 379 Strains in the Family Enterobacteriaceae and Oxidase-Negative, Farmer, J.J., “Proposed Rewording of Rule 10C of the Bacteriologi Gram-Negative Nonfermenters,” Journal of Clinical Microbiology, cal Code.” International Journal of Systematic Bacteriology, vol. 35. vol. 32: 931-934, American Society for Microbiology (1994). No. 2, p. 222, Society for General Microbiology (1985). Kloos, W.E. et al., “Simplified Scheme for Routine Identification of Filer, D. et al., “Duplication of the tuf Gene, which encodes peptide Human Staphylococcus Species,” Journal of Clinical Microbiology, chain elongation factor tu, is widespread in gram-negative bacteria.” vol. I: 82-88, American Society for Microbiology (1975). Journal of Bacteriology, vol. 148, No. 3:006-1011, American Society Koenig C. et al., “Analyses of the FlashTrack DNA Probe and for Microbiology (1981). UTlscreen Bioluminescence Tests for Bacteriuria.” Journal of Clini Fischer, D. et al., “Predicting structures for genome proteins.” Curr. cal Microbiology, vol. 30: 342-345 American Society for Microbiol Opin. Struct. Biol.9: 208-211, Current Biology (1999). ogy (1992). Flores N. et al., “Recovery of DNA from Agarose Gels Stained with Koshkin, A.A. et al., “LNA (Locked Nucleic Acids): Synthesis of the ethylene Blue.” Circle Reader Service No. 138, vol. 13:203-5, The Adenine, Cytosine, Guanine, 5-Methycytosine, Thymine and Uracil Scientist (1992). Bicyclonucleoside Monomers, Oligomerisation, and Unprecedented Fox, G.E. et al., “How close is close: 16S rRNA Sequence identity Nucleic Acid Recognition.” Tetrahedron 54; 3607-3630, Pergamon may not be sufficient to guarantee species Identity.” International Press (1998). Journal of Systematic Bacteriology, vol. 42, No. 1: 166-170, Society Lawrence, J.G. et al., “Molecular and evolutionary relationships for General Microbiology (1992). among enteric bacteria.” Journal of General Microbiology, vol. 131: Gavini, F. et al. “Transfer of Enterobacter agglomerans (Beijerinck 1911-1921, Society for General Microbiology (1991). 1888) Ewing and Fife 1972 to Pantoeagen, nov. as Pantoea Lewin, B. (1990), “Genes IV”, John Wiley & Sons, New York, NY. agglomerans comb. nov. and Description of Pantoea dispersa sp. pp. 41-56. Nov.” International Journal of Systematic Bacteriology, vol.39, No. Livak K.J. et al., “Oligonucleotides with Fluorescent Dyes at Oppo 3:337-345, Society for General. Microbiology (1989). site Ends Provide a Quenched Probe System Useful for Detecting US 8,182,996 B2 Page 10

PCR Product and Nucleic Acid Hybridization.” PCR Methods and Sharma, N.K. et al., “Identification of Yersinia Species by the API Applications, vol. 4: 357-362, Cold Spring Harbor Laboratory Press 20E.” Journal of Clinical Microbiology, 28:1443-1444, American (1995). Society for Microbiology (1990). Ludwig, W. et al., “Complete nucleotide sequences of seven Sproer, C. et al., “The phylogenetic position of Serratia, Buttiauxella and some other genera of the family Enterobacteriaceae'. Interna eubacteral genes coding for the elongation factor Tu: functional, tional Journal of Systematic Bacteriology, 49: 1433-1438, Society for structural and phylogenetic evaluations.” Archives of Microbiology, General Microbiology (1999). vol. 153: 241-247. Springer-Verlag (1990). Stackebrandt, E. et al., “Taxonomic Note: A Place for DNA-DNA Luneberg, et al. Detection of Mycoplasma pneumoniae by Reassociation and 16S rRNA Sequence Analysis in the Present Spe Polymerase Chain Reaction and Nonradioactive Hybridization in cies Definition in Bacteriology”. International Journal of Systematic Microtiter Plates. Journal of Clinical Microbiology, 31(5): 1088 Bacteriology, 44:846-849, Society for General Microbiology (1994). 1094 (1993). Stager C.E. et al., “Automated systems for Identification of Micro McCabe, K.M. et al., “Bacterial Species Identification after DNA organisms’. Clinical Microbiology Reviews, 5:342-327. American Amplification with a Universal Primer Pair.” Molecular Genetics and Society for Microbiology (1992). Metabolism, vol. 66: 205-211, Academic Press (1999). Stark, R.P. et al., “Bacteriuria in the Catheterized Patient'. The New Miller, R.V. et al., “General Microbiology of recA: Environmental England Journal of Medicine, 311:560-564, Massachusetts Medical and Evolutionary Significance.” Annu. Rev. Microbiol. 44:365-394. Society (1984). Annual Reviews, Inc. (1990). Steigerwalt, A.G. et al., “DNA relatedness among species of Mollet, C. et al., “rpoB sequence analysis as a novel basis forbacterial Enterobacter and Serratia, Can. J. Microbiol. 22:131-137, National identification.” Molecular Microbiology, 26:1005-1011, Blackwell Research Council of Canada (1975). Scientific Publications (1997). Takezaki, N. et al., “Phylogenetic Test of the Molecular Clock and Murakami, et al. “Identification of methicillin-resistant strains of Linearized Trees.” Mol. Biol. Evol. 12(5):823-833, University of Staphylococci by polymerase chain reaction.” Journal of Clinical Chicago Press (1995). Microbiology 29(10): 2240-2244 (1991). Tang.Y.-W., et al. (1999), “Molecular Detection and Identification of Nelson, N. et al., “The Evolution of H+ -ATPases', TIBS 14:113 Microorganisms,” in Manual of Clinical Microbiology, 7th Edition, 116, Elsevier (1989). ASM Press, Washington, DC pp. 215-244. Nichols, R. et al., “A universal nucleoside for use of ambiguous sites Taylor, W.R., “Remotely related sequences and structures: analysis in DNA primers.” Letters to Nature, 369: 492-493, Nature Publishing and predictive modelling.” Trends Biotechnol. 12(5):154-158, Co. (1994). Elsevier Science Publishers (1994). Nikiforov, T.T. et al., “The Use of Phosphorothioate Primers and Tenover, F.C., and Unger, E.R.,(1993), "Nucleic Acid Probes for Exonuclease hydrolysis for the Preparation of Single-stranded PCR Detection and Identification of Infectious Agents.” in Diagnostic Products and their Detection by Solid-phase Hybridization.” PCR Molecular Microbiology. Principles and Applications, American Methods and Applications, 3:285-291, Cold Spring Harbor Labora Society for Microbiology, Washington, DC pp. 3-87. tory Press (1994). Tyagi S. et al., “Molecular Beacons: Probes that Fluoresce upon Nikiforov, T.T. et al., “The Use of 96-Well Polystyrene Plates for Hybridization.” Nature Biotechnology, 14:303-308, Nature Publish DNA Hybridization-based Assays: an Evaluation of Different ing Co. (1996). Approaches to Oligonucleotide Immobilization.” Analytical Bio Van Bunk, J. et al., “Panfungal PCR Assay for detection of Fungal chemistry 227: 201-209, Academic Press (1995). Infection in Human Blood Specimens”, Journal of Clinical Pezzlo, M.T. et al., “Detection of Bacteriuria and Pyuria by Microbiology, 36 (S): 1169-1175, American Society for Microbiol URISCREEN, a Rapid Enzymatic Screening Test”, Journal of Clini ogy (1998). cal Microbiology, 30:680-684, American Society for Microbiology Vijgenboom, E. et al., “Three tuf like genes in the kirromycin pro (1992). ducer Streptomyces ramocissimus.” Microbiology, 14:983-998, Ple Porcella, S.F. et al., “Identification of an EF-Tu protein that is num Press (1994). periplasm-associated and processed in Neisseria gonorrhoeae'. Wang, R. et al., “Phylogenetic analysis and identification of Shigella Microbiology 142:2481-2489, Plenum Press (1996). spp. by Molecular probes”. Molecular and Cellular Probes, 11:427 Reeve, J.H., “Guest Commentary: Archaebacteria Then...Archaes 432, Academic Press (1997). Now (Are There Really No Archaeal Pathogens?),” Journal of Bac Watson, J.D. et al., (1987) “Molecular Biology of the Gene', 4th teriology, 181:3613-3617. American Society for Microbiology Edition, The Benjamin/Cummings Publishing Company, Inc., Menlo (1999). Park, CA, pp. 431–462. Relman, D.A., and Persing, D.H., (1996) "Genotypic Methods for Wayne, L.G. et al., “Report of the Ad Hoc Committee on Reconcili Microbial Identification.” in PCR Protocols for Emerging Infectious ation of Approaches to Bacterial Systematics.” International Journal Diseases, a Supplement to Diagnostic Molecular Microbiology and of Systematic Bacteriology, 37(4):463-464, Society for General Applications, ASM Press, Washington, DC pp. 3-31. Microbiology (1987). Sali, A., “Modelling mutations and homologous proteins. Current Weaver, G.A. et al., “Incidence of methanogenic bacteria in a Opinion in Biotechnology 6:437-451, Current Biology (1995). sigmoidoscopy population: an association of methanogenic bacteria Sambrook, J. et al. (1989), "Molecular Cloning: A Laboratory and diverticulosis.' Gut 27:698-704, British Medical Association Manual', 2nd Edition, Cold Spring Harbor Laboratory Press, Cold (1986). Spring Harbor, NY pp. 18.35-18.39. Westin, L., at al., “Anchored multiplex amplification on a microelec Sanchez, R. et al., “Advances in comparative protein-structure tronic chip army.” Nature Biotechnology, 18:199-204. Nature Pub modelling.” Curr. Opin. Struct. Biol. 7:206-21. Current Biology lishing Co. (2000). (1997). Whitcombe, D. et al., “Detection of PCR products using self probing Saraste, M.M. et al., “The atp operon: nucleotide sequence of the amplicons and fluorescence.” Nature Biotechnology, 17:804-807, genes for the Y, B and O. subunits of Escherichia coli ATP synthase.” Nature Publishing Co. (1999). Nucleic Acids Research 9:5287-5296, Oxford University Press Wittwer, C.T. et al., “The LightCycler (TM): A Microvolume (1981). Multisample Fluorimeter with Rapid Temperature Control.” Sela, S. et al., “Duplication of the tuf Gene: a New Insight into the BioTechniques, 22(1):176-181, Eaton Publishing Co. (1997). Phylogeny of Eubacteria.” Journal of Bacteriology, 171:581-584. York, M.K. et al., “Evaluation of the autoSCAN-WIA Rapid System American Society for Microbiology (1989). for Identification and Susceptibility Testing of Gram-Negative Fer Selander, R.K. et al., “Evolutionary Genetics of Salmonella enterica” mentative Bacilli,” Journal of Clinical Microbiology, 30(11):2903 in Escherichia coli and Salmonella Cellular and Molecular Biology, 2910, American Society for Microbiology (1992). 2nd Edition, vol. 2, 147:2691-2707, American Society for Microbiol ogy (1996). * cited by examiner

U.S. Patent May 22, 2012 Sheet 3 of 17 US 8,182,996 B2

U.S. Patent May 22, 2012 Sheet 5 Of 17 US 8,182,996 B2

Earliarists gas Elias wa, Enterococcal E.Frris Eigserger tufts genes Frritors EdisparEfficers

EdirisEas A ihirar £faeciuri t EA"E.3. Enterococcal EpseudaviurnFioratisa Eiga tufa genes East cert feetiis SE"Esfires

stagehermophia

me .05 changes FIGURES. U.S. Patent May 22, 2012 Sheet 6 of 17 US 8,182,996 B2

Kb.

- 3.1 - 2.0

- 1.0

FIGURE 6. U.S. Patent May 22, 2012 Sheet 7 Of 17 US 8,182,996 B2

FIGURE 7 SEQID 30 31 33 NO : coli GAGATCGGG AAGAAGAGCG CGATTCACCG (262O) agglomerans GACACGGG AAGAAGAGCG CGATCCACCG (2621) agglomerans GAGCTGAAAG AAGAAGATGG GAGATCGCCTCTATTCACCG (2622) dispersa GACCGAAAG AAGAAGACGG GAGGTTTCCT. CTATTCATCG (2623) ; ... ptyseos GACCGAAGA ACGAAGATGG GAGGTGAACT CTATTCACCG (2624) coli ruru rvGrw rvErv rv Erv resurr. In r-havn Rava (2625) agglomerans are ruro an as ErsaEmeras a In r-Hrva-Rose (2626) agglomerans MTarakar Err. Ear-Da GarrS In A Sr. r. In H. R. (2627) dispersa -----E-- E----G--S -W--S-I-S- - - -H----R---- (2628) :... ptyseos rwar more rNow ru Erv war win S wWawa r. Sir r a ruHava-Rav (2629) U.S. Patent May 22, 2012 Sheet 8 of 17 US 8,182,996 B2

pests Y, federiksef pseudofuberculosis 70 Y Y intereos midlit 73 OO . s dispersa Pa. A99 offears 93 f. DO Elgor 100 celee Far

75

O

T 0.01 changes FIGURE.8 (1/2) U.S. Patent May 22, 2012 Sheet 9 of 17 US 8,182,996 B2

Y. tis Y. pseudotu losis Y. iSiglia t Y enterocolitica dei Pa. agglom Pa,S di S5 T.ptyseos -a, dispersa Inorgani 68 L. g.ring hoshiae 100 Ed tarda Qe, lapage &e....g. Since.star 99 Energ5329sEle 96 E. Egeus. , ae En. SakazakiErasburlae 76

S. of A 96 interitidis 83 atyphi B . SSTrium Fara hi A Scholeraesuis subsp. arizona Iphi-100 S. i ari 62 'EEEcholeraesus subsp. i 59 flexeir "Schief 68 60 100 E-5i 93 52 KV. city R.E.5 K. pneumoniae subsp. rhinoscleroinéis 68 K. pneuforiae subsp. ozaenae K. prietiforia Subsp.pneumofiaer. agglomeras C.C. g koSeyi C. Werkrani... braakil 77 fundi 73 OLae 70 C. five a Tailoratics Liamensis 100 EW, anericana, lis Se. Tiefa 64 ge. l cars s S:8. naticaRealClels B7 80 times 51 84 Sentico rtibidaea Pg. fontium H. a Wisconsensis ... Wul s R Priabilispenert Psal 78 ... alalifagiens 89 89 PyrustigianiESSEE gElaciensVie W. Cholerae 0.01 changes - FIGURE 8 (2/2) U.S. Patent May 22, 2012 Sheet 10 of 17 US 8,182,996 B2

87 Y. pests Y. rhodei Y. enterocolitica 78 Pa. agglomerans T. plyseos 98 L. grimontil Ed tarda 93 K. Ornihirolitica K. planticola Kv. georgiana Er, aerogenes En, gergoviae C. braaic 79 C. Werikan C, fraudi 99 K, perioriae subsp. pneumoniae K.pneumoniae subsp. ozaerae 68 2 En, sakazaki 67 E. vulneris 89 - S. Enteritidis S. Typhi 83 Sh boydii 69 Sh, flexner 63Sh, Sonte 83 62E. to 1775T saf col2S922 E. Co. 43395 Sh. dysenteriae K. oxytoca 78 C. Sedaki. 52 C. fairner C. arraforatics 7B En astburiae En. annigenus EW, altericana R. aquatilis 2 Se. Odorifera Se.. ficaria Se, Irancescers Se.. plymuthica 97 Se.. girlesi Se fontcola Se, rubidaea H. have Pg. fontium P. vulgaris W. Choleras - 0.01 changes FIGURE 9a) U.S. Patent May 22, 2012 Sheet 11 of 17 US 8,182,996 B2

Y. pestis

Yerrerocolitica Pa. agglomeras T. ptyseas L. grimonti E. fairda K. oritialitica P. planticola 5 En. aerogenes Kw, georgiara En. gergovias En. annigerus E. astriae K. pneutroniae subsp. pneumoniae to K. pneu/FIOriae subsp. Ozaerae ... Sakazaki E. Wres S. Enteriticis o S. Typhi Sh. boydii Sh, ferrer Sh. Sonnel 7 31 E. col1775T E. co 43895 100 Sh. dysenterias E. co25922 K. oxyfoca C. seek C. braak C. Werkrani C. freirai C. after 8 C. annaforaticus Warnericana 1CO F. aquatilis Se.. odorifera Se.. ificaria Se. Faresces 57 Se.. plyrnuthica 85 Se.. grimesii 53 86 Ss, fonticola Se.. rubidaea H. Faye Pig, forturn P. vulgaris W. Colerae 0.01 changes - FIGURE 9b) U.S. Patent May 22, 2012 Sheet 12 of 17 US 8,182,996 B2

52 Y. pestis 9. Y. rhode Y. erraroccolitica 83 Pa. agglomerans T. plyseos L. grinori Pg. fortium Ed. far K. Ornithinolitica Kv. georgiana En. aerogenes E. gergoviae En. annigenus C. fraaki C. Werkrani 52 C. freiro Erasuriae OO K.pneumoniae subsp. pneumonias P. pneumoniae subsp. azasrae E. sakazaki S. Enteritidis S. Typhl Sh boydii Sh, flexner S. SOFre E. coli 11775T 75 B E. Williaris 96 E. 25922 Sh, dysenteriae E. Cof 43895 K. oxytoca 51 K. planticola C. Sedaki 99 C. farmer C. attalionaticus 64 EY. arnericara R, aquatis Se. Odorifera Se, ficaria Se. Francescers Se.. pyrnuthica Se.. grinnesi S. forticola Se. Fubidaea have P. vulgaris W. Cholarae 0.01 changes Figure 9 c) U.S. Patent May 22, 2012 Sheet 13 of 17 US 8,182,996 B2

FIGURE 10a)

C.25

.2

0.5

0.1

0.05

O 0.2 0.04 O.OS O.08 c.1 O.2 U.S. Patent May 22, 2012 Sheet 14 of 17 US 8,182,996 B2

FIGURE 10b)

0.35

A A 0.3 A AA A. A a A A AA 0.25 A.

8 0.2

s 0.15

Ewiners/ | 0.1 cgi-Shigella Ois

0.05

YS planticolav o Kornithinoleica O 0.02 0.04 0.08 0.08 C. 0.2 U.S. Patent May 22, 2012 Sheet 15 of 17 US 8,182,996 B2

FIGURE 10 c) 0.35 m-m-m-m-m-us-w-ul------grimonii/ P. vulgaris A 0.3 EaFay \ A AA P. vulgaris A a. Ai. 0.25 A. la P. vulgaris/ P. aggkornerans

8 0.2 C

0.15

Y. enterocodifica Y. pestis

Y, Phoev Y. pestis 0.05 D w Y. anterocolitica/ Y. rhodei

0 0.05 0. O.5 0.2 0.25 0.3 Ef distance U.S. Patent May 22, 2012 Sheet 16 of 17 US 8,182,996 B2

FIGURE 11: Position of the 5 new primer pairs selected from the M catarrhalis specific 466-bp DNA fragment (SEQIDNO:29).

SEQID No: 118+ SEQID No: 119(116 bp) HO OO 200 300 400 466

O-O WBmcatl-WBmcat? (93 bp) O-O WBmcats-VBmcat4 (140 bp) O-O WBmcats-VBmcató (219 bp) O-O VBmcat?-VBmcats (160 bp) VBmcats. WBmcatio (167 bp) 0-p

All SEQIDNOs, in this Figure are from US patent 6,001,564. 'Amplicon size is given in parenthesis. U.S. Patent May 22, 2012 Sheet 17 Of 17 US 8,182,996 B2

FIGURE 12: Position of the 5 new primer pairs selected from the S epidermidis specific 705-bp DNA fragment (SEQIDNO:36).

SEQIDNO: 145+ SEQIDNO: 146 (125bp SEQDNO: 147+ SEQIDNO; 148 (175bp) O-O O-O 1. 100 200 300 400 SOO 600 705

O-O VBSep3-VBSep4(208bp)

O-O VBSep3-VBScp6(208bp)

-O VBSep-VBSep8 (77 bp)

WBSep9-VBsep10(153 bp) O-O

VBSep11-VBSepl2(135bp) O-O

'Amplicon'All SEQED size NOS. is given in this in Figure parenthesis. are from US patent 6,001,564. US 8,182,996 B2 1. 2 COMPOSITIONS AND METHODS FOR of non-conclusive identifications with bacterial species other DETECTING IKLEBSIELLA PNEUMONIAE than Enterobacteriaceae (Croizé J., 1995, Lett. Infectiol. 10:109-113; York et al., 1992, J. Clin. Microbiol. 30:2903 CROSS-REFERENCE TO RELATED 2910). For Enterobacteriaceae, the percentage of non-conclu APPLICATIONS sive identifications was 2.7 to 11.4%. The list of microorgan isms identified by commercial systems based on classical This application is a continuation of application Ser. No. identification methods is given in Table 15. 1 1/236,785, filed Sep. 27, 2005, which is a continuation of A wide variety of bacteria and fungi are routinely isolated application Ser. No. 10/089,177, filed Mar. 27, 2002, which is and identified from clinical specimens in microbiology labo the U.S. national phase under 35 U.S.C. S371 of prior PCT 10 ratories. Tables 1 and 2 give the incidence for the most com International Application No. PCT/CA00/01150, filed Sep. monly isolated bacterial and fungal pathogens from various 28, 2000, which claims the benefit of Canadian Application types of clinical specimens. These pathogens are the main No. 2,307,010 filed May 19, 2000, and Canadian Application organisms associated with nosocomial and community-ac No. 2283458, filed Sep. 28, 1999. quired human infections and are therefore considered the 15 most clinically important. SEQUENCE LISTING Clinical Specimens Tested in Clinical Microbiology Labora The present application is being filed along with a tories Sequence Listing in electronic format. The Sequence Listing Most clinical specimens received in clinical microbiology is provided as a file entitled GENOM.048NPCC2.TXT, cre laboratories are urine and blood samples. At the microbiology ated May 24, 2010, which is 1.99 MB in size. The information laboratory of the Centre Hospitalier de l’Université Laval in the electronic format of the Sequence Listing is incorpo (CHUL), urine and blood account for approximately 55% and rated herein by reference in its entirety. 30% of the specimens received, respectively (Table 3). The remaining 15% of clinical specimens comprise various bio BACKGROUND OF THE INVENTION 25 logical fluids including sputum, pus, cerebrospinal fluid, Syn ovial fluid, and others (Table 3). Infections of the urinary Classical Methods for the Identification of Microorganisms tract, the respiratory tract and the bloodstream are usually of Microorganisms are classically identified by their ability to bacterial etiology and require antimicrobial therapy. In fact, utilize different Substrates as a source of carbon and nitrogen all clinical samples received in the clinical microbiology through the use of biochemical tests such as the API2OETM 30 system (bioMérieux). For susceptibility testing, clinical laboratory are tested routinely for the identification of bacte microbiology laboratories use methods including disk diffu ria and antibiotic susceptibility. Sion, agar dilution and broth microdilution. Although identi Conventional Pathogen Identification from Clinical Speci fications based on biochemical tests and antibacterial Suscep CS tibility tests are cost-effective, generally two days are 35 Urine Specimens required to obtain preliminary results due to the necessity of The search for pathogens in urine specimens is so prepon two Successive overnight incubations to identify the bacteria derant in the routine microbiology laboratory that a myriad of from clinical specimens as well as to determine their Suscep tests have been developed. However, the gold standard tibility to antimicrobial agents. There are some commercially remains the classical semi-quantitative plate culture method available automated systems (i.e. the MicroScanTM system 40 in which 1 uL of urine is streaked onagarplates and incubated from Dade Behring and the VitekTM system from bioMérieux) for 18-24 hours. Colonies are then counted to determine the which use Sophisticated and expensive apparatus for faster total number of colony forming units (CFU) per liter of urine. microbial identification and Susceptibility testing (Stager and A bacterial urinary tract infection (UTI) is normally associ Davis, 1992, Clin. Microbiol. Rev. 5:302-327). These sys ated with a bacterial count of 107 CFU/L or more in urine. tems require shorter incubation periods, thereby allowing 45 However, infections with less than 107 CFU/L in urine are most bacterial identifications and Susceptibility testing to be possible, particularly in patients with a high incidence of performed in less than 6 hours. Nevertheless, these faster diseases or those catheterized (Stark and Maki, 1984, N. systems always require the primary isolation of the bacteria or Engl.J.Med. 3 11:560-564). Importantly, approximately 80% fungi as a pure culture, a process which takes at least 18 hours of urine specimens tested in clinical microbiology laborato for a pure culture or 2 days for a mixed culture. So, the 50 ries are considered negative (i.e. bacterial count of less than shortest time from sample reception to identification of the 10 CFU/L. Table 3). Urine specimens found positive by pathogen is around 24 hours. Moreover, fungi other than culture are further characterized using standard biochemical yeasts are often difficult or very slow to grow from clinical tests to identify the bacterial pathogen and are also tested for specimens. Identification must rely on labor-intensive tech susceptibility to antibiotics. The biochemical and susceptibil niques such as direct microscopic examination of the speci 55 ity testing normally require 18-24 hours of incubation. mens and by direct and/or indirect immunological assays. Accurate and rapid urine screening methods for bacterial Cultivation of most parasites is impractical in the clinical pathogens would allow a faster identification of negative laboratory. Hence, microscopic examination of the specimen, specimens and a more efficient treatment and care manage a few immunological tests and clinical symptoms are often ment of patients. Several rapid identification methods the only methods used for an identification that frequently 60 (UriscreenTM, UTIscreenTM, Flash TrackTM DNA probes and remains presumptive. others) have been compared to slower standard biochemical The fastest bacterial identification system, the autoSCAN methods, which are based on culture of the bacterial patho Walk-AwayTM system (Dade Behring) identifies both gram gens. Although much faster, these rapid tests showed low negative and gram-positive bacterial species from standard sensitivities and poor specificities as well as a high number of ized inoculum in as little as 2 hours and gives Susceptibility 65 false negative and false positive results (Koening et al., 1992, patterns to most antibiotics in 5 to 6 hours. However, this J. Clin. Microbiol. 30:342-345; Pezzlo et al., 1992, J. Clin. system has a particularly high percentage (i.e. 3.3 to 40.5%) Microbiol. 30:640-684). US 8,182,996 B2 3 4 Blood Specimens invention are Superior in terms of both rapidity and accuracy The Blood Specimens Received In The Microbiology to standard biochemical methods currently used for routine Laboratory Are Always Submitted For Culture. Blood Cul diagnosis from any clinical specimens in microbiology labo ture Systems May Be Manual, Semi-Automated Or Com ratories. Since these tests can be performed in one hour or pletely Automated. The BACTECTM System (From Becton 5 less, they provide the clinician with new diagnostic tools Dickinson) And The BactalertTM System (From Organon which should contribute to a better management of patients Teknika Corporation) Are The Two Most Widely Used Auto with infectious diseases. Specimens from sources other than mated Blood Culture Systems. These Systems Incubate humans (e.g. other primates, birds, plants, mammals, farm Blood Culture Bottles Under Optimal Conditions For Growth animals, livestock, food products, environment Such as water Of Most Bacteria. Bacterial Growth Is Monitored Continu 10 or soil, and others) may also be tested with these assays. ously To Detect Early Positives By Using Highly Sensitive A High Percentage of Culture-Negative Specimens Bacterial Growth Detectors. Once Growth Is Detected, A Among all the clinical specimens received for routine diag Gram Stain Is Performed Directly From The Blood Culture nosis, approximately 80% of urine specimens and even more And Then Used To Inoculate Nutrient Agar Plates. Subse (around 95%) for other types of normally sterile clinical quently, Bacterial Identification And Susceptibility Testing 15 specimens are negative for the presence of bacterial patho Are Carried Out From Isolated Bacterial Colonies With Auto gens (Table 3). It would also be desirable, in addition to mated Systems. As Described Previously. Blood Culture identify bacteria at the species or genus or family or group Bottles Are Normally Reported As Negative If No Growth Is level in a given specimen, to screen out the high proportion of Detected After An Incubation Of 6 To 7 Days. Normally, The negative clinical specimens with a DNA-based test detecting Vast Majority Of Blood Cultures Are Reported Negative. For the presence of any bacterium (i.e. universal bacterial detec Example, The Percentage OfNegative Blood Cultures At The tion). As disclosed in the present invention, Such a screening Microbiology Laboratory Of The CHUL For The Period Feb test may be based on DNA amplification by PCR of a highly ruary 1994-January 1995 Was 93.1% (Table 3). conserved genetic target found in all bacteria. Specimens Other Clinical Samples negative for bacteria would not be amplified by this assay. On Upon receipt by the clinical microbiology laboratory, all 25 the other hand, those that are positive for any bacterium body fluids other than blood and urine that are from normally would give a positive amplification signal. Similarly, highly sterile sites (i.e. cerebrospinal, Synovial, pleural, pericardial conserved genes of fungi and parasites could serve not only to and others) are processed for direct microscopic examination identify particular species or genus or family or group but also and Subsequent culture. Again, most clinical samples are to detect the presence of any fungi or parasite in the specimen. negative for culture (Table 3). In all these normally sterile 30 Towards the Development of Rapid DNA-Based Diagnostic sites, tests for the universal detection of algae, archaea, bac Tests teria, fungi and parasites would be very useful. A rapid diagnostic test should have a significant impact on Regarding clinical specimens which are not from sterile the management of infections. DNA probe and DNA ampli sites such as sputum or stool specimens, the laboratory diag fication technologies offer several advantages over conven nosis by culture is more problematic because of the contami 35 tional methods for the identification of pathogens and anti nation by the normal flora. The bacterial or fungal pathogens microbial agents resistance genes from clinical samples potentially associated with the infection are grown and sepa (Persing et al., 1993, Diagnostic Molecular Microbiology: rated from the colonizing microbes using selective methods Principles and Applications, American Society for Microbi and then identified as described previously. Of course, the ology, Washington, D.C.; Ehrlich and Greenberg, 1994, PCR DNA-based universal detection of bacteria would not be use 40 based Diagnostics in Infectious Disease, Blackwell Scientific ful for the diagnosis of bacterial infections at these non-sterile Publications, Boston, Mass.). There is no need for culture of sites. On the other hand, DNA-based assays for species or the pathogens, hence the organisms can be detected directly genus or family or group detection and identification as well from clinical samples, thereby reducing the time associated as for the detection of antimicrobial agents resistance genes with the isolation and identification of pathogens. Further from these specimens would be very useful and would offer 45 more, DNA-based assays are more accurate for microbial several advantages over classical identification and Suscepti identification than currently used phenotypic identification bility testing methods. systems which are based on biochemical tests and/or micro DNA-Based Assays with Any Specimen scopic examination. Commercially available DNA-based There is an obvious need for rapid and accurate diagnostic technologies are currently used in clinical microbiology labo tests for the detection and identification of algae, archaea, 50 ratories, mainly for the detection and identification of fastidi bacteria, fungi and parasites directly from clinical specimens. ous bacterial pathogens Such as Mycobacterium tuberculosis, DNA-based technologies are rapid and accurate and offer a Chlamydia trachomatis, Neisseria gonorrhoeae as well as for great potential to improve the diagnosis of infectious diseases the detection of a variety of viruses (Tang Y. and Persing D. (Persing et al., 1993, Diagnostic Molecular Microbiology: H. Molecular detection and identification of microorgan Principles and Applications, American Society for Microbi 55 isms, In: P. Murray et al., 1999, Manual of Clinical Microbi ology, Washington, D.C.; Bergeron and Ouellette, 1995, ology, ASM press, 7" edition, Washington D.C.). There are Infection 23:69-72; Bergeron and Ouellette, 1998, J. Clin also other commercially available DNA-based assays which Microbiol. 36:2169-72). The DNA probes and amplification are used for culture confirmation assays. primers which are objects of the present invention are appli Others have developed DNA-based tests for the detection cable for the detection and identification of algae, archaea, 60 and identification of bacterial pathogens which are objects of bacteria, fungi, and parasites directly from any clinical speci the present invention, for example: Staphylococcus sp. (U.S. men such as blood, urine, sputum, cerebrospinal fluid, pus, Pat. No. 5,437,978), Neisseria sp. (U.S. Pat. No. 5,162,199 genital and gastro-intestinal tracts, skin or any other type of and European patent serial no. 0.337,896,131) and Listeria specimens (Table 3). These assays are also applicable to monocytogenes (U.S. Pat. Nos. 5,389,513 and 5,089.386). detection from microbial cultures (e.g. blood cultures, bacte 65 However, the diagnostic tests described in these patents are rial or fungal colonies on nutrient agar, or liquid cell cultures based either on rRNA genes or on genetic targets different in nutrient broth). The DNA-based tests proposed in this from those described in the present invention. To our knowl US 8,182,996 B2 5 6 edge there are only four patents published by others mention from public databases such as GenBank. From the sequences ing the use of any of the four highly conserved gene targets readily available from those public databases, there is no described in the present invention for diagnostic purposes indication therefrom as to their potential for diagnostic pur (PCT international publication number WO92/03455 and poses. For determining good candidates for diagnostic pur WO00/14274, European patent publication number 0 133 5 poses, one could select sequences for DNA-based assays for 671 B1, and European patent publication number 0 133 288 (i) the species-specific detection and identification of com A2). WO92/03455 is focused on the inhibition of Candida monly encountered bacterial, fungal and parasitical patho species for therapeutic purposes. It describes antisense oligo gens, (ii) the genus-specific detection and identification of nucleotide probes hybridizing to Candida messenger RNA. commonly encountered bacterial, fungal or parasitical patho Two of the numerous mRNA proposed as targets are coding 10 gens, (iii) the family-specific detection and identification of for translation elongation factor 1 (tefl) and the beta subunit commonly encountered bacterial, fungal or parasitical patho of ATPase. DNA amplification or hybrization are not under gens, (iv) the group-specific detection and identification of the scope of their invention and although diagnostic use is commonly encountered bacterial, fungal or parasitical patho briefly mentioned in the body of the application, no specific gens, (v) the universal detection of algal, archaeal, bacterial, claim is made regarding diagnostics. WO00/14274 describes 15 fungal or parasitical pathogens, and/or (vi) the specific detec the use of bacterial recA gene for identification and speciation tion and identification of antimicrobial agents resistance of bacteria of the Burkholderia cepacia complex. Specific genes, and/or (vii) the specific detection and identification of claims are made on a method for obtaining nucleotide bacterial toxin genes. All of the above types of DNA-based sequence information for the recA gene from the target bac assays may be performed directly from any type of clinical teria and a following comparison with a standard library of 20 specimens or from a microbial culture. nucleotide sequence information (claim 1), and on the use of In our assigned U.S. Pat. No. 6,001,564 and our WO98/ PCR for amplification of the recA gene in a sample of interest 20157 patent publication, we described DNA sequences suit (claims 4 to 7, and 13). However, the use of a discriminatory able for (i) the species-specific detection and identification of restriction enzyme in a RFLP procedure is essential to fulfill clinically important bacterial pathogens, (ii) the universal the speciation and WO00/14274 did not mention that multiple 25 detection of bacteria, and (iii) the detection of antimicrobial recA probes could be used simultaneously. Patent EP 0 133 agents resistance genes. 288A2 describes and claims the use of bacterial tuf (and fus) The WO98/20157 patent publication describes proprietary sequence for diagnostics based on hybridization of a tuf (or tuf DNA sequences as well as tuf sequences selected from fus) probe with bacterial DNA. DNA amplification is not public databases (in both cases, fragments of at least 100 base under the scope of EPO 133 288A2. Nowhere it is mentioned 30 pairs), as well as oligonucleotide probes and amplification that multiple tuf (or fus) probes could be used simultaneously. primers derived from these sequences. All the nucleic acid No mention is made regarding speciation using tuf (or fus) sequences described in that patent publication can enter in the DNA nucleic acids and/or sequences. The sensitivities of the composition of diagnostic kits or products and methods tuf hybrizations reported are 1x10° bacteria or 1-100 ng of capable of a) detecting the presence of bacteria and fungi b) DNA. This is much less sensitive than what is achieved by our 35 detecting specifically at the species, genus, family or group assays using nucleic acid amplification technologies. levels, the presence of bacteria and fungi and antimicrobial Although there are phenotypic identification methods agents resistance genes associated with these pathogens. which have been used for more than 125 years in clinical However, these methods and kits need to be improved, since microbiology laboratories, these methods do not provide the ideal kit and method should be capable of diagnosing information fast enough to be useful in the initial manage- 40 close to 100% of microbial pathogens and associated antimi ment of patients. There is a need to increase the speed of the crobial agents resistance genes and toxins genes. For diagnosis of commonly encountered bacterial, fungal and example, infections caused by Enterococcus faecium have parasitical infections. Besides being much faster, DNA-based become a clinical problem because of its resistance to many diagnostic tests are more accurate than standard biochemical antibiotics. Both the detection of these bacteria and the evalu tests presently used for diagnosis because the microbial geno- 45 ation of their resistance profiles are desirable. Besides that, type (e.g. DNA level) is more stable than the phenotype (e.g. novel DNA sequences (probes and primers) capable of rec physiologic level). ognizing the same and other microbial pathogens or the same Bacteria, fungi and parasites encompass numerous well and additional antimicrobial agents resistance genes are also known microbial pathogens. Other microorganisms could desirable to aim at detecting more target genes and comple also be pathogens or associated with human diseases. For 50 ment our earlier patent applications. example, achlorophylious algae of the Prototheca genus can The present invention improves the assigned application infect humans. Archae, especially methanogens, are present by disclosing new proprietary tuf nucleic acids and/or in the gut flora of humans (Reeve, J. H., 1999, J. Bacteriol. sequences as well as describing new ways to obtain tuf 181:3613-3617). However, methanogens have been associ nucleic acids and/or sequences. In addition we disclose new ated to pathologic manifestations in the colon, vagina, and 55 proprietary atpD and recA nucleic acids and/or sequences. In mouth (Belay et al., 1988, Appl. Enviro. Microbiol. 54:600 addition, new uses of tuf, atp) and recA DNA nucleic acids 603: Belay et al., 1990, J. Clin. Microbiol. 28:1666-1668: and/or sequences selected from public databases (Table 11) Weaver et al., 1986, Gut 27:698-704). are disclosed. In addition to the identification of the infectious agent, it is Highly Conserved Genes for Identification and Diagnostics often desirable to identify harmful toxins and/or to monitor 60 Highly conserved genes are useful for identification of the sensitivity of the microorganism to antimicrobial agents. microorganisms. For bacteria, the most studied genes for As revealed in this invention, genetic identification of the identification of microorganisms are the universally con microorganism could be performed simultaneously with served ribosomal RNA genes (rRNA). Among those, the prin toxin and antimicrobial agents resistance genes. cipal targets used for identification purposes are the Small Knowledge of the genomic sequences of algal, archaeal, 65 subunit (SSU) ribosomal 16S rRNA genes (in prokaryotes) bacterial, fungal and parasitical species continuously and 18S rRNA genes (in eukaryotes) (Relman and Persing, increases as testified by the number of sequences available Genotyping Methods for Microbial Identification, In: D. H. US 8,182,996 B2 7 8 Persing, 1996, PCR Protocols for Emerging Infectious Dis ubiquitously detect the targeted algal, archaeal, bacterial, fun eases, ASM Press, Washington D.C.). The rRNA genes are gal or parasitical nucleic acids. also the most commonly used targets for universal detection In a particularly preferred embodiment, oligonucleotides of bacteria (Chen et al., 1988, FEMS Microbiol. Lett. 57:19 of at least 12 nucleotides in length have been derived from the 24; McCabe et al., 1999, Mol. Genet. Metabol. 66:205-211) longer DNA fragments, and are used in the present method as and fungi (Van Buriket al., 1998, J. Clin. Microbiol.36:1169 probes or amplification primers. To be a good diagnostic 1175). candidate, an oligonucleotide of at least 12 nucleotides However, it may be difficult to discriminate between should be capable of hybridizing with nucleic acids from closely related species when using primers derived from the given microorganism(s), and with Substantially all strains and 16S rRNA. In some instances, 16S rRNA sequence identity 10 representatives of said microorganism(s); said oligonucle may not be sufficient to guarantee species identity (Fox et al., otide being species-, or genus-, or family-, or group-specific 1992, Int. J. Syst. Bacteriol. 42:166-170) and it has been or universal. shown that inter-operon sequence variation as well as Strainto In another particularly preferred embodiment, oligonucle strain variation could undermine the application of 16S rRNA otides primers and probes of at least 12 nucleotides in length for identification purposes (Clayton et al., 1995, Int. J. Syst. 15 are designed for their specificity and ubiquity based upon Bacteriol. 45:595-599). The heat shock proteins (HSP) are analysis of our databases of tuf, atpD and recA sequences. another family of very conserved proteins. These ubiquitous These databases are generated using both proprietary and proteins in bacteria and eukaryotes are expressed in answer to public sequence information. Altogether, these databases external stress agents. One of the most described of these HSP forma sequence repertory useful for the design of primers and is HSP60. This protein is very conserved at the amino acid probes for the detection and identification of algal, archaeal, level, hence it has been useful for phylogenetic studies. Simi bacterial, fungal and parasitical microorganisms. The reper lar to 16S rRNA, it would be difficult to discriminate between tory can also be subdivided into subrepertories for sequence species using the HSP60 nucleotide sequences as a diagnos analysis leading to the design of various primers and probes. tic tool. However, Goh et al. identified a highly conserved The tuf, atpD and recA sequences databases as a product to region flanking a variable region in HSP60, which led to the 25 assist the design of oligonucleotides primers and probes for design of universal primers amplifying this variable region the detection and identification of algal, archaeal, bacterial, (Gohet al., U.S. Pat. No. 5,708, 160). The sequence variations fungal and parasitical microorganisms are also covered. in the resulting amplicons were found useful for the design of The proprietary oligonucleotides (probes and primers) are species-specific assays. also another object of this invention. 30 Diagnostic kits comprising probes or amplification prim SUMMARY OF THE INVENTION ers such as those for the detection of a microbial species or genus or family or phylum or group selected from the follow It is an object of the present invention to provide a specific, ing list consisting of Abiotrophia adiacens, Acinetobacter ubiquitous and sensitive method using probes and/or ampli baumanii, Actinomycetae, Bacteroides, Cytophaga and fication primers for determining the presence and/or amount 35 Flexibacter phylum, Bacteroides fragilis, Bordetella pertus of nucleic acids: sis, Bordetella sp., Campylobacter jejuni and C. coli, Can from any algal, archaeal, bacterial, fungal or parasitical dida albicans, Candida dubliniensis, Candida glabrata, Can species in any sample Suspected of containing said dida guilliermondii, Candida krusei, Candida lusitaniae, nucleic acids, and optionally, Candida parapsilosis, Candida tropicalis, Candida zeyl from specific microbial species or genera selected from the 40 anoides, Candida sp., Chlamydia pneumoniae, Chlamydia group consisting of the species or genera listed in Table trachomatis, Clostridium sp., Corynebacterium sp., Crypo 4, and optionally, coccus neoformans, Cryptococcus sp., Cryptosporidium par from an antimicrobial agents resistance gene selected from vum, Entamoeba sp., Enterobacteriaceae group, Enterococ the group consisting of the genes listed in Table 5, and cus casselliflavus-flavescens-gallinarum group, Enterococcus optionally, 45 faecalis, Enterococcus faecium, Enterococcus gallinarum, from a toxin gene selected from the group consisting of the Enterococcus sp., Escherichia coli and Shigella sp. group, genes listed in Table 6, Gemella sp., Giardia sp., Haemophilus influenzae, Klebsiella wherein each of said nucleic acids or a variant or part pneumoniae, Legionella pneumophila, Legionella sp., Leish thereof comprises a selected target region hybridiz mania sp., Mycobacteriaceae family, Mycoplasma pneumo able with said probes or primers; 50 niae, Neisseria gonorrhoeae, platelets contaminants group said method comprising the steps of contacting said (see Table 14), Pseudomonas aeruginosa, Pseudomonads sample with said probes or primers and detecting the group, Staphylococcus aureus, Staphylococcus epidermidis, presence and/or amount of hybridized probes or Staphylococcus haemolyticus, Staphylococcus hominis, Sta amplified products as an indication of the presence phylococcus saprophyticus, Staphylococcus sp., Streptococ and/or amount of said any microbial species, specific 55 cus agalactiae, Streptococcus pneumoniae, Streptococcus microbial species or genus or family or group and pyogenes, Streptococcus sp., Trypanosoma brucei, Trypano antimicrobial agents resistance gene and/or toxin Soma Cruzi, Trypanosoma sp., Trypanosomatidae family, are gene. also objects of the present invention. In a specific embodiment, a similar method directed to each Diagnostic kits further comprising probes or amplification specific microbial species or genus or family or group detec 60 primers for the detection of an antimicrobial agents resistance tion and identification, antimicrobial agents resistance genes gene selected from the group listed in Table 5 are also objects detection, toxin genes detection, and universal bacterial of this invention. detection, separately, is provided. Diagnostic kits further comprising probes or amplification In a more specific embodiment, the method makes use of primers for the detection of a toxin gene selected from the DNA fragments from conserved genes (proprietary 65 group listed in Table 6 are also objects of this invention. sequences and sequences obtained from public databases), Diagnostic kits further comprising probes or amplification selected for their capacity to sensitively, specifically and primers for the detection of any other algal, archaeal, bacte US 8,182,996 B2 10 rial, fungal or parasitical species than those specifically listed tance gene and toxin gene PCR primers under uniform herein, comprising or not comprising those for the detection cycling conditions. Furthermore, various combinations of of the specific microbial species or genus or family or group primer pairs may be used in multiplex PCR assays. listed above, and further comprising or not comprising probes It is also an object of the present invention that tuf, atp) and and primers for the antimicrobial agents resistance genes recA sequences could serve as drug targets and these listed in Table 5, and further comprising or not comprising sequences and means to obtain them revealed in the present probes and primers for the toxin genes listed in Table 6 are invention can assist the screening, design and modeling of also objects of this invention. these drugs. In a preferred embodiment, such a kit allows for the sepa It is also an object of the present invention that tuf, atp) and rate or the simultaneous detection and identification of the 10 recA sequences could serve for vaccine purposes and these above-listed microbial species or genus or family or group; or sequences and means to obtain them revealed in the present universal detection of algae, archaea, bacteria, fungi or para invention can assist the screening, design and modeling of sites; orantimicrobial agents resistance genes; or toxin genes; these vaccines. or for the detection of any microorganism (algae, archaea, We aim at developing a universal DNA-based test or kit to bacteria, fungi or parasites). 15 screen out rapidly samples which are free of algal, archaeal, In the above methods and kits, probes and primers are not bacterial, fungal or parasitical cells. This test could be used limited to nucleic acids and may include, but are not restricted alone or combined with more specific identification tests to to analogs of nucleotides such as: inosine, 3-nitropyrrole detect and identify the above algal and/or archaeal and/or nucleosides (Nichols et al., 1994, Nature 369:492-493), bacterial and/or fungal and/or parasitical species and/or gen Linked Nucleic Acids (LNA) (Koskin et al., 1998, Tetrahe era and/or family and/or group and to determine rapidly the dron 54:3607-3630), and Peptide Nucleic Acids (PNA) (Eg bacterial resistance to antibiotics and/or presence of bacterial holm et al., 1993, Nature 365:566-568). toxins. Although the sequences from the selected antimicro In the above methods and kits, amplification reactions may bial agents resistance genes are available from public data include but are not restricted to: a) polymerase chain reaction bases and have been used to develop DNA-based tests for (PCR), b) ligase chain reaction (LCR), c) nucleic acid 25 their detection, our approach is unique because it represents a sequence-based amplification (NASBA), d) self-sustained major improvement over current diagnostic methods based sequence replication (3SR), e) Strand displacement amplifi on bacterial cultures. Using an amplification method for the cation (SDA), f) branched DNA signal amplification simultaneous or independent or sequential microbial detec (bDNA), g) transcription-mediated amplification (TMA), h) tion-identification and antimicrobial resistance genes detec cycling probe technology (CPT), i) nested PCR, j) multiplex 30 tion, there is no need for culturing the clinical sample prior to PCR, k) solid phase amplification (SPA), 1) nuclease depen testing. Moreover, a modified PCR protocol has been devel dent signal amplification (NDSA), m) rolling circle amplifi oped to detect all target DNA sequences in approximately one cation technology (RCA), n) Anchored strand displacement hour under uniform amplification conditions. This procedure amplification, o) Solid-phase (immobilized) rolling circle should save lives by optimizing treatment, should diminish amplification. 35 antimicrobial agents resistance because less antibiotics will In the above methods and kits, detection of the nucleic be prescribed, should reduce the use of broad spectrum anti acids of target genes may include real-time or post-amplifi biotics which are expensive, decrease overall health care cation technologies. These detection technologies can costs by preventing or shortening hospitalizations, and side include, but are not limited to, fluorescence resonance energy effects of drugs, and decrease the time and costs associated transfer (FRET)-based methods such as adjacent hybridiza 40 with clinical laboratory testing. tion to FRET probes (including probe-probe and probe In another embodiment, sequence repertories and ways to primer methods), TaqMan, Molecular Beacons, Scorpions, obtain them for other gene targets are also an object of this nanoparticle probes and Sunrise (Amplifluor). Other detec invention, such is the case for the heXA nucleic acids and/or tion methods include target genes nucleic acids detection via sequences of Streptococci. immunological methods, Solid phase hybridization methods 45 In yet another embodiment, for the detection of mutations on filters, chips or any other solid support, whether the associated with antibiotic resistance genes, we built reperto hybridization is monitored by fluorescence, chemilumines ries to distinguish between point mutations reflecting only cence, potentiometry, mass spectrometry, plasmon reso gene diversity and point mutations involved in resistance. nance, polarimetry, colorimetry, or scanometry. Sequencing, Such repertories and ways to obtain them for pbp1a, pbp2b including sequencing by dideoxy termination or sequencing 50 and pbp2X genes of sensitive and penicillin-resistant Strep by hybridization, e.g. sequencing using a DNA chip, is tocCOccus pneumoniae and also for gyra and parC gene frag another possible method to detect and identify the nucleic ments from various bacterial species are also an object of the acids of target genes. present invention. In a preferred embodiment, a PCR protocol is used for The diagnostic kits, primers and probes mentioned above nucleic acid amplification, in diagnostic method as well as in 55 can be used to identify algae, archaea, bacteria, fungi, para method of construction of a repertory of nucleic acids and sites, antimicrobial agents resistance genes and toxin genes deduced sequences. on any type of Sample, whether said diagnostic kits, primers In a particularly preferred embodiment, a PCR protocol is and probes are used for in vitro or in situ applications. The provided, comprising, an initial denaturation step of 1-3 min said samples may include but are not limited to: any clinical utes at 95°C., followed by an amplification cycle including a 60 sample, any environment sample, any microbial culture, any denaturation step of one second at 95°C. and an annealing microbial colony, any tissue, and any cell line. step of 30 seconds at 45-65 C., without any time allowed It is also an object of the present invention that said diag specifically for the elongation step. This PCR protocol has nostic kits, primers and probes can be used alone or in con been standardized to be suitable for PCR reactions with most junction with any other assay Suitable to identify microorgan selected primer pairs, which greatly facilitates the testing 65 isms, including but not limited to: any immunoassay, any because each clinical sample can be tested with universal, enzymatic assay, any biochemical assay, any lysotypic assay, species-specific, genus-specific, antimicrobial agents resis any serological assay, any differential culture medium, any US 8,182,996 B2 11 12 enrichment culture medium, any selective culture medium, pump ATPase and a protein responsible for the homologous any specific assay medium, any identification culture recombination of genetic material. The alignments of tuf, medium, any enumeration culture medium, any cellular stain, atpD and recA sequences used to derive the universal primers any culture on specific cell lines, and any infectivity assay on include both proprietary and public database sequences. The animals. universal primer strategy allows the rapid screening of the In the methods and kits described herein below, the oligo numerous negative clinical specimens (around 80% of the nucleotide probes and amplification primers have been specimens received, see Table 3) submitted for microbiologi derived from larger sequences (i.e. DNA fragments of at least cal testing. 100 base pairs). All DNA fragments have been obtained either Table 4 provides a list of the archaeal, bacterial, fungal and from proprietary fragments or from public databases. DNA 10 parasitical species for which tuf and/or atp) and/or recA fragments selected from public databases are newly used in a nucleic acids and/or sequences are revealed in the present method of detection according to the present invention, since invention. Tables 5 and 6 provide a list of antimicrobial agents they have been selected for their diagnostic potential. resistance genes and toxin genes selected for diagnostic pur In another embodiment, the amino acid sequences trans poses. Table 7 provides the origin of tuf, atpl) and recA lated from the repertory of tuf, atpl) and recA nucleic acids 15 nucleic acids and/or sequences listed in the sequence listing. and/or sequences are also an object of the present invention. Tables 8-10 and 12-14 provide lists of species used to test the It is clear to the individual skilled in the art that other specificity, ubiquity and sensitivity of some assays described oligonucleotide sequences appropriate for (i) the universal in the examples. Table 11 provides a list of microbial species detection of algae, archaea, bacteria, fungi or parasites, (ii) for which tufand/or atp) and/or recA sequences are available the detection and identification of the above microbial species in public databases. Table 15 lists the microorganisms iden or genus or family or group, and (iii) the detection of antimi tified by commercial systems. Tables 16-18 are part of crobial agents resistance genes, and (iv) the detection of toxin Example 42, whereas Tables 19-20 are part of Example 43. genes, other than those listed in Tables 39-41, 59-60, 70-76, Tables 21-22 illustrate Example 44, whereas Tables 23-25 77-79, and 81-92 may also be derived from the proprietary illustrate Example 45. fragments or selected public database sequences. For 25 example, the oligonucleotide primers or probes may be BRIEF DESCRIPTION OF THE DRAWINGS shorter or longer than the ones chosen; they may also be selected anywhere else in the proprietary DNA fragments or FIGS. 1 and 2 illustrate the principal subdivisions of the tuf in the sequences selected from public databases; they may be and atp) sequences repertories, respectively. For the design also variants of the same oligonucleotide. If the target DNA or 30 of primers and probes, depending on the needs, one may want a variant thereof hybridizes to a given oligonucleotide, or if to use the complete data set illustrated on the top of the the target DNA or a variant thereof can be amplified by a pyramid or use only a subset illustrated by the different given oligonucleotide PCR primer pair, the converse is also branching points. Smaller Subdivisions, representing groups, true; a given target DNA may hybridize to a variant oligo families, genus and species, could even be made to extend to nucleotide probe or be amplified by a variant oligonucleotide 35 the bottom of the pyramid. Because the tuf and atp) PCR primer. Alternatively, the oligonucleotides may be sequences are highly conserved and evolved with each spe designed from any DNA fragment sequences for use in ampli cies, the design of primers and probes does not need to fication methods other than PCR. Consequently, the core of include all the sequences within the database or its subdivi this invention is the identification of universal, species-spe sions. As illustrated in Tables 42 to 58, 61 to 69, 76 and 80, cific, genus-specific, family-specific, group-specific, resis 40 depending on the use, sequences from a limited number of tance gene-specific, toxin gene-specific genomic or non-ge species can be carefully selected to represent: i) only the main nomic DNA fragments which are used as a source of specific phylogenetic branches from which the intended probes and and ubiquitous oligonucleotide probes and/or amplification primers need to be differentiating, and ii) only the species for primers. Although the selection and evaluation of oligonucle which they need to be matching. However, for ubiquity pur otides suitable for diagnostic purposes requires much effort, it 45 poses, and especially for primers and probesidentifying large is quite possible for the individual skilled in the art to derive, groups of species (genus, family, group or universal, or from the selected DNA fragments, oligonucleotides other sequencing primers), the more data is included into the than the ones listed in Tables 39-41, 59-60, 70-76, 77-79, and sequence analysis, the better the probes and primers will be 81-92 which are suitable for diagnostic purposes. When a suitable for each particular intended use. Similarly, for speci proprietary fragment or a public databases sequence is 50 ficity purposes, a larger data set (or repertory) ensures optimal selected for its specificity and ubiquity, it increases the prob primers and probes design by reducing the chance of employ ability that subsets thereof will also be specific and ubiqui ing nonspecific oligonucleotides. tOuS. FIG. 3 illustrates the approach used to design specific Since a high percentage of clinical specimens are negative amplification primers from fuSA as well as from the region for bacteria (Table 3), DNA fragments having a high potential 55 between the end of fusA and the beginning of tuf in the for the selection of universal oligonucleotide probes or prim streptomycin (str) operon (referred to as the fusA-tuf inter ers were selected from proprietary and public database genic spacer in Table 7). Shown is a schematic organization of sequences. The amplification primers were selected from universal amplification primers (SEQID NOS. 1221-1229) in genes highly conserved in algae, archaea, bacteria, fungi and the stroperon. Amplicon sizes are given in bases pairs. Draw parasites, and are used to detect the presence of any algal, 60 ing not to scale, as the fuSA-tuf intergenic spacer size varies archaeal, bacterial, fungal or parasitical pathogen in clinical depending on the bacterial species. Indicated amplicon specimens in order to determine rapidly whether it is positive lengths are for E. coli. or negative for algae, archaea, bacteria, fungi or parasites. The FIGS. 4 to 6 are illustrations to Example 42, whereas FIGS. selected genes, designated tuf, fus, atp) and recA, encode 7 to 10 illustrate Example 43. respectively 2 proteins (elongation factors Tu and G) involved 65 FIG. 4. Abridged multiple amino acid sequence alignment in the translational process during protein synthesis, a protein of the partial tuf gene products from selected species illus (beta subunit) responsible for the catalytic activity of proton trated using the program Alscript. Residues highly conserved US 8,182,996 B2 13 14 in bacteria are boxed in grey and gaps are represented with design of universal amplification and sequencing primers. dots. Residues in reverse print are unique to the enterococcal Moreover, within the fragment amplified by these primers, tufB as well as to Streptococcal and lactococcal tuf gene highly conserved and more variable regions are also present products. Numbering is based on E. coli EF-Tu and secondary hence Suggesting it might be possible to rapidly obtain structure elements of E. coli EF-Tu are represented by cylin sequence information from various microbial species to ders (C.-helices) and arrows (B-strands). The sequences design universal as well as species-, genus-, family-, or shown correspond to SEQID NO’s: 2630 to 2667. group-specific primers and probes of potential use for the FIG. 5. Distance matrix tree of bacterial EF-Tu based on detection and identification and/or quantification of microor amino acid sequence homology. The tree was constructed by ganisms. the neighbor-joining method. The tree was rooted using 10 Translation elongation factors are members of a family of archeal and eukaryotic EF-1C. genes as the outgroup. The GTP-binding proteins which intervene in the interactions of scale bar represents 5% changes in amino acid sequence, as tRNA molecules with the ribosome machinery during essen determined by taking the sum of all of the horizontal lines tial steps of protein synthesis. The role of elongation factor Tu connecting two species. is to facilitate the binding of aminoacylated tRNA molecules FIG. 6. Southern hybridization of BglII/Xbal digested 15 to the A site of the ribosome. The eukaryotic, archaeal (ar genomic DNAS of some enterococci (except for E. Cassellifia chaebacterial) and algal homolog of EF-Tu is called elonga vus and E. gallinarum whose genomic DNA was digested tion factor 1 alpha (EF-1C.). All protein synthesis factors with BamHI/PvulI) using the tufA gene fragment of E. originated from a common ancestor via gene duplications and faecium as probes. The sizes of hybridizing fragments are fusions (Cousineau et al., 1997, J. Mol. Evol. 45:661-670). In shown in kilobases. Strains tested are listed in Table 16. particular, elongation factor G (EF-G), although having a FIG. 7. Pantoea and Tatumella species specific signature functional role in promoting the translocation of aminoacyl indel in atp genes. The nucleotide positions given are for E. tRNA molecules from the A site to the Psite of the ribosome, coli atp) sequence (GenBank accession no. V00267). Num shares sequence homologies with EF-Tu and is thought to bering starts from the first base of the initiation codon. have arisen from the duplication and fusion of an ancestor of FIG. 8: Trees based on sequence data from tuf (left side) 25 the EF-Tu gene. and atpD (right side). The phylogenetic analysis was per In addition, EF-Tu is known to be the target for antibiotics formed using the Neighbor-Joining method calculated using belonging to the elfamycin’s group as well as to other struc the Kimura two-parameter method. The value on each branch tural classes (Anborgh and Parmeggiani, 1991, EMBO J. indicates the occurence (%) of the branching order in 750 10:779-784; Luiten et al., 1992, European patent application bootstrapped trees. 30 serial No. EP0466 251 A1). EF-G for its part, is the target of FIG.9: Phylogenetic tree of members of the family Entero the antibiotic fusidic acid. In addition to its crucial activities bacteriaceae based on tuf (a), atp) (b), and 16S rRNA (c) in translation, EF-Tu has chaperone-like functions in protein genes. Trees were generated by neighbor-joining method cal folding, protection against heat denaturation of proteins and culated using the Kimura two-parameter method. The value interactions with unfolded proteins (Caldas et al., 1998, J. on each branch is the percentage of bootstrap replications 35 Biol. Chem. 273:11478-11482). Interestingly, a form of the supporting the branch. 750 bootstrap replications were cal EF-Tu protein has been identified as a dominant component culated. of the periplasm of Neisseria gonorrhoeae (Porcella et al., FIG.10: Plot of tuf distances versus 16S rRNA distances 1996, Microbiology 142:2481-2489), hence suggesting that (a), atp) distances versus 16S rDNA distances (b), and atpl) at least in Some bacterial species, EF-Tu might be an antigen distances versus tuf distances (c). Symbols: O, distances 40 with vaccine potential. between pairs of strains belonging to the same species; O. FF type ATP-synthase belongs to a superfamily of pro distances between E. coli Strains and Shigella strains; D. ton-translocating ATPases divided in three major families: P. distances between pairs belonging to the same genus; , V and F (Nelson and Taiz, 1989, TIBS 14:113-116). P-AT distances between pairs belonging to different genera; A. Pases (or E-E type) operate via a phosphorylated interme distances between pairs belonging to different families. 45 diate and are not evolutionarily related to the other two fami FIGS. 11 and 12 are illustrations to Example 44. lies. V-ATPases (or VV type) are present on the vacuolar and other endomembranes of eukaryotes, on the plasma DETAILED DESCRIPTION OF THE PREFERRED membrane of archaea (archaebacteria) and algae, and also on EMBODIMENT the plasma membrane of some eubacteria especially species 50 belonging to the order Spirochaetales as well as to the The present inventors reasoned that comparing the pub Chlamydiaceae and Deinococcaceae families. F-ATPases (or lished Haemophilus influenzae and Mycoplasma genitalium FoF type) are found on the plasma membrane of most eubac genomes and searching for conserved genes could provide teria, on the inner membrane of mitochondria and on the targets to develop useful diagnostic primers and probes. This thylakoid membrane of chloroplasts. They function mainly in sequence comparison is highly informative as these two bac 55 ATP synthesis. They are large multimeric enzymes sharing teria are distantly related and most genes present in the mini numerous structural and functional features with the V-AT mal genome of M.genitalium are likely to be present in every Pases. F and V-type ATPases have diverged from a common bacterium. Therefore genes conserved between these two ancestor in an event preceding the appearance of eukaryotes. bacteria are likely to be conserved in all other bacteria. The B subunit of the F-ATPases is the catalytic subunit and it Following the genomic comparison, it was found that sev 60 possesses low but significant sequence homologies with the eral protein-coding genes were conserved in evolution. catalytic A subunit of V-ATPases. Highly conserved proteins included the translation elonga The translation elongation factors EF-Tu, EF-G and EF-1 or tion factors G (EF-G) and Tu (EF-Tu) and the B subunit of and the catalytic subunit of F or V-types ATP-synthase, are FF type ATP-synthase, and to a lesser extent, the RecA highly conserved proteins sometimes used for phylogenetic recombinase. These four proteins coding genes were selected 65 analysis and their genes are also known to be highly con amongst the 20 most conserved genes on the basis that they all served (Iwabe et al., 1989, Proc. Natl. Acad. Sci. USA possess at least two highly conserved regions suitable for the 86: 9355-9359, Gogarten et al., 1989, Proc. Natl. Acad. Sci. US 8,182,996 B2 15 16 USA 86.6661-6665, Ludwig et al., 1993, Antonie van Leeu nucleic acids and/or sequencess. The eukaryotic (mito wenhoek 64:285-305). A recent BLAST (Altschul et al., chondrial) FF type ATP-synthase beta subunit gene is 1997, J. Mol. Biol. 215:403-410) search performed by the named atp2 in yeast. For the purpose of the current invention, present inventors on the GenBank, European Molecular Biol the genes of catalytic sub-unit of either F or V-type ATP ogy Laboratory (EMBL), DNA Database of Japan (DDBJ) synthase will hereafter be designated as > are the pieces of information derived from genetic marker to reconstruct bacterial phylogeny (Miller and (inherent to) these proteobacteria belonging to the bind to any of the four nucleotides A, C, G or T. Degenerated epsilon subdivision (Campylobacter and Helicobacter), the oligonucleotides consist of an oligonucleotide mix having bacteria from the Cytophaga, Flexibacter and Bacteroides two or more of the four nucleotides A, C, G or T at the site of group and some actinomycetes and corynebacteria. By anal mismatches. The inclusion of inosine and/or of base ambigu ysing atpD sequences from the latter species, primers and ities in the amplification primers allow mismatch tolerance probes to specifically fill these gaps could be designed and thereby permitting the amplification of a wider array of target used in conjuction with primers SEQID NOS. 562-565, also nucleotide sequences (Dieffenbach and Dveksler, 1995 PCR 25 derived from atpD nucleic acids and/or sequences. Primer: A Laboratory Manual, Cold Spring Harbor Labora In addition, universality of the assay could be expanded by tory Press, Plainview, N.Y.). mixing atp) sequences-derived primers with tuf sequences The amplification conditions with the universal primers are derived primers. Ultimately, even recA sequences-derived very similar to those used for the species- and genus-specific primers could be added to fill some gaps in the universal amplification assays except that the annealing temperature is 30 assay. slightly lower. The original universal PCR assay described in It is important to note that the 95 bacterial species selected our assigned WO98/20157 (SEQID NOS. 23-24 of the latter to test the ubiquity of the universal assay include all of the application) was specific and nearly ubiquitous for the detec most clinically relevant bacterial species associated with a tion of bacteria. The specificity for bacteria was verified by variety of human infections acquired in the community or in amplifying genomic DNA isolated from the 12 fungal species 35 hospitals (nosocomial infections). The most clinically impor as well as genomic DNA from Leishmania donovani, Sac tant bacterial and fungal pathogens are listed in Tables 1 and charomyces cerevisiae and human lymphocytes. None of the 2. above eukaryotic DNA preparations could be amplified by Amino Acid Sequences Derived from Tuf, atp) and recA the universal assay, thereby suggesting that this test is specific Nucleic Acids and/or Sequences for bacteria. The ubiquity of the universal assay was verified 40 The amino acid sequences translated from the repertory of by amplifying genomic DNAs from 116 reference strains tuf, atp) and recA nucleic acids and/or sequences are also an which represent 95 of the most clinically relevant bacterial object of the present invention. The amino acid sequence data species. These species have been selected from the bacterial will be particularly useful for homology modeling of three species listed in Table 4. We found that at least 104 of these dimensional (3D) structure of the elongation factor Tu, elon strains could be amplified. However, the assay could be 45 gation factor G, elongation factor 1a, ATPase subunit beta and improved since bacterial species which could not be ampli RecA recombinase. For all these proteins, at least one struc fied with the original tuf nucleic acids and/or sequences ture model has been published using X-ray diffraction data based assay included species belonging to the following gen from crystals. Based on those structural informations it is era: Corynebacterium (11 species) and Stenotrophomonas (1 possible to use computer software to build 3D model struc species). Sequencing of the tuf genes from these bacterial 50 tures for any other protein having peptide sequence homolo species and others has been performed in the Scope of the gies with the known structure (Greer, 1991, Methods in Enzy present invention in order to improve the universal assay. This mology, 202:239-252; Taylor, 1994, Trends Biotechnol. sequencing data has been used to select new universal primers 12(5):154-158; Sali, 1995, Curr. Opin. Biotechnol. 6:437 which may be more ubiquitous and more sensitive. Also, we 451; Sanchez and Sali, 1997, Curr. Opin. Struct. Biol. 7:206 improved our primer and probes design strategy by taking 55 214; Fischer and Eisenberg, 1999, Curr. Opin. Struct. Biol. into consideration the phylogeny observed in analysing our 9:208-211; Guex et al., 1999, Trends Biochem. Sci. 24:364 repertory of tuf, atpD and recA sequences. Data from each of 367). Model structures of target proteins are used for the the 3 main subrepertories (tuf, atp) and recA) was subjected design or to predict the behavior of ligands and inhibitors to a basic phylogenic analysis using the Pileup command such as antibiotics. Since EF-Tu and EF-G are already known from version 10 of the GCG package (Genetics Computer 60 as antibiotic targets (see above) and since the beta Subunit of Group, inc.). This analysis indicated the main branches or ATPase and RecA recombinase are essential to the survival of phyla reflecting the relationships between sequences. Instead the microbial cells in natural conditions of infection, all four of trying to design primers or probes able to hybridize to all proteins could be considered antibiotic targets. Sequence phyla, we designed primers or probes able to hybridize to the data, especially the new data generated by us could be very main phyla while trying to use the largest phylum possible. 65 useful to assist the creation of new antibiotic molecules with This strategy should allow less degenerated primers hence desired spectrum of activity. In addition, model structures improving sensitivity and by combining primers in a multiplex could be used to improve protein function for commercial US 8,182,996 B2 29 30 purposes such as improving antibiotic production by micro Example 26: Sequencing of prokaryotic tuf gene frag bial strains or increasing biomass. mentS. The following detailed embodiments and appended draw Example 27: Sequencing of procaryotic recA gene frag ings are provided as illustrative examples of his invention, mentS. with no intention to limit the scope thereof. 5 Example 28: Specific detection and identification of Escherichia coli/Shigella sp. using tuf sequences. Examples and Annexes Example 29: Specific detection and identification of Kleb siella pneumoniae using atp) sequences. For sake of clarity, here is a list of Examples and Annexes: Example30: Specific detection and identification of Acine Example 1: Sequencing of bacterial atp) (F-type and 10 V-type) gene fragments. tobacterbaumanii using tuf sequences. Example 2: Sequencing of eukaryotic atpD (F-type and Example 31: Specific detection and identification of Neis V-type) gene fragments. seria gonorrhoeae using tuf sequences. Example 3: Sequencing of eukaryotic tuf(EF-1) gene frag Example 32: Sequencing of bacterial gyra and parC gene mentS. 15 fragments. Example 4: Sequencing of eukaryotic tuf (organelle origin, Example 33: Development of a PCR assay for the specific M) gene fragments. detection and identification of Staphylococcus aureus and its Example 5: Specific detection and identification of Strep quinolone resistance genes gyra and parC. tococcus agalactiae using tuf sequences. Example34: Development of a PCR assay for the detection Example 6: Specific detection and identification of Strep and identification of Klebsiella pneumoniae and its quinolone tococcus agalactiae using atpd sequences. resistance genes gyrA and parC. Example 7: Development of a PCR assay for detection and Example35: Development of a PCR assay for the detection identification of staphylococci at genus and species levels. and identification of Streptococcus pneumoniae and its qui Example 8: Differentiating between the two closely related nolone resistance genes gyra and parC. yeast species Candida albicans and Candida dubliniensis. 25 Example 36: Detection of extended-spectrum TEM-type Example 9: Specific detection and identification of Enta B-lactamases in Escherichia coli. moeba histolytica. Example 37: Detection of extended-spectrum SHV-type Example 10: Sensitive detection and identification of B-lactamases in Klebsiella pneumoniae. Chlamydia trachomatis. Example38: Development of a PCR assay for the detection Example 11: Genus-specific detection and identification of 30 and identification of Neisseria gonorrhoeae and its associ enterococci. ated tetracycline resistance gene tetM. Example 12: Detection and identification of the major bac Example39: Developmentofa PCR assay for the detection terial platelets contaminants using tuf sequences with a mul and identification of Shigella sp. and their associated trime tiplex PCR test. thoprim resistance gene dhfrila. Example 13: The resolving power of the tuf and atpD 35 Example 40: Development of a PCR assay for the detection sequences databases is comparable to the biochemical meth and identification of Acinetobacterbaumanii and its associ ods for bacterial identification. ated aminoglycoside resistance gene aph (3')-VIa. Example 14: Detection of group B streptococci from clini Example 41: Specific detection and identification of cal specimens. Bacteroides fragilis using atp) (V-type) sequences. Example 15: Simultaneous detection and identification of 40 Example 42: Evidence for horizontal gene transfer in the Streptococcus pyogenes and its pyrogenic exotoxin A. evolution of the elongation factor Tu in Enterococci. Example 16: Real-time detection and identification of Example 43: Elongation factor Tu (tuf) and the F-ATPase Shiga toxin-producing bacteria. beta-subunit (atp)) as phylogenetic tools for species of the Example 17: Development of a PCR assay for the detection family Enterobacteriaceae. and identification of staphylococci at genus and species levels 45 Example 44: Testing new pairs of PCR primers selected and its associated mecA gene. from two species-specific genomic DNA fragments which are Example 18: Sequencing of pbp1a, pbp2b and pbp2X genes objects of U.S. Pat. No. 6,001,564. of Streptoccoccus pneumoniae. Example 45: Testing modified versions of PCR primers Example 19: Sequencing of heXA genes of Streptococcus derived from the sequence of several primers which are species. 50 objects of U.S. Pat. No. 6,001,564. Example 20: Development of a multiplex PCR assay for The various Annexes show the strategies used for the selec the detection of Streptococcus pneumoniae and its penicillin tion of a variety of DNA amplification primers, nucleic acid resistance genes. hybridization probes and molecular beacon internal probes: Example 21: Sequencing of the Vancomycin resistance (i) Table 39 shows the amplification primers used for VanA. VanC1, VanC2 and VanC3 genes. 55 nucleic acid amplification from tuf sequences. Example 22: Development of a PCR assay for the detection (ii) Table 40 shows the amplification primers used for and identification of enterococci at genus and species levels nucleic acid amplification from atp) sequences. and its associated resistance genes VanA and VanB. (iii) Table 41 shows the internal hybridization probes for Example 23: Development of a multiplex PCR assay for detection of tuf sequences. detection and identification of Vancomycin-resistant Entero 60 (iv) Table 42 illustrates the strategy used for the selection of coccus faecalis, Enterococcus faecium, Enterococcus galli the amplification primers specific for atpD sequences of narum, Enterococcus casselliflavus, and Enterococcus flave the F-type. SCa2S. (v) Table 43 illustrates the strategy used for the selection of Example 24: Universal amplification involving the EF-G the amplification primers specific for atpD sequences of (fuSA) Subdivision of tuf sequences. 65 the V-type. Example 25: DNA fragment isolation from Staphylococ (vi) Table 44 illustrates the strategy used for the selection of cus saprophyticus by arbitrarily primed PCR. the amplification primers specific for the tuf sequences US 8,182,996 B2 31 32 of organelle lineage (M, the letter M is used to indicate (xxvii) Table 65 illustrates the strategy for the selection of that in most cases, the organelle is the mitochondria). stx-specific amplification primers and hybridization (vii) Table 45 illustrates the strategy used for the selection probe. of the amplification primers specific for the tuf (xxviii) Table 66 illustrates the strategy for the selection of sequences of eukaryotes (EF-1). Van A-specific amplification primers from Van (viii) Table 46 illustrates the strategy for the selection of Sequences. Streptococcus agalactiae-specific amplification primers (xxix) Table 67 illustrates the strategy for the selection of from tuf sequences. VanB-specific amplification primers from Van (ix) Table 47 illustrates the strategy for the selection of Sequences. 10 (XXX) Table 68 illustrates the strategy for the selection of Streptococcus agalactiae-specific hybridization probes VanC-specific amplification primers from VanC from tuf sequences. Sequences. (x) Table 48 illustrates the strategy for the selection of (xxxi) Table 69 illustrates the strategy for the selection of Streptococcus agalactiae-specific amplification primers Streptococcus pneumoniae-specific amplification prim from atpD sequences. 15 ers and hybridization probes from pbp1a sequences. (xi) Table 49 illustrates the strategy for the selection from (xxxii) Table 70 shows the specific and ubiquitous primers tufsequences of Candida albicans/dubliniensis-specific for nucleic acid amplification from toxin gene amplification primers, Candida albicans-specific Sequences. hybridization probe and Candida dubliniensis-specific (xxxiii) Table 71 shows the molecular beacon internal hybridization probe. hybridization probes for specific detection of toxin (xii) Table 50 illustrates the strategy for the selection of Sequences. Staphylococcus-specific amplification primers from tuf (xxxiv) Table 72 shows the specific and ubiquitous primers Sequences. for nucleic acid amplification from van sequences. (xiii) Table 51 illustrates the strategy for the selection of the (XXXV) Table 73 shows the internal hybridization probes for Staphylococcus-specific hybridization probe from tuf 25 specific detection of van sequences. Sequences. (XXXVi) Table 74 shows the specific and ubiquitous primers (xiv) Table 52 illustrates the strategy for the selection of for nucleic acid amplification from pbp sequences. Staphylococcus saprophyticus-specific and Staphyllo (XXXVii) Table 75 shows the internal hybridization probes coccus haemolyticus-specific hybridization probes from for specific detection of pbp sequences. tuf sequences. 30 (XXXViii) Table 76 illustrates the strategy for the selection (XV) Table 53 illustrates the strategy for the selection of of VanAB-specific amplification primers and Van A- and Staphylococcus aureus-specific and Staphylococcus van B-specific hybridization probes from van sequences. epidermidis-specific hybridization probes from tuf (xxxix) Table 77 shows the internal hybridization probe for Sequences. specific detection of mecA. (xvi) Table 54 illustrates the strategy for the selection of the 35 (x1) Table 78 shows the specific and ubiquitous primers for Staphylococcus hominis-specific hybridization probe nucleic acid amplification from hexA sequences. from tuf sequences. (xli) Table 79 shows the internal hybridization probe for (xvii) Table 55 illustrates the strategy for the selection of specific detection of hexA. the Enterococcus-specific amplification primers from (xlii) Table 80 illustrates the strategy for the selection of tuf sequences. 40 Streptococcus pneumoniae species-specific amplifica (xviii) Table 56 illustrates the strategy for the selection of tion primers and hybridization probe from hex A the Enterococcus faecalis-specific hybridization probe, Sequences. of the Enterococcus faecium-specific hybridization (xliii) Table 81 shows the specific and ubiquitous primers probe and of the Enterococcus casselliflavus-flavescens for nucleic acid amplification from pcp sequences. gallinarum group-specific hybridization probe from tuf 45 (xliv) Table 82 shows specific and ubiquitous primers for Sequences. nucleic acid amplification of S. saprophyticus sequences (xix) Table 57 illustrates the strategy for the selection of of unknown coding potential. primers from tuf sequences for the identification of (xlv) Table 83 shows the molecular beacon internal hybrid platelets contaminants. ization probes for specific detection of antimicrobial (XX) Table 58 illustrates the strategy for the selection of the 50 agents resistance gene sequences. universal amplification primers from atp) sequences. (xlvi) Table 84 shows the molecular beacon internal (xxi) Table 59 shows the amplification primers used for hybridization probe for specific detection of S. aureus nucleic acid amplification from recA sequences. gene sequences of unknown coding potential. (xxii) Table 60 shows the specific and ubiquitous primers (xlvii) Table 85 shows the molecular beacon hybridization for nucleic acid amplification from speA sequences. 55 internal probe for specific detection of tuf sequences. (xxiii) Table 61 illustrates the first strategy for the selection (xlviii) Table 86 shows the molecular beacon internal of Streptococcus pyogenes-specific amplification prim hybridization probes for specific detection of ddI and ers from speA sequences. mtl sequences. (xxiv) Table 62 illustrates the second strategy for the selec (xlix) Table 87 shows the internal hybridization probe for tion of Streptococcus pyogenes-specific amplification 60 specific detection of S. aureus sequences of unknown primers from speA sequences. coding potential. (XXV) Table 63 illustrates the strategy for the selection of (1) Table 88 shows the amplification primers used for Streptococcus pyogenes-specific amplification primers nucleic acid amplification from antimicrobial agents from tuf sequences. resistance genes sequences. (xxvi) Table 64 illustrates the strategy for the selection of 65 (li) Table 89 shows the internal hybridization probes for stX-specific amplification primers and hybridization specific detection of antimicrobial agents resistance probe. genes Sequences. US 8,182,996 B2 33 34 (lii) Table 90 shows the molecular beacon internal hybrid In the same manner, the primers described in Table 43 ization probes for specific detection of atpD sequences. (SEQ ID NOS. 681-683) could amplify the atp|D (V-type) (liii) Annex Table 91 shows the internal hybridization gene from various fungal and parasitical species. This strat probes for specific detection of atpD sequences. egy allowed to obtain SEQ ID NOS. 834-839, 956-957, and (liv) Table 92 shows the internal hybridization probes for 959-965. specific detection of ddI and mtl sequences. As shown in these Annexes, the selected amplification Example 3 primers may contain inosines and/or base ambiguities. Inosine is a nucleotide analog able to specifically bind to any Sequencing of Eukaryotic tuf (EF-1) Gene of the four nucleotides A, C, G or T. Alternatively, degener 10 Fragments ated oligonucleotides which consist of an oligonucleotide mix having two or more of the four nucleotides A, C, G or T As shown in Table 45, the comparison of publicly available at the site of mismatches were used. The inclusion of inosine tuf (EF-1) sequences from a variety of fungal and parasitical and/or of degeneracies in the amplification primers allows species revealed conserved regions allowing the design of mismatch tolerance thereby permitting the amplification of a 15 PCR primers able to amplify tuf sequences from a wide range wider array of target nucleotide sequences (Dieffenbach and of fungal and parasitical species. Using primers pairs SEQID Dveksler, 1995 PCR Primer: A Laboratory Manual, Cold NOs. 558 and 559, 813 and 559, 558 and 815, 560 and 559, Spring Harbor Laboratory Press, Plainview, N.Y.). 653 and 559, 558 and 655, and 654 and 559, 1999 and 2000, 2001 and 2003, 2002 and 2003, it was possible to amplify and EXAMPLES sequence tuf sequences SEQ ID NOS. 399-457, 509-529, 622-624, 677, 779-790, 840-842, 865, 897-903, 1266-1287, Example 1 1561-1571 and 1685. Sequencing of Bacterial atp) (F-Type and V-Type) Example 4 Gene Fragments 25 Sequencing of Eukaryotic tuf (Organelle Origin, M) As shown in Table 42, the comparison of publicly available Gene Fragments atpD (F-type) sequences from a variety of bacterial species revealed conserved regions allowing the design of PCR prim As shown in Table 44, the comparison of publicly available ers able to amplify atp) sequences (F-type) from a wide 30 tuf (organelle origin, M) sequences from a variety of fungal range of bacterial species. Using primers pairs SEQID NOS. and parasitical organelles revealed conserved regions allow 566 and 567,566 and 814,568 and 567,570 and 567,572 and ing the design of PCR primers able to amplify tuf sequences 567, 569 and 567, 571 and 567, 700 and 567, it was possible of several organelles belonging to a wide range fungal and to amplify and sequence atpl) sequences SEQID NOS. 242 parasitical species. Using primers pairs SEQID NOS. 664 and 270, 272-398,673-674, 737-767, 866-867, 942-955, 1245 35 652, 664 and 561,911 and 914,912 and 914,913 and 915,916 1254, 1256-1265, 1527, 1576, 1577, 1600-1604, 1640-1646, and 561, 664 and 917, it was possible to amplify and sequence 1649, 1652, 1655, 1657, 1659-1660, 1671, 1844-1845, and tuf sequences SEQ ID NOS. 498-508, 791-792, 843-855, 1849-1865. 904-910, 1664, 1666-1667, 1669-1670, 1673-1683, 1686 Similarly, Table 43 shows the strategy to design the PCR 1689, 1874-1876, 1879, 1956-1960, and 2193-2199. primers able to amplify atp) sequences of the V-type from a 40 wide range of archaeal and bacterial species. Using primers Example 5 SEQ ID NOS. 681-683, it was possible to amplify and sequence atpD sequences SEQ ID NOS. 827-832, 929-931, Specific Detection and Identification of 958 and 966. As the gene was difficult to amplify for several Streptococcus agalactiae Using tufSequences species, additional amplification primers were designed 45 inside the original amplicon (SEQ ID NOS. 1203–1207) in As shown in Table 46, the comparison of tuf sequences order to obtain sequence information for these species. Other from a variety of bacterial species allowed the selection of primers (SEQ ID NO. 1212, 1213, 2282-2285) were also PCR primers specific for S. agalactiae. The strategy used to designed to amplify regions of the atpD gene (V-type) in design the PCR primers was based on the analysis of a mul archaebacteria. 50 tiple sequence alignment of various tuf sequences. The mul tiple sequence alignment includes the tuf sequences of four Example 2 bacterial strains from the target species as well as tuf sequences from other species and bacterial genera, especially Sequencing of Eukaryotic atp) (F-Type and V-Type) representatives of closely related species. A careful analysis Gene Fragments 55 of this alignment allowed the selection of oligonucleotide sequences which are conserved within the target species but The comparison of publicly available atpD (F-type) which discriminate sequences from other species and genera, sequences from a variety of fungal and parasitical species especially from the closely related species, thereby permit revealed conserved regions allowing the design of PCR prim ting the species-specific, ubiquitous and sensitive detection ers able to amplify atpD sequences from a wide range of 60 and identification of the target bacterial species. fungal and parasitical species. Using primers pairs SEQ ID The chosen primer pair, oligos SEQID NO. 549 and SEQ NOs. 568 and 573, 574 and 573, 574 and 708, and 566 and ID NO. 550, gives an amplification product of 252 bp. Stan 567, it was possible to amplify and sequence atp) sequences dard PCR was carried out using 0.4 uM of each primer, 2.5 SEQ ID NOs. 458-497, 530-538, 663, 667, 676, 678-680, mM MgCl, BSA 0.05 mM, 1x Taq. Buffer (Promega), dNTP 768-778, 856-862, 889-896, 941, 1638-1639, 1647, 1650 65 0.2 mM (Pharmacia), 0.5 UTaq DNA polymerase (Promega) 1651, 1653-1654, 1656, 1658, 1684, 1846-1848, and 2.189 coupled with TaqStartTM antibody (Clontech Laboratories 21.92. Inc., Palo Alto), 1 ul of genomic DNA sample in a final US 8,182,996 B2 35 36 volume of 20 ul using a PTC-200 thermocycler (MJ Research Example 6 Inc.). The optimal cycling conditions for maximum sensitiv ity and specificity were 3 minutes at 95°C. for initial dena Specific Detection and Identification of turation, then forty cycles of two steps consisting of 1 second Streptococcus agalactiae Using atpD Sequences at 95° C. and 30 seconds at 62° C., followed by terminal extension at 72° C. for 2 minutes. Detection of the PCR As shown in Table 48, the comparison of atp) sequences products was made by electrophoresis in agarose gels (2%) from a variety of bacterial species allowed the selection of containing 0.25 ug/ml of ethidium bromide. PCR primers specific for S. agalactiae. The primer design Specificity of the assay was tested by adding into the PCR strategy is similar to the Strategy described in the preceding reactions, 0.1 ng of genomic DNA from each of the bacterial 10 Example except that atp) sequences were used in the align ment. species listed in Table 8. Efficient amplification was observed Four primers were selected, ASag42 (SEQ ID NO. 627), only for the 5 S. agalactiae strains listed. Of the other bacte ASag52 (SEQID NO. 628), ASag206 (SEQID NO. 625) and rial species, including 32 species representative of the vaginal ASag371 (SEQID NO. 626). The following combinations of flora and 27 other streptococcal species, only S. acidomini 15 these four primers give four amplicons: SEQID NO. 627+ mus yielded amplification. The signal with 0.1 ng of S. aci SEQ ID NO. 625=190 bp, SEQ ID NO. 628+SEQ ID NO. dominimus genomic DNA was weak and the detection limit 625=180 bp, SEQID NO. 627+SEQID NO. 626–355bp, and for this species was 10 pg (corresponding to more than 4000 SEQID NO. 628+SEQID NO. 626–345 bp. genome copies) while the detection limit for S. agalactiae Standard PCR was carried out on PTC-200 thermocyclers was 2.5 fg (corresponding to one genome copy) of genomic (MJ Research Inc) using 0.4 uM of each primers pair, 2.5 mM DNA. MgCl, BSA 0.05 mM, 1x taq Buffer (Promega), dNTP 0.2 To increase the specificity of the assay, internal probes mM (Pharmacia), 0.5 U Taq DNA polymerase (Promega) were designed for FRET (Fluorescence Resonance Energy coupled with TaqStartTM antibody (Clontech Laboratories Transfer) detection using the LightCyclerTM (Idaho Technol Inc., Palo Alto), 1 ul of genomic DNA sample in a final ogy). As illustrated in Table 47, a multiple sequence align 25 Volume of 20 uL. The optimal cycling conditions for maxi ment of streptococcal tuf sequence fragments corresponding mum sensitivity and specificity were adjusted for each primer to the 252 bp region amplified by primers SEQID NO. 549 pair. Three minutes at 95° C. for initial denaturation, then and SEQ ID NO. 550, was used for the design of internal forty cycles of two steps consisting of 1 second at 95°C. and probes TSagHF436 (SEQ ID NO. 582) and TSagHF465 30 seconds at the optimal annealing temperature specified (SEQ ID NO. 583). The region of the amplicon selected for 30 below were followed by terminal extension at 72° C. for 2 minutes. Detection of the PCR products was made by elec internal probes contained sequences unique and specific to S. trophoresis in agarose gels (2%) containing 0.25 g/ml of agalactiae. SEQ ID NO. 583, the more specific probe, is ethidium bromide. Since atp) sequences are relatively more labelled with fluorescein in 3', while SEQ ID NO. 582, the specific than tuf sequences, only the most closely related less discriminant probe, is labelled with CY5 in 5' and 35 species namely, the Steptococcal species listed in Table 9. blocked in 3' with a phosphate group. However, since the were tested. FRET signal is only emitted if both probes are adjacently All four primer pairs only amplified the six S. agalactiae hybridized on the same target amplicon, detection is highly strains. With an annealing temperature of 63°C., the primer specific. pair SEQID NO. 627+SEQ ID NO. 625 had a sensitivity of Real-time detection of PCR products using the LightCy 40 1-5 fig (equivalent to 1-2 genome copies). At 55° C., the clerTM was carried out using 0.4 uM of each primer (SEQID primer pair SEQID NO. 628+SEQ ID NO. 625 had a sensi NO. 549-550), 0.2 uM of each probe (SEQID NO. 582-583), tivity of 2.5 fg (equivalent to 1 genome copy). At 60° C., the 2.5 mMMgCl, BSA 450 g/ml, 1xPC2 Buffer (ABPeptides, primer pair SEQID NO. 627+SEQ ID NO. 626 had a sensi St-Louis, Mo.), dNTP 0.2 mM (Pharmacia), 0.5 U Klen tivity of 10 fg (equivalent to 4 genome copies). At 58°C., the Taq1TM DNA polymerase (AB Peptides) coupled with 45 primer pair SEQID NO. 628+SEQ ID NO. 626 had a sensi TaqStartTM antibody (Clontech Laboratories Inc., Palo Alto), tivity of 2.5-5 fig (equivalent to 1-2 genome copies). This 0.7 ul of genomic DNA sample in a final volume of 7ul using proves that all four primer pairs can detect S. agalactiae with a LightCycler thermocycler (Idaho Technology). The optimal high specificity and sensitivity. Together with Example 5, this cycling conditions for maximum sensitivity and specificity example demonstrates that both tuf and atpD sequences are were 3 minutes at 94° C. for initial denaturation, then forty 50 suitable and flexible targets for the identification of microor cycles of three steps consisting of 0 second (this setting mean ganisms at the species level. The fact that 4 different primer ing the LightCycler will reach the target temperature and stay pairs based on atp) sequences led to efficient and specific at it for its minimal amount of time) at 94°C., 10 seconds at amplification of Sagalactiae demonstrates that the challenge 64° C., 20 seconds at 72° C. Amplification was monitored is to find target genes Suitable for diagnostic purposes, rather during each annealing steps using the fluorescence ratio. The 55 than finding primer pairs from these target sequences. streptococcal species having close sequence homologies with Example 7 the tuf sequence of S. agalactiae (S. acidominimus, S. angi nosus, S. Bovis, S. dysgalactiae, S. equi, S. ferus, S. gordonii, Development of a PCR Assay for Detection and S. intermedius, S. parasanguis, S. parauberis, S. salivarius, S. 60 Identification of Staphylococci at Genus and Species sanguis, S. suis) as well as S. agalactiae were tested in the Levels LightCycler with 0.07ng of genomic DNA per reaction. Only S. agalactiae yielded an amplification signal, hence demon Materials and Methods strating that the assay is species-specific. With the LightCy Bacterial strains. The specificity of the PCR assay was clerTM assay using the internal FRET probes, the detection 65 verified by using a panel of ATCC (America Type Culture limit for S. agalactiae was 1-2 genome copies of genomic Collection) and DSMZ (Deutsche Sammlung von Mikroor DNA. ganismen and Zellkulturen GmbH, German Collection of US 8,182,996 B2 37 38 Microorganisms and Cell Cultures) reference strains consist luminescent detection of amplification products. Tables 61 to ing of 33 gram-negative and 47 gram-positive bacterial spe 64 illustrate the strategy for the selection of several internal cies (Table 12). In addition, 295 clinical isolates representing probes. 11 different species of staphylococci from the microbiology PCR amplification. For all bacterial species, amplification laboratory of the Centre Hospitalier Universitaire de Québec, was performed from purified genomic DNA or from a bacte Pavillon Centre Hospitalier de l’Université Laval (CHUL) rial suspension whose turbidity was adjusted to that of a 0.5 (Step-Foy, Québec, Canada) were also tested to further vali McFarland standard, which corresponds to approximately date the Staphylococcus-specific PCR assay. These strains 1.5x10 bacteria per ml. One nanogram of genomic DNA or were all identified by using (i) conventional methods or (ii) 1 Dl of the standardized bacterial suspension was transferred 10 directly to a 19 Ol PCR mixture. Each PCR reaction con the automated MicroScan Autoscan-4 system equipped with tained 50 mM KC1, 10 mM Tris-HCl (pH 9.0), 0.1% Triton the Positive BP Combo Panel Type 6 (Dade Diagnostics, X-100, 2.5 mM MgCl, 0.20M (each) of the two Staphylo Mississauga, Ontario, Canada). Bacterial strains from frozen coccus genus-specific primers (SEQID NOS. 553 and 575), stocks kept at -80° C. in brain heart infusion (BHI) broth 2000M (each) of the four deoxynucleoside triphosphates containing 10% glycerol were cultured on sheep blood agar or 15 (Pharmacia Biotech), 3.3 g/Dl bovine serum albumin in BHI broth (Quelab Laboratories Inc, Montréal, Québec, (BSA) (Sigma-Aldrich Canada Ltd, Oakville, Ontario, Canada). Canada), and 0.5 UTaq polymerase (Promega) coupled with PCR primers and internal probes. Based on multiple TaqStartTM Antibody (Clontech). The PCR amplification was sequence alignments, regions of the tuf gene unique to sta performed as follows: 3 min. at 94°C. for initial denaturation, phylococci were identified. Staphylococcus-specific PCR then forty cycles of two steps consisting of 1 second at 95°C. primers TStaG422 (SEQ ID NO. 553) and TStaG765 (SEQ and 30 seconds at 55° C. plus a terminal extension at 72°C. ID NO. 575) were derived from these regions (Table 50). for 2 minutes. Detection of the PCR products was made by These PCR primers are displaced by two nucleotidepositions electrophoresis inagarose gels (2%) containing 0.25ug/ml of compared to original Staphylococcus-specific PCR primers ethidium bromide. Visualization of the PCR products was described in our patent publication WO98/20157 (SEQ ID 25 made under UV at 254 nm. NOs. 17 and 20 in the said patent publication). These modi For determination of the sensitivities of the PCR assays, fications were done to ensure specificity and ubiquity of the two-fold dilutions of purified genomic DNA were used to primer pair, in the light of new tuf sequence data revealed in determine the minimal number of genome copies which can the present patent application for several additional Staphy be detected. lococcal species and strains. 30 Results Similarly, sequence alignment analysis were performed to Amplifications with the Staphylococcus genus-specific design genus and species-specific internal probes (see Tables PCR assay. The specificity of the assay was assessed by 61 to 64). Two internal probes specific for Staphylococcus performing 30-cycle and 40-cycle PCR amplifications with (SEQ ID NOS. 605-606), five specific for S. aureus (SEQID the panel of gram-positive (47 species from 8 genera) and NOs. 584-588), five specific for S. epidermidis (SEQID NO. 35 gram-negative (33 species from 22 genera) bacterial species 589-593), two specific for S. haemolyticus (SEQ ID NOs. listed in Table 12. The PCR assay was able to detect effi 594-595), three specific for S. hominis (SEQ ID NOS. 596 ciently 27 of 27 staphylococcal species tested in both 598), four specific for S. saprophyticus (SEQID NOS. 599 30-cycle and 40-cycle regimens. For 30-cycle PCR, all bac 601 and 695), and two specific for coagulase-negative Sta terial species tested other than Staphylococci were negative. phylococcus species including S. epidermidis, S. hominis, S. 40 For 40-cycle PCR, Enterococcus faecalis and Macrococcus Saprophyticus, S. auricularis, S. capitis, S. haemolyticus, S. caseolyticus were slightly positive for the Staphylococcus lugdunensis, S. simulans, S. cohnii and S. warneri (SEQ ID specific PCR assay. The other species tested remained nega NOs. 1175-1176) were designed. The range of mismatches tive. Ubiquity tests performed on a collection of 295 clinical between the Staphylococcus-specific 371-bp amplicon and isolates provided by the microbiology laboratory of the Cen each of the 20-mer species-specific internal probes was from 45 tre Hospitalier Universitaire de Québec, Pavillon Centre Hos 1 to 5, in the middle of the probe when possible. No mis pitalier de l’Université Laval (CHUL), including Staphylo matches were present in the two Staphylococcus-specific coccus aureus (n=34), S. auricularis (n=2), S. capitis (n=19), probes for the 11 species analyzed: S. aureus, S. auricularis, S. cohnii (n=5), S. epidermidis (n=18), S. haemolyticus S. capitis, S. cohnii, S. epidermidis, S. haemolyticus, S. homi (n=21), S. hominis (n=73). S. lugdunensis (n=17), S. nis, S. lugdunensis, S. saprophyticus, S. simulans and S. warn 50 saprophyticus (n=6), S. simulans (n=3), S. warneri (n=32) eri. In order to Verify the intra-specific sequence conservation and Staphylococcus sp. (n-65), showed a uniform amplifica of the nucleotide sequence, sequences were obtained for the tion signal with the 30-cycle PCR assays and a perfect rela 371-bp amplicon from five unrelated ATCC and clinical tion between the genotype and classical identification strains for each of the species S. aureus, S. epidermidis, S. schemes. haemolyticus, S. hominis and S. saprophyticus. The OligoTM 55 The sensitivity of the Staphylococcus-specific assay with (version 5.0) primer analysis software (National Biosciences, 30-cycle and 40-cycle PCR protocols was determined by Plymouth, Minn.) was used to confirm the absence of self using purified genomic DNA from the 11 staphylococcal complementary regions within and between the primers or species previously mentioned. For PCR with 30 cycles, a probes. When required, the primers contained inosines or detection limit of 50 copies of genomic DNA was consis degenerated nucleotides at one or more variable positions. 60 tently obtained. In order to enhance the sensitivity of the Oligonucleotide primers and probes were synthesized on a assay, the number of cycles was increased. For 40-cycle PCR model 394 DNA synthesizer (Applied Biosystems, Missis assays, the detection limit was lowered to a range of 5-10 sauga, Ontario, Canada). Detection of the hybridization was genome copies, depending on the staphylococcal species performed with the DIG-labeled duTP incorporated during tested. amplification with the Staphylococcus-specific PCR assay, 65 Hybridization between the Staphylococcus-specific 371 and the hybridization signal was detected with aluminometer bp amplicon and species-specific or genus-specific internal (Dynex Technologies) as described above in the section on probes. Inter-species polymorphism was sufficient to gener US 8,182,996 B2 39 40 ate species-specific internal probes for each of the principal Research), the cycling conditions for initial sensitivity and species involved in human diseases (S. aureus, S. epidermi specificity testing were 3 min. at 94° C. for initial denatur dis, S. haemolyticus, S. hominis and S. saprophyticus). In ation, then forty cycles of two steps consisting of 1 second at order to verify the intra-species sequence conservation of the 95° C. and 30 seconds at 55° C., followed by terminal exten nucleotide sequence, sequence comparisons were performed 5 sion at 72°C. for 2 minutes. Detection of the PCR products on the 371-bp amplicon from five unrelated ATCC and clini was made by electrophoresis in agarose gels (2%) containing cal strains for each of the 5 principal Staphylococcal species: 0.25ug/ml of ethidium bromide. The three primer pairs could S. aureus, S. epidermidis, S. haemolyticus, S. hominis and S. detect the equivalent of less than 200 E. histolytica genome Saprophyticus. Results showed a high level of conservation of copies. Specificity was tested using 0.5 ng of purified nucleotide sequence between different unrelated strains from 10 genomic DNA from a panel of microorganisms including the same species. This sequence information allowed the Babesia Bovis, Babesia microtti, Candida albicans, Crithidia development of staphylococcal species identification assays fasciculata, Leishmania major; Leishmania hertigi and using species-specific internal probes hybridizing to the 371 Neospora caninum. Only E. histolytica DNA could be ampli bp amplicon. These assays are specific and ubiquitous for fied, thereby suggesting that the assay was species-specific. those five staphylococcal species. In addition to the species 15 specific internal probes, the genus-specific internals probes Example 10 were able to recognize all or most Staphylococcus species tested. Sensitive Identification of Chlamydia trachomatis Example 8 Upon analysis of tuf sequence data, it was possible to find two regions where Chlamydia trachomatis sequences Differentiating Between the Two Closely Related remained conserved while other species have diverged. Prim Yeast Species Candida albicans and Candida ers Ctr82 (SEQID NO. 554) and Ctr249 (SEQID NO. 555) Dubliniensis were designed. With the PTC-200 thermocyclers (MJ 25 Research), the optimal cycling conditions for maximum sen It is often useful for the clinician to be able to differentiate sitivity and specificity were determined to be 3 min. at 94°C. between two very closely related species of microorganisms. for initial denaturation, then forty cycles of two steps consist Candida albicans is the most important cause of invasive ing of 1 second at 95°C. and 30 seconds at 60°C., followed human mycose. In recent years, a very closely related species, by terminal extension at 72°C. for 2 minutes. Detection of the Candida dubliniensis, was isolated in immunosuppressed 30 PCR products was made by electrophoresis in agarose gels patients. These two species are difficult to distinguish by (2%) containing 0.25 g/ml of ethidium bromide. The assay classic biochemical methods. This example demonstrates the could detect the equivalent of 8 C. trachomatis genome cop use of tuf sequences to differentiate Candida albicans and ies. Specificity was tested with 0.1 ng of purified genomic Candida dubliniensis. PCR primers SEQ ID NOS. 11-12, DNA from a panel of microorganisms including 22 species from previous patent publication WO98/20157, were 35 commonly encountered in the vaginal flora (Bacillus subtilis, selected for their ability to specifically amplify a tuf (elonga Bacteroides fragilis, Candida albicans, Clostridium difficile, tion factor 1 alpha type) fragment from both species (see Corynebacterium cervicis, Corynebacterium urealyticum, Annex XI for primer positions). Within this tuffragment, a Enterococcus faecalis, Enterococcus faecium, Escherichia region differentiating C. albicans and C. dubliniensis by two coli, Fusobacterium nucleatum, Gardnerella vaginalis, Hae nucleotides was selected and used to design two internal 40 mophilus influenzae, Klebsiella Oxytoca, Lactobacillus aci probes (see Table 49 for probe design, SEQID NOS. 577 and dophilus, Peptococcus niger, Peptostreptococcus previotii, 578) specific for each species. Amplification of genomic Porphyromonas asaccharolytica, PrevOtella melamino DNA from C. albicans and C. dubliniensis was carried out genica, Propionibacterium acnes, Staphylococcus aureus, using DIG-11-dUTP as described above in the section on Streptococcus acidominimus, and Streptococcus agalactiae). chemiluminescent detection of amplification products. Inter 45 Only C. trachomatis DNA could be amplified, thereby sug nal probes SEQID NOS. 577 and 578 were immobilized on gesting that the assay was species-specific. the bottom of individual microtiter plates and hybridization was carried out as described above in the above section on Example 11 chemiluminescent detection of amplification products. Lumi nometer data showed that the amplicon from C. albicans 50 Genus-Specific Detection and Identification of hybridized only to probe SEQID NO. 577 while the amplicon Enterococci from C. dubliniensis hybridized only to probe SEQ ID NO. 578, thereby demonstrating that each probe was species-spe Upon analysis of tuf sequence data and comparison with cific. the repertory of tuf sequences, it was possible to find two 55 regions where Enterococcus sequences remained conserved Example 9 while other genera have diverged (Table 65). Primer pair Encg313dF and Ency599c (SEQ ID NOS. 1137 and 1136) Specific Identification of Entamoeba histolytica was tested for its specificity by using purified genomic DNA from a panel of bacterialisted in Table 10. Using the PTC-200 Upon analysis of tuf (elongation factor 1 alpha) sequence 60 thermocycler (MJ Research), the optimal cycling conditions data, it was possible to find four regions where Entamoeba for maximum sensitivity and specificity were determined to histolytica sequences remained conserved while other para be 3 min. at 94°C. for initial denaturation, then forty cycles of sitical and eukaryotic species have diverged. Primers two steps consisting of 1 second at 95°C. and 30 seconds at TEntG38 (SEQID NO. 703), TEntG442 (SEQID NO. 704), 55° C., followed by terminal extension at 72° C. for 2 min TEntG534 (SEQID NO. 705), and TEntG768 (SEQID NO. 65 utes. Detection of the PCR products was made by electro 706) were designed so that SEQID NO. 703 could be paired phoresis in agarose gels (2%) containing 0.25 ug/ml of with the three other primers. On PTC-200 thermocyclers (MJ ethidium bromide. Visualization of the PCR products was US 8,182,996 B2 41 42 made under UV at 254 nm. The 18 enterococcal species listed 0.5 UTaq DNA polymerase (Boerhinger Mannheim) coupled in Table 10 were all amplified efficiently. The only other with TaqStartTM antibody (Clontech), and 0.07 ng of genomic species amplified were Abiotrophia adiacens, Gemella DNA sample in a final volume of 7 The optimal cycling haemolysans and Gemella morbillorum, three gram-positive conditions for maximum sensitivity and specificity were 1 species. Sensitivity tested with several strains of E. cassellifla- 5 minute at 94°C. for initial denaturation, then forty-five cycles vus, E. faecium, E. faecalis, E. flavescens and E. gallinarum of three steps consisting of 0 second at 95°C., 5 seconds at and with one strain of each other Enterococcus species listed 60° C. and 9 seconds at 72°C. Amplification was monitored in Table 10 ranged from 1 to 10 copies of genomic DNA. The during each elongation cycle by measuring the level of sequence variation within the 308-bp amplicon was sufficient SYBRR) Green I. However, real analysis takes place after so that internal probes could be used to speciate the amplicon PCR. Melting curves are done for each sample and transfor and differenciate enterococci from Abiotrophia adiacens, Gemella haemolysans and Gemella morbillorum, thereby mation of the melting peak allows determination of Tm. Thus allowing to achieve excellent specificity. Species-specific primer-dimer and specific PCR product are discriminated. internal probes were generated for each of the clinically With this assay, all prominent bacterial contaminants of plate important species, E. faecalis (SEQID NO. 1174), E. faecium 15 let concentrates listed in Table 57 and Table 14 were detected. (SEQID NO. 602), and the group including E. casselliflavus, Sensitivity tests were performed on the 9 most frequent bac E. flavescens and E. gallinarum (SEQID NO. 1122) (Table terial contaminants of platelets. The detection limit was less 66). The species-specific internal probes were able to differ than 20 genome copies for E. cloacae, B. cereus, S. choler entiate their respective Enterococcus species from all other aesuis and S. marcescens; less than 15 genome copies for P Enterococcus species. These assays are sensitive, specific and aeruginosa; and 2 to 3 copies were detected for S. aureus, S. ubiquitous for those five Enterococcus species. epidermidis, E. coli and K. pneumoniae. Further refinements of assay conditions should increase sensitivity levels. Example 12 Example 13 Identification of the Major Bacterial Platelets 25 Contaminants Using TufSequences with a Multiplex The Resolving Power of the tuf and atpD Sequences PCR Test Databases is Comparable to the Biochemical Methods for Bacterial Identification Blood platelets preparations need to be monitored for bac terial contaminations. The tufsequences of 17 important bac 30 The present gold standard for bacterial identification is terial contaminants of platelets were aligned. As shown in mainly based on key morphological traits and batteries of Table 57, analysis of these sequences allowed the design of biochemical tests. Here we demonstrate that the use of tufand PCR primers. Since in the case of contamination of platelet atpD sequences combined with simple phylogenetic analysis concentrates, detecting all species (not just the more fre quently encountered ones) is desirable, perfect specificity of 35 of databases formed by these sequences is comparable to the primers was not an issue in the design. However, sensitivity is gold standard. In the process of acquiring data for the tuf important. That is why, to avoid having to put too much sequences, we sequenced the tuf gene of a strain that was degeneracy, only the most frequent contaminants were given to us labelled as Staphylococcus hominis ATCC 35982. included in primer design, knowing that the selected primers That tuf sequence (SEQID NO. 192) was incorporated into would anyway be able to amplify more species than the 17 40 the tuf sequences database and Subjected to a basic phylo used in the design because they target highly conserved genic analysis using the Pileup command from version 10 of regions of tuf sequences. Oligonucleotide sequences which the GCG package (Genetics Computer Group). This analysis are conserved in these 17 major bacterial contaminants of indicated that SEQID NO.192 is not associated with other S. platelet concentrates were chosen (oligos Tplaq 769 and hominis strains but rather with the S. warneri strains. The Tplaq991, respectively SEQID NOS. 636 and 637) thereby 45 ATCC 35982 strain was sent to the reference laboratory of the permitting the detection of these bacterial species. However, Laboratoire de Santé publicque du Québec (LSPQ). They used sensitivity was slightly deficient with staphylococci. To the classic identification scheme for staphylococci (Kloos ensure maximal sensitivity in the detection of all the more and Schleifer, 1975. J. Clin. Microbiol. 1:82-88). Their frequent bacterial contaminants, a multiplex assay also results shown that although the colonial morphology could including oligonucleotide primers targetting the Staphyllo 50 correspond to S. hominis, the more precise biochemical coccus genera (oligos Stag 422, SEQID NO. 553; and Stag assays did not. These assays included discriminant mannitol, 765, SEQID NO. 575) was developed. The bacterial species mannose and ribose acidification tests as well as rapid and detected with the assay are listed in Table 14. dense growth in deep thioglycolate agar. The LSPQ report The primer pairs, oligos SEQID NO. 636 and SEQID NO. identified strain ATCC 35982 as S. warneri which confirms 637 that give an amplification product of 245 pb, and oligos 55 our database analysis. The same thing happened for S. warn SEQ ID NO. 553 and SEQID NO. 575 that give an amplifi eri (SEQID NO. 187) which had initially been identified as S. cation product of 368 pb, were used simultaneously in the haemolyticus by a routine clinical laboratory using a low multiplex PCR assay. Detection of these PCR products was resolving power automated System (MicroScan, AutoScan made on the LightCycler thermocycler (Idaho Technology) 4TM). Again, the tuf and LSPQ analysis agreed on its identi using SYBR(R) Green I (Molecular Probe Inc.). SYBR(R) 60 fication as S. warneri. In numerous other instances, in the Green I is a fluorescent dye that binds specifically to double course of acquiring tuf and atp) sequence data from various stranded DNA. species and genera, analysis of our tuf and/or atp) sequence Fluorogenic detection of PCR products with the LightCy databases permitted the exact identification of mislabelled or cler was carried out using 1.0LM of both Tplaq primers (SEQ erroneously identified strains. These results clearly demon ID NOS. 636-637) and 0.4 uM of both TStaG primers (SEQ 65 strate the usefulness and the high resolving power of our ID NOS. 553 and 575), 2.5 mM MgCl, BSA 7.5 uM, dNTP sequence-based identification assays using the tuf and atpD 0.2 mM (Pharmacia), 10 mM Tris-HCl (pH 8.3), 50 mMKCl, sequences databases. US 8,182,996 B2 43 44 Example 14 clonal antibody of Taq DNA polymerase, was added to all PCR reactions to enhance the efficiency of the amplification. Detection Of Group B Streptococci From Clinical The PCR mixtures were subjected to thermal cycling (3 min Specimens* at 95°C. and then 40 cycles of 1 sat 95°C., and 30s at 62° C. with a 2-min final extension at 72°C.) with a PTC-200 DNA Introduction Engine thermocycler (MJ research). The PCR-amplified Streptococcus agalactiae, the group B Streptococcus reaction mixture was resolved by agarose gel electrophoresis. (GBS), is responsible for a severe illness affecting neonate The LightCyclerTM PCR amplifications were performed infants. The bacterium is passed from the healthy carrier with 1 ul of a purified genomic DNA preparation or cell mother to the baby during delivery. To prevent this infection, 10 lysates of vaginal/anal specimens. The 100 amplification it is recommended to treat expectant mothers susceptible of mixture consisted of 0.4LM each GBS-specific primer (SEQ carrying GBS in their vaginal/anal flora. Carrier status is ID NOS. 549-550), 200 uMeach dNTP, 0.2 Meach fluores often a transient condition and rigorous monitoring requires cently labeled probe (SEQ ID NOS. 582-583), 300 g/ml cultures and classic bacterial identification weeks before BSA (Sigma), and 1 ul of 10xPC2 buffer (containing 50 mM delivery. To improve the detection and identification of GBS 15 Tris-HCl (pH 9.1), 16 mMammonium sulfate, 3.5 mMMg", we developed a rapid, specific and sensitive PCR test fast and 150 ug/ml BSA) and 0.5 U KlenTaq1TM (AB Peptides) enough to be performed right at delivery. coupled with TaqStartTM antibody (Clontech). KlenTaq1TM is Materials and Methods a highly active and more heat-stable DNA polymerase with GBS clinical specimens. A total of 66 duplicate vaginal/ out 5'-exonuclease activity. This prevents hydrolysis of anal Swabs were collected from 41 consenting pregnant hybridized probes by the 5' to 3' exonuclease activity. A women admitted for delivery at the Centre Hospitalier Uni volume of 7 ul of the PCR mixture was transferred into a versitaire de Québec, Pavillon Saint-Francois d’Assise fol composite capillary tube (Idaho Technology). The tubes were lowing the CDC recommendations. The samples were then centrifuged to move the reaction mixture to the tips of the obtained either before or after rupture of membranes. The capillaries and then cleaned with optical-grade methanol. swab samples were tested at the Centre de Recherche en 25 Subsequently the capillaries were loaded into the carousel of Infectiologie de l’Université Laval within 24 hours of collec a LC32 LightCyclerTM (Idaho Technology), an instrument tion. Upon receipt, one Swab was cut and then the tip of the that combines rapid-cycle PCR with fluorescence analysis for swab was added to GNS selective broth for identification of continuous monitoring during amplification. The PCR reac group B streptococci (GBS) by the standard culture methods tion mixtures were subjected to a denaturation step at 94° C. recommended by the CDC. The other swab was processed 30 for 3 min followed by 45 cycles of 0s at 94°C., 20s at 64°C. following the instruction of the IDI DNA extraction kit (In and 10s at 72°C. with a temperature transition rate of 20° fectio Diagnotics (IDI) Inc.) prior to PCR amplification. C./s. Fluorescence signals were obtained at each cycle by Oligonucleotides. PCR primers, Tsag340 (SEQ ID NO. sequentially positioning each capillary on the carousel at the 549) and Tsag552 (SEQ ID NO. 550) complementary to the focus of optical elements affiliated to the built-in fluorimeter regions of the tuf gene unique for GBS were designed based 35 for 100 milliseconds. Complete amplification and analysis upon a multiple sequence alignment using our repertory of tuf required about 35 min. sequences. Oligo primer analysis Software (version 5.0) (Na Specificity and sensitivity tests. The specificity of the con tional BioSciences) was used to analyse primers annealing ventional and LightCyclerTM PCR assays was verified by temperature, secondary structure potential as well as using purified genomic DNA (0.1 ng/reaction) from a battery mispriming and dimerization potential. The primers were 40 of ATCC reference strains representing 35 clinically relevant synthesized using a model 391 DNA synthesizer (Applied gram-positive species (Abiotrophia defectiva ATCC 49176, Biosystems). Bifidobacterium breve ATCC 15700, Clostridium difficile A pair of fluorescently labeled adjacent hybridization ATCC 9689, Corynebacterium urealyticum ATCC 43042, probes Sag465-F (SEQID NO. 583) and Sag436-C (SEQID Enterococcus casselliflavus ATCC 25788. Enterococcus NO. 582) were synthesized and purified by Operon Technolo 45 durans ATCC 19432, Enterococcus faecalis ATCC 29212, gies. They were designed to meet the recommendations of the Enterococcus faecium ATCC 19434, Enterococcus galli manufacturer (Idaho Technology) and based upon multiple narum ATCC 49573, Enterococcus raffinosus ATCC 49427, sequence alignment analysis using our repertory of tuf Lactobacillus reuteri ATCC 23273, Lactococcus lactis sequences to be specific and ubiquitous for GBS. These adja ATCC 19435, Listeria monocytogenes ATCC 15313, Pepto cent probes, which are separated by one nucleotide, allow 50 coccus niger ATCC 27731, Peptostreptococcus anaerobius fluorescence resonance energy transfer (FRET), generating ATCC 27337, Peptostreptococcus previotii ATCC 9321, Sta an increased fluorescence signal when both hybridized simul phylococcus aureus ATCC 25923, Staphylococcus epidermi taneously to their target sequences. The probe SEQID NO. dis ATCC 14990, Staphylococcus haemolyticus ATCC 583 was labeled with FITC in 3 prime while SEQID NO. 582 29970, Staphylococcus saprophyticus ATCC 15305, Strepto was labeled with Cy5 in 5 prime. The Cy5-labeled probes 55 coccus agalactiae ATCC 27591, Streptococcus anginosus contained a 3'-blocking phosphate group to prevent extension ATCC 33397, Streptococcus Bovis ATCC 33317, Streptococ of the probes during the PCR reactions. cus constellatus ATCC 27823, Streptococcus dysgalactiae PCR amplification. Conventional amplifications were per ATCC 43078, Streptococcusgordonii ATCC 10558, Strepto formed either from 2 ul of a purified genomic DNA prepara coccus mitis ATCC 33399, Streptococcus mutans ATCC tion or cell lysates of vaginal/anal specimens. The 20 ul PCR 60 25175, Streptococcus oralis ATCC 35037, Streptococcus mixture contained 0.4LM of each GBS-specific primer (SEQ parauberis ATCC 6631, Streptococcus pneumoniae ATCC ID NOS. 549-550), 200 uM of each deoxyribonucleotide 6303, Streptococcus pyogenes ATCC 19615, Streptococcus (Pharmacia Biotech), 10 mM Tris-HCl (pH 9.0), 50 mMKC1, salivarius ATCC 7073, Streptococcus sanguinis ATCC 0.1% Triton X-100, 2.5 mM MgCl2, 3.3 mg/ml bovine serum 10556, Streptococcus uberis ATCC 19436). These microbial albumin (BSA) (Sigma), and 0.5 U of Taq polymerase 65 species included 15 species of Streptococci and many mem (Promega) combined with the TaqStartTM antibody (Clon bers of the normal vaginal and anal floras. In addition, 40 tech). The TaqStartTM antibody, which is a neutralizing mono GBS isolates of human origin, whose identification was con US 8,182,996 B2 45 46 firmed by a latex agglutination test (Streptex, Murex), were specifically detect S. pyogenes, nucleotide sequences of the also used to evaluate the ubiquity of the assay. pyrrolidone carboxylyl peptidase (pcp) gene were aligned to For determination of the sensitivities (i.e., the minimal design PCR primers Spy291 (SEQID NO. 1211) and Spy473 number of genome copies that could be detected) for conven (SEQID NO. 1210). Next, we designed primers for the spe tional and LightCyclerTM PCR assays, serial 10-fold or 2-fold 5 cific detection of the pyrogenic exotoxin A. Nucleotide dilutions of purified genomic DNA from 5 GBSATCC strains sequences of the speA gene, carried on the bacteriophage were used. T12, were aligned as shown in Table 60 to design PCR prim Results ers Spytx814 (SEQID NO.994) and Spytx 927 (SEQID NO. Evaluation of the GBS-specific conventional and LightCy 995). clerTM PCR assays. The specificity of the two assays demon 10 The primer pairs: oligos SEQID NOS. 1210-1211, yielding strated that only DNAs from GBS strains could be amplified. an amplification product of 207 bp, and oligos SEQID NOS. Both PCR assays did not amplify DNAs from any other 994-995, yielding an amplification product of 135 bp, were bacterial species tested including 14 streptococcal species used in a multiplex PCR assay. other than GBS as well as phylogenetically related species belonging to the genera Enterococcus, Peptostreptococcus 15 PCR amplification was carried out using 0.4 uM of both and Lactococcus. Important members of the vaginal or anal pairs of primers, 2.5 mMMgCl, BSA 0.05uM, dNTP 0.2M flora, including coagulase-negative staphylococci, Lactoba (Pharmacia), 10 mM Tris-HCl (pH 9.0), 0.1% Triton X-100, cillus sp., and Bacteriodes sp. were also negative with the 2.5 mM MgCl, 0.5 U Taq DNA polymerase (Promega) GBS-specific PCR assay. The LightCyclerTM PCR assays coupled with TaqStartTM antibody (Clontech Laboratories detected only GBS DNA by producing an increased fluores Inc.), and 1 ul of genomic DNA sample in a final volume of 20 cence signal which was interpreted as a positive PCR result. ul. PCR amplification was performed using a PTC-200 ther Both PCR methods were able to amplify all of 40 GBS clini mal cycler (MJ Research). The optimal cycling conditions for cal isolates, showing a perfect correlation with the phenotypic maximum specificity and sensitivity were 3 minutes at 94° C. identification methods. for initial denaturation, then forty cycles of two steps consist The sensitivity of the assay was determined by using puri 25 ing of 1 second at 95°C. and 30 seconds at 63°C., followed fied genomic DNA from the 5ATCC strains of GBS. The by a final step of 2 minutes at 72° C. Detection of the PCR detection limit for all of these 5 strains was one genome copy products was made by electrophoresis in agarose gels (2%) of GBS. The detection limit of the assay with the LightCy containing 0.25ug/ml of ethidium bromide. Visualization of clerTM was 3.5 fg of genomic DNA (corresponding to 1-2 the PCR products was made under UV at 254 nm. genome copies of GBS). These results confirmed the high 30 The detection limit was less than 5 genome copies for both sensitivity of our GBS-specific PCR assay. S. pyogenes and its pyrogenic exotoxin A. The assay was Direct Detection of GBS from vaginal/anal specimens. specific for pyrogenic exotoxin A-producing S. pyogenes: Among 66 vaginal/anal specimens tested, 11 were positive strains of the 27 other species of Streptococcus tested, as well for GBS by both culture and PCR. There was one sample as 20 strains of various gram-positive and gram-negative positive by culture only. The sensitivity of both PCR methods 35 bacterial species were all negative. with vaginal/anal specimens for identifying colonization sta A similar approach was used to design an alternative set of tus in pregnant women at delivery was 91.7% when compared speA-specific primers (SEQ ID NOS. 996 to 998, see Table to culture results. The specificity and positive predictive val 62). In addition, another set of primers based on the tuf gene ues were both 100% and the negative predictive value was (SEQ ID NOS. 999 to 1001, see Annex XXV) could be used 97.8%. The time for obtaining results was approximately 45 40 to specifically detect Streptococcus pyogenes. min for LightCyclerTM PCR, approximately 100 min for con ventional PCR and 48 hours for culture. Example 16 Conclusion Real-Time Detection and Identification of Shiga 45 Toxin-Producing Bacteria We have developed two PCR assays (conventional and LightCyclerTM) for the detection of GBS, which are specific Shiga toxin-producing Escherichia coli and Shigella dys (i.e., no amplification of DNA from a variety of bacterial enteriae cause bloody diarrhea. Currently, identification species other than GBS) and sensitive (i.e., able to detect relies mainly on the phenotypic identification of S. dysente around 1 genome copy for several reference ATCC strains of 50 riae and E. coli serotype O157:H7. However, other serotypes GBS). Both PCR assays are able to detect GBS directly from of E. coli are increasingly found to be producers of type 1 vaginal/anal specimens in a very short turnaround time. and/or type 2 Shiga toxins. Two pairs of PCR primers target Using the real-time PCR assay on LightCyclerTM. we can ing highly conserved regions present in each of the Shiga detect GBS carriage in pregnant women at delivery within 45 toxin genes stx and stx were designed to amplify all variants minutes. 55 of those genes (see Tables 64 and 65). The first primer pair, oligonucleotides 1 SLT224 (SEQID NO. 1081) and 1SLT385 Example 15 (SEQ ID NO. 1080), yields an amplification product of 186 bp from the stx gene. For this amplicon, the 1SLTB1-Fam Simultaneous Detection and Identification of (SEQ ID NO. 1084) molecular beacon was designed for the Streptococcus pyogenes and its Pyrogenic 60 specific detection of stx/using the fluorescent label 6-car Exotoxin A boxy-fluorescein. The 1SltS1-FAM (SEQ ID NO. 2012) molecular Scorpion was also designed as an alternate way for The rapid detection of Streptococcus pyogenes and of its the specific detection of stX. A second pair of PCR primers, pyrogenic exotoxin A is of clinical importance. We developed oligonucleotides 2SLT537 (SEQ ID NO. 1078) and a multiplex assay which permits the detection of strains of S. 65 2SLT678b (SEQID NO. 1079), yields an amplification prod pyogenes carrying the pyrogenic toxin A gene, which is asso uct of 160 bp from the stX gene. Molecular beacon 2SLTB1 ciated with scarlet fever and other pathologies. In order to Tet (SEQID NO. 1085) was designed for the specific detec US 8,182,996 B2 47 48 tion of stx using the fluorescent label 5-tetrachloro The format of the assay is not limited to the one described fluorescein. Both primer pairs were combined in a multiplex above. A person skilled in the art could adapt the assay for PCR assay. different formats such as PCR with real-time detection using PCR amplification was carried out using 0.8 uM of primer molecular beacon probes. Molecular beacon probes designed pair SEQID NOS. 1080-1081, 0.5uM of primer pair SEQID 5 to be used in this assay include, but are not limited to, SEQID NOs. 1078-1079, 0.3 uM of each molecular beacon, 8 mM NO. 1232 for detection of the S. aureus-specific amplicon, MgCl, 490 ug/mL BSA, 0.2 mM dNTPs (Pharmacia), 50 SEQ ID NO. 1233 for detection of coagulase-negative sta mM Tris-HCl, 16 mM NHSO 1x TaqMaster (Eppendorf), phylococci and SEQID NO. 1231 for detection of mecA. 2.5 U KlenTaq1 DNA polymerase (AB Peptides) coupled Alternatively, a multiplex PCR assay containing the Sta with TaqStartTM antibody (Clontech Laboratories Inc.), and 1 10 phylococcus-specific PCR primers described in Example 7 ul of genomic DNA sample in a final volume of 25 ul. PCR (SEQ ID NOS. 553 and 575) and the mecA-specific PCR amplification was performed using a SmartCycler thermal primers described in our assigned U.S. Pat. No. 5,994.066 cycler (Cepheid). The optimal cycling conditions for maxi (SEQ ID NOS. 261 and 262 in the said patent) were devel mum sensitivity and specificity were 60 seconds at 95°C. for oped. PCR amplification and agarose gel electrophoresis of initial denaturation, then 45 cycles of three steps consisting of 15 the amplified products were performed as described in 10 seconds at 95°C., 15 seconds at 56°C. and 5 seconds at 72° Example 7, with the exception that 0.4 uM (each) of the C. Detection of the PCR products was made in real-time by Staphylococcus-specific primers (SEQID NOS. 553 and 575) measuring the fluorescent signal emitted by the molecular and 0.4 uM (each) of the mec A-specific primers described in beacon when it hybridizes to its target at the end of the our assigned U.S. Pat. No. 5,994,066 (SEQID NOs. 261 and annealing step at 56°C. 262 in the said patent) were used in the PCR mixture. The The detection limit was the equivalent of less than 5 sensitivity of the multiplex assay with 40-cycle PCR proto genome copies. The assay was specific for the detection of cols was determined by using purified genomic DNA from both toxins, as demonstrated by the perfect correlation two methicillin-resistant and five methicillin-sensitive sta between PCR results and the phenotypic characterization phylococcal strains. The detection limit was 2 to 5 copies of performed using antibodies specific for each Shigatoxin type. 25 genomic DNA, depending on the staphylococcal species The assay was successfully performed on several Shigatoxin tested. The specificity of the multiplex PCR assay coupled producing strains isolated from various geographic areas of with capture-probe hybridization was tested with two strains the world, including 10 O157:H7 E. coli, 5 non-O157:H7 E. of methicillin-resistant S. aureus, two strains of methicillin coli and 4S. dysenteriae. sensitive S. aureus and seven strains of methicillin-sensitive 30 coagulase-negative staphylococci. The mecA-specific inter Example 17 nal probe (SEQ ID NO. 1177) and the S. aureus-specific internal probe (SEQ ID NO. 587) described in Example 7 Development of a PCRAssay for the Detection and were able to recognize all the strains with high specificity Identification of Staphylococci at Genus and Species showing a perfect correlation with susceptibility to methicil Levels and its Associated mecA Gene 35 lin. The sensitivity of the PCR assay coupled with capture probe hybridization was tested with one strain of methicillin The Staphylococcus-specific PCR primers described in resistant S. aureus. The detection limit was around 10 copies Example 7 (SEQID NOS. 553 and 575) were used in multi of genomic DNA. plex with the mecA-specific PCR primers and the S. aureus specific primers described in our assigned U.S. Pat. No. 40 Example 18 5,994,066 (SEQID NOS. 261 and 262 for mecA and SEQID NOs. 152 and 153 for S. aureus in the said patent). Sequence Sequencing of pbp1a, pbp2b and pbp2X genes of alignment analysis of 10 publicly available mecA gene StreptocCOccus pneumoniae sequences allowed to design an internal probe specific to mecA (SEQ ID NO. 1177). An internal probe was also 45 Penicillin resistance in Streptococcus pneumoniae designed for the S. aureus-specific amplicon (SEQ ID NO involves the sequential alteration of up to five penicillin 1234). PCR amplification and agarose gel electrophoresis of binding proteins (PBPs) 1A, 1B, 2A, 2x and 2B in such away the amplified products were performed as described in that their affinity is greatly reduce toward the antibiotic mol Example 7, with the exception that 0.4 uM (each) of the two ecule. The altered PBP genes have arisen as the result of Staphylococcus-specific primers (SEQID NOS. 553 and 575) 50 interspecies recombination events from related Streptococcal and 0.4 uM (each) of the mec A-specific primers and 0.4 uM species. Among the PBPs usually found in S. pneumoniae, (each) of the S. aureus-specific primers were used in the PCR PBPs 1A, 2B, and 2x play the most important role in the mixture. The specificity of the multiplex assay with 40-cycle development of penicillin resistance. Alterations in PBP2B PCR protocols was verified by using purified genomic DNA and 2x mediate low-level resistance to penicillin while addi from five methicillin-resistant and fifteen methicillin-sensi 55 tional alterations in PBP 1A plays a significant role in full tive staphylococcal strains. The sensitivity of the multiplex penicillin resistance. assay with 40-cycle PCR protocols was determined by using In order to generate a database for pbp sequences that can purified genomic DNA from twenty-three methicillin-resis be used for design of primers and/or probes for the specific tant and twenty-eight methicillin-sensitive staphylococcal and ubiquitous detection of B-lactam resistance in S. pneu strains. The detection limit was 2 to 10 genome copies of 60 moniae, pbp1a, pbp2b and pbp2X DNA fragments sequenced genomic DNA, depending on the staphylococcal species by us or selected from public databases (GenBank and tested. Furthermore, the mecA-specific internal probe, the S. EMBL) from a variety of S. pneumoniae strains were used to aureus-specific internal probe and the coagulase-negative design oligonucleotide primers. This database is essential for staphylococci-specific internal probe (described in Example the design of specific and ubiquitous primers and/or probes 7) were able to recognize twenty-three methicillin-resistant 65 for detection of B-lactam resistance in S. pneumoniae since staphylococcal strains and twenty-eight methicillin-sensitive the altered PBP1A, PBP2B and PBP2x of B-lactam resistant staphylococcal strains with high sensitivity and specificity. S. pneumoniae are encoded by mosaic genes with numerous US 8,182,996 B2 49 50 sequence variations among resistant isolates. The PCR prim PCR primers and internal probes. The analysis of hex A ers were located in conserved regions of pbp genes and were sequences from a variety of Streptococcal species from the able to amplify pbp1a, pbp2b, and pbp2x sequences of sev publicly available hexA sequence and from the database eral strains of S. pneumoniae having various levels of resis described in Example 19 (SEQID NOS. 1184-1191) allowed tance to penicillin and third-generation cephalosporins. the selection of a PCR primer specific to S. pneumoniae, SEQ Using primer pairs SEQ ID NOS. 1125 and 1126, SEQ ID ID NO. 1181. This primer was used with the S. pneumoniae NOs. 1142 and 1143, SEQ ID NOS. 1146 and 1147, it was specific primer SEQID NO. 1179 to generate an amplifica possible to amplify and determine pbp1a sequences SEQID tion product of 241 bp (Table 80). The PCR primer SEQ ID NOs. 1004-1018, 1648, 2056-2060 and 2062-2064, pbp2b NO. 1181 is located 127 nucleotides downstream on the heXA sequences SEQ ID NOS. 1019-1033, and pbp2x sequences 10 sequence compared to the original S. pneumoniae-specific SEQ ID NOS. 1034-1048. Six other PCR primers (SEQ ID PCR primer Spn 1515 described in our assigned U.S. Pat. No. NOs. 1127-1128, 1144-1145,1148-1149) were also designed 5,994,066 (SEQID NO. 157 in the said patent). These modi and used to complete the sequencing of pbp1a, pbp2b and fications were done to ensure the design of the S. pneumo pbp2x amplification products. The described primers (SEQ niae-specific internal probe according to the new heXA ID NOS. 1125 and 1126, SEQID NOs. 1142 and 1143, SEQ 15 sequences of several streptococcal species from the database ID NOS. 1146 and 1147, SEQ ID NOs. 1127-1128, 1144 described in Example 19 (SEQ ID NOS. 1184-1191). 1145, 1148-1149) represent a powerful tool for generating The analysis of pbpla sequences from S. pneumoniae new pbp sequences for design of primers and/or probes for strains with various levels of penicillin resistance from public detection off-lactam resistance in S. pneumoniae. databases and from the database described in Example 18 allowed the identification of amino acid substitutions Ile-459 Example 19 to Met and Ser-462 to Ala that occur in isolates with high level penicillin resistance (MICs21 g/ml), and amino acid Sequencing of heXA Genes of Streptococcus Species substitutions Ser-575 to Thr, Gln-576 to Gly and Phe-577 to Tyr that are common to all penicillin-resistant isolates with The heXA sequence of S. pneumoniae described in our 25 MICs20.25 g/ml. As shown in Table 69, PCR primer pair assigned U.S. Pat. No. 5,994,066 (SEQID NO. 31 in the said SEQ ID NOS. 1130 and 1131 were designed to detect high patent, SEQID NO. 1183 in the present application) allowed level penicillin resistance (MICs21 ug/ml), whereas PCR the design of a PCR primer (SEQ ID NO. 1182) which was primer pair SEQ ID NOS. 1129 and 1131 were designed to used with primer Spn1401 described in our assigned U.S. Pat. detect intermediate- and high-level penicillin resistance No. 5,994,066 (SEQID NO. 156 in the said patent, SEQ ID 30 (MICs 0.25 ug/ml). NO. 1179 in the present application) to generate a database The analysis of hexA sequences from the publicly avail for heXA sequences that can be used to design primers and/or able hexA sequence and from the database described in probes for the specific identification and detection of S. pneu Example 19 allowed the design of an internal probe specific to moniae (Table 80). Using primers SEQID NO. 1179 and SEQ S. pneumoniae (SEQID NO. 1180) (Table 80). The range of ID NO. 1182 (Annex XIII), it was possible to amplify and 35 mismatches between the S. pneumoniae-specific 241-bp determine the heXA sequence from S. pneumoniae (4 strains) amplicon was from 2 to 5, in the middle of the 19-bp probe. (SEQ ID NOS. 1184-1187), S. mitis (three strains) (SEQ ID The analysis of pbpla sequences from public databases and NOs. 1189-1191) and S. oralis (SEQ ID NO. 1188). from the database described in Example 18 allowed the design of five internal probes containing all possible muta Example 20 40 tions to detect the high-level penicillin resistance 383-bp amplicon (SEQ ID NOS. 1197, 1217-1220). Alternatively, Development of Multiplex PCRAssays Coupled two other internal probes (SEQID NOS. 2024-2025) can also with Capture Probe Hybridization for the Detection be used to detect the high-level penicillin resistance 383-bp and Identification of Streptococcus pneumoniae and amplicon. Five internal probes containing all possible muta its Penicillin Resistance Genes. 45 tions to detect the 157-bp amplicon which includes interme diate- and high-level penicillin resistance were also designed Two different assays were developed to identify S. pneu (SEQID NOS. 1094, 1192-1193, 1214 and 1216). Design and moniae and its Susceptibility to penicillin. synthesis of primers and probes, and detection of the probe Assay I: hybridization were performed as described in Example 7. Bacterial strains. The specificity of the multiplex PCR 50 Table 69 illustrates one of the internal probe for detection of assay was verified by using a panel of ATCC (AmericanType the high-level penicillin resistance 383-bp amplicon (SEQID Culture Collection) reference strains consisting of 33 gram NO. 1197) and one of the internal probe for detection of the negative and 67 gram-positive bacterial species (Table 13). In intermediate- and high-level penicillin resistance 157-bp addition, a total of 98 strains of S. pneumoniae, 16 strains of amplicon (SEQ ID NO. 1193). S. mitis and 3 strains of S. oralis from the American Type 55 PCR amplification. For all bacterial species, amplification Culture Collection, the microbiology laboratory of the Centre was performed from purified genomic DNA using a PTC-200 Hospitalier Universitaire de Québec, Pavillon Centre Hospi thermocycler (MJ Research). 1 ul of genomic DNA at 0.1 talier de l’Université Laval (CHUL), (Step-Foy, Québec, ngful, or 1 ul of a bacterial lysate, was transferred to a 19 ul Canada), the Laboratoire de Santé publique du Québec, PCR mixture. Each PCR reaction contained 50 mM KC1, 10 (Sainte-Anne-de-Bellevue, Québec, Canada), the Sunny 60 mM Tris-HCl (H 9.0), 0.1% Triton X-100, 2.5 mM MgCl, brook and Women's College Health Sciences Centre (Tor 0.1 uM (each) of the S. pneumoniae-specific primers SEQID onto, Canada), the Infectious Diseases Section, Department NO. 1179 and SEQID NO. 1181, 0.2M of primer SEQID of Veterans Affairs Medical Center, (Houston, USA) were NO. 1129, 0.7 uM of primer SEQID NO. 1131, and 0.6 uM also tested to further validate the Streptococcus pneumoniae of primer SEQID NO. 1130, 0.05 mM bovine serum albumin specific PCR assay. The penicillin MICs (minimal inhibitory 65 (BSA), and 0.5 U Taq polymerase (Promega) coupled with concentrations) were measured by the broth dilution method TaqStartTM antibody. In order to generate Digoxigenin (DIG)- according to the recommended protocol of NCCLS. labeled amplicons for capture probe hybridization, 0.1xPCR US 8,182,996 B2 51 52 DIG labeling four deoxynucleoside triphosphates mix (Boe multiplex PCR and hybridization assays results in a highly hiringer Mannheim GmbH) was used for amplification. specific test for the detection of penicillin-resistant Strepto For determination of the sensitivity of the PCR assays, COCCuS pneumoniae. 10-fold dilutions of purified genomic DNA were used to Assay II: determine the minimal number of genome copies which can Bacterial strains. The specificity of the multiplex PCR be detected. assay was verified by using the same Strains as those used for Capture probe hybridization. The DIG-labeled amplicons the development of Assay I. The penicillin MICs (minimal were hybridized to the capture probes bound to 96-well inhibitory concentrations) were measured by the broth dilu plates. The plates were incubated with anti-DIG-alkaline tion method according to the recommended protocol of phosphatase and the chemiluminescence was measured by 10 NCCLS. using a luminometer (MLX, Dynex Technologies Inc.) after PCR primers and internal probes. The analysis of pbpla incubation with CSPD and recorded as Relative Light Unit sequences from S. pneumoniae strains with various levels of (RLU). The RLU ratio of tested sample with and without penicillin resistance from public databases and from the data captures probes was then calculated. A ratio22.0 was defined base described in Example 18 allowed the design of two as a positive hybridization signal. All reactions were per 15 primers located in the constant region of pbp1a. PCR primer formed in duplicate. pair (SEQID NOS. 2015 and 2016) was designed to amplify Results a 888-bp variable region of pbp1a from all S. pneumoniae Amplifications with the multiplex PCR assay. The speci strains. A series of internal probes were designed for identi ficity of the assay was assessed by performing 40-cycle PCR fication of the pbpla mutations associated with penicillin amplifications with the panel of gram-positive (67 species resistance in S. pneumoniae. For detection of high-level peni from 12 genera) and gram-negative (33 species from 17 gen cillin resistance (MICs21 ug/ml), three internal probes were era) bacterial species listed in Table 13. All bacterial species designed (SEQID NOS. 2017-2019). Alternatively, ten other tested other than S. pneumoniae were negative except S. mitis internal probes were designed that can also be used for detec and S. Oralis. Ubiquity tests were performed using a collec tion of high-level resistance within the 888-bp pbp1a ampli tion of 98 S. pneumoniae strains including high-level penicil 25 con: (1) three internal probes for identification of the amino lin resistance (n=53), intermediate resistance (n=12) and sen acid substitutions Thr-371 to Ser or Ala within the motif sitive (n=33) strains. There was a perfect correlation between S370TMK (SEQ ID NOs. 2031-2033); (2) two internal PCR and standard susceptibility testing for 33 penicillin probes for detection of the amino acid substitutions Ile-459 to sensitive isolates. Among 12 S. pneumoniae isolates with Met and Ser-462 to Alainear the motifS428RN (SEQID NOs. intermediate penicillin resistance based on Susceptibility test 30 1135 and 2026); (3) two internal probes for identification of ing, 11 had intermediate resistance based on PCR, but one S. the amino acid substitutions Asn-443 to Asp (SEQID NOS. pneumoniae isolate with penicillin MIC of 0.25 ug/ml 1134 and 2027); and (4) three internal probes for detection of showed a high-level penicillin resistance based on genotyp all sequence variations within another region (SEQID NOS. ing. Among 53 isolates with high-level penicillin resistance 2028-2030). For detection of high-level and intermediate based on susceptibility testing, 51 had high-level penicillin 35 penicillin resistance (MICs 0.25 g/ml), four internal probes resistance based on PCR but two isolates with penicillin MIC were designed (SEQID NOS. 2020-2023). Alternatively, six > 1 g/ml showed an intermediate penicillin resistance based other internal probes were designed for detection of the four on genotyping. In general, there was a good correlation consecutive amino acid substitutions T574SQF to A574TGY between the genotype and classical culture method for bac near the motif K557TG (SEQID NOS. 2034-2039) that can terial identification and Susceptibility testing. 40 also be used for detection of intermediate- and high-level The sensitivity of the S. pneumoniae-specific assay with resistance within the 888-bp pbp1a amplicon. 40-cycle PCR protocols was determined by using purified PCR amplification. For all bacterial species, amplification genomic DNA from 9 isolates of S. pneumoniae. The detec was performed from purified genomic DNA using a PTC-200 tion limit was around 10 copies of genomic DNA for all of thermocycler (MJ Research). 1 ul of genomic DNA at 0.1 them. 45 ngful, or 1 ul of a bacterial lysate, was transferred to a 19 ul Post-PCR hybridization with internal probes. The specific PCR mixture. Each PCR reaction contained 50 mM KC1, 10 ity of the multiplex PCR assay coupled with capture-probe mM Tris-HCl (pH 9.0), 0.1% Triton X-100, 2.5 mM MgCl, hybridization was tested with 98 strains of S. pneumoniae, 16 0.08 LM (each) of the S. pneumoniae-specific primers SEQ strains of S. mitis and 3 strains of S. oralis. The internal probe ID NO. 1179 and SEQ ID NO. 1181, 0.4 uM of the pbpla specific to S. pneumoniae (SEQID NO. 1180) detected all 98 50 specific primer SEQID NO. 2015, 1.2 uM of pbp1a-specific S. pneumoniae strains but did not hybridize to the S. mitis and primer SEQID NO. 2016, 0.05 mM bovine serum albumin S. oralis amplicons. The five internal probes specific to the (BSA), and 0.5 U Taq polymerase (Promega) coupled with high-level resistance amplicon (SEQ ID NOS. 1197. 1217 TaqStartTM antibody. In order to generate Digoxigenin (DIG)- 1220) detected all amplification patterns corresponding to labeled amplicons for capture probe hybridization, 0.1xPCR high-level resistance. The two S. pneumoniae strains with 55 DIG labeling four deoxynucleoside triphosphates mix (Boe penicillin MIC > 1 g/ml that showed an intermediate peni hiringer Mannheim GmbH) was used for amplification. cillin resistance based on PCR amplification were also inter For determination of the sensitivities of the PCR assays, mediate resistance based on probe hybridization. Similarly, 10-fold dilutions of purified genomic DNA were used to among 12 strains with intermediate-penicillin resistance determine the minimal number of genome copies which can based on Susceptibility testing, 11 showed intermediate-peni 60 be detected. cillin resistance based on hybridization with the five internal Capture probe hybridization. The DIG-labeled amplicons probes specific to the intermediate and high-level resistance were hybridized to the capture probes bound to 96-well plates amplicon (SEQ ID NOS. 1094, 1192-1193, 1214 and 1216). as described for Assay I. The strain described above having a penicillin MIC of 0.25 Results ug/ml which was high-level penicillin resistance based on 65 Amplifications with the multiplex PCR assay. The speci PCR amplification was also high-level resistance based on ficity of the assay was assessed by performing 40-cycle PCR probe hybridization. In summary, the combination of the amplifications with the panel of gram-positive (67 species US 8,182,996 B2 53 54 from 12 genera) and gram-negative (33 species from 17 gen 1112 and 1111) was used in multiplex with the Enterococcus era) bacterial species listed in Table 13. All bacterial species specific primers Ency,313dF and Ency599c (SEQ ID NOs. tested other than S. pneumoniae were negative except S. mitis 1137 and 1136) described in Example 11. Sequence align and S. Oralis. Ubiquity tests were performed using a collec ment analysis of VanA and VanB sequences revealed regions tion of 98 S. pneumoniae strains including high-level penicil suitable for the design of internal probes specific to van A lin resistance (n=53), intermediate resistance (n=12) and sen (SEQ ID NO. 1170) and van B (SEQ ID NO. 1171). PCR sitive (n=33) strains. All the above S. pneumoniae strains amplification and agarose gel electrophoresis of the amplified produced the 888-bp amplicon corresponding to pbp1a and products were performed as described in Example 11. The the 241-bp fragment corresponding to heXA. optimal cycling conditions for maximum sensitivity and The sensitivity of the S. pneumoniae-specific assay with 10 specificity were found to be 3 min. at 94°C., followed by forty 40-cycle PCR protocols was determined by using purified cycles of two steps consisting of 1 second at 95° C. and 30 genomic DNA from 9 isolates of S. pneumoniae. The detec seconds at 62° C. plus a terminal extension at 72° C. for 2 tion limit was around 10 copies of genomic DNA for all of minutes. The specificity of the multiplex assay with 40-cycle them. PCR was verified by using 0.1 nanogram of purified genomic Post-PCR hybridization with internal probes. The specific 15 DNA from a panel of bacteria listed in Table 10. The sensi ity of the multiplex PCR assay coupled with capture-probe tivity of the multiplex assay with 40-cycle PCR was verified hybridization was tested with 98 strains of S. pneumoniae, 16 with three strains of E. Casselliflavus, eight strains of E. galli strains of S. mitis and 3 strains of S. oralis. The internal probe narum, two strains of E. flavescens, two Vancomycin-resis specific to S. pneumoniae (SEQID NO. 1180) detected all 98 tant strains of E. faecalis and one Vancomycin-sensitive strain S. pneumoniae strains but did not hybridize to the S. mitis and of E. faecalis, three Vancomycin-resistant strains of E. S. oralis amplicons. The three internal probes (SEQID NOS faecium, one Vancomycin-sensitive strain of E. faecium and 2017-2019) specific to high-level resistance detected all the one strain of each of the other enterococcal species listed in 43 strains with high-level penicillin resistance based on Sus Table 10. The detection limit was 1 to 10 copies of genomic ceptibility testing. Among 12 isolates with intermediate-peni DNA, depending on the enterococcal species tested. The cillin resistance based on Susceptibility testing, 11 showed 25 van A- and VanB-specific internal probes (SEQID NOS. 1170 intermediate-penicillin resistance based on hybridization and 1171), as well as the E. faecalis-and E. faecium-specific with 4 internal probes (SEQ ID NOS. 2020-2023) and one internal probes (SEQID NOS. 1174 and 602) and the internal strain having penicillin MIC of 0.25ug/ml was misclassified probe specific to the group including E. Casselliflavus, E. as high-level penicillin resistance. In Summary, the combina gallinarum and E. flavescens (SEQ ID NO. 1122) described tion of the multiplex PCR and hybridization assays results in 30 in Example 11, were able to recognize Vancomycin-resistant a highly specific test for the detection of penicillin-resistant enterococcal species with high sensitivity, specificity and Streptococcus pneumoniae. ubiquity showing a perfect correlation between the genotypic and phenotypic analysis. Example 21 The format of the assay is not limited to the one described 35 above. A person skilled in the art could adapt the assay for Sequencing of the Vancomycin Resistance VanA, different formats such as PCR with real-time detection using VanC1, VanC2 and VanC3 Genes molecular beacon probes. Molecular beacon probes designed to be used in this assay include, but are not limited to, SEQID The publicly available sequences of the van H-vanA-vanx NO. 1236 for the detection of E. faecalis, SEQID NO. 1235 vanY locus of transposon Tn 1546 from E. faecalis, VanC1 40 for the detection of E. faecium, SEQ ID NO. 1240 for the sequence from one strain of E. gallinarum, VanC2 and VanC3 detection of VanA, and SEQID NO.1241 for the detection of sequences from a variety of E. casselliflavus and E. flavescens VanB. strains, respectively, allowed the design of PCR primers able to amplify the VanA. VanC1, VanC2 and VanC3 sequences of Example 23 several Enterococcus species. Using primer pairs Vanó877 45 and van9106 (SEQID NOS. 1150 and 1155), VanC1-122 and Development of a Multiplex PCRAssay for vanC1-1315 (SEQID NOS. 1110 and 1109), and VanC2C3-1 Detection and Identification of and VanC2C3-1064 (SEQ ID NOS. 1108 and 1107), it was Vancomycin-Resistant Enterococcus faecalis, possible to amplify and determine VanA sequences SEQ ID Enterococcus faecium and the Group including NOs. 1049-1057, VanC1 sequences SEQID NOS. 1058-1059, 50 Enterococcus Gallinarum, Enterococcus vanC2 sequences SEQ ID NOS. 1060-1063 and vanC3 Casselliflavus, and Enterococcus flavescens sequences SEQID NOS. 1064-1066, respectively. Four other PCR primers (SEQ ID NOS. 1151-1154) were also designed The analysis of VanA and VanB sequences revealed con and used to complete the sequencing of VanA amplification served regions allowing design of a PCR primer pair (SEQID products. 55 NOs. 1089 and 1090) specific to VanA sequences (Table 66) and a PCR primer pair (SEQID NOS. 1095 and 1096) specific Example 22 to van B sequences (Table 67). The VanA-specific PCR primer pair (SEQ ID NOS. 1089 and 1090) was used in multiplex Development of a PCRAssay for the Detection and with the VanB-specific PCR primer pair described in our Identification of Enterococci at Genus and Species 60 assigned U.S. Pat. No. 5,994,066 (SEQ ID NOS. 1095 and Levels and its Associated Resistance Genes VanA 1096 in the present patent and SEQID NOS. 231 and 232 in and VanB the said patent). The comparison of VanC1, VanC2 and VanC3 sequences revealed conserved regions allowing design of The comparison of VanA and VanB sequences revealed PCR primers (SEQID NOS. 1101 and 1102) able to generate conserved regions allowing the design of PCR primers spe 65 a 158-bp amplicon specific to the group including E. galli cific to both van A and van B sequences (Annex Table 76). The narum, E. casselliflavus and E. flavescens (Table 68). The PCR primer pair van AB459 and vanAB830R (SEQID NOs. vanC-specific PCR primer pair (SEQ ID NOS. 1101 and US 8,182,996 B2 55 56 1102) was used in multiplex with the E. faecalis-specific PCR two Vancomycin-sensitive E. faecium strains, two Vancomy primer pair described in our assigned U.S. Pat. No. 5,994.066 cin-resistant E. faecium strains, 16 other enterococcal species (SEQ ID NOS. 40 and 41 in the said patent) and with the E. and 31 other gram-positive bacterial species. All the E. faecium-specific PCR primer pair described in our patent faecium and E. faecalis strains were amplified with high publication WO 98/20157 (SEQID NOS. 1 and 2 in the said 5 specificity showing a perfect correlation between the geno publication). For both multiplexes, the optimal cycling con typic analysis and the Susceptibility to glycopeptide antibiot ditions for maximum sensitivity and specificity were found to ics (Vancomycin and teicoplanin). The sensitivity of the assay be 3 min. at 94° C., followed by forty cycles of two steps was determined for two Vancomycin-resistant E. faecalis consisting of 1 second at 95°C. and 30 seconds at 58°C., plus strains and two Vancomycin-resistant E. faecium strains. The a terminal extension at 72°C. for 2 minutes. Detection of the 10 PCR products was made by electrophoresis in agarose gels detection limit was 5 copies of genomic DNA for all the (2%) containing 0.25ug/ml of ethidium bromide. The van A strains. specific PCR primer pair (SEQID NOS. 1089 and 1090), the This multiplex PCR assay was coupled with capture-probe van B-specific primer pair (SEQID NOS. 1095 and 1096) and hybridization. Four internal probes were designed: one spe the VanC-specific primer pair (SEQID NOS. 1101 and 1102) 15 cific to the van A amplicon (SEQID NO. 2292), one specific were tested for their specificity by using 0.1 nanogram of to the van Bamplicon (SEQID NO. 2294), one specific to the purified genomic DNA from a panel of 5 Vancomycin-sensi E. faecalisamplicon (SEQID NO. 2291) and one specific to tive Enterococcus species, 3 Vancomycin-resistant Entero the E. faecium amplicon (SEQ ID NO. 2287). Each of the coccus species, 13 other gram-positive bacteria and one internal probes detected their specific amplicons with high gram-negative bacterium. Specificity tests were performed specificity and sensitivity. with the E. faecium-specific PCR primer pair described in our patent publication WO 98/20157 (SEQID NOS. 1 and 2 in the Example 24 said publication) and with the E. faecalis-specific PCR primer pair described in our assigned U.S. Pat. No. 5,994.066 (SEQ Universal Amplification Involving the EF-G (fusA) ID NOS. 40 and 41 in the said patent) on a panel of 37 25 Subdivision of tufSequences gram-positive bacterial species. All Enterococcus strains were amplified with high specificity showing a perfect corre As shown in FIG. 3, primers SEQID NOS. 1228 and 1229 lation between the genotypic and phenotypic analysis. The were designed to amplify the region between the end of fusA sensitivity of the assays was determined for several strains of and the beginning of tuf genes in the stroperon. Genomic E. gallinarum, E. casselliflavus, E. flavescens and Vancomy 30 DNAs from a panel of 35 strains were tested for PCR ampli cin-resistant E. faecalis and K. faecium. Using each of the E. fication with those primers. In the initial experiment, the faecalis-and E. faecium-specific PCR primer pairs as well as following strains showed a positive result: Abiotrophia adi van A-, van B- and VanC-specific PCR primers used alone or in acens ATCC 49175, Abiotrophia defectiva ATCC 49176, multiplex as described above, the sensitivity ranged from 1 to Bacillus subtilis ATCC 27370, Closridium difficile ATCC 10 copies of genomic DNA. 35 9689, Enterococcus avium ATCC 14025, Enterococcus cas The format of the assay is not limited to the one described selliflavus ATCC 25788. Enterococcus Cecorum ATCC above. A person skilled in the art could adapt the assay for 43198, Enterococcus faecalis ATCC 29212, Enterococcus different formats such as PCR with real-time detection using faecium ATCC 19434, Enterococcus flavescens ATCC molecular beacon probes. Molecular beacon probes designed 49996, Enterococcus gallinarum ATCC 49573, Enterococ to be used in this assay include, but are not limited to, SEQID 40 cus solitarius ATCC 49428, Escherichia coli ATCC 11775, NO. 1238 for the detection of E. faecalis, SEQID NO. 1237 Haemophilus influenzae ATCC 9006, Lactobacillus acido for the detection of E. faecium, SEQ ID NO. 1239 for the philus ATCC 4356, Peptococcus niger ATCC 27731, Proteus detection of VanA, and SEQID NO.1241 for the detection of mirabilis ATCC 25933, Staphylococcus aureus ATCC VanB. 43300, Staphylococcus auricularis ATCC 33753, Staphylo Alternatively, another PCR assay was developed for the 45 coccus capitis ATCC 27840. Staphylococcus epidemidis detection of Vancomycin-resistant E. faecium and Vancomy ATCC 14990, Staphylococcus haemolyticus ATCC 29970, cin-resistant E. faecalis. This assay included two multiplex: Staphylococcus hominis ATCC 27844, Staphylococcus lug (1) the first multiplex contained the VanA-specific primer pair dunensis ATCC 43.809, Staphylococcus saprophyticus ATCC (SEQID NOS. 1090-1091) and the van B-specific PCR primer 15305, Staphylococcus simulans ATCC 27848, and Staphy pair described in our assigned U.S. Pat. No. 5,994.066 (SEQ 50 lococcus warneri ATCC 27836. This primer pair could ID NOS. 1095 and 1096 in the present patent and SEQ ID amplify additional bacterial species; however, there was no NOs. 231 and 232 in the said patent), and (2) the second amplification for Some species, Suggesting that the PCR multiplex contained the E. faecalis-specific PCR primer pair cycling conditions could be optimized or the primers modi described in our assigned U.S. Pat. No. 5,994,066 (SEQ ID fied. For example, SEQID NO. 1227 was designed to amplify NOs. 40 and 41 in the said patent) and the E. faecium-specific 55 a broader range of species. PCR primer pair described in our patent publication WO98/ In addition to other possible primer combinations to 20157 (SEQID NOS. 1 and 2 in the said publication). For both amplify the region covering fusA and tuf, FIG. 3 illustrates multiplexes, the optimal cycling conditions for maximum the positions of amplification primers SEQ ID NOS. 1221 sensitivity and specificity were found to be 3 min. at 94°C., 1227 which could be used for universal amplification of fusA followed by forty cycles of two steps consisting of 1 second at 60 segments. All of the above mentioned primers (SEQID NOS. 95° C. and 30 seconds at 58°C., plus a terminal extension at 1221-1229) could be useful for the universal and/or the spe 72° C. for 2 minutes. Detection of the PCR products was cific detection of bacteria. made by electrophoresis inagarose gels (2%) containing 0.25 Moreover, different combinations of primers SEQID NOs. ug/ml of ethidium bromide. The two multiplexes were tested 1221-1229. Sometimes in combination with tuf sequencing for their specificity by using 0.1 nanogram of purified 65 primer SEQID NO. 697, were used to sequence portions of genomic DNA from a panel of two Vancomycin-sensitive E. the stroperon, including the intergenic region. In this manner, faecalis Strains, two Vancomycin-resistant E. faecalis Strains, the following sequences were generated: SEQID NOS. 1518 US 8,182,996 B2 57 58 1526, 1578-1580, 1786-1821, 1822-1834, 1838-1843, 2184, purification kit (midi format). These large-scale plasmid 2187,2188,2214-2249, and 2255-2269. preparations were used for automated DNA sequencing. The 380 bp nucleotide sequence was determined for three Example 25 strains of S. saprophyticus (SEQ ID NOS. 74, 1093, and 1198). Both strands of the AP-PCR insert from the two DNA Fragment Isolation from Staphylococcus selected clones were sequenced by the dideoxynucleotide saprophyticus by Arbitrarily Primed PCR chain termination sequencing method with SP6 and T7 sequencing primers by using the Applied Biosystems auto DNA sequences of unknown coding potential for the spe mated DNA sequencer (model 373A) with their PRISMTM cies-specific detection and identification of Staphylococcus 10 Sequenase(R) Terminator Double-stranded DNA Sequencing saprophyticus were obtained by the method of arbitrarily Kit (Applied Biosystems, Foster City, Calif.). primed PCR (AP-PCR). Optimal species-specific amplification primers (SEQ ID AP-PCR is a method which can be used to generate specific NOs. 1208 and 1209) have been selected from the sequenced DNA probes for microorganisms (Fani et al., 1993, Molecular AP-PCR Staphylococcus saprophyticus DNA fragments with Ecology 2:243-250). A description of the AP-PCR protocol 15 the help of the primeranalysis software OligoTM5.0 (National used to isolate a species-specific genomic DNA fragment BioSciences Inc.). The selected primers were tested in PCR from Staphylococcus saprophyticus follows. Twenty differ assays to Verify their specificity and ubiquity. Data obtained ent oligonucleotide primers of 10 nucleotides in length (all with DNA preparations from reference ATCC strains of 49 included in the AP-PCR kit OPAD (Operon Technologies, gram-positive and 31 gram-negative bacterial species, includ Inc., Alameda, Calif.)) were tested systematically with DNAS ing 28 different staphylococcal species, indicate that the from 5 bacterial strains of Staphylococcus saprophyticus as selected primer pairs are specific for Staphylococcus well as with bacterial strains of 27 other staphylococcal (non Saprophyticus since no amplification signal has been S. saprophyticus) species. For all bacterial species, amplifi observed with DNAs from the other staphylococcal or bacte cation was performed directly from one uL (0.1 ng/LL) of rial species tested. This assay was able to amplify efficiently purified genomic DNA. The 25 uL PCR reaction mixture 25 DNA from all 60 strains of S. saprophyticus from various contained 50 mM KC1, 10 mM Tris-HCl (pH 9.0), 0.1% origins tested. The sensitivity level achieved for three S. Triton X-100, 2.5 mM MgCl, 1.2 uM of only one of the 20 Saprophyticus reference ATCC strains was around 6 genome different AP-PCR primers OPAD, 200 uM of each of the four cop1es. dNTPs, 0.5 U of Taq DNA polymerase (Promega Corp., Madison, Wis.) coupled with TaqStartTM antibody (Clontech 30 Example 26 Laboratories Inc., Palo Alto, Calif.). PCR reactions were sub jected to cycling using a MJ Research PTC-200 thermal Sequencing of Prokaryotic tuf Gene Fragments cycler as follows: 3 min at 96° C. followed by 42 cycles of 1 min at 94°C. for the denaturation step, 1 min at 31°C. for the The comparison of publicly available tuf sequences from a annealing step and 2 min at 72° C. for the extension step. A 35 variety of bacterial species revealed conserved regions, final extension step of 7 min at 72°C. followed the 42 cycles allowing the design of PCR primers able to amplify tuf to ensure complete extension of PCR products. Subsequently, sequences from a wide range of bacterial species. Using twenty microliters of the PCR-amplified mixture were primer pair SEQ ID NOS. 664 and 697, it was possible to resolved by electrophoresis on a 1.5% agarose gel containing amplify and determine tuf sequences SEQ ID NOS.: 1-73, 0.25ug/ml of ethidium bromide. The size of the amplification 40 75-241, 607-618, 621,662,675, 717-736,868-888,932,967 products was estimated by comparison with a 50-bp molecu 989, 992, 1002, 1572-1575, 1662-1663, 1715-1733, 1835 lar weight ladder. 1837, 1877-1878, 1880-1881, 2183, 2185, 2200, 2201, and Amplification patterns specific for Staphylococcus 2270-2272. saprophyticus were observed with the AP-PCR primer OPAD-16 (sequence: 5'-AACGGGCGTC-3). Amplification 45 Example 27 with this primer consistently showed aband corresponding to a DNA fragment of approximately 380 bp for all Staphylo Sequencing of Procaryotic recA Gene Fragments coccus saprophyticus strains tested but not for any of the other staphylococcal species tested. The comparison of publicly available recA sequences from The band corresponding to the 380 bp amplicon, specific 50 a variety of bacterial species revealed conserved regions, and ubiquitous for S. saprophyticus based on AP-PCR, was allowing the design of PCR primers able to amplify recA excised from the agarose gel and purified using the sequences from a wide range of bacterial species. Using QIAquickTM gel extraction kit (QIAGEN Inc.). The gel-puri primer pairs SEQ ID NOS. 921-922 and 1605-1606, it was fied DNA fragment was cloned into the T/A cloning site of the possible to amplify and determine recA sequences SEQ ID pCR 2.1TMplasmid vector (Invitrogen Inc.) using T4 DNA 55 NOs.: 990-991, 1003, 1288-1289, 1714, 1756-1763, 1866 ligase (New England BioLabs). Recombinant plasmids were 1873 and 2202-2212. transformed into E. coli DH5a competent cells using standard procedures. All reactions were performed according to the Example 28 manufacturers instructions. Plasmid DNA isolation was done by the method of Birnboim and Doly (Nucleic Acid 60 Specific Detection and Identification of Escherichia coli/ Res., 1979, 7:1513-1523) for small-scale preparations. All Shigella Sp. Using tufSequences plasmid DNA preparations were digested with the EcoRI The analysis of tuf sequences from a variety of bacterial restriction endonuclease to ensure the presence of the species allowed the selection of PCR primers (SEQID NOs. approximately 380 bp AP-PCR insert into the plasmid. Sub 1661 and 1665) and of an internal probe (SEQID NO. 2168) sequently, a large-scale and highly purified plasmid DNA 65 specific to Escherichia coli/Shigella sp. The strategy used to preparation was performed from two selected clones shown design the PCR primers was based on the analysis of a mul to carry the AP-PCR insert by using the QIAGEN plasmid tiple sequence alignment of various tuf sequences. The mul US 8,182,996 B2 59 60 tiple sequence alignment included the tuf sequences of marcescens, Enterobacter aerogenes, Proteus vulgaris, Escherichia Coli/Shigella sp. as well as tuf sequences from Kluyvera ascorbata, Kluyverageorgiana, Kluyvera cryocre other species and bacterial genera, especially representatives scens and Yersinia enterolitica. Amplification was detected of closely related species. A careful analysis of this alignment for the two K. pneumoniae strains, K. planticola, K. terrigena allowed the selection of oligonucleotide sequences which are and the three Kluyvera species tested. Analysis of the multiple conserved within the target species but which discriminate alignment sequence of the atp gene allowed the design of an sequences from other species, especially from the closely internal probe SEQID NO. 2167 which can discrimate Kleb related species, thereby permitting the species-specific and siella pneumoniae from other Klebsiella sp. and Kluyvera sp. ubiquitous detection and identification of the target bacterial The sensitivity of the assay with 40-cycle PCR was verified species. 10 with one strain of K. pneumoniae. The detection limit for K. The chosen primer pair, oligos SEQ ID NOS. 1661 and pneumoniae was around 10 copies of genomic DNA. 1665, gives an amplification product of 219 bp. Standard PCR was carried out using 0.4 uM of each primer, 2.5 mM MgCl, Example 30 BSA 0.05 mM, 50 mM KC1, 10 mM Tris-HCl (pH 9.0), 0.1% Triton X-100, dNTPs 0.2 mM (Pharmacia), 0.5 U Taq DNA 15 Specific Detection and Identification of polymerase (Promega) coupled with TaqStartTM antibody Acinetobacter Baumannii Using atp) Sequences (Clontech Laboratories Inc.), 1 ul of genomic DNA sample in a final volume of 20 ul using a PTC-200 thermocycler (MJ The analysis of atpd sequences from a variety of bacterial Research). The optimal cycling conditions for maximum sen species allowed the selection of PCR primers specific to sitivity and specificity were 3 minutes at 95° C. for initial Acinetobacter baumannii. The primer design strategy is simi denaturation, then forty cycles of two steps consisting of 1 lar to the strategy described in Example 28. second at 95° C. and 30 seconds at 60° C., followed by Two A. baumannii-specific primers were selected, SEQID terminal extension at 72° C. for 2 minutes. Detection of the NOs. 1690 and 1691, which give an amplification product of PCR products was made by electrophoresis in agarose gels 233 bp. Standard PCR was carried out on PTC-200 thermocy (2%) containing 0.25 ug/ml of ethidium bromide. Visualiza 25 clers (MJ Research) using 0.4 uM of each primeras described tion of the PCR products was made under UV at 254 nm. in Example 28. The optimal cycling conditions for maximum Specificity of the assay was tested by adding to the PCR sensitivity and specificity were as follow: three minutes at 95° reactions 0.1 ng of genomic DNA from each of the following C. for initial denaturation, then forty cycles of two steps bacterial species: Escherichia coli (7 Strains), Shigella son consisting of 1 second at 95° C. and 30 seconds at 60° C. nei, Shigella flexneri, Shigella dysenteriae, Salmonella typh 30 followed by terminal extension at 72° C. for 2 minutes. imyurium, Salmonella typhi, Salmonella enteritidis, Specificity of the assay was tested by adding to the PCR Tatumella ptyseos, Klebsiella pneumoniae (2 strains), reactions 0.1 ng of genomic DNA from each of the following Enterobacter aerogenes, Citrobacter farmeri, Campylo bacterial species: Acinetobacter baumannii (3 strains), bacter jejuni, Serratia marcescens. Amplification was Acinetobacter anitratus, Acinetobacter lwofi, Serratia observed only for the Escherichia coli and Shigella sp. strains 35 marcescens, Enterobacter cloacae, Enterococcus faecalis, listed and Escherichiafergusonii. The sensitivity of the assay Pseudomonas aeruginosa, Psychrobacter phenylpyruvicus, with 40-cycle PCR was verified with one strain of E. coli and Neisseria gonorrheoae, Haemophilus haemoliticus, Yersinia three strains of Shigella sp. The detection limit for E. coli and enterolitica, Proteus vulgaris, Eikenella corrodens, Escheri Shigella sp. was 1 to 10 copies of genomic DNA, depending chia coli. Amplification was detected only for A. baumannii, on the Strains tested. 40 A. anitratus and A. lwoffi. The sensitivity of the assay with 40-cycle PCR was verified with two strains of A. baumannii. Example 29 The detection limit for the two A. baumannii strains tested was 5 copies of genomic DNA. Analysis of the multiple Specific Detection and Identification of Klebsiella alignment sequence of the atp gene allowed the design of a pneumoniae Using atpD Sequences 45 A. baumannii-specific internal probe (SEQID NO. 2169). The analysis of atp) sequences from a variety of bacterial Example 31 species allowed the selection of PCR primers specific to K. pneumoniae. The primer design strategy is similar to the Specific Detection and Identification of Neisseria strategy described in Example 28 except that atp) sequences 50 gonorrhoeae. Using tufSequences were used in the alignment. Two K. pneumoniae-specific primers were selected, (SEQ The analysis of tuf sequences from a variety of bacterial ID NOS. 1331 and 1332) which give an amplification product species allowed the selection of PCR primers specific to of 115 bp. Standard PCR was carried out on PTC-200 ther Neisseria gonorrhoeae. The primer design strategy is similar mocyclers (MJ Research) using 0.4 LM of each primer as 55 to the strategy described in Example 28. described in Example 28. The optimal cycling conditions for Two N. gonorrhoeae-specific primers were selected, SEQ maximum sensitivity and specificity were as follow: three ID NOS. 551 and 552, which give an amplification product of minutes at 95°C. for initial denaturation, then forty cycles of 139 bp. PCR amplification was carried out on PTC-200 ther two steps consisting of 1 second at 95°C. and 30 seconds at mocyclers (MJ Research) using 0.4 LM of each primer as 55° C., followed by terminal extension at 72° C. for 2 min 60 described in Example 28. The optimal cycling conditions for utes. maximum sensitivity and specificity were as follow: three Specificity of the assay was tested by adding to the PCR minutes at 95°C. for initial denaturation, then forty cycles of reactions 0.1 ng of genomic DNA from each of the following two steps consisting of 1 second at 95°C. and 30 seconds at bacterial species: Klebsiella pneumoniae (2 Strains), Kleb 65°C., followed by terminal extension at 72° C. for 2 min siella Ornitholytica, Klebsiella Oxytoca (2 strains), Klebsiella 65 utes. planticola, Klebsiella terrigena, Citrobacter freundii, Specificity of the assay was tested by adding into the PCR Escherichia coli, Salmonella cholerasuis typhi, Serratia reactions, 0.1 ng of genomic DNA from each of the following US 8,182,996 B2 61 62 bacterial species: Neisseria gonorrhoeae (19 strains), Neis niae subsp. rhinoscleromatis (SEQID NO. 1784) and Kleb seria meningitidis (2 Strains), Neisseria lactanica, Neisseria siella terrigena (SEQID NO. 1785). flavescens, Neisseria animalis, Neisseria canis, Neisseria cuniculi, Neisseria elongata, Neisseria mucosa, Neisseria Example 33 polysaccharea, Neisseria sicca, Neisseria subflava, Neisseria weaveri. Amplification was detected only for N. gonor Development of a PCRAssay for the Specific rhoeae, N. sicca and N. polysaccharea. The sensitivity of the Detection and Identification of Staphylococcus assay with 40-cycle PCR was verified with two strains of N. aureus and its Quinolone Resistance Genes Gyra gonorrhoeae. The detection limit for the N. gonorrhoeae and ParC strains tested was 5 copies of genomic DNA. Analysis of the 10 multiple alignment sequence of the tuf gene allowed the The analysis of gyra and parC sequences from a variety of design of an internal probe, SEQ ID NO. 2166, which can bacterial species revealed conserved regions allowing the discriminate N. gonorrhoeae from N. sicca and N. polysac design of PCR primers specific to the quinolone-resistance charea. determining region (QRDR) of gyra and parC from Staphy 15 lococcus aureus. PCR primer pair SEQ ID NOS. 1340 and Example 32 1341 was designed to amplify the gyra sequence of S. aureus, whereas PCR primer pair SEQID NOS. 1342 and 1343 was Sequencing of Bacterial gyra and parC Gene designed to amplify S. aureus parC. The comparison of gyra Fragments. Sequencing of Bacterial gyra and parC and parC sequences from S. aureus Strains with various levels Fragments of quinolone resistance allowed the identification of amino acid substitutions Ser-84 to Leu, Glu-88 to Gly or Lys in the One of the major mechanism of resistance to quinolone in Gyra subunit of DNA gyrase encoded by gyra and amino various bacterial species is mediated by target changes (DNA acid changes Ser-80 to Phe or Tyr and Ala-116 to Glu in the gyrase and/or topoisomerase IV). These enzymes control ParC subunit of topoisomerase IV encoded by parC. These DNA topology and are vital for chromosome function and 25 amino acid substitutions in Gyra and ParC subunits occur in replication. Each of these enzymes is a tetramer composed of isolates with intermediate- or high-level quinolone resis two Subunits: GyrA and GyrB forming AB complex in tance. Internal probes for the specific detection of wild-type DNA gyrase; and ParC and ParE forming and C.E. complex S. aureus gyra (SEQID NO. 1940) and wild-type S. aureus in DNA topoisomerase IV. It has been shown that they are parC (SEQ ID NO. 1941) as well as internal probes for the hotspots, called the quinolone-resistance-determining region 30 specific detection of each of the gyra (SEQID NOS. 1333 (QRDR) for mutations within gyra that encodes for the Gyra 1335) and parC mutations identified in quinolone-resistant S. subunit of DNA gyrase and within parC that encodes the parC aureus (SEQID NOS. 1336-1339) were designed. subunit of topoisomerase IV. The gyra- and parC-specific primer pairs (SEQ ID NOs. In order to generate a database for gyra and parC 1340-1341 and SEQID NOS. 1342-1343) were used in mul sequences that can be used for design of primers and/or 35 tiplex. PCR amplification was carried out on PTC-200 ther probes for the specific detection of quinolone resistance in mocyclers (MJ Research) using 0.3, 0.3, 0.6 and 0.6 uM of various bacterial species, gyra and parC DNA fragments each primers, respectively, as described in Example 28. The selected from public database (GenBank and EMBL) from a optimal cycling conditions for maximum sensitivity and variety of bacterial species were used to design oligonucle specificity were 3 minutes at 95°C. for initial denaturation, otide primers. 40 then forty cycles of two steps consisting of 1 second at 95°C. Using primer pair SEQ ID NOS. 1297 and 1298, it was and 30 seconds at 62°C., followed by terminal extension at possible to amplify and determine gyrA sequences from 72° C. for 2 minutes. Detection of the PCR products was Klebsiella Oxytoca (SEQID NO. 1764), Klebsiella pneumo made by electrophoresis inagarose gels (2%) containing 0.25 niae subsp. Ozaneae (SEQID NO. 1765), Klebsiella planti ug/ml of ethidium bromide. The specificity of the multiplex cola (SEQ ID NO. 1766), Klebsiella pneumoniae (SEQ ID 45 assay with 40-cycle PCR was verified by using 0.1 ng of NO. 1767), Klebsiella pneumoniae subsp. pneumoniae (two purified genomic DNA from a panel of gram-positive bacte strains) (SEQ ID NOS. 1768-1769), Klebsiella pneumoniae ria. The list included the following: Abiotrophia adiacens, subsp. rhinoscleromatis (SEQID NO. 1770), Klebsiella ter Abiotrophia defectiva, Bacillus cereus, Bacillus mycoides, rigena (SEQ ID NO. 1771), Kluyvera ascorbata (SEQ ID Enterococcus faecalis (2 strains), Enterococcus flavescens, NO. 2013), Kluyverageorgiana (SEQ ID NO. 2014) and 50 Gemella morbillorum, Lactococcus lactis, Listeria innocua, Escherichia coli (4 strains) (SEQID NOs. 2277-2280). Using Listeria monocytogenes, Staphylococcus aureus (5 strains), primer pair SEQID NOS. 1291 and 1292, it was possible to Staphylococcus auricalis, Staphylococcus capitis Subsp. ure amplify and determine gyra sequences from Legionella alyticus, Staphylococcus carnosus, Staphylococcus chromo pneumophila subsp. pneumophila (SEQID NO. 1772), Pro genes, Staphylococcus epidermidis (3 strains), Staphylococ teus mirabilis (SEQID NO. 1773), Providencia rettgeri (SEQ 55 cus gallinarum, Staphylococcus haemolyticus (2 Strains), ID NO. 1774), Proteus vulgaris (SEQ ID NO. 1775) and Staphylococcus hominis, Staphylococcus hominis Subsp Yersinia enterolitica (SEQID NO. 1776). Using primer pair hominis, Staphylococcuslentus, Staphylococcus lugdunensis, SEQID NOS. 1340 and 1341, it was possible to amplify and Staphylococcus saccharolyticus, Staphylococcus saprophyti determine gyrA sequence from Staphylococcus aureus (SEQ cus (3 strains), Staphylococcus simulans, Staphylococcus ID NO. 1255). 60 warneri, Staphylococcus xylosus, Streptococcus agalactiae, Using primers SEQ ID NOS. 1318 and 1319, it was pos Streptococcus pneumoniae. Strong amplification of both sible to amplify and determine parC sequences from K. Oxy gyra and parC genes was only detected for the S. aureus toca (two strains) (SEQ ID NOS. 1777-1778), Klebsiella strains tested. The sensitivity of the multiplex assay with pneumoniae subsp. Ozaenae (SEQID NO. 1779), Klebsiella 40-cycle PCR was verified with one quinolone-sensitive and planticola (SEQID NO. 1780), Klebsiella pneumoniae (SEQ 65 four quinolone-resistant strains of S. aureus. The detection ID NO. 1781), Klebsiella pneumoniae subsp. pneumoniae limit was 2 to 10 copies of genomic DNA, depending on the (two strains) (SEQID NOS. 1782-1783), Klebsiella pneumo strains tested. US 8,182,996 B2 63 64 Detection of the hybridization with the internal probes was NOs. 1934 and 1935) and the second multiplex contained K. performed as described in Example 7. The internal probes pneumoniae gyrA/parC-specific primer (SEQ ID NOs. specific to wild-type gyra and parC of S. aureus and to the 1936), K. pneumoniae gyrA-specific primer (SEQ ID NO. gyra and parC variants of S. aureus were able to recognize 1937) and K. pneumoniae parC-specific primer (SEQID NO. two quinolone-resistant and one quinolone-sensitive S. 5 1935). Standard PCR was carried out on PTC-200 thermocy aureus strains showing a perfect correlation with the Suscep clers (MJ Research) using for the first multiplex 0.6,0.6,0.4, tibility to quinolones. 0.4 uM of each primer, respectively, and for the second mul tiplex 0.8, 0.4, 0.4 uM of each primer, respectively. PCR The complete assay for the specific detection of S. aureus amplification and agarose gel electrophoresis of the amplified and its susceptibility to quinolone contains the Staphylococ products were performed as described in Example 28. The cus-specific primers (SEQID NOS. 553 and 575) described in 10 optimal cycling conditions for maximum sensitivity and Example 7 and the multiplex containing the S. aureus gyra specificity were 3 minutes at 95°C. for initial denaturation, and parC-specific primer pairs (SEQID NOS. 1340-1341 and then forty cycles of two steps consisting of 1 second at 95°C. SEQ ID NOS. 1342-1343). Amplification is coupled with and 30 seconds at 62°C., followed by terminal extension at post-PCR hybridization with the internal probe specific to S. 72° C. for 2 minutes. The specificity of the two multiplex aureus (SEQ ID NO. 587) described in Example 7 and the 15 assays with 40-cycle PCR was verified by using 0.1 ng of internal probes specific to wild-type S. aureus gyra and parC purified genomic DNA from a panel of gram-negative bacte (SEQID NOS. 1940-1941) and to the S. aureus gyra and parC ria. The list included: Acinetobacter baumannii, Citrobacter variants (SEQID NOs. 1333-1338). freundii, Eikenella corrodens, Enterobacter aerogenes, An assay was also developed for the detection of qui Enterobacter cancerogenes, Enterobacter cloacae, Escheri nolone-resistant S. aureus using the SmartCycler (Cepheid). chia coli (10 strains), Haemophilus influenzae, Klebsiella Real-time detection is based on the use of S. aureus parC pneumoniae, Klebsiella Ornitholytica, Klebsiella Oxytoca (2 specific primers (SEQID NOS. 1342 and 1343) and the Sta strains), Klebsiella planticola, Klebsiella terrigena, Kluyvera phylococcus-specific primers (SEQ ID NOS. 553 and 575) ascorbata, Kluyvera cryocrescens, Kluyvera georgiana, described in Example 7. Internal probes were designed for Neisseria gonorrhoeae, Proteus mirabilis, Proteus vulgaris, 25 Pseudomonas aeruginosa, Salmonella choleraesuis Subsp. molecular beacon detection of the wild-type S. aureus parC typhimurium, Salmonella enteritidis, Serratia liquefaciens, (SEQ ID NO.1939), for detection of the Ser-80 to Tyr or Phe Serratia marcescens and Yersinia enterocolytica. For both amino acid substitutions in the ParC subunit encoded by S. multiplex, strong amplification of both gyra and parC was aureus parC (SEQID NOS. 1938 and 1955) and for detection observed only for the K. pneumoniae strain tested. The sen of S. aureus (SEQID NO. 2282). sitivity of the two multiplex assays with 40-cycle PCR was 30 Verified with one quinolone-sensitive strain of K. pneumo Example 34 niae. The detection limit was around 10 copies of genomic DNA. Development of a PCRAssay for the Detection and The complete assay for the specific detection of K. pneu Identification of Klebsiella pneumoniae and Its moniae and its Susceptibility to quinolone contains the Kleb Quinolone Resistance Genes gyra and parC 35 siella-specific primers (SEQ ID NOS. 1331 and 1332) described in Example 29 and either the multiplex containing The analysis of gyra and parC sequences from a variety of the K. pneumoniae gyra- and parC-specific primers (SEQID bacterial species from the public databases and from the NOs. 1935, 1936, 1937) or the multiplex containing the K. database described in Example32 revealed conserved regions pneumoniae gyra- and parC-specific primers (SEQID NOs. allowing the design of PCR primers specific to the quinolone 40 1934, 1937, 1939, 1942). Amplification is coupled with post resistance-determining region (QRDR) of gyra and parC PCR hybridization with the internal probespecific to K. pneu from K. pneumoniae. PCR primer pair SEQ ID NOS. 1936 moniae (SEQID NO. 2167) described in Example 29 and the and 1937, or pair SEQID NOS. 1937 and 1942, were designed internal probes specific to wild-type K. pneumoniae gyra and to amplify the gyra sequence of K. pneumoniae, whereas parC (SEQID NOS. 1943, 1944) and to the K. pneumoniae PCR primer pair SEQID NOS. 1934 and 1935 was designed 45 gyra and parC variants (SEQID NOS. 1945-1949 and 1950 to amplify K. pneumoniae parC sequence. An alternative pair, 1953). SEQID NOS. 1935 and 1936, can also amplify K. pneumo An assay was also developed for the detection of qui niae parC. The comparison of gyra and parC sequences from nolone-resistant K. pneumoniae using the SmartCycler (Cep K. pneumoniae strains with various levels of quinolone resis heid). Real-time detection is based on the use of resistant K. tance allowed the identification of amino acid substitutions 50 pneumoniae gyra-specific primers (SEQ ID NOS. 1936 and Ser-83 to Tyr or Phe and Asp-87 to Gly or Ala and Asp-87 to 1937) and the K. pneumoniae-specific primers (SEQID NOs. Asn in the Gyr A subunit of DNA gyrase encoded by gyra and 1331 and 1332) described in Example 29. Internal probes amino acid changes Ser-80 to Ile or Arg and Glu-84 to Gly or were designed for molecular beacon detection of the wild Lys in the ParC subunit of topoisomerase IV encoded by type K. pneumoniae gyra (SEQID NO. 2251), for detection parC. These amino acid substitutions in the Gyra and ParC 55 of the Ser-83 to Tyr or Phe and/or Asp-87 to Gly or Asn in the subunits occur in isolates with intermediate- or high-level Gyra subunit of DNA gyrase encoded by gyra (SEQ ID quinolone resistance. Internal probes for the specific detec NOs. 2250) and for detection of K. pneumoniae (SEQID NO. tion of wild-type K. pneumoniae gyra (SEQ ID NO. 1943) 2281). and wild-type K. pneumoniae parC (SEQ ID NO. 1944) as well as internal probes for the specific detection of each of the 60 Example 35 gyra (SEQID NOS. 1945-1949) and parC mutations identi fied in quinolone-resistant K. pneumoniae (SEQ ID NOS. Development of a PCR Assay for Detection and 1950-1953) were designed. Identification of S. Pneumoniae and its Quinolone Two multiplex using the K. pneumoniae gyra- and parC Resistance Genes gyra and parC specific primer pairs were used: the first multiplex contained 65 K. pneumoniae gyra-specific primers (SEQ ID NOS. 1937 The analysis of gyra and parC sequences from a variety of and 1942) and K. pneumoniae parC-specific primers (SEQID bacterial species revealed conserved regions allowing the US 8,182,996 B2 65 66 design of PCR primers able to amplify the quinolone-resis specific to each of the S. pneumoniae gyra and parC variants tance-determining region (QRDR) of gyra and parC from all (SEQ ID NOS. 2042, 2043 and 2046). S. pneumoniae strains. PCR primer pair SEQID NOS. 2040 and 2041 was designed to amplify the QRDR of S. pneumo Example 36 niae gyra, whereas PCR primer pair SEQID NOS. 2044 and 5 2045 was designed to amplify the QRDR of S. pneumoniae Detection of Extended-Spectrum TEM-Type parC. The comparison of gyra and parC sequences from S. B-Lactamases in Escherichia coli pneumoniae strains with various levels of quinolone resis tance allowed the identification of amino acid substitutions The analysis of TEM sequences which confer resistance to 10 third-generation cephalosporins and to B-lactamase inhibi Ser-81 to Phe or Tyr in the Gyra subunit of DNA gyrase tors allowed the identification of amino acid substitutions encoded by gyra and amino acid changes Ser-79 to Phe in the Met-69 to Ile or Leu or Val, Ser-130 to Gly, Arg-164 to Seror ParC subunit of topoisomerase IV encoded by parC. These H is, Gly-238 to Ser, Glu-240 to Lys and Arg-244 to Ser or amino acid substitutions in the Gyra and ParC subunits occur Cys or Thr or His or Leu. PCR primers SEQID NOS. 1907 in isolates with intermediate- or high-level quinolone resis 15 and 1908 were designed to amplify TEM sequences. Internal tance. Internal probes for the specific detection of each of the probes for the specific detection of wild-type TEM (SEQID gyrA (SEQID NOS. 2042 and 2043) and parC (SEQID NO. NO. 2141) and for each of the amino acid substitutions (SEQ 2046) mutations identified in quinolone-resistant S. pneumo ID NOS. 1909-1926) identified in TEM variants were niae were designed. designed to detect resistance to third-generation cephalospor For all bacterial species, amplification was performed from ins and to B-lactamase inhibitors. Design and synthesis of purified genomic DNA. 1 ul of genomic DNA at 0.1 ng/1 uL. primers and probes, and detection of the hybridization were was transferred directly to a 19 ul PCR mixture. Each PCR performed as described in Example 7. reaction contained 50 mM KC1, 10 mM Tris-HCl (pH 9.0), For all bacterial species, amplification was performed from 0.1% Triton X-100, 2.5 mM MgCl, 0.4 uM (each) of the purified genomic DNA. One ul of genomic DNA at 0.1 ng/ul above primers SEQID NOS. 2040,2041,2044 and 2045, 0.05 25 was transferred directly to a 19 ul PCR mixture. Each PCR mM bovine serum albumin (BSA) and 0.5 UTaq polymerase reaction contained 50 mM KC1, 10 mM Tris-HCl (pH 9.0); coupled with TaqStartTM antibody. The optimal cycling con 0.1% Triton X-100, 2.5 mM MgCl, 0.4 uM of the TEM ditions for maximum sensitivity and specificity were 3 min specific primers SEQID NOS. 1907 and 1908,200 uM (each) utes at 95°C. for initial denaturation, then forty cycles of two of the four deoxynucleoside triphosphates, 0.05 mM bovine steps consisting of 1 second at 95°C. and 30 seconds at 58° 30 serum albumin (BSA) and 0.5 UTaq polymerase (Promega) C., followed by terminal extension at 72°C. for 2 minutes. In coupled with TaqStartTM antibody. PCR amplification and order to generate Digoxigenin (DIG)-labeled amplicons for agarose gel analysis of the amplified products were per capture probe hybridization, 0.1xPCR DIG labeling four formed as described in Example 28. The optimal cycling deoxynucleoside triphosphates mix (Boehringer Mannheim conditions for maximum sensitivity and specificity were 3 GmbH) was used for amplification. 35 minutes at 95°C. for initial denaturation, then forty cycles of The DIG-labeled amplicons were hybridized to the capture three steps consisting of 5 seconds at 95°C., 30 seconds at 55° probes bound to 96-well plates. The plates were incubated C. and 30 seconds at 72°C., followed by terminal extension at with anti-DIG-alkaline phosphatase and the chemilumines 72° C. for 2 minutes. cence was measured by using a luminometer (MLX, DyneX The specificity of the TEM-specific primers with 40-cycle Technologies Inc.) after incubation with CSPD and recorded 40 PCR was verified by using 0.1 ng of purified genomic from as Relative Light Unit (RLU). The RLU ratio of tested sample the following bacteria: three third-generation cephalosporin with and without captures probes was then calculated. A ratio resistant Escherichia coli strains (one with TEM-10, one with 2.0 was defined as a positive hybridization signal. All reac TEM-28 and the other with TEM-49), two third-generation tions were performed in duplicate. cephalosporin-sensitive Escherichia coli Strain (one with The specificity of the multiplex assay with 40-cycle PCR 45 TEM-1 and the other without TEM), one third-generation was verified by using 0.1 ng of purified genomic DNA from a cephalosporin-resistant Klebsiella pneumoniae Strain (with panel of bacteria listed in Table 13. Strong amplification of TEM-47), and one B-lactamase-inhibitor-resistant Proteus both gyra and parC was detected only for the S. pneumoniae mirabilis strain (with TEM-39). Amplification with the TEM strains tested. Weak amplification of both gyra and parC specific primers was detected only for strains containing genes was detected for Staphylococcus simulans. The detec 50 TEM. tion limit tested with purified genomic DNA from 5 strains of The sensitivity of the assay with 40-cycle PCR was verified S. pneumoniae was 1 to 10 genome copies. In addition, 5 with three E. coli strains containing TEM-1 or TEM-10 or quinolone-resistant and 2 quinolone-sensitive clinical iso TEM-49, one K. pneumoniae strain containing TEM-47 and lates of S. pneumoniae were tested to further validate the one P. mirabilis strain containing TEM-39. The detection developed multiplex PCR coupled with capture probe hybrid 55 limit was 5 to 100 copies of genomic DNA, depending on the ization assays. There was a perfect correlation between detec TEM-containing strains tested. tion of S. pneumoniae gyra and parC mutations and the The TEM-specific primers SEQ ID NOS. 1907 and 1908 Susceptibility to quinolone. were used in multiplex with the Escherichia coli/Shigella The complete assay for the specific detection of S. pneu sp.-specific primers SEQID NOS. 1661 and 1665 described moniae and its susceptibility to quinolone contains the S. 60 in Example 28 to allow the complete identification of pneumoniae-specific primers (SEQID NOS. 1179 and 1181) Escherichia coli/Shigella sp. and the susceptibility to 3-lac described in Example 20 and the multiplex containing the S. tams. PCR amplification with 0.4 uM of each of the primers pneumoniae gyra-specific and parC-specific primer pairs and agarose gel analysis of the amplified products was per (SEQ ID NOS. 2040 and 2041 and SEQID NOS. 2044 and formed as described above. 2045). Amplification is coupled with post-PCR hybridization 65 The specificity of the multiplex with 40-cycle PCR was with the internal probe specific to S. pneumoniae (SEQ ID verified by using 0.1 ng of purified genomic DNA from the NO. 1180) described in Example and the internal probes following bacteria: three third-generation cephalosporin-re US 8,182,996 B2 67 68 sistant Escherichia coli strains (one with TEM-10, one with wild-type SHV (SEQID NO. 1896) and for each of the amino TEM-28 and the other with TEM-49), two third-generation acid substitutions (SEQID NOs. 1886-1895 and 1897-1898) cephalosporin-sensitive Escherichia coli strain (one with identified in SHV variants. The specificity of the probes was TEM-1 and the other without TEM), one third-generation verified with six strains containing various SHV enzymes, cephalosporin-resistant Klebsiella pneumoniae Strain (with 5 one Klebsiella pneumoniae Strain containing SHV-1, one TEM-47), and one B-lactamase-inhibitor-resistant Proteus Klebsiella pneumoniae strain containing SHV-2a, one Kleb mirabilis strain (with TEM-39). The multiplex was highly siella pneumoniae Strain containing SHV-12, one Escheri specific to Escherichia coli strains containing TEM. chia coli strain containing SHV-1, one Escherichia coli strain The complete assay for detection of TEM-type B-lacta containing SHV-7 and one Escherichia coli strain containing mases in E. coli includes PCR amplification using the multi 10 SHV-8. The probes correctly detected each of the SHV genes plex containing the TEM-specific primers (SEQ ID NOS. and their specific mutations. There was a perfect correlation 1907 and 1908) and the Escherichia coli/Shigella sp.-specific between the SHV genotype of the strains and the susceptibil primers (SEQ ID NOS. 1661 and 1665) coupled with post ity to B-lactam antibiotics. PCR-hybridization with the internal probes specific to wild The SHV-specific primers SEQ ID NOs. 1884 and 1885 15 were used in multiplex with the K. pneumoniae-specific prim type TEM (SEQID NO. 2141) and to the TEM variants (SEQ ers SEQID NOS. 1331 and 1332 described in Example 29 to ID NOs. 1909-1926). allow the complete identification of K. pneumoniae and the Example 37 susceptibility to B-lactams. PCR amplification with 0.4 uMof each of the primers and agarose gel analysis of the amplified Detection of Extended-Spectrum SHV-Type products were performed as described above. The specificity of the multiplex with 40-cycle PCR was B-Lactamases in Klebsiella pneumoniae verified by using 0.1 ng of purified genomic DNA from the The comparison of SHV sequences, which confer resis following bacteria: three K. pneumoniae strains containing tance to third-generation cephalosporins and to B-lactamase SHV-1, one Klebsiella pneumoniae strain containing SHV inhibitors, allowed the identification of amino acid substitu 25 2a, one Klebsiella pneumoniae strain containing SHV-12, one tions Ser-130 to Gly, Asp-179 to Ala or ASn, Gly-238 to Ser, Krhinoscleromatis strain containing SHV-1, one Escherichia and Glu-240 to Lys. PCR primer pair SEQID NOS. 1884 and coli strain without SHV. The multiplex was highly specific to 1885 was designed to amplify SHV sequences. Internal Klebsiella pneumoniae strain containing SHV. probes for the specific identification of wild-type SHV (SEQ ID NO. 1896) and for each of the amino acid substitutions 30 Example 38 (SEQID NOs. 1886-1895 and 1897-1898) identified in SHV Variants were designed to detect resistance to third-genera Development of a PCR Assay for the Detection and tion cephalosporins and to B-lactamase inhibitors. Design Identification of Neisseria gonorrhoeae and its and synthesis of primers and probes, and detection of the Associated Tetracycline Resistance Gene tetM hybridization were performed as described in Example 7. For all bacterial species, amplification was performed from 35 The analysis of publicly available tetM sequences revealed purified genomic DNA. One ul of genomic DNA at 0.1 ng/ul conserved regions allowing the design of PCR primers spe was transferred directly to a 19 ul PCR mixture. Each PCR cific to tetM sequences. The PCR primer pair SEQID NOs. reaction contained 50 mM KC1, 10 mM Tris-HCl (pH 9.0), 1588 and 1589 was used in multiplex with the Neisseria 0.1% Triton X-100, 2.5 mM MgCl, 0.4 uM of the SHV gonorrhoeae-specific primers SEQ ID NOS. 551 and 552 specific primers SEQID NO. 1884 and 1885, 200M (each) 40 described in Example 31. Sequence alignment analysis of of the four deoxynucleoside triphosphates, 0.05 mM bovine tetM sequences revealed regions Suitable for the design of an serum albumin (BSA) and 0.5 UTaq polymerase (Promega) internal probe specific to tetM (SEQ ID NO. 2254). PCR coupled with TaqStartTM antibody. PCR amplification and amplification was carried out on PTC-200 thermocyclers (MJ agarose gel analysis of the amplified products were per Research) using 0.4 uM of each primer pair as described in formed as described in Example 28. The optimal cycling 45 Example 28. The optimal cycling conditions for maximum conditions for maximum sensitivity and specificity were 3 sensitivity and specificity were as follow: three minutes at 95° minutes at 95°C. for initial denaturation, then forty cycles of C. for initial denaturation, then forty cycles of two steps three steps consisting of 5 seconds at 95°C., 30 seconds at 55° consisting of 1 second at 95° C. and 30 seconds at 60° C. C. and 30 seconds at 72°C., followed by terminal extension at followed by terminal extension at 72° C. for 2 minutes. 72° C. for 2 minutes. 50 The specificity of the multiplex PCR assay with 40-cycle The specificity of the SHV-specific primers with 40-cycle PCR was verified by using 0.1 ng of purified genomic DNA PCR was verified by using 0.1 ng of purified genomic from from the following bacteria: two tetracycline-resistant the following bacteria: two third-generation cephalosporin Escherichia coli strains (one containing the tetracycline-re resistant Klebsiella pneumoniae strains (one with SHV-2a sistant gene tetB and the other containing the tetracycline and the other with SHV-12), one third-generation cepha resistant gene tetC), one tetracycline-resistant Pseudomonas losporin-sensitive Klebsiella pneumoniae strain (with SHV 55 aeruginosa strain (containing the tetracycline-resistant gene 1), two third-generation cephalosporin-resistant Escherichia tetA), nine tetracycline-resistant Neisseria gonorrhoeae coli strains (one with SHV-8 and the other with SHV-7), and strains, two tetracycline-sensitive Neisseria meningitidis two third-generation cephalosporin-sensitive Escherichia strains, one tetracycline-sensitive Neisseria polysaccharea coli strains (one with SHV-1 and the other without any SHV). strain, one tetracycline-sensitive Neisseria sicca strain and Amplification with the SHV-specific primers was detected 60 one tetracycline-sensitive Neisseria subflava strain. Amplifi only for strains containing SHV. cation with both the tetM-specific and Neisseria gonor The sensitivity of the assay with 40-cycle PCR was verified rhoeae-specific primers was detected only for N. gonor with four strains containing SHV. The detection limit was 10 rhoeae strains containing tetM. There was a weak to 100 copies of genomic DNA, depending on the SHV amplification signal using Neisseria gonorrhoeae-specific containing strains tested. 65 primers for the following species: Neisseria sicca, Neisseria The amplification was coupled with post-PCR hybridiza polysaccharea and Neisseria meningitidis. There was a per tion with the internal probes specific for identification of fect correlation between the tetM genotype and the tetracy US 8,182,996 B2 69 70 cline Susceptibility pattern of the Neisseria gonorrhoeae aminoglycoside-resistant bacteria, one Serratia marcescens strains tested. The internal probe specific to N. gomorrhoeae strain containing the aminoglycoside-resistant gene aacC1, SEQID NO. 2166 described in Example 31 can discriminate one Serratia marcescens Strain containing the aminoglyco Neisseria gonorrhoeae from the other Neisseria sp. side-resistant gene aacC4, one Enterobacter cloacae Strain The sensitivity of the assay with 40-cycle PCR was verified 5 containing the aminoglycoside-resistant gene aacC2, one with two tetracycline resistant strains of N. gonorrhoeae. The Enterococcus faecalis containing the aminoglycoside-resis tant gene aacA-aphD, one Pseudomonas aeruginosa Strain detection limit was 5 copies of genomic DNA for both strains. containing the aminoglycoside-resistant gene aacGIIa and Example 39 one of each of the following aminoglycoside-sensitive bacte rial species, Acinetobacter anitratus, Acinetobacter lwofi, 10 Psychobbacter phenylpyruvian, Neisseria gonorrhoeae, Development of a PCRAssay for the Detection and Haemophilus haemolyticus, Haemophilus influenzae, Yers Identification of Shigella Sp. and Their Associated inia enterolitica, Proteus vulgaris, Eikenella corrodens, Trimethoprim Resistance Gene dhfrila Escherichia coli. There was a perfect correlation between the aph (3')-VIa genotype and the aminoglycoside SuSuceptibility The analysis of publicly available dhfrila and other dhfr 15 pattern of the A. baumannii strains tested. The aph(3)-VIa sequences revealed regions allowing the design of PCR prim specific primers were specific to the aph(3)-VIa gene and did ers specific to dhfrila sequences. The PCR primer pair (SEQ not amplify any of the other aminoglycoside-resistant genes ID NOS. 1459 and 1460) was used in multiplex with the tested. The sensitivity of the multiplex assay with 40-cycle Escherichia coli/Shigella sp.-specific primers SEQID NOs. PCR was verified with two strains of aminoglycoside-resis 1661 and 1665 described in Example 28. Sequencealignment tant strains of A. baumannii. The detection limit was 5 analysis of dhfra sequences revealed regions Suitable for the genome copies of DNA for both A. baumannii strains tested. design of an internal probe specific to dhfrila (SEQ ID NO. 2253). PCR amplification and agarose gel analysis of the Example 41 amplified products were performed as described in Example 28 with an annealing temperature of 60°C. The specificity of 25 Specific Identification of Bacteroides fragilis Using the multiplex assay with 40-cycle PCR was verified by using atpl) (V-Type) Sequences 0.1 ng of purified genomic DNA from a panel of bacteria. The list included the following trimethoprim-sensitive strains, The comparison of atpD (V-type) sequences from a variety Salmonella typhimyurium, Salmonella typhi, Salmonella of bacterial species allowed the selection of PCR primers for enteritidis, Tatumella ptyseos, Klebsiella pneumoniae, Bacteroides fragilis. The strategy used to design the PCR Enterobacter aerogenes, Citrobacter farmeri, Campylo 30 primers was based on the analysis of a multiple sequence bacter jejuni, Serratia marcescens, Shigella dysenteriae, Shi alignement of various atp) sequences from B. fragilis, as gella flexneri, Shigella sonnei, six trimethoprim-resistant well as atpD sequences from the related species B. dispar, Escherichia coli strains (containing dhfrila or dhfrV or bacterial genera and archaea, especially representatives with dhfrVII or dhfrXII or dhfrXIII or dhfrXV), four trimethop phylogenetically related atp) sequences. A careful analysis rim-resistant strains containing dhfra (Shigella sonnei, Shi 35 of this alignment allowed the selection of oligonucleotide gella flexneri, Shigella dysenteriae and Escherichia coli). sequences which are conserved within the target species but There was a perfect correlation between the dhfrila genotype which discriminate sequences from other species, especially and the trimethoprim susceptibility pattern of the Escherichia from closely related species B. dispar, thereby permitting the coli and Shigella sp. strains tested. The dhfrila primers were species-specific and ubiquitous detection and identification specific to the dhfrila gene and did not amplify any of the other 40 of the target bacterial species. trimethoprim-resistant dhfr genes tested. The sensitivity of The chosen primer pair, SEQ ID NOS. 2134-2135, pro the multiplex assay with 40-cycle PCR was verified with duces an amplification product of 231 bp. Standard PCR was three strains of trimethoprim-resistant strains of Shigella sp. carried out on PTC-200 thermocyclers (MJ Research Inc.) The detection limit was 5 to 10 genome copies of DNA, using 0.4LM of each primers pair as described in Example 28. depending on the Shigella sp. strains tested. 45 The optimal cycling conditions for maximum sensitivity and specificity were as follows: three minutes at 95°C. for initial Example 40 denaturation, then forty cycles of two steps consisting of 1 second at 95° C. and 30 seconds at 60° C., followed by Development of a PCRAssay for the Detection and terminal extension at 72°C. for 2 minutes. Identification of Acinetobacter baumannii and its 50 The format of this assay is not limited to the one described Associated Aminoglycoside Resistance Gene above. A person skilled in the art could adapt the assay for different formats such as PCR with real-time detection using The comparison of publicly available aph(3)-VIa molecular beacon probes. Molecular beacon probes designed sequence revealed regions allowing the design of PCR prim to be used in this assay include, but are not limited to, SEQID ers specific to aph(3')-VIa. The PCR primer pair (SEQ ID 55 NO. 2136 for the detection of the B. fragilis amplicon. NOs. 1404 and 1405) was used in multiplex with the Acine tobacter baumannii-specific primers SEQID NOS. 1692 and Example 42 1693 described in Example 30. Analysis of the aph(3)-VIa sequence revealed region Suitable for the design of an internal Evidence for Horizontal Gene Transfer in the probe specific to aph(3)-VIa (SEQ ID NO. 2252). PCR 60 Evolution of the Elongation Factor Tu in Enterococci amplification and agarose gel analysis of the amplified prod ucts were performed as described in Example 28. The speci Overview ficity of the multiplex assay with 40-cycle PCR was verified The elongation factor Tu, encoded by tuf genes, is a GTP by using 0.1 ng of purified genomic DNA from a panel of binding protein that plays a central role in protein synthesis. bacteria including: two aminoglycoside-resistant A. bau 65 One to three tuf genes per genome are present depending on manni Strains (containing aph(3')-VIa), one aminoglycoside the bacterial species. Most low G+C gram-positive bacteria sensitive A. baumani strain, one of each of the following carry only one tuf gene. We have designed degenerate PCR US 8,182,996 B2 71 72 primers derived from consensus sequences of the tuf gene to that intrachromosomal recombination has taken place in the amplify partial tuf sequences from 17 enterococcal species evolution of the genome of this organism. and other phylogenetically related species. The amplified To date, little is known about the tuf genes of enterococcal DNA fragments were sequenced either by direct sequencing species. In this study, we analyzed partial sequences of tuf or by sequencing cloned inserts containing putative ampli genes in 17 enterococcal species, namely, E. avium, E. cas cons. Two different tuf genes (tufa and tufB) were found in selliflavus, E. Cecorum, E. columbae, E. dispar, E. durans, E. 11 enterococcal species, including Enterococcus avium, E. faecalis, E. faecium, E. gallinarum, E. hirae, E. malodoratus, casselliflavus, E. dispar, E. durans, E. faecium, E. gallinarum, E. mundtii, E. pseudoavium, E. raffinosus, E. Saccharolyticus, E. hirae, E. malodoratus, E. mundtii, E. pseudoavium, and E. E. solitarius, and E. sulfitreus. We report here the presence of 10 two divergent copies of tuf genes in 11 of these enterococcal rafinosus. For the other six enterococcal species (E. cecorum, species. The 6 other species carried a single tuf gene. The E. columbae, E. faecalis, E. sulfureus, E. Saccharolyticus, and evolutionary implications are discussed. E. solitarius), only the tufA gene was present. Based on 16S Materials and Methods rRNA gene sequence analysis, the 11 species having two tuf Bacterial strains. Seventeen enterococcal strains and other genes all share a common ancestor, while the six species 15 gram-positive bacterial strains obtained from the American having only one copy diverged from the enterococcal lineage Type Culture Collection (ATCC, Manassas, Va.) were used in before that common ancestor. The presence of one or two this study (Table 16). All strains were grown on sheep blood copies of the tufgene in enterococci was confirmed by South agar or in brain-heart infusion broth prior to DNA isolation. ern hybridization. Phylogenetic analysis of tuf sequences DNA isolation. Bacterial DNAs were prepared using the G demonstrated that the enterococcal tufA gene branches with NOME DNA extraction kit (Biol()1, Vista, Calif.) as previ the Bacillus, Listeria and Staphylococcus genera, while the ously described. enterococcal tufB gene clusters with the genera Streptococ Sequencing of putative tuf genes. In order to obtain the tuf cus and Lactococcus. Primary structure analysis showed that gene sequences of enterococci and other gram-positive bac four amino acid residues within the sequenced regions are teria, two sequencing approaches were used: 1) sequencing of conserved and unique to the enterococcal tufB genes and the 25 cloned PCR products and 2) direct sequencing of PCR prod tuf genes of streptococci and L. lactis. The data Suggest that ucts. A pair of degenerate primers (SEQ ID NOS. 664 and an ancestral Streptococcus or a streptococcus-related species 697) were used to amplify an 886-bp portion of the tuf genes may have horizontally transferred a tuf gene to the common from enterococcal species and other gram-positive bacteria as ancestor of the 11 enterococcal species which now carry two previously described. For E. avium, E. casselliflavus, E. dis tuf genes. 30 par, E. durans, E. faecium, E. gallinarum, E. hirae, E. Introduction mundtii, E. pseudoavium, and E. rafinosus, the amplicons The elongation factor Tu (EF-Tu) is a GTP binding protein were cloned using the Original TA cloning kit (Invitrogen, playing a central role in protein synthesis. It mediates the Carlsbad, Calif.) as previously described. Five clones for each recognition and transport of aminoacyl-tRNAS and their posi species were selected for sequencing. For E. Cecorum, E. tioning to the A-site of the ribosome. The highly conserved 35 faecalis, E. Saccharolyticus, and E. Solitarius as well as the function and ubiquitous distribution render the elongation other gram-positive bacteria, the sequences of the 886-bp factor a valuable phylogenetic marker among eubacteria and amplicons were obtained by direct sequencing. Based on the even throughout the archaebacterial and eukaryotic king results obtained from the earlier rounds of sequencing, two doms. The tuf genes encoding elongation factor Tu are pairs of primers were designed for obtaining the partial tuf present in various copy numbers per bacterial genome. Most 40 sequences from the other enterococcal species by direct gram-negative bacteria contain two tuf genes. As found in sequencing. One pair of primers (SEQID NOS. 543 and 660) Escherichia coli, the two genes, while being almost identical were used to amplify the enterococcal tuf gene fragments in sequence, are located in different parts of the bacterial from E. columbae, E. malodoratus, and E. sulfureus. Another chromosome. However, recently completed microbial pair of primers (SEQ ID NOS. 664 and 661) were used to genomes revealed that only one tuf gene is found in Helico 45 amplify the second tuf gene fragments from E. avium, E. bacter pylori as well as in Some obligate parasitic bacteria, malodoratus, and E. pseudoavium. such as Borrelia burgdorferi, Rickettsia prowazekii, and Tre Prior to direct sequencing, PCR products were electro ponema pallidum, and in Some cyanobacteria. In most gram phoresed on 1% agarose gel at 120V for 2 hours. The gel was positive bacteria studied so far, only one tuf gene was found. then stained with 0.02% methylene blue for 30 minutes and However, Southern hybridization showed that there are two 50 washed twice with autoclaved distilled water for 15 minutes. tuf genes in some clostridia as well as in Streptomyces coeli The gel slices containing PCR products of the expected sizes color and S. lividans. Up to three tuf-like genes have been were cut out and purified with the QIAquick gel extraction kit identified in S. ramocissimus. (QIAgen Inc., Mississauga, Ontario, Canada) according to Although massive prokaryotic gene transfer is Suggested to the manufacturers instructions. PCR mixtures for sequenc be one of the factors responsible for the evolution of bacterial 55 ing were prepared as described previously. DNA sequencing genomes, the genes encoding components of the translation was carried out with the Big DyeTM Terminator Ready Reac machinery are thought to be highly conserved and difficult to tion cycle sequencing kit using a 377 DNA sequencer (PE be transferred horizontally due to the complexity of their Applied Biosystems, Foster City, Calif.). Both strands of the interactions. However, a few recent studies demonstrated evi amplified DNA were sequenced. The sequence data were dence that horizontal gene transfer has also occurred in the 60 verified using the SequencerTM 3.0 software (Gene Codes evolution of some genes coding for the translation apparatus, Corp., Ann Arbor, Mich.). namely, 16S rRNA and some aminoacyl-tRNA synthetases. Sequence analysis and phylogenetic study. Nucleotide No further data Suggest that such a mechanism is involved in sequences of the tuf genes and their respective flanking the evolution of the elongation factors. Previous studies con regions for E. faecalis, Staphylococcus aureus, and Strepto cluded that the two copies of tufgenes in the genomes of some 65 coccus pneumoniae, were retrieved from the TIGR microbial bacteria resulted from an ancient event of gene duplication. genome database and S. pyogenes from the University of Moreover, a study of the tuf gene in R. prowaZeki Suggested Oklahoma database. DNA sequences and deduced protein US 8,182,996 B2 73 74 sequences obtained in this study were compared with those in other hand, for E. avium, E. Casselliflavus, E. dispar, E. all publicly available databases using the BLAST and FASTA durans, E. faecium, E. gallinarum, E. hirae, E. inundtii, E. programs. Unless specified, sequence analysis was conducted pseudoavium, and E. rafinosus, direct sequencing of the 886 with the programs from GCG package (Version 10; Genetics bp fragments revealed overlapping peaks according to their Computer Group, Madison, Wisc.). Sequence alignment of 5 sequence chromatograms, Suggesting the presence of addi the tufgenes from 74 species representing all three kingdoms tional copies of the tuf gene. Therefore, the tuf gene frag of life (Tables 16 and 17) were carried out by use of Pileup and ments of these 10 species were cloned first and then corrected upon visual analysis. The N- and C-termini sequenced. Sequencing data revealed that two different types extremities of the sequences were trimmed to yield a common of tuf sequences (tufa and tufB) are found in eight of these block of 201 amino acids sequences and equivocal residues 10 species including E. casselliflavus, E. dispar, E. durans, E. were removed. Phylogenetic analysis was performed with the faecium, E. gallinarum, E. hirae, E. mundtii, and E. raffino aid of PAUP 4.0b4 written by Dr. David L. Swofford (Sinauer sus. Five clones from E. avium and E. pseudoavium yielded Associates, Inc., Publishers, Sunderland, Mass.). The dis only a single tuf sequence. These new sequence data allowed tance matrix and maximum parsimony were used to generate the design of new primers specific for the enterococcal tufA phylogenetic trees and bootstrap resampling procedures were 15 or tufB sequences. Primers SEQID NOS. 543 and 660 were performed using 500 and 100 replications in each analysis, designed to amplify only enterococcal tufA sequences and a respectively. 694-bp fragment was amplified from all 17 enterococcal spe Protein structure analysis. The crystal structures of (i) Th cies. The 694-bp sequences of tufA genes from E. columbae, ermus aquaticus EF-Tu in complex with Phe-tRNA" and a E. malodoratus, and E. sulfureus were obtained by direct GTP analog and (ii) E. coli EF-Tu in complex with GDP 20 sequencing using these primers. Primers SEQID NOS. 664 served as templates for constructing the equivalent models for and 661 were designed for the amplification of 730-bp por enterococcal EF-Tu. Homology modeling of proteinstructure tion of tufB genes and yielded the expected fragments from was performed using the SWISS-MODEL server and 11 enterococcal species, including E. malodoratus and the 10 inspected using the SWISS-PDB viewer version 3.1. enterococcal species in which heterogeneous tuf sequences Southern hybridization. In a previous study, we amplified 25 were initially found. The sequences of the tufB fragments for and cloned an 803-bp PCR product of the tuf gene fragment E. avium, E. malodoratus and E. pseudoavium were deter from E. faecium. Two divergent sequences of the inserts, mined by direct sequencing using the primers SEQID NOS. which we assumed to be tufA and tuf3 genes, were obtained. 664 and 661. Overall, tufA gene fragments were obtained The recombinant plasmid carrying either tufA or tufB from all 17 enterococcal species but tufB gene fragments sequence was used to generate two probes labeled with 30 were obtained with only 11 enterococcal species (Table 16). Digoxigenin (DIG)-11-dUTP by PCR incorporation follow The identities betweentufA and tufB for each enterococcal ing the instructions of the manufacturer (Boehringer Man species were 68-79% at the nucleotide level and 81 to 89% at nheim, Laval, Québec, Canada). Enterococcal genomic DNA the amino acid level. The tufA gene is highly conserved samples (1-2 ug) were digested to completion with restriction among all enterococcal species with identities varying from endonucleases BglII and Xbal as recommended by the Sup 35 87% to 99% for DNA and 93% to 99% for amino acid plier (Amersham Pharmacia Biotech, Mississauga, Ontario, sequences, while the identities among tufB genes of entero Canada). These restriction enzymes were chosen because no cocci varies from 77% to 92% for DNA and 91% to 99% for restriction sites were observed within the amplified tuf gene amino acid sequences, indicating their different origins and fragments of most enterococci. Southern blotting and filter evolution (Table 18). Since E. solitarius has been transferred hybridization were performed using positively charged nylon 40 to the genus Tetragenococcus, which is also a low G+C gram membranes (Boehringer Mannheim) and QuikHyb hybrid positive bacterium, our sequence comparison did not include ization Solution (Stratagene Cloning Systems, La Jolla, this species as an enterococcus. G+C content of enterococcal Calif.) according to the manufacturers instructions with tufA sequences ranged from 40.8% to 43.1%, while that of modifications. Twenty ul of each digestion were electro enterococcal tuf3 sequences varied from 37.8% to 46.3%. phoresed for 2 h at 120V on a 0.8% agarose gel. The DNA 45 Based on amino acid sequence comparison, the enterococcal fragments were denatured with 0.5M NaOH and transferred tufA gene products share higher identities with those of by Southern blotting onto a positively charged nylon mem Abiotrophia adiacens, Bacillus subtilis, Listeria monocyto brane (Boehringer Mannheim). The filters were pre-hybrid genes, S. aureus, and S. epidermidis. On the other hand, the ized for 15 min and then hybridized for 2 h in the QuikHyb enterococcal tufB gene products share higher percentages of solution at 68°C. with either DIG-labeled probe. Posthybrid 50 amino acid identity with the tuf genes of S. pneumoniae, S. ization washings were performed twice with 0.5xSSC, 1% pyogenes and Lactococcus lactis (Table 18). SDS at room temperature for 15 min and twice in the same In order to elucidate whether the two enterococcal tuf solution at 60° C. for 15 min. Detection of bound probes was sequences encode genuine EF-Tu, the deduced amino acid achieved using disodium 3-(4-methoxyspiro (1,2-dioxetane sequences of both genes were aligned with other EF-Tu 3.2'-(5'-chloro)tricyclo(3.3.1.17) decan)-4-yl)phenyl phos 55 sequences available in SWISSPROT (Release 38). Sequence phate (CSPD) (Boehringer Mannheim) as specified by the alignment demonstrated that both gene products are highly manufacturer. conserved and carry all conserved residues present in this GenBank submission. The GenBank accession numbers portion of prokaryotic EF-Tu (FIG. 4). Therefore, it appears for partial tufgene sequences generated in this study are given that both gene products could fulfill the function of EF-Tu. in Table 16. 60 The partial tuf gene sequences encode the portion of EF-Tu Results from residues 117 to 317, numbered as in E. coli. This portion Sequencing and nucleotide sequence analysis. In this makes up of the last four C.-helices and two f-strands of study, all gram-positive bacteria other than enterococci domain I, the entire domain II and the N-terminal part of yielded a single tufsequence of 886 bp using primers SEQID domain III on the basis of the determined structures of E. coli NOs. 664 and 697 (Table 16). Each of four enterococcal 65 EF-Tu. species including E. Cecorum, E. faecalis, E. Saccharolyticus, Based on the deduced amino acid sequences, the entero and E. solitarius also yielded one 886-bp tufsequence. On the coccal tufB genes have unique conserved residues Lys129, US 8,182,996 B2 75 76 Leu140, Ser230, and Asp234 (E. coli numbering) that are also members of three different enterococcal subgroups (E. conserved in Streptococci and L. lactis, but not in the other avium, E. faecium, and E. gallinarum species groups) and a bacteria (FIG. 4). All these residues are located in loops distinct species (E. dispar). Moreover, 16S rDNA phylogeny except for Ser230. In other bacteria the residue Ser230 is Suggests that these 11 species possessing 2 tufgenes all share substituted for highly conserved Thr, which is the 5' residue 5 a common ancestor before they further evolved to become the of the third B-strand of domain II. This region is partially modern species. Since the six other species having only one responsible for the interaction between the EF-Tu and ami copy diverged from the enterococcal lineage before that com noacyl-tRNA by the formation of a deep pocket for any of the mon ancestor, it appears that the presence of one tuf gene in 20 naturally occurring amino acids. According to our three these six species is not attributable to gene loss. dimensional model (data not illustrated), the substitution 10 Two clusters of low G+C gram-positive bacteria were Thr230->Serin domain II of EF-Tu may have little impact on observed in the phylogenetic tree of the tuf genes: one con the capability of the pocket to accommodate any amino acid. tains a majority of low G+C gram-positive bacteria and the However, the high conservation of Thr230 comparing to the other contains lactococci and streptococci. This is similar to unique Ser Substitution found only in Streptococci and 11 the finding on the basis of phylogenetic analysis of the 16S enterococci could suggest a subtle functional role for this 15 rRNA gene and the hrc.A gene coding for a unique heat-shock residue. regulatory protein. The enterococcal tufA genes branched The tuf gene sequences obtained for E. faecalis, S. aureus, with most of the low G+C gram-positive bacteria, Suggesting S. pneumoniae and S. pyogenes were compared with their that they originated from a common ancestor. On the other respective incomplete genome sequence. Contigs with more hand, the enterococcal tufB genes branched with the genera than 99% identity were identified. Analysis of the E. faecalis 20 Streptococcus and Lactococcus that form a distinct lineage genome data revealed that the single E. faecalis tuf gene is separated from other low G+C gram-positive bacteria (FIG. located within an stroperon where tufis preceded by fus that 5). The finding that these EF-Tu proteins share some con encodes the elongation factor G. This stroperon is present in served amino acid residues unique to this branch also Sup S. aureus and B. subtilis but not in the two streptococcal ports the idea that they may share a common ancestor. genomes examined. The 700-bp or so sequence upstream the 25 Although these conserved residues might result from conver S. pneumoniae tuf gene has no homology with any known gent evolution upon a specialized function, such convergence gene sequences. In S. pyogenes, the gene upstream of tufis at the sequence level, even for a few residues, seems to be rare, similar to a cell division gene, ftsW. Suggesting that the tuf making it an unlikely event. Moreover, no currently known genes in Streptococci are not arranged in a stroperon. selective pressure, if any, would account for keeping one Phylogenetic analysis. Phylogenetic analysis of the tuf 30 versus two tuf genes in bacteria. The G+C contents of entero amino acid sequences with representatives of eubacteria, coccal tufA and tufB Sequences are similar, indicating that archeabacteria, and eukaryotes using neighbor-joining and they both originated from low G+C gram-positive bacteria, in maximum parsimony methods showed three major clusters accordance with the phylogenetic analysis. representing the three kingdoms of life. Both methods gave The tuf genes are present in various copy numbers in dif similar topologies consistent with the rRNA gene data (data 35 ferent bacteria. Furthermore, the two tuf genes are normally not shown). Within the bacterial Glade, the tree is polyphyl associated with characteristic flanking genes. The two tuf etic but tufA genes from all enterococcal species always gene copies commonly encountered within gram-negative clustered with those from other low G+C gram-positive bac bacteria are part of the bacterial stroperon and tRNA-tufB teria (except for streptococci and lactococci), while the tufB operon, respectively. The arrangement of tufA in the str genes of the 11 enterococcal species form a distinct cluster 40 operon was also found in a variety of bacteria, including with streptococci and L. lactis (FIG. 5). Duplicated genes Thermotoga maritima, the most ancient bacteria sequenced from the same organism do not cluster together, thereby not So far, Aquifex aeolicus, cyanobacteria, Bacillus sp., Micro Suggesting evolution by recent gene duplication. coccus luteus, Mycobacterium tuberculosis, and Streptomy Southern hybridization. Southern hybridization of BglII/ ces sp. Furthermore, the tRNA-tufB operon has also been Xbal digested genomic DNA from 12 enterococcal species 45 identified in Aquifex aeolicus, Thermus thermophilus, and tested with the tufA probe (DIG-labeled tufA fragment from Chlamydia trachomatis. The two widespread tuf gene E. faecium) yielded two bands of different sizes in 9 species, arrangements argue in favor of their ancient origins. It is which also carried two divergent tuf sequences according to noteworthy that most obligate intracellular parasites, such as their sequencing data. For E. faecalis and E. Solitarius, a Mycoplasma sp., R. prowaZekii, B. burgdorferi, and T. palli single band was observed indicating that one tuf gene is 50 dum, contain only one tuf gene. Their flanking sequences are present (FIG. 6). A single band was also found when digested distinct from the two conserved patterns as a result of selec genomic DNA from S. aureus, S. pneumoniae, and S. pyo tion for effective propagation by an extensive reduction in genes were hybridized with the tufA probe (data not shown). genome size by intragenomic recombination and rearrange For E. faecium, the presence of three bands can be explained ment. by the existence of a Xbal restriction site in the middle of the 55 Most gram-positive bacteria with low G+C content tufA sequence, which was confirmed by sequencing data. sequenced to date contain only a single copy of the tufgene as Hybridization with the tufB probe (DIG-labeled tufB frag a part of the str operon. This is the case for B. subtilis, S. ment of E. faecium) showed a banding profile similar to the aureus and E. faecalis. PCR amplification using a primer one obtained with the tufA probe (data not shown). targeting a conserved region of the fus gene and the tufA Discussion 60 specific primer SEQ ID NO. 660, but not the tufB-specific In this study, we have shown that two divergent copies of primer SEQID NO. 661, yielded the expected amplicons for genes encoding the elongation factor Tuare present in some all 17 enterococcal species tested, indicating the presence of enterococcal species. Sequence data revealed that both genes the fus-tuf organization in all enterococci (data not shown). are highly conserved at the amino acid level. One copy (tufa) However, in the genomes of S. pneumoniae and S. pyogenes, is present in all enterococcal species, while the other (tufB) is 65 the sequences flanking the tuf genes varies although the tuf present only in 11 of the 17 enterococcal species studied. gene itself remains highly conserved. The enterococcal tufB Based on 16S rRNA sequence analysis, these 11 species are genes are clustered with Streptococci, but at present we do not US 8,182,996 B2 77 78 have enough data to identify the genes flanking the entero identification of enterococci. The enterococcal tufB genes coccal tufB genes. Furthermore, the functional role of the would also be useful in identification of these 11 enterococcal enterococcal tufB genes remains unknown. One can only species. postulate that the two divergent gene copies are expressed under different conditions. 5 Example 43 The amino acid sequence identities between the enterococ cal tufA and tuf3 genes are lower than eitheri) those between Elongation Factor Tu (Tuf) and the F-ATPase the enterococcal tufA and the tuf genes from other low G+C Beta-Subunit (atpd) as Phylogenetic Tools for gram-positive bacteria (streptococci and lactococci Species of the Family Enterobacteriaceae excluded) or ii) those between the enterococcal tufB and 10 streptococcal and lactococcal tuf genes. These findings Sug SUMMARY gest that the enterococcal tufA genes share a common ances tor with other low G+C gram-positive bacteria via the simple The phylogeny of enterobacterial species commonly found scheme of vertical evolution, while the enterococcal tufB in clinical samples was analyzed by comparing partial genes are more closely related to those of Streptococci and 15 sequences of their elongation factor Tu (tuf) genes and their lactococci. The facts that some enterococci possess an addi F-ATPase beta-subunit (atp)) genes. A 884-bp fragment for tional tufgene and that the single streptococcal tufgene is not tuf and a 884- or 871-bp fragment for atp) were sequenced clustered with other low G+C gram-positive bacteria cannot for 88 strains of 72 species from 25 enterobacterial genera. be explained by the mechanism of gene duplication or intra The atpD sequence analysis revealed a specific indel to Pan chromosomal recombination. According to sequence and toea and Tatumella species showing for the first time a tight phylogenetic analysis, we propose that the presence of the phylogenetic affiliation between these two genera. Compre additional copy of the tuf genes in 11 enterococcal species is hensive tufandatp) phylogenetic trees were constructed and due to horizontal gene transfer. The common ancestor of the are in agreement with each other. Monophyletic genera are 11 enterococcal species now carrying tuf3 genes acquired a Yersinia, Pantoea, Edwardsiella, Cedecea, Salmonella, Ser tuf gene from an ancestral Streptococcus or a streptococcus 25 ratia, Proteus, and Providencia. Analogous trees were related species during enterococcal evolution through gene obtained based on available 16S rDNA sequences from data transfer before the diversification of modern enterococci. bases. tufandatp) phylogenies are in agreement with the 16S Further study of the flanking regions of the gene may provide rDNA analysis despite the smaller resolution power for the more clues for the origin and function of this gene in entero latter. In fact, distance comparisons revealed that tufandatp) cocci. 30 genes provide a better resolution for pairs of species belong Recent studies of genes and genomes have demonstrated ing to the family Enterobacteriaceae. However, 16S rDNA that considerable horizontal transfer occurred in the evolution distances are better resolved for pairs of species belonging to of aminoacyl-tRNA synthetases in all three kingdoms of life. different families. In conclusion, tuf and atp) conserved The heterogeneity of 16S rRNA is also attributable to hori genes are sufficiently divergent to discriminate different spe Zontal gene transfer in Some bacteria, such as Streptomyces, 35 cies inside the family Enterobacteriaceae and offer potential Thermomonospora chromogena and Mycobacterium cella for the development of diagnostic tests based on DNA to tum. In this study, we provide the first example in Support of identify enterobacterial species. a likely horizontal transfer of the tuf gene encoding the elon Introduction gation factor Tu. This may be an exception since stringent Members of the family Enterobacteriaceae are faculta functional constraints do not allow for frequent horizontal 40 tively anaerobic gram-negative rods, catalase-positive and transfer of the tuf gene as with other genes. However, entero oxydase-positive (Brenner, 1984). They are found in soil, coccal tuf genes should not be the only Such exception as we water, plants, and in animals from insects to man. Many have noticed that the phylogeny of Streptomyces tuf genes is enterobacteria are opportunistic pathogens. In fact, members equally or more complex than that of enterococci. For of this family are responsible for about 50% of nosocomial example, the three tuf-like genes in a high G+C gram-positive 45 infections in the United States (Brenner, 1984). Therefore, bacterium, S. ramocissimus, branched with the tuf genes of this family is of considerable clinical importance. phylogenetically divergent groups of bacteria (FIG. 5). Major classification studies on the family Enterobacteri Another example may be the tuf genes in clostridia, which aceae are based on phenotypic traits (Brenner et al., 1999; represent a phylogenetically very broad range of organisms Brenner et al., 1980; Dickey & Zumoff, 1988: Farmer III et and form a plethora of lines and groups of various complexi 50 al., 1980: Farmer III et al., 1985b; Farmer III et al., 1985a) ties and depths. Four species belonging to three different Such as biochemical reactions and physiological characteris clusters within the genus Clostridium have been shown by tics. However, phenotypically distinct strains may be closely Southern hybridization to carry two copies of the tuf gene. related by genotypic criteria and may belong to the same Further sequence data and phylogenetic analysis may help genospecies (Bercovier et al., 1980; Hartl & Dykhuizen, interpreting the evolution of the elongation factor Tu in these 55 1984). Also, phenotypically close strains (biogroups) may gram-positive bacteria. Since the tuf genes and 16S rRNA belong to different genospecies, like Klebsiella pneumoniae genes are often used for phylogenetic study, the existence of and Enterobacter aerogenes (Brenner, 1984) for example. duplicate genes originating from horizontal gene transfer Consequently, identification and classification of certain spe may alter the phylogeny of microorganisms when the later cies may be ambiguous with techniques based on phenotypic ally acquired copy of the gene is used for Such analysis. 60 tests (Janda et al., 1999; Kitch et al., 1994; Sharma et al., Hence, caution should be taken in interpreting phylogenetic 1990). data. In addition, the two tuf genes in enterococci have More advances in the classification of members of the evolved separately and are distantly related to each other family Enterobacteriaceae have come from DNA-DNA phylogenetically. The enterococcal tufB genes are less con hybridization studies (Brenner et al., 1993: Brenner et al., served and unique to the 11 enterococcal species only. We 65 1986; Brenner, et al., 1980; Farmer III, et al., 1980; Farmer previously demonstrated that the enterococcal tufA genes III, et al., 1985b; Izard et al., 1981; Steigerwalt et al., 1976). could serve as a target to develop a DNA-based assay for Furthermore, the phylogenetic significance of bacterial clas US 8,182,996 B2 79 80 sification based on 16S rDNA sequences has been recognized enterobacteria difficult to amplify with the first primer set. by many workers (Stackebrandt & Goebel, 1994; Wayne et When required, the primers contained inosines or degenera al., 1987). However, members of the family Enterobacteri cies to account for variable positions. Oligonucleotide prim aceae have not been Subjected to extensive phylogenetic ers were synthesized with a model 394 DNA/RNA synthe analysis of 16S rDNA (Sproer et al., 1999). In fact, this sizer (PE Applied Biosystems). PCR primers used in this molecule was not thought to solve taxonomic problems con study are listed in Table 20. cerning closely related species because of its very high degree DNA sequencing. An 884-bpportion of the tufgene and an of conservation (Brenner, 1992; Sproer, et al., 1999). Another 884-bp portion (or alternatively an 871-bp portion for a few drawback of the 16S rDNA gene is that it is found in several enterobacterial strains) of the atpD gene were sequenced for copies within the genome (seven in Escherichia coli and 10 Salmonella typhimurium) (Hill & Harnish, 1981). Due to all enterobacterialisted in the first strain column of Table 19. sequence divergence between the gene copies, direct Amplification was performed with 4 ng of genomic DNA. sequencing of PCR products is often not suitable to achieve a The 40-ul PCR mixtures used to generate PCR products for representative sequence (Cilia et al., 1996; Hill & Harnish, sequencing contained 1.0 LM each primer, 200 LM each 1981). Other genes such as gap and ompA (Lawrence et al., 15 deoxyribonucleoside triphosphate (Pharmacia Biotech), 10 1991), rpoB (Mollet et al., 1997), and infB (Hedegaard et al., mM Tris-HCl (pH 9.0 at 25° C.), 50 mM KC1, 0.1% (w/v) 1999) were used to resolve the phylogeny of enterobacteria. Triton X-100, 2.5 mM MgCl, 0.05 mM BSA, 0.3 U of Taq However, none of these studies covered an extensive number DNA polymerase (Promega) coupled with TaqStartTM anti of species. body (Clontech Laboratories). The TaqStartTM neutralizing tuf and atp) are the genes encoding the elongation factor monoclonal antibody for Taq DNA polymerase was added to Tu (EF-Tu) and the F-ATPase beta-subunit, respectively. EF all PCR mixtures to enhance efficiency of amplification Tu is involved in peptide chain formation (Ludwig et al., (Kellogg et al., 1994). The PCR mixtures were subjected to 1990). The two copies of the tuf gene (tufa and tufB) found thermal cycling (3 min at 95°C. and then 35 cycles of 1 min in enterobacteria (Sela et al., 1989) share high identity level at 95°C., 1 min at 55° C. for tufor 50° C. for atpD, and 1 min (99%) in Salmonella typhimurium and in E. coli. The recom 25 at 72° C., with a 7-min final extension at 72° C.) using a bination phenomenon could explain sequence homogeniza PTC-200 DNA Engine thermocycler (MJ Research). PCR tion between the two copies (Abdulkarim & Hughes, 1996; products having the predicted sizes were recovered from an Grunberg-Manago, 1996). F-ATPase is present on the plasma agarose gel stained for 15 min with 0.02% of methylene blue membranes of eubacteria (Nelson & Taiz, 1989). It functions followed by washing insterile distilled water for 15 mintwice mainly in ATP synthesis (Nelson & Taiz, 1989) and the beta 30 (Flores et al., 1992). Subsequently, PCR products having the subunit contains the catalytic site of the enzyme. EF-Tu and F-ATPase are highly conserved throughout evolution and predicted sizes were recovered from gels using the QIAquick shows functional constancy (Amann et al., 1988; Ludwig, et gel extraction kit (QIAGEN). al., 1990). Recently, phylogenies based on protein sequences Both Strands of the purified amplicons were sequenced from EF-Tu and F-ATPase beta-subunit showed good agree 35 using the ABI Prism BigDye Terminator Cycle Sequencing ment with each other and with the rDNA data (Ludwig et al., Ready Reaction Kit (PE Applied Biosystems) on an auto 1993). mated DNA sequencer (Model 377). Amplicons from two We elected to sequence 884-bp fragments of tuf and atpD independent PCR amplifications were sequenced for each from 88 clinically relevant enterobacterial strains represent strain to ensure the absence of sequencing errors attributable ing 72 species from 25 genera. These sequences were used to 40 to nucleotide miscorporations by the Taq DNA polymerase. create phylogenetic trees that were compared with 16S rDNA Sequence assembly was performed with the aid of trees. These trees revealed good agreement with each others Sequencher 3.0 software (Gene Codes). and demonstrated the high resolution of tuf and atpD phylog Phylogenetic analysis. Multiple sequence alignments were enies at the species level. performed using PileUp from the GCG package (Version Materials and Methods 45 10.0) (Genetics Computer Group) and checked by eye with Bacterial strains and genomic material. Allbacterial Strains the editor SeqLab to edit sequences if necessary and to note used in this study were obtained from the American Type which regions were to be excluded for phylogenetic analysis. Culture Collection (ATCC) or the Deutsche Sammlung von Vibrio cholerae and Shewanella putrefaciens were used as Mikroorganismen and Zellkulturen GmbH (DSMZ). These outgroups. Bootstrap Subsets (750 sets) and phylogenetic enterobacteria can all be recovered from clinical specimens, 50 trees were generated with the Neighbor Joining algorithm but not all are pathogens. Whenever possible, we choose type from Dr. David Swofford's PAUP (Phylogenetic Analysis strains. Identification of all Strains was confirmed by classical Using Parsimony) Software version 4.0b4 (Sinauer Associ biochemical tests using the automated System MicroScan ates) and with tree-bisection branch-Swapping. The distance WalkAway-96 system equipped with a Negative BP Combo model used was Kimura (1980) two-parameter. Relative rate Panel Type 15 (Dade Behring Canada). Genomic DNA was 55 test was performed with the aid of Phyltest program version purified using the GNOME DNA kit (Bio 101). Genomic 2.0 (c). DNA from Yersinia pestis was kindly provided by Dr. Robert Results and Discussion R. Brubaker. Strains used in this study and their descriptions DNA Amplification, Sequencing And Sequence Alignments are shown in Table 19. A PCR product of the expected size of 884 bp was obtained PCR primers. The eubacterial tuf and atp) gene sequences 60 for tuf and of 884 or 871 bp for atp) from all bacterial strains available from public databases were analyzed using the tested. After Subtracting for biased primer regions and GCG package (version 8.0) (Genetics Computer Group). ambiguous single strand data, sequences of at least 721 bp for Based on multiple sequence alignments, two highly con tuf and 713 bp for atp) were submitted to phylogenetic served regions were chosen for each genes, and PCR primers analyses. These sequences were aligned with tuf and atpD were derived from these regions with the help of Oligo primer 65 sequences available in databases to verify that the nucleotide analysis software (version 5.0) (National Biosciences). A sec sequences indeed encoded a part of tested genes. Gaps were ond 5' primer was design to amplify the gene atpl) for few excluded to perform phylogenetic analysis. US 8,182,996 B2 81 82 Signature Sequences Escherichia fergusonii is very close to E. coli-Shigella From the sequence alignments obtained from both tested genetic species. This observation is corroborated by 16S genes, only one insertion was observed. This five amino acids rDNA phylogeny (McLaughlin et al., 2000) but not by DNA insertion is located between the positions 325 and 326 of atpl) hybridization values. In fact, E. fergusonii is only 49% to 63% gene of E. coli strain K-12 (Saraste et al., 1981) and can be 5 related to E. coli-Shigella (Farmer III, et al., 1985b). It was considered a signature sequence of Tatumella ptyseos and previously observed that very recently diverged species may Pantoea species (FIG. 7). The presence of a conserved indel not be recognizable based on 16S rDNA sequences although of defined length and sequence and flanked by conserved DNA hybridization established them as different species (Fox regions could suggest a common ancestor, particularly when et al., 1992). Therefore, E. fergusonii could be a new “quasi members of a given taxa share this indel (Gupta, 1998). To our 10 species'. knowledge, high relatedness between the genera Tatumella and Pantoea is demonstrated for the first time. atpD phylogeny revealed Salmonella Subspecies divisions Enterobacter agglomerans ATCC 27989 sequence does consistent with the actual taxonomy. This result was already not possess the five amino acid indel (FIG. 7). This indel observed by Christensen et al. (Christensen & Olsen, 1998). could represent a useful marker to help resolve the Entero 15 Nevertheless, tuf partial sequences discriminate less than bacter agglomerans and Pantoea classification. Indeed, the atp) between Salmonella subspecies. transfer of Enterobacter agglomerans to Pantoea agglomer Overall, tuf and atpl) phylogenies exhibit enough diver ans was proposed in 1989 bp Gavini et al. (Gavini et al., gence between species to ensure efficient discrimination. 1989). However, some strains are provisionally classified as Therefore, it could be easy to distinguish phenotypically Pantoea sp. until their interrelatedness is elucidated (Gavini, close enterobacteria belonging to different genetic species et al., 1989). Since the transfer was proposed, the change of Such as Klebsiella pneumoniae and Enterobacter aerogenes. nomenclature has not yet been made for all Enterobacter Phylogenetic relationships between Salmonella, E. coli agglomerans in the ATCC database. The absence of the five and C. freundii are not well defined. 16S rDNA and 23S amino acids indel Suggests that Some strains of Enterobacter rDNA sequence data reveals a closer relationship between agglomerans most likely do not belong to the genus Pantoea. 25 Salmonella and E. coli than between Salmonella and C. fre Phylogenetic Trees Based On Partial Tuf Sequences, atpl) undii (Christensen et al., 1998), while DNA homology stud Sequences, and Published 16S Rdna Data of Members of the ies (Selander et al., 1996) and infB phylogeny (Hedegaard, et Enterobacteriaceae. al., 1999) showed that Salmonella is more closely related to Representative trees constructed from tuf and atpD C. freundii than to E. coli. In that regard, tuf and atp) phy sequences with the neighbor-joining method are shown in 30 logenies are coherent with 16S rDNA and 23S rDNA FIG. 8. The phylogenetic trees generated from partial tuf sequence analysis. sequences and atp) sequences are very similar. Nevertheless, Phylogenetic analyses were also performed using amino atpD tree shows more monophyletic groups corresponding to acids sequences. tuftree based on amino acids is character species that belong to the same genus. These groups are more ized by a better resolution between taxa outgroup and taxa consistent with the actual taxonomy. For both genes, some 35 ingroup (enterobacteria) than tree based on nucleic acids genera are not monophyletic. These results support previous whereas atpD trees based on amino acids and nucleic acids phylogenies based on the genes gap and ompA (Lawrence, et give almost the same resolution between taxa outgroup and al., 1991), rpoB (Mollet, et al., 1997), and infB (Hedegaard, et ingroup (data not shown). al., 1999) which all showed that the genera Escherichia and Relative rate test (or two cluster test (Takezaki et al., 1995)) Klebsiella are polyphyletic. There were few differences in 40 evaluates if evolution is constant between two taxa. Before to branching between tuf and atp genes. apply the test, the topology of a tree is determined by tree Even though Pantoea agglomerans and Pantoea dispersa building method without the assumption of rate constancy. indels were excluded for phylogenetic analysis, these two Therefore, two taxa (or two groups of taxa) are compared with species grouped together and were distant from Enterobacter a third taxon that is an outgroup of the first two taxa (Takezaki, agglomerans ATCC 27989, adding another evidence that the 45 et al., 1995). Few pairs of taxa that exhibited a great difference latter species is heterogenous and that not all members of this between their branch lengths at particular nodes were chosen species belong to the genus Pantoea. In fact, the E. agglom to perform the test. This test reveals that tuf and atp) are not erans strain ATCC 27989 exhibits branch lengths similar to constant in their evolution within the family Enterobacteri others Enterobacter species with both genes. Therefore, we aceae. For tuf, for example, the hypothesis of rate constancy Suggest that this strain belong to the genus Enterobacter until 50 is rejected (Z value higher than 1.96) between Yersinia spe further reclassification of that genus. cies. The same is true for Proteus species. For atp), for tuf and atpd trees exhibit very short genetic distances example, evolution is not constant between Proteus species, between taxa belonging to the same genetic species including between Proteus species and Providencia species, and species segregated for clinical considerations. This first con between Yersinia species and Escherichia coli. For 16S cern E. coli and Shigella species that were confirmed to be the 55 rDNA, for example, evolution is not constant between two E. same genetic species by hybridization studies (Brenner et al., coli, between E. coli and Enterobacter aerogenes, and 1972; Brenner et al., 1972; Brenner et al., 1982) and phylog between E. coli and Proteus vulgaris. These results suggest enies based on 16S rDNA (Wang et al., 1997) and rpoB genes that tuf, atpD and 16S rDNA could not serve as a molecular (Mollet, et al., 1997). Hybridization studies (Bercovier, et al., clock for the entire family Enterobacteriaceae. 1980) and phylogeny based on 16S rDNA genes (Ibrahim et 60 Since the number and the nature of taxa can influence al., 1994) demonstrated also that Yersinia pestis and Y topology of trees, phylogenetic trees from tuf and atp) were pseudotuberculosis are the same genetic species. Among reconstructed using sequences corresponding to strains for Yersinia pestis and Y. pseudotuberculosis, the three Klebsiella which 16S rDNA genes were published in GenEMBL. These pneumoniae Subspecies, E. coli-Shigella species, and Salmo trees were similar to those generated using 16S rDNA (FIG. nella choleraesuis Subspecies, Salmonella is a less tightly knit 65 9). Nevertheless, 16S rDNA tree gave poorer resolution species than the other genetic species. The same is true for E. power than tufandatp gene trees. Indeed, these latter exhib coli and Shigella species. ited less multifurcation (polytomy) than the 16S rRNA tree. US 8,182,996 B2 83 84 Comparison of Distances Based on tuf, atpl), and 16S rDNA Example 44 Data. tuf, atpl), and 16S rDNA distances (i.e. the number of Testing New Pairs of PCR Primers Selected from differences per nucleotide site) were compared with each Two Species-Specific Genomic DNA Fragments other for each pair of strains. We found that the tuf and atpl) 5 which are Objects of Our Assigned U.S. Pat. No. distances were respectively 2.268+0.965 and 2.927+0.896 6,001,564 times larger than 16S rDNA distances (FIG.10a and b). atpl) Objective. The goal of these experiments is to demonstrate distances were 1.445+0.570 times larger than tuf distances that it is relatively easy for a person skilled in the art to find (FIG. 10c). FIG. 10 also shows that the tuf, atp|D, and 16S 10 other PCR primer pairs from the species-specific fragments rDNA distances between members of different species of the used as targets for detection and identification of a variety of same genus (0.053+0.034, 0.060+0.020, and 0.024+0.010, microorganisms. In fact, we wish to prove that the PCR prim respectively) were in mean Smaller than the distances ers previously tested by our group and which are objects of between members of different genera belonging to the same the present patent application are not the only possible good family (0.103+0.053, 0.129-0.051, and 0.044+0.013, respec 15 choices for diagnostic purposes. For this example, we used tively). However, the overlap exhibits with standard devia diagnostic targets described in our assigned U.S. Pat. No. tions add to a focus of evidences that some enterobacterial 6,001,564. genera are not well defined (Brenner, 1984). In fact, many Experimental strategy. We have selected randomly two distances for pairs of species especially belonging to the species-specific genomic DNA fragments for this experi genera Escherichia, Shigella, Enterobacter, Citrobacter, ment. The first one is the 705-bp fragment specific to Staphy Klebsiella, and Kluyvera overlap distances for pairs of spe lococcus epidermidis (SEQ ID NO: 36 from U.S. Pat. No. cies belonging to the same genus (FIG. 10). For example, 6,001.564) while the second one is the 466-bp fragment spe distances for pairs composed by species of Citrobacter and cific to Moraxella catarrhalis (SEQID NO: 29 from U.S. Pat. species of Klebsiella overlap distances for pairs composed by No. 6,001.564). Subsequently, we have selected from these 25 two fragments a number of PCR primer pairs other than those two Citrobacter or by two Klebsiella. previously tested. We have chosen 5 new primer pairs from Observing the distance distributions, 16S rDNA distances each of these two sequences which are well dispersed along reveal a clear separation between the families Enterobacteri the DNA fragment (FIGS. 11 and 12). We have tested these aceae and Vibrionaceae despite the fact that the family Vibri primers for their specificity and compared them with the onaceae is genetically very close to the Enterobacteriaceae 30 original primers previously tested. For the specificity tests, (FIG. 10a and b). Nevertheless, tuf and atpl) show higher we have tested all bacterial species closely related to the target discriminating power below the family level (FIG.10a and b). species based on phylogenetic analysis with three conserved There were some discrepancies in the relative distances for genes (rRNA genes, tuf and atpd). The rational for selecting the same pairs of taxa between the two genes studied. First, a restricted number of bacterial species to evaluate the speci 35 ficity of the new primer pairs is based on the fact that the lack distances between Yersinia species are at least two times of specificity of a DNA-based assay is attributable to the lower for atpl) than for tuf (FIG. 10c). Also, distances at the detection of closely related species which are more similar at family level (between Enterobacteriaceae and Vibrionaceae) the nucleotide level. Based on the phylogenetic analysis, we show that Enterobacteriaceae is a tightlier knit family with have selected (i) species from the closely related genus Sta atpD gene (Proteus genus excepted) than with tuf gene. Both 40 phylococcus, Enterococcus, Streptococcus and Listeria to genes well delineate taxa belonging to the same species. test the specificity of the S. epidermidis-specific PCR assays There is one exception with atp): Klebsiella planticola and and (ii) Species from the closely related genus Moraxella, K. Ornithinolithica belong to the same genus but fit with taxa Kingella and Neisseria to test the specificity of the M. belonging to the same species (FIG. 10a and c). These two catarrhalis-specific PCR assays. species are also very close genotypically with tuf gene. This 45 Materials and Methods Suggest that Klebsiella planticola and K. Ornithinolithica Bacterial strains. All bacterial strains used for these experi could be two newborn species. tuf and atp genes exhibit ments were obtained from the American Type Culture Col little distances between Escherichiafergusonii and E. coli lection (ATCC, Rockville, Md.). Shigella species. Unfortunately, comparison with 16S rDNA Genomic DNA isolation. Genomic DNA was purified from could not be achieved because the E. fergusonii 16S rDNA 50 the ATCC reference strains by using the G-nome DNA kit sequence is not yet accessible in GenEMBL database. There (Bio 101 Inc., Vista, Calif.). fore, the majority of phenotypically close enterobacteria Oligonucleotide design and synthesis. PCR primers were could be easily discriminated genotypically using tuf and designed with the help of the OligoTM primer analysis soft atpD gene sequences. ware Version 4.0 (National Biosciences Inc., Plymouth, 55 Minn.) and synthesized using a model 391 DNA synthesizer In conclusion, tufand atpD genes exhibit phylogenies con (Applied Biosystems, Foster City, Calif.). sistent with 16S rDNA genes phylogeny. For example, they PCR assays. All PCR assays were performed by using reveal that the family Enterobacteriaceae is monophyletic. genomic DNA purified from reference strains obtained from Moreover, tuf and atp) distances provide a higher discrimi the ATCC. One ul of purified DNA preparation (containing nating power than 16S rDNA distances. In fact, tuf and atpl) 60 0.01 to 1 ng of DNA per ul) was added directly into the PCR genes discriminate well between different genospecies and reaction mixture. The 20 uL PCR reactions contained final are conserved between strains of the same genetic species in concentrations of 50 mM KC1, 10 mM Tris-HCl (pH 9.0), Such a way that primers and molecular probes for diagnostic 0.1% Triton X-100, 2.5 mM MgCl, 0.4 uM of each primer, purposes could be designed. Preliminary studies Support 200 uM of each of the four dNTPs and 0.5 unit of Taq DNA these observations and diagnostic tests based on tuf and atp) 65 polymerase (Promega, Madison, Wis.) combined with the sequence data to identify enterobacteria are currently under TaqStartTM antibody (Clontech Laboratories Inc., Palo Alto, development. Calif.). An internal control was integrated into all amplifica US 8,182,996 B2 85 86 tion reactions to verify the efficiency of the amplification mize by modifying critical variables Such as the annealing reaction as well as to ensure that significant PCR inhibition temperature to attain the desired specificity and sensitivity. was absent. Primers amplifying a region of 252 bp from a Consequently, we consider that it is legitimate to claim any control plasmid added to each amplification reaction were possible primer sequences selected from the species-specific used to provide the internal control. PCR reactions were then fragment and that it would be unfair to grant only the claims subjected to thermal cycling (3 min at 95°C. followed by 30 dealing with the primer pairs previously tested. By extrapo cycles of 1 second at 95°C. for the denaturation step and 30 lation, these results strongly suggest that it is also relatively seconds at 50 to 65° C. for the annealing-extension step) easy for a person skilled in the art to select, from the species using a PTC-200 thermal cycler (MJ Research Inc., Water specific DNA fragments, DNA probes suitable for diagnostic town, Mass.). PCR amplification products were then ana 10 lyzed by standard agarose gel (2%) electrophoresis. Ampli purposes other than those previously tested. fication products were visualized in agarose gels containing Example 45 0.25 ug/mL of ethidium bromide under UV at 254 nm. Results Testing Modified Versions of PCR Primers Derived Tables 21 and 22 show the results of specificity tests with 15 the 5 new primer pairs selected from SEQID NO: 29 (specific from the Sequence of Several Primers which are to M. catarrhalis from U.S. Pat. No. 6,001,564) and SEQID Objects of U.S. Pat. No. 6,001,564. NO:36 (specific to S. epidermidis from U.S. Pat. No. 6,001, 564), respectively. In order to evaluate the performance of Objective. The purpose of this project is to verify the effi these new primers pairs, we compared them in parallel with ciency of amplification by modified PCR primers derived the original primer pairs previously tested. from primers previously tested. The types of primer modifi For M. catarrhalis, all of the 5 selected PCR primer pairs cations to be tested include (i) variation of the sequence at one were specific for the target species because none of the or more nucleotide positions and (ii) increasing or reducing closely related species could be amplified (Table 21). In fact, the length of the primers. For this example, we used diagnos the comparison with the original primer pair SEQ ID NO: 25 tic targets described in U.S. Pat. No. 6,001,564. 118+SEQ ID NO: 119 (from U.S. Pat. No. 6,001,564) Experimental Strategy: revealed that all new pairs showed identical results in terms of Testing Primers with Nucleotide Changes specificity and sensitivity thereby suggesting their Suitability We have designed 13 new primers which are derived from for diagnostic purposes. the S. epidermidis-specific SEQ ID NO: 146 from U.S. Pat. For S. epidermidis, 4 of the 5 selected PCR primer pairs 30 No. 6,001,564 (Table 23). These primers have been modified were specific for the target species (Table 22). It should be at one or more nucleotidepositions. As shown in Table 23, the noted that for 3 of these four primer pairs the annealing nucleotide changes were introduced all along the primer temperature had to be increased from 55° C. to 60 or 65° C. to sequence. Furthermore, instead of modifying the primer at attain specificity for S. epidermidis. Again the comparison any nucleotide position, the nucleotide changes were intro with the original primer pair SEQID NO: 145+SEQ ID NO: 35 duced at the third position of each codon to better reflect 146 (from U.S. Pat. No. 6,001,564) revealed that these four potential genetic variations in vivo. It should be noted that no primer pairs were as good as the original pair. Increasing the nucleotide changes were introduced at the 3' end of the oli annealing temperature for the PCR amplification is well gonucleotide primers because those skilled in the art are well known by persons skilled in the art to be a very effective way aware of the fact that mimatches at the 3' end should be to improve the specificity of a PCR assay (Persing et al., 1993, 40 Diagnostic Molecular Microbiology: Principles and Applica avoided (Persing et al., 1993, Diagnostic Molecular Micro tions, American Society for Microbiology, Washington, D.C.; biology: Principles and Applications, American Society for Ehrlich and Greenberg, 1994, PCR-based Diagnostics in Microbiology, Washington, D.C.). All of these modified Infectious Disease, Blackwell Scientific Publications, Bos primers were tested in PCR assays in combination with SEQ ton, Mass.). In fact, those skilled in the art are well aware of 45 ID NO: 145 from U.S. Pat. No. 6,001,564 and the efficiency the fact that the annealing temperature is critical for the opti of the amplification was compared with the original primer mization of PCR assays. Only the primer pair VBsep3+VB pair SEQID NO: 145+SEQID NO: 146 previously tested in sepa amplified bacterial species other than S. epidermidis U.S. Pat. No. 6,001,564. including the staphylococcal species S. capitis, S. cohnii, S. Testing Shorter or Longer Versions of Primers aureus, S. haemolyticus and S. hominis (Table 22). For this 50 We have designed shorter and longer versions of the origi non-specific primer pair, increasing the annealing tempera nal S. epidermidis-specific PCR primer pair SEQ ID NO: ture from 55 to 65° C. was not sufficient to attain the desired 145+146 from U.S. Pat. No. 6,001,564 (Table 24) as well as specificity. One possible explanation for the fact that it shorter versions of the original Paeruginosa-specific primer appears sligthly easier to select species-specific primers for pair SEQID NO: 83+84 from U.S. Pat. No. 6,001,564 (Table M. catarrhalis than for S. epidermidis is that M. catarrhalis is 55 25). As shown in Tables 24 and 25, both primers of each pair more isolated in phylogenetic trees than S. epidermidis. The were shortened or lengthen to the same length. Again, those large number of coagulase negative staphylococcal species skilled in the art know that the melting temperature of both Such as S. epidermidis is largely responsible for this phylo primers from a pair should be similar to avoid preferential genetic clustering. binding at one primer binding site which is detrimental in 60 PCR (Persing et al., 1993, Diagnostic Molecular Microbiol Conclusion ogy: Principles and Applications, American Society for Microbiology, Washington, D.C.; Ehrlich and Greenberg, These experiment clearly show that it is relatively easy for 1994, PCR-based Diagnostics in Infectious Disease, Black a person skilled in the art to select, from the species-specific well Scientific Publications, Boston, Mass.). All of these DNA fragments selected as target for identification, PCR 65 shorter or longer primer versions were tested in PCR assays primer pairs suitable for diagnostic purposes other than those and the efficiency of the amplification was compared with the previously tested. The amplification conditions can be opti original primer pair SEQID NOs 145 and 146. US 8,182,996 B2 87 88 Materials and Methods Conclusion See the Materials and methods section of Example 44. Results Testing Primers with Nucleotide Changes Testing Primers with Nucleotide Changes The results of the PCR assays with the 13 modified ver The above experiments clearly show that PCR primers may sions of SEQ ID NO: 146 from U.S. Pat. No. 6,001,564 are be modified at one or more nucleotide positions without shown in Table 23. The 8 modified primers having a single affecting the specificity and the sensitivity of the PCR assay. nucleotide variation showed an efficiency of amplification These results strongly suggest that a given oligonucleotide identical to the original primer pair based on testing with 3 can detect variant genomic sequences from the target species. different dilutions of genomic DNA. The four primers having 10 In fact, the nucleotide changes in the selected primers were two nucleotide variations and primer VBmut 12 having 3 purposely introduced at the third position of each codon to nucleotide changes also showed PCR results identical to mimic nucleotide variation in genomic DNA. Thus we con those obtained with the original pair. Finally, primer clude that it is justified to claim “a variant thereof for i) the VBmut13 with four nucleotide changes showed a reduction in SEQ IDs of the fragments and oligonucleotides which are sensitivity by approximately one log as compared with the 15 object of the present patent application and ii) genomic vari original primer pair. However, reducing the annealing tem ants of the target species. perature from 55 to 50° C. gave an efficiency of amplification Testing Shorter or Longer Versions of Primers very similar to that observed with the original primer pair The above experiments clearly show that PCR primers may (Table 23). In fact, reducing the annealing temperature of be shorter or longer without affecting the specificity and the PCR cycles represents an effective way to reduce the strin sensitivity of the PCR assay. We have showed that oligonucle gency of hybridization for the primers and consequently otides ranging in sizes from 13 to 30 nucleotides may be as allows the binding of probes with mismatches (Persing et al., specific and sensitive as the original primer pair from which 1993, Diagnostic Molecular Microbiology: Principles and they were derived. Consequently, these results suggest that it Applications, American Society for Microbiology, Washing 25 is not exaggerated to claim sequences having at least 12 ton, D.C.). Subsequently, we have confirmed the specificity nucleotide in length. of the PCR assays with each of these 13 modified versions of SEQID NO: 146 from U.S. Pat. No. 6,001,564 by performing This invention has been described herein above, and it is amplifications from all bacterial species closely related to S. readily apparent that modifications can be made thereto with epidermidis which are listed in Table 22. 30 out departing from the spirit of this invention. These modifi Testing Shorter or Longer Versions of Primers cations are under the scope of this invention, as defined in the For these experiments, two primer pairs were selected: i) appended claims. SEQID NO: 145+146 from U.S. Pat. No. 6,001,564 (specific TABLE 1 to S. epidermidis) which are AT rich and ii) SEQ ID NO: 35 83+84 (specific to P. aeruginosa) which are GC rich. For the Distribution (%) of nosocomial pathogens for various human infections in AT rich sequence, primers of 15 to 30 nucleotide in length USA (1990-1992)". were designed (Table 24) while for the GC rich sequences, primers of 13 to 19 nucleotide in length were designed (Table Pathogen UTI SSI BSI Pneumonia CSF 25). 40 Escherichia coi 2 Table 24 shows that, for an annealing temperature of 55° Staphylococcusatiretts 2 2 Staphylococci is epidermidis s C., the 30-25-20- and 17-nucleotide versions of SEQID NO: Enterococci is faecalis 1 1 145 and 146 from U.S. Pat. No. 6,001,564 all showed iden Enterococci is faecium tical results as compared with the original primer pair except Pseudomonas aeruginosa 1 1 that the 17-nucleotide version amplified slightly less effi 45 Klebsiella pneumoniae ciently the S. epidermidis DNA. Reducing the annealing tem Proteus mirabilis Streptococci is pneumoniae 1 perature from 55 to 45° C. for the 17-nucleotide version Group B Streptococci allowed to increase the amplification efficiency to a level very Other streptococci similar to that with the original primer pair (SEQ ID NO: Haemophilus influenzae 45 145+146 from U.S. Pat. No. 6,001,564). Regarding the 50 Neisseria meningitidis 1 15-nucleotide version, there was amplification of S. epider Listeria monocytogenes midis DNA only when the annealing temperature was Other enterococci Other staphylococci 1 reduced to 45° C. Under those PCR conditions the assay Candida albicans remained S. epidermidis-specific but the amplification signal 55 Other Candida with S. epidermidis DNA was sligthly lower as compared Enterobacter sp. 1 with the original primer pair. Subsequently, we have further Acinetobacter sp. confirmed the specificity of the shorter or longer versions by Citrobacter sp. Serraia marcescens amplifying DNA from all bacterial species closely related to Other Kiebsielia S. epidermidis which are listed in Table 22. 60 Others Table 25 shows that, for an annealing temperature of 55° C., all shorter versions of SEQID NO: 83 and 84 from U.S. 'Data recorded by the National Nosocomial Infections Surveillance (NNIS) from 80 hos itals (Emori and Gaynes, 1993, Cin. Microbiol. Rev, 6:428-442). Pat. No. 6,001.564 showed identical PCR results as compared Urinary tract infection. with the original primer pair. As expected, these results show Surgical site infection. that it is simpler to reduce the length of GC rich as compared 65 'Bloodstream infection. with AT rich. This is attributable to the fact that GC binding is Cerebrospinal fluid. more stable than AT binding. US 8,182,996 B2 89 90 TABLE 2 TABLE 4-continued Distribution (%) of bloodstream infection pathogens in Quebec Example of microbial species for which tuf and/or atpD and/or recA 1995), Canada (1992), UK (1969-1988) and USA (1990-1992). nucleic acids and/or sequences are used in the present invention. UK3 USA4 5 Actinomyces meyeri Aerococcus viridans Community- Hospital- Hospital- Aeromonas hydrophila Organism Quebec Canada acquired acquired acquired Aeromonas Salmonicida Agrobacterium radiobacter E. coi 15.6 53.8 24.8 20.3 S.O Agrobacterium timefaciens S. epidermitis and 25.8 O.S 7.2 31.0 10 Alcaligenes faecalis Subsp. faecalis other CoNS Aiochromatium vinosum S. airetts 9.6 9.7 19.4 16.0 Anabaena variabilis S. pneumoniae 6.3 22.5 2.2 Anacystis nidulans E. faecalis 3.0 1.O 4.2 Anaerorhabdits firCostis E. faecium 2.6 O.2 O.S Aquifex aeolicits Enterococci is sp. 9.0 15 Aquifex pyrophilus H. influenzae 1.5 3.4 0.4 Arcanobacterium haemolyticum Paeruginosa 1.5 8.2 1.O 8.2 3.0 Archaeoglobits filgidus K. pneumoniae 3.0 11.2 3.0 9.2 4.0 Azotobacter vineiandi P. mirabilis 3.9 2.8 5.3 1.O Bacilius anthracia S. pyogenes 1.9 O.9 Bacilius cereus Enterobacter sp. 4.1 5.5 O.S 2.3 4.0 Bacilius firmus Candida sp. 8.5 1.O so 20 Bacilius halodurans Others 18.S 17.4 28.7 18.9 19.0 Bacilius negaterium Bacilius mycoides 'Data obtained for 270 isolates collected at the Centre Hospitalier de l’Universite Laval Bacilius pseudomycoides SHUL) during a 5 month period (May to October 1995). Bacilius Stearothermophilus Data from 10 hospitals throughout Canada representing 941 gram-negative isolates, Bacilius subtiis Shamberland et al., 1992, Cin. Infect. Dis., 15:615-628). 25 Data from a 20-year study (1969-1988) for nearly 4000 isolates. (Eykyn et al., 41990, J. Bacilius thuringiensis Antimicrob. Chemother, Suppl. C, 25:41-58). Bacilius weihenstephanensis 'Data recorded by the National Nosocomial Infections Surveillance (NNIS) from 80 hos Bacteroides distasonis g (Emoriand Gaynes, 1993, Clin. Microbiol. Rev, 6:428-442). Bacteroides fragilis oagulase-negative Staphylococci. Bacteroides forsythus Bacteroides ovatus 30 Bacteroides vulgatus TABLE 3 Bartoneia henseiae Bifidobacterium adolescentis Distribution of positive and negative clinical specimens tested at the Bifidobacterium breve microbiology laboratory of the CHUL (February 1994-January 1995). Bifidobacterium dentium Bifidobacterium longum Clinical No. of % of % of 35 Biastochioris viridis specimens samples positive negative Borrelia burgdorferi and/or sites tested (%) specimens specimens Bordeteila peritissis Bordeteila bronchiseptica Urine 17,981 (54.5) 19.4 80.6 Bruceiia abortus Blood culture? marrow 10,010 (30.4) 6.9 93.1 Brevibacterium inens Sputum 1,266 (3.8) 68.4 31.6 Brevibacterium flavum Superficial pus 1,136 (3.5) 72.3 27.7 40 Brevundimonas diminuta Cerebrospinal fluid 553 (1.7) 1.O 99.0 Buchnera aphidicola Synovial fluid 523 (1.6) 2.7 97.3 Budvicia aquatica Respiratory tract 502 (1.5) 56.6 43.4 Burkholderia cepacia Deep pus 473 (1.4) 56.8 43.2 Burkhoideria maiei Ears 289 (0.9) 47.1 S2.9 Burkholderia pseudomaiei Pleural and pericardial fluid 132 (0.4) 1.O 99.0 45 Bittiativella agrestis Peritoneal fluid 101 (0.3) 28.6 71.4 Butyrivibriofibrisolvens Campylobacter coli Total: 32,966 (100.0) 2O.O 80.0 Campylobacter curvus Campylobacter fetus Subsp. fetus Campylobacter fetus Subsp. venerealis 50 Campylobacter gracilis TABLE 4 Campylobacterieitini Campylobacterieitini Subsp. doylei Example of microbial species for which tuf and/or atpD and/or recA Campylobacterieitini Subsp...ieitini nucleic acids and/or sequences are used in the present invention. Campylobacteriani Campylobacter rectus Bacterial species 55 Campylobacterspittortin Subsp. splitorum Campylobacter upsaliensis Abiotrophia adiacens Cedecea davisae Abiotrophia defectiva Cedecea lapagei Achromobacter xylosoxidans subsp. denitrificans Cedecea neieri Acetobacterium woodi Chlamydia pneumoniae Acetobacter aceti Chlamydia psittaci Acetobacter altoacetigenes 60 Chlamydia trachomatis Acetobacter polyoxogenes Chlorobium vibrioforme Acholeplasma laidlawii Chloroflexus aurantiacus Acidothermus cellulolyticus Chryseobacterium meningosepictim Acidiphilum facilis Citrobacter amationaticus Acinetobacter battmannii Citrobacter braaki Acinetobacter Caicoaceticus 65 Citrobacter farmeri Acinetobacter twofi Citrobacter freundii US 8,182,996 B2 91 92 TABLE 4-continued TABLE 4-continued Example of microbial species for which tuf and/or atpD and/or recA Example of microbial species for which tuf and/or atpD and/or recA nucleic acids and/or sequences are used in the present invention. nucleic acids and/or sequences are used in the present invention. Citrobacter koseri Escherichiafergusonii Citrobactersediaki Escherichia hermannii Citrobacter werkmanii Escherichia vulneris Citrobacter votingae Eubacterium ienium Clostridium acetobutyllicum Etibacterium nodatum Cliostridium betterinckii Ewingelia americana Clostridium bifermenians 10 Franciselia initiatensis Clostridium botuinum Frankia aini Clostridium difficile Fervidobacterium islandictim Cliostridium innocuum Fibrobacter succinogenes Clostridium histolyticum Flavobacterium ferrigeneum Clostridium novyi Flexistipes sinusarabici Clostridium septicum Fusobacterium gonidiaformans Clostridium perfingens 15 Fusobacterium necrophorum subsp. necrophorum Clostridium ranosum Fusobacterium nucleatin Subsp. polymorphin Cliostridium tertium Gardnerella vaginalis Cliostridium tetani Gemella haemolysans Comamonas acidovorans Gemeia morbiorum Corynebacterium accolens Giobicatella sanguis Corynebacterium bovis Gioeobacter violiaceus Corynebacterium cervicis Gloeothece sp. Corynebacterium diphtheriae Gluconobacter oxydans Corynebacterium flavescens Haemophilus actinomycetemcomitans Corynebacterium genitalium Haemophilus aphrophilus Corynebacterium glutamicum Haemophilus ducreyi Corynebacterium jeikeium 25 Haemophilus haemolyticus Corynebacterium kutscheri Haemophilus influenzae Corynebacterium minutissimum Haemophilus para haemolyticus Corynebacterium mycetoides Haemophilus parainificienzae Corynebacterium pseudodiphtheriticum Haemophilus paraphrophilus Corynebacterium pseudogenitalium Haemophilus Segnis Corynebacterium pseudotuberculosis 30 Hafnia alvei Corynebacterium renale Haiobacterium marismortati Corynebacterium striatum Haiobacterium sainarum Corynebacterium ulcerans Haloferax volcanii Corynebacterium urealyticum Helicobacter pylori Corynebacterium xerosis Herpetoshiphon aurantiacus Coxieila burnetii Kingeila kingae Cytophaga lytica 35 Klebsiella ornithinolytica Deinococcus radiodurans Klebsiella Oxytoca Deinonema sp. Klebsiella planticola Edwardsiella hoshinae Klebsiella pneumoniae subsp. ozaenae Edwardsielia tarda Klebsiella pneumoniae Subsp. pneumoniae Ehrichia canis Klebsiella pneumoniae subsp. rhinoscleromatis Ehrlichia risticii 40 Klebsiella terrigena Eikeneia corrodens Kluyvera ascorbata Enterobacter aerogenes Kluyvera cryocrescens Enterobacter agglomerans Kluyverageorgiana Enterobacter annigentis Kocuria kristinae Enterobacter asburiae Lactobacilius acidophilus Enterobacter cancerogenits 45 Lactobacilitisgarvieae Enterobacter cloacae Lactobacilitis paracasei Enterobacter gergoviae Lactobacilius casei Subsp. casei Enterobacter hormaechei Lactococciisgarvieae Enterobacter Sakazaki Lactococci is lactis Enterococci is a vitin Lactococci is lactis Subsp. lactis Enterococci is cassellifiavits 50 Legionelia micaiadei Enterococcits Cecorum Legionella pneumophia Subsp. pneumophia Enterococcus columbae Leminorella grimontii Enterococci is dispar Leminorelia richardi Enterococci is durans Leptospira bifiexa Enterococci is faecalis Leptospira interrogans Enterococci is faecium 55 Leticonostoc mesenteroides Subsp. dextranictim Enterococci is fiavescens Listeria innoctia Enterococcus gallinartin Listeria ivanovii Enterococcus hirae Listeria monocytogenes Enterococci is maiodoratiis Listeria Seeigeri Enterococcus mindtii Macrococci is caseolyticits Enterococci is pseudoavium Magnetospirilium magnetotactictim Enterococci is rafinostis 60 Megamonas hypermegale Enterococci is saccharolyticits Methanobacterium thermoautotrophicum Enterococci is solitaritis Methanococcus jannaschii Enterococci is sulfitreus Meihanococcus vanniei Clostridium sordei Meihanosarcina barkeri Erwinia amylovora Methanosarcina jannaschii Erwinia carotovora 65 Methyliobacilius flagellatum Escherichia coi Methylomonas clara US 8,182,996 B2 93 94 TABLE 4-continued TABLE 4-continued Example of microbial species for which tuf and/or atpD and/or recA Example of microbial species for which tuf and/or atpD and/or recA nucleic acids and/or sequences are used in the present invention. nucleic acids and/or sequences are used in the present invention. Micrococcus initeus Providencia rustigianii Micrococcus liviae Providencia Stuarii Mitsuokeia multacidus Pseudomonas aeruginosa Mobiluncus curtisii subsp. holmesii Pseudomonas fittorescens Moellereia thermoacetica Pseudomonas puttida Moellereia wisconsensis Pseudomonas Stutzeri Mooreia thermoacetica 10 Psychrobacter phenylpyruvicum Moraxeia caiarrhais Pyrococcus abyssi Moraxeia Osioensis Rahnella aquatiis Morganella morgani Subsp. morgani Rickettsia prowazeki Mycobacterium avium Rhizobium leguminosarum Mycobacterium bovis Rhizobium phaseoli Mycobacterium gordonae Rhodobacter capsulatus Mycobacterium kansasii 15 Rhodobacter sphaeroides Rhodopseudomonas Mycobacterium leprae palustris Mycobacterium terrae Rhodospirilium rubrum Mycobacterium tuberculosis Ruminococcus aibus Mycoplasma capricoium Ruminococcus bromii Mycoplasma galliseptictim Salmonella bongori Mycoplasma genitalium Salmonelia Choleraestis Subsp. arizonae Mycoplasma hominis Salmonella choleraesuis Subsp choleraesuis Mycoplasma pirtin Salmonella Choleraestis Subsp. diarizonae Mycoplasma mycoides Salmonella Choleraestis Subsp. holienae Mycoplasma pneumoniae Salmonella choleraesuis Subsp. indica Mycoplasma pulmonis Salmonelia Choleraestis Subsp. Salamae Mycoplasma salivarium 25 Serputina hyodysenteriae Myxococcus xanthus Serratia ficaria Neisseria animalis Serratia fonticola Neisseria canis Serratia grimesii Neisseria cinerea Serratia liquefaciens Neisseria clinicui Serraia marcescens Neisseria elongata Subsp. elongata 30 Serratia odorifera Neisseria elongata Subsp. intermedia Serratia plymuthica Neisseria flava Serratia rubidaea Neisseria flavescens Shewanelia puttrefaciens Neisseria gonorrhoeae Shigella boydii Neisseria iacianica Shigella dysenteriae Leclercia adecarboxylata Shigella flexneri Neisseria meningitidis 35 Shigella sonnei Neisseria inticosa Sinorhizobium meioti Neisseria perflava Spirochaeta aurantia Neisseria pharyngis varfiava Staphylococcusatiretts Neisseria polysaccharea Staphylococci is aureus Subsp. aurents Neisseria sicca Staphylococcusatiricularis Neisseria subflava 40 Staphylococci is capitis Subsp. capitis Neisseria weaveri Staphylococcus cohnii subsp. cohnii Obesumbacterium proteus Staphylococci is epidermidis Ochrobactrum anthropi Staphylococciis haemolyticus Pantoea agglomerans Staphylococcus hominis Pantoea dispersa Staphylococcus hominis subsp. hominis Paracoccus denitrificans 45 Staphylococcus iugdunensis Pasteureia mitocida Staphylococci is saprophyticus Pectinatus frisingensis Staphylococcus Sciuri Subsp. Sciuri Peptococcus niger Staphylococci is Sinitians Peptostreptococci is anaerobius Staphylococciis warneri Peptostreptococci is asaccharolyticits Stigmatella aurantiaca Peptostreptococci is prevotii 50 Stenotrophomonas maliophilia Phormidium ectocarpi Streptococci is acidominimits Pineiulia marina Streptococci is agaiactiae Planobispora rosea Streptococci is anginostis Plesiomonas Shigelioides Streptococcus bovis Plectonema bonyanum Streptococci is cricetus Porphyromonas asaccharolytica Streptococci is cristatus Porphyromonas gingivais 55 Streptococci is downei Pragia fontium Streptococci is dysgalaciae Prevoteiia buccais Streptococci is equi Subsp. equi Prevoteila melaninogenica Streptococci is fertis Prevoteia orais Streptococci isgordonii Prevoteia ruminocoia Streptococci is macacae Prochiorothrix holiandica 60 Streptococci is mitis Propionibacterium acnes Streptococci is mutans Propionigenium modestin Streptococcus oralis Proteus mirabilis Streptococci is parasanguinis Proteus penneri Streptococci is pneumoniae Proteus vulgaris Streptococci is pyogenes Providencia alcalifaciens 65 Streptococci is ratti Providencia retigeri Streptococci is Saivarius US 8,182,996 B2 95 96 TABLE 4-continued TABLE 4-continued Example of microbial species for which tuf and/or atpD and/or recA Example of microbial species for which tuf and/or atpD and/or recA nucleic acids and/or sequences are used in the present invention. nucleic acids and/or sequences are used in the present invention. Streptococci is Saivarius Subsp. thermophilus 5 Candida kefir Streptococci is sanguinis Candida krusei Streptococci is sobrinus Candida iambica Streptococci is stiis Candida iusitaniae Streptococci is liberis Candida norvegica Streptococcus vestibularis Candida norvegensis Streptomyces anbofaciens 10 Candida parapsilosis Streptomyces attreofaciens Candida rugosa Streptomyces cinnamonetis Candida sphaerica Streptomyces coelicolor Candida tropicalis Streptomyces collinus Candida utilis Streptomyces lividans Candida viswanathi Streptomyces neiropsis 15 Candida zeylanoides Streptomyces ranocissini is Cladophiaiophora carrionii Streptomyces rimosits Coccidioides immiiis Streptomyces Venezuelae Coprint is cineretts Succini vibrio dextrinosolvens Cryptococci is albidus Synechococci is sp. Cryptococci is humicoius Synechocystis sp. Cryptococci is laurentii Tattimelia ptyseos 2O Cryptococci is neoformans Taxeobacter occealits Cunninghamella bertholietiae Tetragenococciis halophilus Curviliaria iunata Thermoplasma acidophilum Emericeia nidulians Thermotoga maritima Emmonisia parva Thermits aquaticits Eremothecium gossypii Thermus thermophilus 25 Exophiaia dermatitidis Thiobacilius ferrooxidans Exophiala jeanselmei Thiomonas cuprina Exophiaia moniae Trabilisiella gliamensis Exserohium rostratum Treponema pallidiin Eremothecium gossypii Ureaplasma trealytictim Fonsecaea pedrosoi Veillonella parvula 30 Fusarium moniiforme Vibrio alginolyticus Fusarium oxysportin Vibrio anguillarum Fusarium Soiani Vibrio choierae Geotrichum sp. Vibrio mimicus Histoplasma capsulatin Wolinella succinogenes Horiaea werneckii Xanthomonas cirri 35 Issatchenkia orientalis Kudrijanzev Xanthomonas oryzae Kluyveromyces lactic Xenorhabdus bovieni Malassezia furfur Xenorhabdus nematophilus Malassezia pachydermatis Yersinia bercovieri Malbranchea filamentosa Yersinia enterocolitica Metschnikowia pulcherrima Yersinia fiederiksensii Microsporum audouinii Yersinia intermedia 40 Microsporum canis Yersinia pestis Mucor circineioides Yersinia pseudotuberculosis Neurospora Crassa Yersinia rohdei Paecilomyces lilacinus Yokenelia regensburgei Paracoccidioides brasiliensis Zoogloea ramigera Penicilium marneffei Fungal species 45 Phialaphora verrucose Pichia anomaia Absidia corymbifera Piedraia horitai Absidia giatica Podospora aniserina Alternaria alternata Podospora curvicolia Arwula adeninivorans Puccinia graminis Aspergiiitisfia vils 50 Pseudaliescheria boydii Aspergilius finigatus Recinomonas americana Aspergilius nidians Rhizontcor racemosus Aspergilius niger Rhizopus oryzae Aspergilius Oryzae Rhodotoria minuta Aspergilius terretts Rhodotorula mucilaginosa Aspergillus versicolor 55 Saccharomyces cerevisiae Aureobasidium pitilitians Saksenaea vasiformis Basidioboits ranarum Schizosaccharomyces pombe Bipolaris hawaiiensis Scopulariopsis koningii Biophila wadsworthia Sordaria macrospora Biastoschizomyces capitates Sporobolomyces salmonicolor Blastomyces dermatitidis Sporothrix schenckii Candida albicans 60 Stephanoascus ciferrii Candida Catentilata Syncephaiastrum racemosum Candida dubiniensis Trichoderma reesei Candida famata Trichophyton mentagrophytes Candida glabrata Trichophyton rubrum Candida guilliermondii Trichophyton tonsurans Candida haemationi 65 Trichosporon cutaneum Candida inconspicua Ustilago maydis US 8,182,996 B2 97 98 TABLE 4-continued TABLE 4-continued Example of microbial species for which tuf and/or atpD and/or recA Example of microbial species for which tuf and/or atpD and/or recA nucleic acids and/or sequences are used in the present invention. nucleic acids and/or sequences are used in the present invention. Wangiella dermatitidis 5 Leishmania heriigi Yarrowia lipolytica Leishmania major Parasitical species Leishmania mexicana Leishmania panamensis Babesia bigemina Leishmania tarentolae Babesia bovis Leishmania tropica Babesia microti 10 Neospora caninum Blastocystis hominis Onchocerca voivulus Crithidia fasciculata Plasmodium berghei Cryptosporidium parvin Plasmodium falciparum Entamoeba histolytica Piasmodium knowiesi Giardia iambia Porphyra purpurea Kentrophoros sp. 15 Toxoplasma gondii Leishmania aethiopica Treponema pallidum Leishmania amazonensis Trichomonas tenax Leishmania braziliensis Trichomonas vaginalis Leishmania donovani Trypanosoma brucei Leishmania infantum Trypanosoma bricei Subsp. brucei Leishmania enrietti 2O Trypanosoma Congolense Leishmania gerbilli Trypanosoma Cruzi Leishmania guyanensis

TABLE 5 Antimicrobial agents resistance genes selected for diagnostic purposes

Gene Antimicrobial ACCESSION ID NO. agent Bacteria' NO. SEQ ID NO. aac(3)-Ib? Aminoglycosides Enterobacteriaceae LO6157 Pseudomonads aac(3)-IIb’ Aminoglycosides Enterobacteriaceae, M97172 Pseudomonads aac(3)-IVa’ Aminoglycosides Enterobacteriaceae XO1385 aac(3)-VIa’ Aminoglycosides Enterobacteriaceae, M88O12 Pseudomonads aac(2)-1a Aminoglycosides Enterobacteriaceae, XO4555 Pseudomonads aac(6')-aph(2") Aminoglycosides Enterococcus sp., 83-86 Staphylococci is sp. aac(6')-Ia, Aminoglycosides Enterobacteriaceae, M18967 Pseudomonads aac(6')-Ic’ Aminoglycosides Enterobacteriaceae, M94O66 Pseudomonads aac(6')-IIa Aminoglycosides Pseudomonads 1124 aadB Aminoglycosides Enterobacteriaceae 53-54 ant(2")-Ia aacC1 Aminoglycosides Pseudomonads 55-563 aac(3)-Ia aacC2 Aminoglycosides Pseudomonads 57-58 aac(3)-IIa aacC3 Aminoglycosides Pseudomonads 59-60 aac(3)-III aacA4 Aminoglycosides Pseudomonads 65-66 aac(6')-Ib’ ant(3")-Ia Aminoglycosides Enterobacteriaceae, XO2340 Enterococci is sp., M10241 Staphylococci is sp. ant(4)-Ia’ Aminoglycosides Staphylococci is sp. WO1282 aph(3')-Ia Aminoglycosides Enterobacteriaceae, JO1839 Pseudomonads aph(3')-IIa) Aminoglycosides Enterobacteriaceae, WOO618 Pseudomonads aph(3)-IIIa Aminoglycosides Enterococcus sp., VO1547 Staphylococci is sp. aph(3)-VIa Aminoglycosides Enterobacteriaceae, XO7753 Pseudomonads rpsL’ Streptomycin M. tuberculosis, X8O120 M. avium complex U14749 X70995 LO8O11 &laOXAS.6 B-lactams Enterobacteriaceae, Y10693 1104 Pseudomonads AJ238349 AJOO9819

US 8,182,996 B2 103 104 TABLE 5-continued Antimicrobial agents resistance genes Selected for diagnostic purposes

Gene Antimicrobial ACCESSION ID NO. agent Bacteria' NO. SEQ ID NO. F047171 F1881.99 F157553 F190694 F190695 F190693 F190692 bioCARB B-lactams Pseudomonas sp., S162 Enterobacteriaceae S46063 69058 4749 86225 3210 8955 FO71555 F153200 FO30945 &laCTX-M-15 B-lactams Enterobacteriaceae 92SO6 &laCTX-M-25 B-lactams Enterobacteriaceae 92.507 bioCMY-2 B-lactams Enterobacteriaceae 91840 OO7826 O11293 O11291 7716 6783 6781

blimp f-lactams Enterobacteriaceae, AJ2236O4 Pseudomonas S71932 aeruginosa DSO438 D29636 X98393 ABO10417 D783.75 bioPER-1 5 B-lactams Enterobacteriaceae, Z21957 Pseudomodanaceae &la PER-27 B-lactams Enterobacteriaceae X93314 blaZ12 B-lactams Enterococci is sp., 1114 Staphylococci is sp. mecA B-lactams Staphylococci is sp. 97-98 pbp1a' B-lactams Streptococcus M90527 1004-1018, pneumoniae X67872 1648, BOO6868 2056-2064, BOO6874 2273-2276 67873 BOO6878 BOO6875 BOO6877 BOO6879 FO46237 FO4623S FO26431 FO46232 FO46233 FO46236 67871 ZA 9095 FO46234 BOO6873 67866 6.7868 BOO6870 BOO6869 BOO6872 67870 BOO6871 67867 67869 BOO6876 FO46230 US 8,182,996 B2 105 106 TABLE 5-continued Antimicrobial agents resistance genes Selected for diagnostic purposes

Gene Antimicrobial ACCESSION ID NO. agent Bacteria' NO. SEQ ID NO. AFO46238 ZA9094 B-lactams Streptococcus X16022 1019-1033 pneumoniae M2SS16 M2SS18 M25515 U2OO71 U2OO84 U2O082 U2OO67 U20079 Z22.185 U2OO72 B-lactams Streptococcus U2O083 pneumoniae U2O081 M25522 U20075 U20070 U20077 U2OO68 Z22184 U20069 U20078 M25521 M255.25 M25519 Z21981 M25523 M2S526 U2OO76 U20074 M2552O M25517 M2SS24 Z22230 U20073 U2008O B-lactams Streptococcus 6367 1034-1048 pneumoniae 65135 BO11204 BO11209 BO11,199 BO11200 BO112O1 BO112O2 BO11,198 BO11208 BO1120S BO15852 BO11210 BO15849 BO158SO BO15851 BO15847 BO15846 BO112O7 BO15848 ZA9096 int B-lactams, Enterobacteriaceae, 99-1023 trimethoprim Sul aminoglycosides, Pseudomonads 103-106 antiseptic, chloramphenicol ermA' Macrollides, Staphylococci is sp. 1134 lincosamides, streptogramin B ermB' Macrollides, Enterobacteriaceae, 1144 lincosamides, Staphylococci is sp. streptogramin B Enterococci is sp. Streptococci is sp. ermC Macrollides, Enterobacteriaceae, 1154 lincosamides, Staphylococci is sp. streptogramin B US 8,182,996 B2 107 108 TABLE 5-continued Antimicrobial agents resistance genes Selected for diagnostic purposes

Gene Antimicrobial ACCESSION ID NO. agent Bacteria' NO. SEQ ID NO. ereA' Macrollides Enterobacteriaceae, M11277 Staphylococci is sp. EO1199 ereB? Macrollides Enterobacteriaceae Staphylococci is sp. msrA'? Macrollides Staphylococci is sp. 77-803 mefA, mefE Macrollides Streptococci is sp. U70055 U836.67 mph.A Macrollides Enterobacteriaceae, D16251 Staphylococci is sp. U34344 U36578 linA/linA' Lincosamides Staphylococci is sp.

linB 9 Lincosamides Enterococcits faecium vga' Streptrogramin Staphylococci is sp. M900S6 89-90 vgb' Streptrogramin Staphylococci is sp. wati Streptrogramin Staphylococci is sp. LO7778 87-88 watB Streptrogramin Staphylococci is sp. U19459 L38.809 sat A Streptrogramin Enterococci is faecium L12033 81-82 mup A Mupirocin Staphylococcits X75439 (iiietS XS9478 X59477 gyra Quinolones Gram-positive and X95718 1255, gram-negative XO6744 1607-1608, bacteria X571.74 1764-1776, X16817 2013-2014, X71437 2277-228O AFO651S2 AFO60881 D322S2 Quinolones Gram-positive and ABOOSO36 1777-1785 gram-negative AFOS6287 bacteria X95 717 AF129764 ABO17811 Quinolones Gram-positive X95 717 bacteria AFO65153 AFOS892O norA Quinolones Staphylococci is sp. D901.19 M97169 mexR(nalB) Quinolones Pseudomonas U23763 aeruginosa infxB16 Quinolones Pseudomonas X65646 aeruginosa cat? Chloramphenicol Gram-positive and MSS 620 gram-negative X151OO bacteria A24651 M28717 AOOS68 AOOS69 X74948 YOO723 A24362 AOOS69 M931.13 M62822 MS8516 VO1277 XO2166 M77169 X53796 JO1841 XO7848 ppflo-like Chloramphenicol AFO71555 embB7 Ethambutol Mycobacterium tuberculosis US 8,182,996 B2 109 110 TABLE 5-continued Antimicrobial agents resistance genes Selected for diagnostic purposes

Gene Antimicrobial ACCESSION ID NO. agent Bacteria' NO. SEQ ID NO. Pyrazinamide Mycobacterium U59967 tuberculosis rpoB7 Rifampin Mycobacterium AFOSS891 tuberculosis AFOSS892 S71246 L27989 AFOSS893 Isoniazid Mycobacterium AF106O77 tuberculosis UO2492 Vancomycin Enterococci is sp. 67-703 1049-1057 Vancomycin Enterococci is sp. 116 Vancomycin Enterococcits 1174 gallinartin 1058-1059 Vancomycin Enterococcits U94521 1060-1063 casseifiavits U94522 U94523 U94524 U94525 L296.38 vanC32 Vancomycin Enterococcits L29639 1064-1066 fiavescens vanD8 Vancomycin Enterococcits AF13.0997 faecium vanE2 Vancomycin Enterococcits AF136925 faecium tetB Tetracycline Gram-negative JO1830 bacteria AF162223 APOOO342 S83213 U81141 WOO611 tetMI9 Tetracycline Gram-negative and X52632 Gram-positive AF116348 bacteria USO983 X92947 M211136 UO8812 XO4388 sul II29 Sulfonamides Gram-negative M36657 bacteria AFO17389 AFO17391 Trimethoprim Gram-negative A2383SO bacteria X17477 KOOOS2 UO9476 XOO926 Trimethoprim Gram-negative Z50805 bacteria ZSO804 Trimethoprim Gram-negative X12868 bacteria Trimethoprim Gram-negative bacteria Trimethoprim Gram-negative U31119 bacteria AF139109 XS8425 hfrVIII20 Trimethoprim Gram-negative U101.86 bacteria UO9273 Trimethoprim Gram-negative X57730 bacteria Trimethoprim Gram-negative Z21672 bacteria AF1752O3 AF180731 M84522 hfrXIII-20 Trimethoprim Gram-negative ZSO802 bacteria Trimethoprim Gram-negative Z833.31 bacteria hfrXVII.20 Trimethoprim Gram-negative AF170088 bacteria AF180469 AF169041 Trimethoprim Staphylococci is sp. AFO4S472 U4O259 AFOS1916 X13290 US 8,182,996 B2 111 112 TABLE 5-continued Antimicrobial agents resistance genes Selected for diagnostic purposes

Gene Antimicrobial ACCESSION ID NO. agent Bacteria' NO. SEQ ID NO. YO7536 Z16422 ZA-8233 Bacteria having high incidence for the specified antibiotic resistance gene. The presence of the antibiotic resistance genes in other bacteria is not excluded. *Shaw, K. J., P.N. Rather, R. S. Hare, and G.H. Miller, 1993. Molecular genetics of aminoglycoside resistance genes and familial relationships of the aminoglycoside-modifying enzymes. Microbiol. Rev. 57:138-163. Antibiotic resistance genes from our assigned U.S. Pat. No. 6,001,564 for which we have selected PCR primer 81S, These SEQID NOs, refer to a previous patent (publication W098, 20157). Bush, K., G. A. Jacoby and A. Medeiros. 1995. A functional classification scheme for B-lactamase and its correlation with molecular structure. Antimicrob, Agents. Chemother, 39:1211-1233. ucleotide mutations in blast, blate, and blao, are associated with extended-spectrum B-lactamase or inhibitor-resistant B-lactamase. Bauerfeind, A.Y. Chong, and K. Lee. 1998. Plasmid-encoded AmpC beta-lactamases; how far have we gone 10 ears after discovery? Yonsei Med. J. 39:520-525. Sutcliffe, J., T. Grebe, A. Tait-Kamradt, and L. Wondrack. 1996. Detection of erythromycin-resistant deter minants by PCR. Antimicrob, Agent Chemother, 40:2562-2566. Leclerc, R., A., Brisson-Noël, J. Duval, and P. Courvalin. 1991. Phenotypic expression and genetic hetero eneity of lincosamide inactivation in Staphylococcus sp. Antimicrob, Agents. Chemother, 31:1887-1891. Bozdogan, B., L. Berrezouga, M.-S. Kuo, D. A. Yurek, K. A. Farley, B. J. Stockman, and R. Leclercq, 1999. A new gene, linB, conferring resistance to lincosamides by nucleotidylation in Enterococcus faecium HM1025. Antimicrob, Agents. Chemother, 43:925-929. 'Cockerill III, F.R. 1999. Genetic methods for assessing antimicrobial resistance, Antimicrob, Agents, Chemother, 43:199-212. 'Tenover, F.C., T. Popovic, and O Olsvik, 1996. Genetic methods for detecting antibacterial resistance genes. pp. 1368-1378. In Murray, P.R.E. J. Baron, M. A. Pfaller, F. C. Tenover, R. H. Yolken (eds). Manual of clinical microbiology, 6th ed., ASM Press, Washington, D.C., USA 'Dowson, C. G., T. J. Tracey, and B. G. Spratt, 1994. Origin and molecular epidemiology of penicillin binding-protein-mediated resistance to B-lactam antibiotics. Trends Molec. Microbiol.2: 361-366. 'Jensen, L. B., N. Frimodt-Moller, F. M. Aarestrup, 1999. Presence of erm gene classes in Gram-positive bacteria of animal and human origin in Denmark. FEMS Microbiol. 170:151-158. Thal, L. A., and M. J. Zervos, 1999. Occurrence and epidemiology of resistance to virginimycin and streptrogramins. J. Antimicrob, Chemother, 43:171-176. Martinez J. L.A. Alonso, J.M. Gomez-Gomez, and F. Bacquero, 1998. Quinolone resistance by mutations in chromosomal gyrase genes, Just the tip of the iceberg? J. Antimicrob, Chemother, 42:683-688 'Cockerill III, F.R. 1999. Genetic methods for assessing antimicrobial resistance, Antimicrob, Agents, Chemother, 43:199-212. 'Casadewall, B, and P. Courvalin, 1999 Characterization of the vanD glycopeptide resistance gene cluster from Enterococcus faecium BM 4339, J. Bacteriol. 181:3644-3648. 'Roberts, M.C. 1999. Genetic mobility and distribution of tetracycline resistance determinants. Ciba Found. Symp. 207:206-222. 2 Huovinen, P.L. Sundström, G. Swedberg, and O. Sköld. 1995. Trimethoprim and sulfonamide resistance. Antimicrob, Agent Chemother, 39:279-289.

TABLE 6 TABLE 6-continued List of bacterial toxins selected for diagnostic purposes. List of bacterial toxins selected for diagnostic purposes. 40 Accession Accession Organism Toxin number Organism Toxin number Actinobacilius Cytolethal distending AFOO6830 Bordeteia Pertussis toxin (S1 subunit, tox) AJO06151 actinomycetemcomitans toxin (cdtA, coltB, coltC) pertissis AJOO6153 Leukotoxin (ItXA) M27399 AJOO615S Actinomyces Hemolysin (pyolysin) U84782 45 AJOO6157 pyogeneS AJOO61.59 Aeromonas Aerolysin (aerA) M16495 AJOO7363 hydrophila Haemolysin (hly A) U81555 M14378, Cytotonic enterotoxin (alt) L77573 M16494 Bacilius anthracis Anthrax toxin (cya) M23179 AJOO7364 Bacilius cereus Enterotoxin (bceT) D17312 50 M13223 AF192766, X16347 AF192767 Adenyl cyclase (cya) 18323 Enterotoxic hemolysin BL AJ237785 Dermonecrotic toxin (dnt) U10527 Non-haemolytic enterotoxins Y19005 Campylobacter Cytolethal distending toxin US 1121 A.B and C (nhe) jeiini (cdtA, coltB, ccdtC) Bacilius mycoides Hemolytic enterotoxin HBL AJ243150 to 55 Citrobacter Shiga-like toxin (silt-IIcA) X67514, A243153 freundi SS32O6 Bacilius Hemolytic enterotoxin HBL AJ243154 to Cliostridium Botulism toxin (BoNT) (A, X52066, pseudomycoides AJ243156 bointinum B, E and F serotypes XS2088 Bacteroides Enterotoxin (bftP) U67735 are neurotoxic for humans; X73423 fragilis Matrix metalloproteasef S75941, the other serotypes M301.96 enterotoxin (fragilysin) AFO38459 60 have not been considered) X70814 Metalloprotease toxin-2 U90931 X70819 AFO81785 X71343 Metalloprotease toxin-3 AFOS6297 Z11934 Bordeteia Adenylate cyclase Z37112, X70817 bronchiseptica hemolysin (cyaA) U22953 M81186 Dermonecrotic toxin (dnt) U59687 65 X70818 ABO2OO2S X70815 US 8,182,996 B2 113 114 TABLE 6-continued TABLE 7-continued List of bacterial toxins Selected for diagnostic purposes. Origin of the nucleic acids and/or Sequences in the Sequence listing. Accession SEQ Archaeal, bacterial, fungal Organism Toxin number 5 ID NO. or parasitical species Source Gene X62089 6 Bacilius anthracis This paten X62683 7 Bacilius cereus This paten S76749 8 Bacteroides distasonis This paten X81714 9 Enterococcus casselliflavus This paten X70816 10 10 Staphylococci is saprophyticits This paten X7082O 11 Bacteroides ovatus This paten X70281 12 Bartoneia henseiae This paten L3S496 13 Bifidobacterium adolescentis This paten M92906 14 Bifidobacterium dentium This paten Cliostridium A toxin (enterotoxin) ABO12304 15 Bruceiia aborius This paten difficile (tcdA) (cdtA) AFOS3400 15 16 Burkholderia cepacia This paten Y12616 17 Cedecea davisae This paten X51797 18 Cedecea neieri This paten X171.94 19 Cedecea lapagei This paten M30307 20 Chlamydia pneumoniae This paten B toxin (cytotoxin) Z23277 21 Chlamydia psittaci This paten (toxB) (cdtB) X531.38 22 Chlamydia trachomatis This paten Cliostridium Alpha (phospholipase L43S45 2O 23 Chryseobacterium This paten perfingens C) (cpa) L43546 meningosepictim L43S47 24 Citrobacter amationaicus This paten L43548 25 Citrobacter braaki This paten X13608 26 Citrobacter koseri This paten X173OO 27 Citrobacter farmeni This paten D10248 25 28 Citrobacter fieundii This paten Beta (dermonecrotic L131.98 29 Citrobactersediaki This paten protein) (cpb) X83275 30 Citrobacter werkmani This paten L77965 31 Citrobacter youngae This paten Enterotoxin (cpe) AJOOO766 32 Clostridium perfingens This paten M98O37 33 Comamonas acidovorans This paten X81849 30 34 Corynebacterium bovis This paten X71844 35 Corynebacterium cervicis This paten Y16009 36 Corynebacterium flavescens This paten Enterotoxin pseudogene AFO37328 37 Corynebacterium kutscheri This paten (not expressed) AFO37329 38 Corynebacterium This paten AFO37330 mintitissini in Epsilon toxin (etXD) M8O837 35 39 Corynebacterium mycetoides This paten M952O6 40 Corynebacterium This paten X60694 pseudogenitalium Iota (Ia and Ib) X73562 41 Corynebacterium renale This paten Lambda (metalloprotease) D45904 42 Corynebacterium ulcerans This paten Theta (perfringolysin O) M36704 43 Corynebacterium urealyticum This paten Cliostridium sordei Cytotoxin L X82638 44 Corynebacterium xerosis This paten Cliostridium tetani Tetanos toxin XO6214 40 45 Coxieia burnetii This paten XO4436 46 Edwardsielia hoshinae This paten Corynebacterium Diphtheriae toxin XOO703 47 Edwardsielia tarda This paten diphtheriae 48 Eikeneia corrodens This paten Corynebacterium Phospholipase C A21336 49 Enterobacter aerogenes This paten pseudotuberculosis 50 Enterobacter agglomerans This paten Eikeneia corrodens lysine decarboxylase (cada) U89166 45 51 Enterobacter amnigenus T his 8t Enterobacter cloacae Shiga-like toxin II Z50754, 52 Enterobacter asburiae his paten U335O2 53 Enterobacter cancerogenus This paten Enterococci is faecalis Cytolysin B (cylB) M38052 : first cloacae Inis paten Escherichia coi Hemolysin toxin (hlyA AFO43471 interopactergergovae Inis paren 56 Enterobacter hormaechei S 8Cl (EHEC) and ehkA) X94129 50 57 Enterobacter Sakazaki S 8Cl X79839 58 Enterococcus casselliflavus This paten X86087 59 Enterococcus Cecorum This paten ABO11549 60 Enterococcus dispar This paten AFO74613 61 Enterococcus durans This paten 62 Enterococcus faecalis This paten 55 63 Enterococcus faecalis This paten 64 Enterococcus faecium This paten TABLE 7 65 Enterococcus flavescens This paten 66 Enterococcus gallinarum This paten Origin of the nucleic acids and/or Sequences in the Sequence listing. a. Elects Tail T his paten le:OCOCO2S fiti S 8Cl SEQ Archaeal, bacterial, fungal 60 69 Enterococcus pseudoavium This paten ID NO. or parasitical species Source Gene 70 Enterococcus raffinosus This paten 71 Enterococcus saccharolyticus This paten 1 Acinetobacter battmannii This patent tuf 72 Enterococcus solitarius This paten 2 Actinomyces meyeri This patent tuf 73 Enterococcus casselliflavus This paten tuf (C) 3 Aerococcus viridans This patent tuf 74 Staphylococci is saprophyticits This paten unknown 4 Achromobacter xylosoxidans This patent tuf 75 Enterococcus flavescens This paten tuf (C) Subsp. denitrificans 65 76 Enterococcus gallinarum This paten tuf (C) 5 Anaerorhabdits fircosus This patent tuf 77 Ehrichia Canis This paten US 8,182,996 B2 115 116 TABLE 7-continued TABLE 7-continued Origin of the nucleic acids and/or Sequences in the Sequence listing. Origin of the nucleic acids and/or Sequences in the Sequence listing. SEQ Archaeal, bacterial, fungal SEQ Archaeal, bacterial, fungal ID NO. or parasitical species Source Gene 5 ID NO. or parasitical species Source Gene 78 Escherichia coli This paten 40 Porphyromonas This paten 79 Escherichiafergusonii This paten asaccharolytica 80 Escherichia hermannii This paten 41 Porphyromonas gingivais This paten 81 Escherichia vulneris This paten 42 Pragia fontium This paten 82 Eubacterium lenium This paten 10 43 Prevoteila melaninogenica This paten 83 Eubacterium nodatum This paten 44 Prevoteia orais This paten 84 Ewingeila americana This paten 45 Propionibacterium acnes This paten 85 Franciseia tuiarensis This paten 46 Proteus mirabilis This paten 86 Fusobacterium nucleatum This paten 47 Proteus penneri This paten Subsp. polymorphin 48 Proteus vulgaris This paten 87 Gemella haemolysans This paten 15 49 Providencia alcalifaciens This paten 88 Gemeia morbiorum This paten 50 Providencia retigeri This paten 89 Haemophilus This paten 51 Providencia rustigianii This paten actinomycetemcomitans 52 Providencia Stuarii This paten 90 Haemophilus aphrophilus This paten 53 Pseudomonas aeruginosa This paten 91 Haemophilus ducreyi This paten 54 Pseudomonas fluorescens This paten 92 Haemophilus haemolyticus This paten 55 Pseudomonas Stutzeri This paten 93 Haemophilus parahaemolyticus This paten 2O 56 Psychrobacter This paten 94 Haemophilus parainfluenzae This paten phenylpyruvictim 95 Haemophilus paraphrophilus This paten 57 Rahnella aquatilis This paten 96 Haemophilus segnis This paten 58 Saimoneiia choieraestiis This paten 97 Hafnia alvei This paten Subsp.arizonae 98 Kingeila kingae This paten 59 Salmoneiia choieraestiis This paten 99 Klebsiella ornithinolytica This paten 25 Subsp. Choleraestiis 00 Klebsiella Oxytoca This paten serotype CholeraeSuis 01 Klebsiella planticola This paten 60 Salmoneiia choieraesuis This paten 02 Klebsiella pneumoniae This paten Subsp. diarizonae Subsp. Ozaenae 61 Saimoneiia choieraesuis This paten 03 Klebsiella pneumoniae This paten Subsp. Choleraestiis pneumoniae 30 serotype Heidelberg 04 Klebsiella pneumoniae This paten 62 Salmoneiia choieraesuis This paten subsp. rhinoscleromatis Subsp. holitenae 05 Kluyvera ascorbata This paten 63 Salmoneiia choieraesuis This paten 06 Kluyvera cryocrescens This paten subsp. indica 07 Kluyverageorgiana This paten 64 Salmoneiia choieraesuis This paten 08 Lactobacilius casei This paten 35 Subsp. Salamae Subsp. casei 65 Salmoneiia choieraesuis This paten 09 Lactococcusiactis This paten Subsp. Choleraestiis Subsp. lactis serotype Typhi 10 Leclercia adecarboxylata This paten 66 Serratia fonticola This paten 11 Legionella micaadei This paten 67 Serratia liquefaciens This paten 12 Legionella pneumophila This paten 68 Serraia marcesCens This paten Subsp. pneumophia 40 69 Serratia odorifera This paten 13 Leminorella grimontii This paten 70 Serratia ply muthica This paten 14 Leminorelia richardii This paten 71 Serratia rubidaea This paten 15 Leptospira interrogans This paten 72 Shigella boydii This paten 16 Megamonas hypermegale This paten 73 Shigella dysenteriae This paten 17 Mitsutokeia muitacidus This paten 74 Shigella flexneri This paten 18 Mobiluncus curtisii This paten 45 75 Shigella sonnei This paten Subsp. holmesii 76 Staphylococcusatiretts This paten 19 Moeierelia wisconsensis This paten 77 Staphylococcus aureus This paten 20 Moraxeiia catarrhais This paten 78 Staphylococcus aureus This paten 21 Morganella morgani This paten 79 Staphylococcus aureus This paten Subsp. morgani 80 Staphylococcusatiretts This paten 22 Mycobacterium tuberculosis This paten 50 Subsp. aurents 23 Neisseria cinerea This paten 81 Staphylococcus auricularis This paten 24 Neisseria elongata This paten 82 Staphylococci is capitis This paten Subsp. elongata Subsp. capitis 25 Neisseria flavescens This paten 83 Macrococcus caseolyticus This paten 26 Neisseria gonorrhoeae This paten 84 Staphylococcus cohnii This paten 27 Neisseria iacianica This paten 55 subsp. cohnii 28 Neisseria meningitidis This paten 85 Staphylococcus epidermidis This paten 29 Neisseria maicosa This paten 86 Staphylococcus haemolyticus This paten 30 Neisseria sicca This paten 87 Staphylococcus warneri This paten 31 Neisseria subfiava This paten 88 Staphylococcus haemolyticus This paten 32 Neisseria weaveri This paten 89 Staphylococcus haemolyticus This paten 33 Ochrobactrum anthropi This paten 90 Staphylococcus haemolyticus This paten 34 Pantoea agglomerans This paten 60 91 Staphylococcus hominis This paten 35 Pantoea dispersa This paten subsp. hominis 36 Pasteureia mitocida This paten 92 Staphylococcus warneri This paten 37 Peptostreptococcus This paten 93 Staphylococcus hominis This paten anaerobius 94 Staphylococcus hominis This paten 38 Peptostreptococcus This paten 95 Staphylococcus hominis This paten asaccharolyticits 65 96 Staphylococcus hominis This paten 39 Peptostreptococcus previotii This paten 97 Staphylococcus lugdunensis This paten US 8,182,996 B2 117 118 TABLE 7-continued TABLE 7-continued Origin of the nucleic acids and/or Sequences in the Sequence listing. Origin of the nucleic acids and/or Sequences in the Sequence listing. SEQ Archaeal, bacterial, fungal SEQ Archaeal, bacterial, fungal ID NO. or parasitical species Source Gene 5 ID NO. or parasitical species Source Gene 198 Staphylococci is saprophyticits This paten 269 Cliostridium innocuum This paten atpD 199 Staphylococcus saprophyticus This paten 270 Clostridium perfingens This paten atpD 200 Staphylococci is saprophyticits This paten 272 Corynebacterium diphtheriae This paten atpD 201 Staphylococcus Sciuri This paten 273 Corynebacterium This paten atpD Subsp. Sciuri 10 pseudodiphtheriticum 202 Staphylococcus warneri This paten 274 Corynebacterium ulcerans This paten atpD 203 Staphylococcus warneri This paten 275 Corynebacterium urealyticum This paten atpD 204 Bifidobacterium longum This paten 276 Coxieia burnetii This paten atpD 205 Stenotrophomonas maitophilia This paten 277 Edwardsielia hoshinae This paten atpD 206 Streptococcus acidominimus This paten 278 Edwardsielia tarda This paten atpD 207 Streptococci is agaiaciae This paten 15 279 Eikeneia corrodens This paten atpD 208 Streptococci is agaiaciae This paten 280 Enterobacter agglomerans This paten atpD 209 Streptococci is agaiaciae This paten 281 Enterobacter amnigenus This paten atpD 210 Streptococci is agaiaciae This paten 282 Enterobacter as buriae This paten atpD 211 Streptococci is anginostis This paten 283 Enterobacter cancerogenus This paten atpD 212 Streptococcus bovis This paten 284 Enterobacter cloacae This paten atpD 213 Streptococci is anginostis This paten 285 Enterobacter gergoviae This paten atpD 214 Streptococcus cricetus This paten 2O 286 Enterobacter hormaechei This paten atpD 215 Streptococcus cristatus This paten 287 Enterobacter Sakazaki This paten atpD 216 Streptococcus downei This paten 288 Enterococci is avium This paten atpD 217 Streptococci is dysgalactiae This paten 289 Enterococcus casselliflavus This paten atpD 218 Streptococci is equi Subsp. equi This paten 290 Enterococcus durans This paten atpD 219 Streptococcus ferus This paten 291 Enterococcus faecalis This paten atpD 220 Streptococcusgordonii This paten 25 292 Enterococcus faecium This paten atpD 221 Streptococci is anginostis This paten 293 Enterococcus gallinarum This paten atpD 222 Streptococci is macacae This paten 294 Enterococcus saccharolyticus This paten atpD 223 Streptococcusgordonii This paten 295 Escherichiafergusonii This paten atpD 224 Streptococci is mutans This paten 296 Escherichia hermannii This paten atpD 225 Streptococci is parasanguinis This paten 297 Escherichia vulneris This paten atpD 226 Streptococcus ratti This paten 30 298 Eubacterium ienium This paten atpD 227 Streptococci is sanguinis This paten 299 Ewingeila americana This paten atpD 228 Streptococcus sobrinus This paten 300 Franciselia tularensis This paten atpD 229 Streptococcus suis This paten 301 Fusobacterium gonidiaformans This paten atpD 230 Streptococcus uberis This paten 302 Fusobacterium necrophorum This paten atpD 231 Streptococcus vestibularis This paten Subsp. necrophorum 232 Tattimelia ptyseos This paten 35 303 Fusobacterium nucleatum This paten atpD 233 Trabulsiella guamensis This paten Subsp. polymorphi in 234 Veillonella parvula This paten 304 Gardnerella vaginalis This paten atpD 235 Yersinia enterocolitica This paten 305 Gemella haemolysans This paten atpD 236 Yersinia fiederiksenii This paten 306 Geneia morbiorum This paten atpD 237 Yersinia intermedia This paten 307 Haemophilus ducreyi This paten atpD 238 Yersinia pestis This paten 308 Haemophilus haemolyticus This paten atpD 239 Yersinia pseudotuberculosis This paten 40 309 Haemophilus parahaemolyticus This paten atpD 240 Yersinia rohdei This paten 310 Haemophilus parainfluenzae This paten atpD 241 Yokenella regensburgei This paten 311 Hafnia alvei This paten atpD 242 Achromobacter xylosoxidans This paten atpD 312 Kingeila kingae This paten atpD Subsp. denitrificans 313 Klebsiella pneumoniae subsp. This paten atpD 243 Acinetobacter battmannii This paten atpD Oziele 244 Acinetobacter iwofi This paten atpD 45 314 Klebsiella ornithinolytica This paten atpD 245 Staphylococci is saprophyticits This paten atpD 315 Klebsiella Oxytoca This paten atpD 246 Alcaligenes faecalis This paten atpD 316 Klebsiella planticola This paten atpD Subsp. faecalis 317 Klebsiella pneumoniae subsp. This paten atpD 247 Bacilius anthracis This paten atpD pneumoniae 248 Bacilius cereus This paten atpD 318 Kluyvera ascorbata This paten atpD 249 Bacteroides distasonis This paten atpD 50 319 Kluyvera cryocrescens This paten atpD 250 Bacteroides ovatus This paten atpD 320 Kluyverageorgiana This paten atpD 251 Leclercia adecarboxylata This paten atpD 321 Lactobacilius acidophilus This paten atpD 252 Stenotrophomonas maitophilia This paten atpD 322 Legionella pneumophia Subsp. This paten atpD 253 Bartoneia henseiae This paten atpD pneumophila 254 Bifidobacterium adolescentis This paten atpD 323 Leminorella grimontii This paten atpD 255 Bruceiia abortus This paten atpD 55 324 Listeria monocytogenes This paten atpD 256 Cedecea davisae This paten atpD 325 Micrococcus lyilae This paten atpD 257 Cedecea lapagei This paten atpD 326 Moellereia wisconsensis This paten atpD 258 Cedecea neieri This paten atpD 327 Moraxeiia caiarrhais This paten atpD 259 Chryseobacterium This paten atpD 328 Moraxeia Osiloensis This paten atpD meningosepictim 329 Morganella morganii This paten atpD 260 Citrobacter amationaticus This paten atpD Subsp. morgani 261 Citrobacter braaki This paten atpD 60 330 Pantoea agglomerans This paten atpD 262 Citrobacter koseri This paten atpD 331 Pantoea dispersa This paten atpD 263 Citrobacter farmeri This paten atpD 332 Pasieureia mitocida This paten atpD 264 Citrobacter freundii This paten atpD 333 Pragia fontium This paten atpD 265 Citrobacter koseri This paten atpD 334 Proteus mirabilis This paten atpD 266 Citrobactersediaki This paten atpD 335 Proteus vulgaris This paten atpD 267 Citrobacter werkmani This paten atpD 65 336 Providencia alcalifaciens This paten atpD 268 Citrobacter youngae This paten atpD 337 Providencia retigeri This paten atpD US 8,182,996 B2 119 120 TABLE 7-continued TABLE 7-continued Origin of the nucleic acids and/or Sequences in the Sequence listing. Origin of the nucleic acids and/or Sequences in the Sequence listing. SEQ Archaeal, bacterial, fungal SEQ Archaeal, bacterial, fungal ID NO. or parasitical species Source Gene 5 ID NO. or parasitical species Source Gene 338 Providencia rustigiani This paten atpD 391 Trabulsiella guamensis This paten atpD 339 Providencia Stuarii This paten atpD 392 Yersinia bercovieri This paten atpD 340 Psychrobacter This paten atpD 393 Yersinia enterocolitica This paten atpD phenylpyruvictim 394 Yersinia fiederiksenii This paten atpD 341 Rahnella aquatilis This paten atpD 10 395 Yersinia intermedia This paten atpD 342 Saimoneiia choieraestiis This paten atpD 396 Yersinia pseudotuberculosis This paten atpD Subsp. arizonae 397 Yersinia rohdei This paten atpD 343 Saimoneiia choieraestiis This paten atpD 398 Yokenella regensburgei This paten atpD Subsp. Choleraestis 399 Yarrowia lipolytica This paten ) Serotype CholeraeSuis 400 Absidia corymbifera This paten ) 344 Saimoneiia choieraestiis This paten atpD 15 401 Alternaria alternata This paten ) Subsp. diarizonae 402 Aspergiiitisfiavits This paten ) 345 Saimoneiia choieraestiis This paten atpD 403 Aspergilius finigatus This paten ) Subsp. holienae 404 Aspergilius finigatus This paten ) 346 Saimoneiia choieraestiis This paten atpD 405 Aspergilius niger This paten ) subsp. indica 406 Biastoschizomyces capitatus This paten ) 347 Saimoneiia choieraestiis This paten atpD 407 Candida albicans This paten ) Subsp. Choleraestis 2O 408 Candida albicans This paten ) serotype Paratyphi A 409 Candida albicans This paten ) 348 Saimoneiia choieraestiis This paten atpD 410 Candida albicans This paten ) Subsp. Choleraestis 411 Candida albicans This paten ) serotype Paratyphi B 412 Candida dubiniensis This paten ) 349 Saimoneiia choieraestiis This paten atpD 413 Candida catentiaia This paten ) Subsp. Salamae 25 414 Candida dubiniensis This paten ) 350 Saimoneiia choieraestiis This paten atpD 415 Candida dubiniensis This paten ) Subsp. Choleraestis 416 Candida famata This paten ) serotype Typhi 417 Candida glabrata WO98.2O157 till ) 351 Saimoneiia choieraestiis This paten atpD 418 Candida guilliermondii This paten ) Subsp. Choleraestis 419 Candida haemationi This paten ) Serotype Typhimurium 30 420 Candida inconspicua This paten ) 352 Saimoneiia choieraestiis This paten atpD 421 Candida kefir This paten ) Subsp. Choleraestis 422 Candida krusei WO98.2O157 till ) serotype Virchow 423 Candida iambica This paten ) 353 Serratia ficaria This paten atpD 424 Candida iusitaniae This paten ) 354 Serratia fonticola This paten atpD 425 Candida norvegensis This paten ) 355 Serratia grimesii This paten atpD 35 426 Candida parapsilosis WO98.2O157 till ) 356 Serratia liquefaciens This paten atpD 427 Candida rugosa This paten ) 357 Serraia marCescens This paten atpD 428 Candida sphaerica This paten ) 358 Serratia odorifera This paten atpD 429 Candida tropicalis WO98.2O157 till ) 359 Serratia plymuthica This paten atpD 430 Candida utilis This paten ) 360 Serratia rubidaea This paten atpD 431 Candida viswanathi This paten ) 361 Pseudomonasputida This paten atpD 432 Candida zeylanoides This paten ) 362 Shigella boydii This paten atpD 40 433 Coccidioides inmitis This paten ) 363 Shigella dysenteriae This paten atpD 434 Cryptococcus albidus This paten ) 364 Shigella flexneri This paten atpD 435 Exophiala jeanselmei This paten ) 365 Shigella sonnei This paten atpD 436 Fusarium oxysporum This paten ) 366 Staphylococcus aureus This paten atpD 437 Geotrichum sp. This paten ) 367 Staphylococcus auricularis This paten atpD 438 Histoplasma capsulatin This paten ) 368 Staphylococcus capitis This paten atpD 45 439 Issaichenkia orientais This paten ) Subsp. capitis Kudrijanzev 369 Staphylococcus cohnii This paten atpD 440 Malassezia furfur This paten ) Subsp. cohnii 4.41 Malassezia pachydermatis This paten ) 370 Staphylococcus epidermidis This paten atpD 442 Malbranchea filamentosa This paten ) 371 Staphylococcus haemolyticus This paten atpD 443 Metschnikowia pulcherrima This paten ) 372 Staphylococcus hominis subsp. This paten atpD 50 444 Paecilomyces lilacinus This paten ) hominis 445 Paracoccidioides brasiliensis This paten ) 373 Staphylococcus hominis This paten atpD 446 Penicillium marneffei This paten ) 374 Staphylococcus iugdunensis This paten atpD 447 Pichia anomaia This paten ) 375 Staphylococcus saprophyticus This paten atpD 448 Pichia anomaia This paten ) 376 Staphylococcus simulans This paten atpD 449 Pseudaliescheria boydii This paten ) 377 Staphylococcus warneri This paten atpD 55 450 Rhizopus oryzae This paten ) 378 Streptococcus acidominimus This paten atpD 451 Rhodotoruia minuta This paten ) 379 Streptococcus agalactiae This paten atpD 452 Sporobolomyces salmonicolor This paten ) 380 Streptococci is agaiaciae This paten atpD 453 Sporothrix schenckii This paten ) 381 Streptococci is agaiaciae This paten atpD 454 Stephanoascus ciferri This paten ) 382 Streptococci is agaiaciae This paten atpD 455 Trichophyton mentagrophytes This paten ) 383 Streptococci is agaiaciae This paten atpD 456 Trichosporon cutaneum This paten ) 384 Streptococci is dysgalactiae This paten atpD 60 457 Wangiella dermatitidis This paten ) 385 Streptococcus equi This paten atpD 458 Aspergilius finigatus This paten atpD Subsp. equi 459 Blastoschizomyces capitatus This paten atpD 386 Streptococci is anginostis This paten atpD 460 Candida albicans This paten atpD 387 Streptococcus salivarius This paten atpD 461 Candida dubiniensis This paten atpD 388 Streptococcus suis This paten atpD 462 Candida famata This paten atpD 389 Streptococcus uberis This paten atpD 65 463 Candida glabrata This paten atpD 390 Tatumella ptyseos This paten atpD 464 Candida guilliermondii This paten atpD US 8,182,996 B2 121 122 TABLE 7-continued TABLE 7-continued Origin of the nucleic acids and/or Sequences in the Sequence listing. Origin of the nucleic acids and/or Sequences in the Sequence listing. SEQ Archaeal, bacterial, fungal SEQ Archaeal, bacterial, fungal ID NO. or parasitical species Source Gene 5 ID NO. or parasitical species Source Gene 465 Candida haemationi This paten atpD 607 Enterococcus faecalis WO98.2O157 till 466 Candida inconspicua This paten atpD 608 Enterococcus faecium WO98.2O157 till 467 Candida kefir This paten atpD 609 Enterococcus gallinarum WO98.2O157 till 468 Candida krusei This paten atpD 610 Haemophilus influenzae WO98.2O157 till 469 Candida iambica This paten atpD 10 611 Staphylococcus epidermidis WO98.2O157 till 470 Candida iusitaniae This paten atpD 612 Salmoneiia choieraestiis This paten 471 Candida norvegensis This paten atpD Subsp. Choleraestiis 472 Candida parapsilosis This paten atpD serotype Paratyphi A 473 Candida rugosa This paten atpD 613 Serratia ficaria This paten 474 Candida sphaerica This paten atpD 614 Enterococcus maiodoratus This paten tuf (C) 475 Candida tropicalis This paten atpD 15 615 Enterococcus durans This paten tuf (C) 476 Candida utilis This paten atpD 616 Enterococci is pseudoavium This paten tuf (C) 477 Candida viswanathi This paten atpD 617 Enterococcus dispar This paten tuf (C) 478 Candida zeylanoides This paten atpD 618 Enterococci is avium This paten tuf (C) 479 Coccidioides inmitis This paten atpD 619 Saccharomyces cerevisiae Database tuf (M) 480 Cryptococcus albidus This paten atpD 621 Enterococcus faecium This paten tuf (C) 481 Fusarium oxysporum This paten atpD 622 Saccharomyces cerevisiae This paten tuf (EF-1) 482 Geotrichum sp. This paten atpD 2O 623 Cryptococcus neoformans This paten tuf (EF-1) 483 Histoplasma capsulatin This paten atpD 624 Candida albicans WO98/20157 tuf (EF-1) 484 Malassezia furfur This paten atpD 662 Corynebacterium diphtheriae WO98.2O157 till 485 Malassezia pachydermatis This paten atpD 663 Candida catentiaia This paten atpD 486 Metschnikowia pulcherrima This paten atpD 665 Saccharomyces cerevisiae Database tuf (EF-1) 487 Penicilium marineffei This paten atpD 666 Saccharomyces cerevisiae Database atpD 488 Pichia anomaia This paten atpD 25 667 Trypanosoma cruzi This paten atpD 489 Pichia anomaia This paten atpD 668 Corynebacterium glutamicum Database 490 Rhodotoruia minuta This paten atpD 669 Escherichia coi Database atpD 491 Rhodotorula mucilaginosa This paten atpD 670 Helicobacter pylori Database atpD 492 Sporobolomyces salmonicolor This paten atpD 671 Clostridium acetobutyllicum Database atpD 493 Sporothrix schenckii This paten atpD 672 Cytophaga lytica Database atpD 494 Stephanoascus ciferrii This paten atpD 30 673 Ehrichiaristicii This patent atpD 495 Trichophyton mentagrophytes This paten atpD 674 Vibrio choieae This patent atpD 496 Wangiella dermatitidis This paten atpD 675 Vibrio choieae This patent tu 497 Yarrowia lipolytica This paten atpD 676 Leishmania enriettii This patent atpD 498 Aspergilius finigatus This paten tuf (M) 677 Babesia microti This patent tuf (EF-1) 499 Blastoschizomyces capitatus This paten tuf (M) 678 Cryptococcus neoformans This patent atpD 500 Candida rugosa This paten tuf (M) 35 679 Cryptococcus neoformans This patent atpD 501 Coccidioides inmitis This paten tuf (M) 680 Cunninghamella berthoiletiae This patent atpD 502 Fusarium oxysporum This paten tuf (M) 684 Candida tropicalis Database atplD (V) 503 Histoplasma capsulatum This paten tuf (M) 685 Enterococcus hirae Database atplD (V) 504 Paracoccidioides brasiliensis This paten tuf (M) 686 Chlamydia pneumoniae Database atplD (V) 505 Penicilium marineffei This paten tuf (M) 687 Haiobacterium sainarum Database atplD (V) 506 Pichia anomaia This paten tuf (M) 688 Homo sapiens Database atplD (V) 507 Trichophyton mentagrophytes his 86 tuf (M) 40 689 Plasmodium falciparum Database atplD (V) 508 arrowia lipolytica T his paten (M) 690 Saccharomyces cerevisiae Database atplD (V) 509 Babesia higemina Inis paren (EF- ) 691 Schizosaccharomyces pombe Database atplD (V) 510 Babesia bovis S 8Cl tuf (EF-1) 692 Trypanosoma Congotense D888Se. atplDD (V) 511 Crithidia fasciculata S 8Cl tuf (EF-1) hill D D (V) 512 Entamoeba histolytica This paten tuf (EF-1) 693 T. ermus t ermop ii.2iS 888Se. 8 513 Giardia iambia This paten tuf (EF-1) 45 698 Escherichia coi WO98.2O157 till 514 Leishmania tropica This paten tuf (EF-1) 709 Borreia burgdorferi Database atplD (V) 515 Leishmania aethiopica This paten tuf (EF-1) 710 Treponema pallidum Database atplD (V) 516 Leishmania tropica This paten tuf (EF-1) 711 Chlamydia trachomatis Genome project atpD (V) 517 Leishmania donovani This paten tuf (EF-1) 712 Enterococcus faecalis Genome project atpD (V) 518 Leishmania infantum This paten tuf (EF-1) 713 Meihanosarcina barkeri Database atplD (V) 519 Leishmania enrietti This paten tuf (EF-1) 50 714 Methanococcus jannaschii Database atplD (V) 520 Leishmania gerbilli This paten tuf (EF-1) 715 Porphyromonas gingivais Genome project atpD (V) 521 filming heriigi This paten : R- : 716 Streptococci is pneumoniae Genome project atpD (V) 522 Leishmania major This paten tuf (EF- 717 Burkhoideria maiei This paten 523 Leishmania amazonensis This paten tuf (EF-1) 718 Burkholderia pseudomaiei This paten 524 Leishmania mexicana T his 86 (EF- ) 719 Clostridium beijerinckii This paten 525 Leishmania tarentolae Inis paren (EF- ) 55 720 Cliostridium innocuum This paten 526 Leishmania tropica his paten tuf (E - ) 721 Clostridium novyi This paten 527 Neospora caninum This paten tuf (EF-1) 722 Cliostridium septicum This paten 528 Trichomonas vaginalis This paten tuf (EF-1) pt 529 Trypanosoma brucei S 8Cl tuf (EF-1) 723 Cliostridium tertium S 8Cl Subsp. brucei 724 Cliostridium tetani his paten 530 Crithidia fasciculata This paten atpD 725 Enterococcus maiodoratus nus 8t 531 Leishmania tropica This paten atpD 60 726 Enterococcus sulfureus S 8Cl 532 Leishmania aethiopica This paten atpD 727 Lactococci is garvieae This paten 533 Leishmania donovani This paten atpD 728 Mycoplasma pirum This paten 534 Leishmania infantum This paten atpD 729 Mycoplasma salivarium This paten 535 Leishmania gerbilli This paten atpD 730 Neisseria polysaccharea This paten 536 Leishmania heriigi This paten atpD 731 Sainoneiia choieraestis This paten 537 Leishmania major This paten atpD 65 Subsp. Choleraestiis 538 Leishmania amazonensis This paten atpD serotype Enteritidis US 8,182,996 B2 123 124 TABLE 7-continued TABLE 7-continued Origin of the nucleic acids and/or Sequences in the Sequence listing. Origin of the nucleic acids and/or Sequences in the Sequence listing. SEQ Archaeal, bacterial, fungal SEQ Archaeal, bacterial, fungal ID NO. or parasitical species Source Gene 5 ID NO. or parasitical species Source Gene 732 Saimoneiia choieraestiis This paten tu 831 Clostridium perfingens This paten atplD (V) Subsp. Choleraestis 832 Ciostridium tetani This paten atplD (V) Serotype Gallinarum 833 Streptococci is pyogenes Database atplD (V) 733 Saimoneiia choieraestiis This paten tu 834 Babesia bovis This paten atplD (V) Subsp. Choleraestis 10 835 Cryptosporidium parvum This paten atplD (V) serotype Paratyphi B 836 Leishmania infantum This paten atplD (V) 734 Saimoneiia choieraestiis This paten tu 837 Leishmania major This paten atplD (V) Subsp. Choleraestis 838 Leishmania tarentoiae This paten atplD (V) serotype Virchow 839 Trypanosoma brucei This paten atplD (V) 735 Serratia grimesii This paten tu 840 Trypanosoma cruzi This paten tuf (EF-1) 736 Clostridium difficile This paten tu 15 841 Trypanosoma cruzi This paten tuf (EF-1) 737 Burkholderia pseudomaiei This paten atpD 842 Trypanosoma cruzi This paten tuf (EF-1) 738 Clostridium bifermenians This paten atpD 843 Babesia bovis This paten tuf (M) 739 Clostridium beijerinckii This paten atpD 844 Leishmania aethiopica This paten tuf (M) 740 Clostridium difficile This paten atpD 845 Leishmania amazonensis This paten tuf (M) 741 Cliostridium ranosum This paten atpD 846 Leishmania donovani This paten tuf (M) 742 Clostridium septicum This paten atpD 847 Leishmania infantum This paten tuf (M) 743 Cliostridium tertium This paten atpD 2O 848 Leishmania enriettii This paten tuf (M) 744 Comamonas acidovorans This paten atpD 849 Leishmania gerbilli This paten tuf (M) 745 Klebsiella pneumoniae subsp. This paten atpD 850 Leishmania major This paten tuf (M) rhinoscieromatis 851 Leishmania mexicana This paten tuf (M) 746 Neisseria canis This paten atpD 852 Leishmania tarentoiae This paten tuf (M) 747 Neisseria cinerea This paten atpD 853 Trypanosoma cruzi This paten tuf (M) 748 Neisseria clinicui This paten atpD 25 854 Trypanosoma cruzi This paten tuf (M) 749 Neisseria elongata This paten atpD 855 Trypanosoma cruzi This paten tuf (M) Subsp. elongata 856 Babesia bigemina This paten atpD 750 Neisseria flavescens This paten atpD 857 Babesia bovis This paten atpD 751. Neisseria gonorrhoeae This paten atpD 858 Babesia microti This paten atpD 752 Neisseria gonorrhoeae This paten atpD 859 Leishmania guyanensis This paten atpD 753 Neisseria iacianica This paten atpD 30 860 Leishmania mexicana This paten atpD 754 Neisseria meningitidis This paten atpD 861 Leishmania tropica This paten atpD 755 Neisseria mucosa This paten atpD 862 Leishmania tropica This paten atpD 756 Neisseria subfiava This paten atpD 863 Bordeteila pertussis Database 757 Neisseria weaveri This paten atpD 864 Trypanosoma bruceii brucei Database tuf (EF-1) 758 Neisseria animalis This paten atpD 865 Cryptosporidium parvum This paten tuf (EF-1) 759 Proteus penneri This paten atpD 35 866 Staphylococci is saprophyticus This paten atpD 760 Saimoneiia choieraestiis This paten atpD 867 Zoogloea ramigera This paten atpD Subsp. Choleraestis 868 Staphylococcus saprophyticus This paten serotype Enteritidis 869 Enterococcus casselliflavus This paten 761 Yersinia pestis This paten atpD 870 Enterococcus casselliflavus This paten 762 Burkhoideria maiei This paten atpD 871 Enterococcus flavescens This paten 763 Cliostridium sordelii This paten atpD 872 Enterococcus gallinarum This paten 764 Clostridium novyi This paten atpD 40 873 Enterococcus gallinarum This paten 765 Cliostridium botulinum This paten atpD 874 Staphylococcus haemolyticus This paten 766 Clostridium histolyticum This paten atpD 875 Staphylococcus epidermidis This paten 767 Peptostreptococcus prevotii This paten atpD 876 Staphylococcus epidermidis This paten 768 Absidia corymbifera This paten atpD 877 Staphylococcus epidermidis This paten 769 Alternaria alternata This paten atpD 878 Staphylococcus epidermidis This paten 770 Aspergillus flavus This paten atpD 45 879 Enterococcus gallinarum This paten 771 Mucor circineioides This paten atpD 880 Pseudomonas aeruginosa This paten 772 Piedraia horitai This paten atpD 881 Enterococcus casselliflavus This paten 773 Pseudaliescheria boydii This paten atpD 882 Enterococcus casselliflavus This paten 774 Rhizopus oryzae This paten atpD 883 Enterococcus faecalis This paten 775 Scopulariopsis koningii This paten atpD 884. Enterococcus faecalis This paten 776 Trichophyton mentagrophytes This paten atpD 50 885 Enterococcus faecium This paten 777 Trichophyton tonsurans This paten atpD 886 Enterococcus faecium This paten 778 Trichosporon cutaneum This paten atpD 887 Zoogloea ramigera This paten 779 Cladophiaiophora carrionii This paten tuf (EF-1) 888 Enterococcus faecalis This paten 780 Cunninghamella berthoiletiae This paten tuf (EF-1) 889 Aspergilius finigatus This paten atpD 781 Curviliaria iunata This paten tuf (EF-1) 890 Penicillium marneffei This paten atpD 782 Fonsecaea pedrosoi This paten tuf (EF-1) 55 891 Paecillomyces lilacinus This paten atpD 783 Microsporum audouinii This paten tuf (EF-1) 892 Penicillium marneffei This paten atpD 784. Mucor circineioides This paten tuf (EF-1) 893 Sporothrix schenckii This paten atpD 785 Phialophora verrucosa This paten tuf (EF-1) 894 Malbranchea filamentosa This paten atpD 786 Saksenaea vasiformis This paten tuf (EF-1) 895 Paecillomyces lilacinus This paten atpD 787 Syncephalastrum racemosum This paten tuf (EF-1) 896 Aspergillus niger This paten atpD 788 Trichophyton tonsurans This paten tuf (EF-1) 897 Aspergilius finigatus This paten tuf (EF-1) 789 Trichophyton mentagrophytes This paten tuf (EF-1) 60 898 Penicillium marneffei This paten tuf (EF-1) 790 Bipolaris hawaiiensis This paten tuf (EF-1) 899 Piedraia horitai This paten tuf (EF-1) 791 Aspergilius finigatus This paten tuf (M) 900 Paecillomyces lilacinus This paten tuf (EF-1) 792 Trichophyton mentagrophytes This paten tuf (M) 901 Paracoccidioides brasiliensis This paten tuf (EF-1) 827 Clostridium novyi This paten atplD (V) 902 Sporothrix schenckii This paten tuf (EF-1) 828 Clostridium difficile This paten atplD (V) 903 Penicillium marneffei This paten tuf (EF-1) 829 Clostridium septicum This paten atplD (V) 65 904 Curviliaria iunata This paten tuf (M) 830 Cliostridium bointinum This paten atplD (V) 905 Aspergillus niger This paten tuf (M) US 8,182,996 B2 125 126 TABLE 7-continued TABLE 7-continued Origin of the nucleic acids and/or Sequences in the Sequence listing. Origin of the nucleic acids and/or Sequences in the Sequence listing. SEQ Archaeal, bacterial, fungal SEQ Archaeal, bacterial, fungal ID NO. or parasitical species Source Gene ID NO. or parasitical species Source Gene 906 Bipolaris hawaiiensis This paten tuf (M) 011 Streptococci is pneumoniae This paten bbb1a. 907 Aspergillus flavus This paten tuf (M) 012 Streptococci is pneumoniae This paten bbb1a. 908 Alternaria alternata This paten tuf (M) O13 Streptococci is pneumoniae This paten bbb1a. 909 Penicilium marineffei This paten tuf (M) 014 Streptococci is pneumoniae This paten bbb1a. 910 Penicilium marineffei This paten tuf (M) 10 O15 Streptococci is pneumoniae This paten bbb1a. 918 Escherichia coli Database recA O16 Streptococci is pneumoniae This paten bbb1a. 929 Bacteroides fragilis This paten atplD (V) O17 Streptococci is pneumoniae This paten bbb1a. 930 Bacteroides distasonis This paten atplD (V) 018 Streptococci is pneumoniae This paten bbb1a. 931 Porphyromonas asaccharolytica This paten atplD (V) O19 Streptococci is pneumoniae This paten bbb2b 932 Listeria monocytogenes This paten tu 020 Streptococci is pneumoniae This paten bbb2b 939 Saccharomyces cerevisiae Database recA (RadS1) 15 021 Streptococci is pneumoniae This paten bbb2b 940 Saccharomyces cerevisiae Database recA (Dmc1) 022 Streptococci is pneumoniae This paten bbb2b 941 Cryptococcus humicolus This paten atpD O23 Streptococci is pneumoniae This paten bbb2b 942 Escherichia coi This paten atpD 024 Streptococci is pneumoniae This paten bbb2b 943 Escherichia coi This paten atpD O25 Streptococci is pneumoniae This paten bbb2b 944 Escherichia coi This paten atpD 026 Streptococci is pneumoniae This paten bbb2b 945 Escherichia coli This paten atpD O27 Streptococci is pneumoniae This paten bbb2b 946 Neisseria polysaccharea This paten atpD 028 Streptococci is pneumoniae This paten bbb2b 947 Neisseria sicca This paten atpD O29 Streptococci is pneumoniae This paten bbb2b 948 Streptococcus mitis This paten atpD O30 Streptococci is pneumoniae This paten bbb2b 949 Streptococcus mitis This paten atpD O31 Streptococci is pneumoniae This paten bbb2b 950 Streptococcus mitis This paten atpD O32 Streptococci is pneumoniae This paten bbb2b 951 Streptococcus oralis This paten atpD 033 Streptococci is pneumoniae This paten bbb2b 952 Streptococcus pneumoniae This paten atpD 25 O34 Streptococci is pneumoniae This paten b2x 953 Streptococcus pneumoniae This paten atpD 035 Streptococcus pneumoniae This paten b2x 954 Streptococcus pneumoniae This paten atpD O36 Streptococci is pneumoniae This paten b2x 955 Streptococcus pneumoniae This paten atpD 037 Streptococcus pneumoniae This paten b2x 956 Babesia microti This paten atplD (V) 038 Streptococcus pneumoniae This paten b2x 957 Entamoeba histolytica This paten atplD (V) 039 Streptococcus pneumoniae This paten b2x 958 Fusobacterium nucleatum This paten atplD (V) 30 040 Streptococci is pneumoniae This paten b2x Subsp. polymorphin O41 Streptococci is pneumoniae This paten b2x 959 Leishmania aethiopica This paten atp) (V) 042 Streptococcus pneumoniae This paten b2x 960 Leishmania tropica This paten atplD (V) O43 Streptococci is pneumoniae This paten b2x 961 Leishmania guyanensis This paten atplD (V) 044 Streptococci is pneumoniae This paten b2x 962 Leishmania donovani This paten atplD (V) O45 Streptococci is pneumoniae This paten b2x 963 Leishmania heriigi This paten atplD (V) 35 O46 Streptococci is pneumoniae This paten b2x 964 Leishmania mexicana This paten atplD (V) O47 Streptococci is pneumoniae This paten b2x 965 Leishmania tropica This paten atplD (V) 048 Streptococci is pneumoniae This paten b2x 966 Peptostreptococcus anaerobius This paten atplD (V) 049 Enterococcus faecium This paten VanA 967 Bordeteila pertussis This paten 050 Enterococcus gallinarum This paten VanA 968 Bordeteila pertussis This paten 051 Enterococcus faecium This paten VanA 969 Enterococcus columbae This paten 052 Enterococcus faecium This paten VanA 970 Enterococcus flavescens This paten 40 053 Enterococcus faecium This paten VanA 971 Streptococcus pneumoniae This paten 054 Enterococcus faecalis This paten VanA 972 Escherichia coli This paten 055 Enterococcus gallinarum This paten VanA 973 Escherichia coli This paten 056 Enterococcus faecium This paten VanA 974 Escherichia coli This paten 057 Enterococcus flavescens This paten VanA 975 Escherichia coli This paten 058 Enterococcus gallinarum This paten wanC1 976 Mycobacterium avium This paten 45 059 Enterococcus gallinarum This paten wanC1 977 Streptococcus pneumoniae This paten 060 Enterococcus casselliflavus This paten wanC2 978 Mycobacterium gordonae This paten 061 Enterococcus casselliflavus This paten wanC2 979 Streptococcus pneumoniae This paten 062 Enterococcus casselliflavus This paten wanC2 980 Mycobacterium tuberculosis This paten 063 Enterococcus casselliflavus This paten wanC2 981 Staphylococcus warneri This paten 064 Enterococcus flavescens This paten wanC3 982 Streptococcus mitis This paten 50 065 Enterococcus flavescens This paten wanC3 983 Streptococcus mitis This paten 066 Enterococcus flavescens This paten wanC3 984 Streptococcus mitis This paten 067 Enterococcus faecium This paten wan XY 985 Streptococcus oralis This paten 068 Enterococcus faecium This paten wan XY 986 Streptococcus pneumoniae This paten 069 Enterococcus faecium This paten wan XY 987 Enterococcus hirae This paten tuf (C) 070 Enterococcus faecalis This paten wan XY 988 Enterococcus mindtii This paten tuf (C) 071 Enterococcus gallinarum This paten wan XY 989 Enterococcus raffinosus This paten tuf (C) 072 Enterococcus faecium This paten wan XY 990 Bacilius anthracis This paten recA 073 Enterococcus flavescens This paten wan XY 991 Prevoteila melaninogenica This paten recA 074 Enterococcus faecium This paten wan XY 992 Enterococcus casselliflavus This paten 075 Enterococcus gallinarum This paten wan XY 993 Streptococci is pyogenes Database speA O76 Escherichia coi Database StX 1002 Streptococci is pyogenes WO982O157 077 Escherichia coi Database StX2 1003 Bacilius cereus This paten recA 60 093 Staphylococcus saprophyticus This paten unknown 1004 Streptococci is pneumoniae This paten pbpla 117 Enterococcus faecium Database wanB 1005 Streptococcus pneumoniae This paten pbpla 138 Enterococcus gallinarum Database wanC1 1006 Streptococci is pneumoniae This paten pbpla 139 Enterococcus faecium Database VanA 1007 Streptococcus pneumoniae This paten pbpla 140 Enterococcus casselliflavus Database wanC2 1008 Streptococcus pneumoniae This paten pbpla 141 Enterococcus faecium Database wan HAXY 1009 Streptococcus pneumoniae This paten pbpla 65 169 Streptococci is pneumoniae Database pbp1a 1010 Streptococci is pneumoniae This paten pbpla 172 Streptococci is pneumoniae Database pbp2b US 8,182,996 B2 127 128 TABLE 7-continued TABLE 7-continued Origin of the nucleic acids and/or Sequences in the Sequence listing. Origin of the nucleic acids and/or Sequences in the Sequence listing. SEQ Archaeal, bacterial, fungal SEQ Archaeal, bacterial, fungal ID NO. or parasitical species Source Gene 5 ID NO. or parasitical species Source Gene 173 Streptococci is pneumoniae Database pbp2x 376 Serraia marcescens Database aac6Ic 178 Staphylococcus aureus Database mecA 381 Escherichia coi Database anta 183 Streptococci is pneumoniae Database hexA 386 Staphylococcus aureus Database antAIa 184 Streptococci is pneumoniae This patent hexA 391 Escherichia coi Database aph3Ia 185 Streptococci is pneumoniae This patent hexA 10 396 Escherichia coi Database aph3IIa 186 Streptococci is pneumoniae This patent hexA 401 Enterococcus faecalis Database aph3IIIa 187 Streptococci is pneumoniae This patent hexA 406 Acinetobacter battmannii Database aph3VIa 188 Streptococcus oralis This patent hexA 411 Pseudomonas aeruginosa Database blacARB 189 Streptococcus mitis This patent hexA 416 Klebsiella pneumoniae Database blacMY-2 190 Streptococcus mitis This patent hexA 423 Escherichia coi Database blacTX-M-1 191 Streptococcus mitis This patent hexA 15 428 Salmonella choleraesuis Subsp. Database blacTX-M-2 198 Staphylococci is saprophyticits This patent KOW choleraestis serotype 215 Streptococci is pyogenes Database pcp Typhimurium 230 Escherichia coi Database tuf (EF-G) 433 Pseudomonas aeruginosa Database baMP 242 Enterococcus faecium Database did 438 Escherichia coi Database bladXA2 243 Enterococcus faecalis Database mtlF, mtlD 439 Pseudomonas aeruginosa Database bladXA10 244 Staphylococcusatiretts This paten unknown 442 Pseudomonas aeruginosa Database bapBR1 Subsp. aureus 2O 445 Salmonella choleraesuis Subsp. Database bapR2 245 Bacilius anthracis This paten atpD choleraestis serotype 246 Bacilius mycoides This paten atpD Typhimurium 247 Bacilius thuringiensis This paten atpD 452 Staphylococcus epidermidis Database rA 248 Bacilius thuringiensis This paten atpD 461 Escherichia coi Database hfra 249 Bacilius thuringiensis This paten atpD 470 Escherichia coi Database frb 250 Bacilius weihenstephanensis This paten atpD 25 475 Escherichia coi Database frV 251 Bacilius thuringiensis This paten atpD 480 Proteus mirabilis Database frVI 252 Bacilius thuringiensis This paten atpD 489 Escherichia coi Database frVII 253 Bacilius cereus This paten atpD 494 Escherichia coi Database frVII 254 Bacilius cereus This paten atpD 499 Escherichia coi Database frx 255 Staphylococcus aureus This paten gyra 504 Escherichia coi Database frxII 256 Bacilius weihenstephanensis This paten atpD 30 507 Escherichia coi Database frxII 257 Bacilius anthracis This paten atpD 512 Escherichia coi Database frxV 258 Bacillus thuringiensis This paten atpD 517 Escherichia coi Database frxVII 259 Bacilius cereus This paten atpD 518 Acinetobacter twofi This patent uSA 260 Bacilius cereus This paten atpD 519 Acinetobacter twofi This patent uSA-tu 261 Bacilius thuringiensis This paten atpD S800 262 Bacilius thuringiensis This paten atpD 35 520 Acinetobacter twofi This patent tuf 263 Bacilius thuringiensis This paten atpD 521 Haemophilus influenzae This patent uSA 264 Bacilius thuringiensis This paten atpD 522 Haemophilus influenzae This patent uSA-tu 265 Bacilius anthracis This paten atpD S800 266 Paracoccidioides brasiiensis This paten tuf (EF-1) 523 Haemophilus influenzae This patent tuf 267 Blastomyces dermatitidis This paten tuf (EF-1) 524 Proietis mirabilis This patent uSA 268 Histoplasma capsulatin This paten tuf (EF-1) 40 525 Proietis mirabilis This patent uSA-tu 269 Trichophyton rubrum Inis paren (EFRR ) 526 Proteus mirabilis This patent S800tuf 270 Microsporum canis S 8Cl tuf (EF-1) 527 Campylobacter curvus This patent atpD 271 Aspergillus versicolor S 8Cl tuf (EF-1) 530 Escherichia coi Database ereA 272 Exophiaia moniliae S 8Cl tuf (EF-1) 535 Escherichia coi Database ere3 273 Hortaea werneckii S 8Cl tuf (EF-1) 540 Staphylococcus haemolyticus Database inA 274 Fusarium Soiani S 8Cl tuf (EF-1) 545 Enterococcus faecium Database inB 275 Aureobasidium pullulans S 8Cl tuf (EF-1) 45 548 Streptococci is pyogenes Database mefA 276 Blastomyces dermatitidis S 8Cl tuf (EF-1) 551 Streptococci is pneumoniae Database mefE 277 Exophiaia dermatitidis S 8Cl tuf (EF-1) 560 Escherichia coi Database mph.A 278 Fusarium moniiforme S 8Cl tuf (EF-1) 279 Aspergillus terreus S 8Cl tuf (EF-1) 561 Candida albicans S 8Cl tuf (EF-1) 280 Aspergilius finigatus S 8Cl tuf (EF-1) 562 Candida dubiniensis S 8Cl tuf (EF-1) 281 Cryptococcus laurentii S 8Cl tuf (EF-1) 50 563 Candida famata S 8Cl tuf (EF-1) 282 Emmonsia parva S 8Cl tuf (EF-1) 564 Candida glabrata S 8Cl tuf (EF-1) 283 Fusarium Soiani S 8Cl tuf (EF-1) 565 Candida guilliermondii S 8Cl tuf (EF-1) 284 Sporothrix schenckii S 8Cl tuf (EF-1) 566 Candida haemationi S 8Cl tuf (EF-1) 285 Aspergillus nidulans S 8Cl tuf (EF-1) 567 Candida kefir S 8Cl tuf (EF-1) 286 Cladophialophora carrionii S 8Cl tuf (EF-1) 568 Candida iusitaniae S 8Cl tuf (EF-1) 287 Exserohium rostratum S 8Cl tuf (EF-1) 569 Candida sphaerica S 8Cl tuf (EF-1) 288 Bacilius thuringiensis S 8Cl recA 55 570 Candida tropicalis S 8Cl tuf (EF-1) 571 Candida viswanathi S 8Cl tuf (EF-1) 289 Bacilius thuringiensis S 8Cl recA 299 Staphylococcus aureus Database gyra 572 Alcaligenesb faecalisi S 8Cl 300 Escherichia coli Database gyra Subsp. faecais 573 Prevoieia buccais S 8Cl 307 Staphylococcus aureus Database gyrB 574. Succinivibriod 320 Escherichia coi Database parC (grlA) iCCaio extrinosolvens his paten 321 Staphylococcusatiretts Database parC (grlA) 60 575 Teiragenococcus halophilus his paten 328 Staphylococcus aureus Database parE (grilB) 576 Campylobacterjejiini S 8Cl atpD 348 unidentified bacterium Database aac2Ia Subsp...ieitini 351 Pseudomonas aeruginosa Database aac3Ib 577 Campylobacter rectus This paten atpD 356 Serraia marCescens Database aac3IIb 578 Enterococcus casselliflavus This paten uSA 361 Escherichia coi Database aac3IVa. 579 Enterococcus gallinarum This paten uSA 366 Enterobacter cloacae Database aac3VIa 65 580 Streptococcus mitis This paten uSA 371 Citrobacter koseri Database aac6Ia 585 Enterococcus faecium Database SatG US 8,182,996 B2 129 130 TABLE 7-continued TABLE 7-continued Origin of the nucleic acids and/or Sequences in the Sequence listing. Origin of the nucleic acids and/or Sequences in the Sequence listing. SEQ Archaeal, bacterial, fungal SEQ Archaeal, bacterial, fungal ID NO. or parasitical species Source Gene ID NO. or parasitical species Source Gene 590 Cloning vector pFW16 Database tetM 706 Streptococci is Saivarius WO98.20 57 recA 594 Enterococci is faecium Database wanD subsp. thermophilus 599 Enterococci is faecalis Database wanE 707 Escherichia coi WO98.20 57 OX8. 600 Campylobacterieitini This patent atpD 708 Enterococci is faecalis WO98.20 57 blaz, Subsp. doylei 10 709 Pseudomonas aeruginosa WO98.20 57 aac6'-IIa 6O1 Enterococci is stillfiretts This patent atpD 710 Staphylococcusatiretts WO98.20 57 ermA 602 Enterococci is solitarius This patent atpD 711 Escherichia coi WO98.20 57 erm 603 Campylobacterspittortin This patent atpD 712 Staphylococcusatiretts WO98.20 57 ermC Subsp. spittortin 713 Enterococci is faecalis WO98.20 57 604 Enterococci is pseudoavium This patent atpD 71.4 Campylobacterieitini This patent 607 Klebsiella ornithinolytica This patent gyra 15 Subsp...ieitini 608 Klebsiella Oxytoca This patent gyra 715 Abiotrophia adiacens WO98.20 57 613 Staphylococcusatiretts Database wat 716 Abiotrophia defectiva WO98.20 57 618 Staphylococcus cohnii Database watC 717 Corynebacterium accolens WO98.20 57 623 Staphylococcusatiretts Database Vga 718 Corynebacterium genitalium WO98.20 57 628 Staphylococcusatiretts Database B 719 Corynebacterium jeikeium WO98.20 57 633 Staphylococcusatiretts Database Y. 720 Corynebacterium WO98.20 57 638 Aspergilius finigatus This paten pseudodiphtheriticum 639 Aspergilius finigatus his paten 721 Corynebacterium striatum WO98.20 57 640 Bacilius mycoides his paten 722 Enterococci is a vitin WO98.20 57 641 Bacilius mycoides his paten 723 Gardnerella vaginalis WO98.20 57 642 Bacilius mycoides his paten 724 Listeria innoctia WO98.20 57 643 Bacilius pseudomycoides his paten 725 Listeria ivanovii WO98.20 57 644 Bacilius pseudomycoides his paten 25 726 Listeria monocytogenes WO98.20 57 645 Budvicia aquatica his paten 727 Listeria Seeigeri WO98.20 57 646 Buttiativelia agrestis his paten 728 Staphylococcusatiretts WO98.20 57 647 Candida norvegica his paten 729 Staphylococci is saprophyticus WO98.20 57 648 Streptococci is pneumoniae his paten b p 1 8. 730 Staphylococcus Sinitians WO98.20 57 649 Campylobacteriad his paten 731 Streptococci is agaiaciae WO98.20 57 6SO Coccidioides immiiis his paten 30 732 Streptococci is pneumoniae WO98.20 57 651 Emmonisia parva his paten 733 Streptococci is Saivarius WO98.20 57 652 Erwinia amylovora his paten 734 Agrobacterium radiobacter WO98.20 57 653 Fonsecaea pedrosoi his paten 735 Bacilius subtiis WO98.20 57 654 Fusarium moniiforme his paten 736 Bacteroides fragilis WO98.20 57 655 Klebsiella Oxytoca his paten 737 Borrelia burgdorferi WO98.20 57 his paten 656 Microsporum audouinii 35 738 Brevibacterium inens WO98.20 57 657 Obesumbacterium proteus his paten 739 Chlamydia trachomatis WO98.20 57 658 Paracoccidioides brasiiensis his paten 740 Fibrobacter succinogenes WO98.20 57 659 Plesiomonas Shigelioides his paten 741 Flavobacterium ferrugineum WO98.20 57 660 Shewanelia pittrefaciens his paten 742 Helicobacter pylori WO98.20 57 662 Campylobacter curvus his paten 743 Micrococcus initeus WO98.20 57 663 Campylobacter rectus his paten 744 Mycobacterium tuberculosis WO98.20 57 664 Fonsecaea pedrosoi his paten 40 745 Mycoplasma genitalium WO98.20 57 666 Microsporum audouinii his paten 746 Neisseria gonorrhoeae WO98.20 57 667 Piedraia horitai his paten 747 Rickettsia prowazeki WO98.20 57 668 Escherichia coi Database 748 Saimoneiia choieraestiis WO98.20 57 669 Saksenaea vasifornis his paten Subsp. Choleraestiis 670 Trichophyton tonsurans his paten serotype Typhimurium 671 Enterobacter aerogenes his paten 45 749 Shewanella puttrefaciens WO98.20 57 672 Bordeteila pertissis Database 750 Stigmatella aurantiaca WO98.20 57 673 Arcanobacterium his paten 751 Thiomonas cuprina WO98.20 57 haemolyticum 752 Treponema pallidiin WO98.20 57 674 Butyrivibriofibrisolvens his paten 753 Ureaplasma trealytictim WO98.20 57 675 Campylobacterieitini his paten N 754 Wolinella succinogenes WO98.20 57 Subsp. doylei 50 755 Burkholderia cepacia WO98.20 57 676 Campylobacteriani his paten 756 Bacilius anthracis S 8. el 677 Campylobacterspittortin his paten N 757 Bacilius anthracis his 8. el Subsp. spittortin 758 Bacilius cereus his 8. el 678 Campylobacter upsaliensis his paten 759 Bacilius cereus his 8. el 679 Giobicatella Sangitis his paten 760 Bacilius mycoides his 8. el his paten 68O Lactobacilius acidophilus 55 761 Bacilius pseudomycoides his 8. el 681 Leticonostoc mesenteroides his paten 762 Bacilius thuringiensis his 8. el Subsp. dextranictim 763 Bacilius thuringiensis his 8. el 682 Prevoteia buccais his paten 764 Klebsiella Oxytoca his 8. el 683 Ruminococcus bromii his paten 765 Klebsiella pneumoniae his 8. el 684 Paracoccidioides brasiiensis his paten Subsp. ozaenae 685 Candida norvegica his paten 766 Klebsiella planticola his 8. el 60 686 Aspergilius nidians his paten 767 Klebsiella pneumoniae his 8. el 687 Aspergilius terretts his paten 768 Klebsiella pneumoniae his 8. el 688 Candida norvegica his paten Subsp. pneumoniae 689 Candida parapsilosis his paten 769 Klebsiella pneumoniae his 8. el 702 Streptococci isgordonii WO982O157 Subsp. pneumoniae 703 Streptococci is mutans WO982O157 770 Klebsiella pneumoniae his 8. el 704 Streptococci is pneumoniae WO982O157 65 subsp. rhinoscleromatis 705 Streptococci is pyogenes WO982O157 771 Klebsiella terrigena his 8. el US 8,182,996 B2 131 132 TABLE 7-continued TABLE 7-continued Origin of the nucleic acids and/or Sequences in the Sequence listing. Origin of the nucleic acids and/or Sequences in the Sequence listing. SEQ Archaeal, bacterial, fungal SEQ Archaeal, bacterial, fungal ID NO. or parasitical species Source Gene 5 ID NO. or parasitical species Source Gene 772 Legionella pneumophila This paten gyra 830 Budvicia aquatica This paten fusA-tuf Subsp. pneumophia spacer 773 Proietis mirabilis This paten gyra 831 Plesiomonas Shigelioides This paten fusA-tuf 774 Providencia retigeri This paten gyra spacer 775 Proteus vulgaris This paten gyra 10 832 Obesumbacterium proteus S 8Cl fusA-tuf 776 Yersinia enterocolitica This paten rA spacer 777 Klebsiella Oxytoca This paten E. (grlA) 833 Shewanella putrefaciens S 8Cl fusA-tuf spacer 778 Klebsiella Oxytoca his paten parC (grlA) 834. Buttiauxella agrestis This paten fusA-tuf 779 Klebsiella pneumoniae This paten parC (grlA) spacer Subsp. Ozaenae 835 Campylobacter coli This paten 780 Klebsiella planticola This paten parC (grlA) 15 836 Campylobacter fetus This paten 781 Klebsiella pneumoniae This paten parC (grlA) Subsp. fetus 782 Klebsiella pneumoniae This paten parC (grlA) 837 Campylobacter fetus This paten Subsp. pneumoniae Subsp. venerealis 783 Klebsiella pneumoniae This paten parC (grlA) 838 Buttiauxella agrestis This paten Subsp. pneumoniae 839 Klebsiella Oxytoca This paten 784 Klebsiella pneumoniae This paten parC (grlA) 2O 840 Plesiomonas Shigelioides This paten Subsp. rhinoscleromatis 841 Shewanella putrefaciens This paten 785 Klebsiella terrigena This paten parC (grA) 842 Obesumbacterium proteus This paten 786 Bacilius cereus This paten uSA 843 Budvicia aquatica This paten 787 Bacilius cereus This paten uSA 844 Abiotrophia adiacens This paten atpD 788 Bacilius anthracis This paten uSA 845 Arcanobacterium This paten atpD 789 Bacilius cereus This paten uSA haemolyticum 790 Bacilius anthracis This paten uSA 25 846 Basidiobolus ranarum This paten atpD 791 Bacilius pseudomycoides This paten uSA 847 Blastomyces dermatitidis This paten atpD 792 Bacilius cereus This paten uSA 848 Blastomyces dermatitidis This paten atpD 793 Bacilius anthracis This paten uSA 849 Campylobacter coli This paten atpD 794 Bacilius cereus This paten uSA 850 Campylobacter fetus This paten atpD 795 Bacilius weihenstephanensis This paten uSA Subsp. fetus 796 Bacilius mycoides This paten uSA 30 851 Campylobacter fetus This paten atpD 797 Bacilius thuringiensis This paten uSA Subsp. venerealis 798 Bacilius weihenstephanensis This paten uSA-tu 1852 Campylobacter gracilis This paten atpD S800 853 Campylobacter jejuni This paten atpD 799 Bacilius thuringiensis S 8Cl uSA-tu Subsp...ieitini S800 800 Bacilius anthracis This paten uSA-tu 854 Enterococci is ceCortin Inis paten atpD S800 35 855 Enterococcits columbae Inis paten atpD 801 Bacilius pseudomycoides This paten uSA-tu 856 Enterococcus dispar his paten atpD S800 857 Enterococcus maiodoratus This paten atpD 802 Bacilius anthracis This paten uSA-tu 858 Enterococcus mindtii This paten atpD S800 859 Enterococcus raffinosus This paten atpD 803 Bacilius cereus This paten uSA-tu 860 Giobicatella sanguis This paten atpD S800 40 861 Lactococci is garvieae This paten atpD 804 Bacilius cereus This paten uSA-tu 862 Lactococcusiactis This paten atpD S800 863 Listeria ivanovii This paten atpD 805 Bacilius mycoides S 8Cl uSA-tu 864 Succini vibrio dextrinosolvens This paten atpD 806 Bacilius cereus This paten E. 865 Tetragenococcus halophilus T his 8t atpD S800 866 Campylobacter fetus S 8Cl recA 807 Bacilius cereus This paten uSA-tu 45 Subsp. fetus S800 867 Campylobacter fetus S 8Cl recA 808 Bacilius cereus This paten uSA-tu Subsp. venerealis S800 868 Campylobacter jejuni This paten recA 809 Bacilius anthracis This paten uSA-tu Subsp...ieitini S800 869 Enterococci is avium This paten recA 810 Bacilius mycoides This paten tuf 870 Enterococcus faecium This paten recA 811 Bacilius thuringiensis This paten tuf 50 871 Listeria monocytogenes This paten recA 812 Bacilius cereus This paten tuf 872 Streptococcus mitis This paten recA 813 Bacilius weihenstephanensis This paten tuf 873 Streptococcus oralis This paten recA 814 Bacilius anthracis This paten tuf 874 Aspergiiitisfiinigatus This paten tuf (M) 815 Bacilius cereus This paten tuf 875 Aspergillus versicolor This paten tuf (M) 816 Bacilius cereus This paten tuf 876 Basidiobolus ranarum This paten tuf (M) 817 Bacilius anthracis This paten tuf 55 877 Campylobacter gracilis This paten tuf 818 Bacilius cereus This paten tuf 878 Campylobacter jejuni This paten tuf 819 Bacilius anthracis This paten tuf Subsp...ieitini 820 Bacilius pseudomycoides This paten tuf 879 Coccidioides inmitis This paten tuf (M) 821 Bacilius cereus This paten tuf 880 Erwinia amylovora This paten tuf 822 Streptococcus oralis This paten uSA 881 Saimoneiia choieraesuis This paten tuf 823 Budvicia aquatica This paten uSA 60 Subsp. 824 Bittiativelia agrestis This paten uSA choleraesuis Serotype 825 Klebsiella Oxytoca This paten uSA Typhimurium 826 Plesiomonas Shigelioides This paten uSA 899 Klebsiella pneumoniae Database baSHV 827 Shewanella putrefaciens This paten uSA 900 Klebsiella pneumoniae Database baSHV 828 Obesumbacterium proteus This paten uSA 901 Escherichia coi Database baSHV 829 Klebsiella Oxytoca This paten fusA-tuf 65 902 Klebsiella pneumoniae Database baSHV spacer 903 Klebsiella pneumoniae Database baSHV US 8,182,996 B2 133 134 TABLE 7-continued TABLE 7-continued Origin of the nucleic acids and/or Sequences in the Sequence listing. Origin of the nucleic acids and/or Sequences in the Sequence listing. SEQ Archaeal, bacterial, fungal SEQ Archaeal, bacterial, fungal ID NO. or parasitical species Source Gene 5 ID NO. or parasitical species Source Gene 904 Escherichia coi Database baSHV 2183 Alcaligenes faecalis This paten tuf 905 Pseudomonas aeruginosa Database baSHV Subsp. faecais 927 Neisseria meningitidis Database baTEM 2184 Campylobacter coli This paten fusA 928 Escherichia coli Database baTEM 2185 Succini vibrio dextrinosoivens This paten tuf 929 Klebsiella Oxytoca Database baTEM 10 2186 Tetragenococcus halophilus This paten tuf 930 Escherichia coli Database baTEM 2187 Campylobacter jejuni This paten fusA 931 Escherichia coli Database baTEM Subsp...ieitini 932 Escherichia coli Database baTEM 2188 Campylobacter jejuni This paten fusA 933 Escherichia coli Database baTEM Subsp...ieitini 954 Klebsiella pneumoniae Database gyra 2189 Leishmania guyanensis This paten atpD Subsp. pneumoniae 15 2190 Trypanosoma bruceii brucei This paten atpD 956 Candida inconspicua This patent tuf (M) 2191 Aspergillus nidulans This paten atpD 957 Candida utilis This patent tuf (M) 2192 Leishmania panamensis This paten atpD 958 Candida zeylanoides This patent tuf (M) 2193 Aspergillus nidulans This paten tuf (M) 959 Candida catentiaia This patent tuf (M) 2194 Aureobasidium pullulans This paten tuf (M) 960 Candida krusei This patent tuf (M) 2195 Emmonsia parva This paten tuf (M) 965 Plasmid pCSO5 Database Sull 2196 Exserohiium rostratum This paten tuf (M) 970 Transposon Tn10 Database etB 2O 2197 Fusarium moniliforme This paten tuf (M) 985 Cryptococcus neoformans Database tuf (EF-1) 2198 Fusarium Soiani This paten tuf (M) 986 Cryptococcus neoformans Database tuf (EF-1) 2199 Histoplasma capsulatum This paten tuf (M) 987 Saccharomyces cerevisiae Database tuf (EF-1) 2200 Kocuria kristinae This paten tuf 988 Saccharomyces cerevisiae Database tuf (EF-1) 2201 Vibrio mimicus This paten tuf 989 Eremothecium gossypii Database tuf (EF-1) 2202 Citrobacter fieundii This paten recA 990 Eremothecium gossypii Database tuf (EF-1) 25 2203 Cliostridium botulinum This paten recA 991 Aspergillus oryzae Database tuf (EF-1) 2204 Franciselia tularensis This paten recA 992 Aureobasidium pullulans Database tuf (EF-1) 2205 Peptostreptococcus anaerobius This paten recA 993 Histoplasma capsulatum Database tuf (EF-1) 2206 Peptostreptococcus This paten recA 994 Neurospora crassa Database tuf (EF-1) asaccharolyticus 995 Podospora anserina Database tuf (EF-1) 2207 Providencia Stuarii This paten recA 996 Podospora curvicola Database tuf (EF-1) 30 2208 Sainoneiia choieraestis This paten recA 997 Sordaria macrospora Database tuf (EF-1) Subsp. Choleraestiis 998 Trichoderma reesei Database tuf (EF-1) serotype Paratyphi A 2004 Candida albicans Database tuf (M) 2209 Sainoneiia choieraestis This paten recA 2005 Schizosaccharomyces pombe Database tuf (M) Subsp. Choleraestiis 2010 Klebsiella pneumoniae Database baTEM serotype Typhimurium 2011 Klebsiella pneumoniae Database baTEM 35 2210 Staphylococci is saprophyticits This paten recA 2013 Kluyvera ascorbata This patent gyra 2211 Yersinia pseudotuberculosis This paten recA 2014 Kluyverageorgiana This patent gyra 2212 Zoogloea ramigera This paten recA 2047 Streptococci is pneumoniae Database bbp1A 2214 Abiotrophia adiacens This paten uSA 2048 Streptococci is pneumoniae Database bbp1A 2215 Acinetobacter battmannii This paten uSA 2049 Streptococcus pneumoniae Database bbp1A 2216 Actinomyces meyeri This paten uSA 2050 Streptococcus pneumoniae Database bbp1A 2217 Clostridium difficile This paten uSA 2051 Streptococci is pneumoniae Database bbp1A 40 2218 Corynebacterium diphtheriae This paten uSA 2052 Streptococci is pneumoniae Database bbp1A 2219 Enterobacter cloacae This paten uSA 2053 Streptococcus pneumoniae Database bbp1A 2220 Klebsiella pneumoniae This paten uSA 2054 Streptococci is pneumoniae Database gyra Subsp. pneumoniae 2055 Streptococcus pneumoniae Database barC 2221 Listeria monocytogenes This paten uSA 2056 Streptococcus pneumoniae This patent bbp1A 2222 Mycobacterium avium This paten uSA 2057 Streptococcus pneumoniae This patent bbp1A 45 2223 Mycobacterium gordonae This paten uSA 2058 Streptococcus pneumoniae This patent bbp1A 2224 Mycobacterium kansasii This paten uSA 2059 Streptococcus pneumoniae This patent bbp1A 2225 Mycobacterium terrae This paten uSA 2060 Streptococci is pneumoniae This patent bbp1A 2226 Neisseria polysaccharea This paten uSA 2061 Streptococci is pneumoniae This patent bbp1A 2227 Staphylococcus epidermidis This paten uSA 2062 Streptococci is pneumoniae This patent bbp1A 2228 Staphylococcus haemolyticus This paten uSA 2063 Streptococcus pneumoniae This patent bbp1A 50 2229 Succini vibrio dextrinosoivens This paten uSA 2O64 Steptococcus pneumoniae This patent bbp1A 2230 Tetragenococcus halophilus This paten uSA 2072 Mycobacterium tuberculosis Database rpoB 2231 Veiioneiia parvutta S 8Cl SA. 2097 Mycoplasma pneumoniae Database tuf 2232 Yersinia pseudotuberculosis This paten uSA 2101 Mycobacterium tuberculosis Database inha 2233 Zoogigtoea ramigera S 8Cl SA. 2105 Mycobacterium tuberculosis Database emb3 2234 Aeromonas hydrophilvaropnita S 8Cl SA. 2129 Clostridium difficile Database cotA 55 2235 Abiotrophia adiacens This paten fusA-tuf 2130 Clostridium difficile Database cdtB spacer 2137 Pseudomonasputida Genome project tuf 2236 Acinetobacter battmannii This paten fusA-tuf 2138 Pseudomonas aeruginosa Genome project tuf spacer 2139 Campylobacter jejuni Database atpD 2237 Actinomyces meyeri This paten fusA-tuf 2140 Streptococci is pneumoniae Database pbp1a spacer 2144 Staphylococcusatiretts Database mup A 60 2238 Clostridium difficile This paten fusA-tuf 2147 Escherichia coi Database cat spacer 2150 Escherichia coli Database catII 2239 Corynebacterium diphtheriae S 8Cl fusA-tuf S800 2153 Shigella flexneri Database catIII 2240 Enterobacter cloacae This paten Eur 2156 Clostridium perfingens Database catP spacer 2159 Staphylococcus aureus Database cat 2241 Klebsiella pneumoniae This paten fusA-tuf 2162 Staphylococcusatiretts Database cat 65 spacer 2165 Salmonella typhimurium Database ppflo-like Subsp. pneumoniae US 8,182,996 B2 135 136 TABLE 7-continued TABLE 8-continued Origin of the nucleic acids and/or Sequences in the Sequence listing. Bacterial species used to test the specificity of the Streptococcus agalactiae-specific amplification primers derived from tuf sequences. SEQ Archaeal, bacterial, fungal ID NO. or parasitical species Source Gene 5 Strain Reference number 2242 Listeria monocytogenes This paten fusA-tuf Streptococci is downei ATCC 33748 spacer Streptococci is dysgalaciae ATCC 43078 2243 Mycobacterium avium This paten fusA-tuf Streptococci is equi Subsp. equi ATCC 9528 spacer Streptococci is fertis ATCC 33477 2244 Mycobacterium gordonae S 8Cl fusA-tuf 10 Streptococci isgordonii ATCC 10558 224.5 Mycobacterium kansasii This paten S800Ruf RC focus place A: 3. 2246 Mycobacterium terrae This paten R tuf Streptococci is mutans ATCC 25175 spacer Streptococci is oralis ATCC 35037 2247 Neisseria polysaccharea This paten fusA-tuf Streptococci is parasanguinis ATCC 15912 spacer 15 Streptococci is paratiberis DSM 6631 2248 Staphylococcus epidermidis This paten fusA-tuf Streptococci is pneumoniae ATCC 27336 spacer Streptococci is pyogenes ATCC 1961S 2249 Staphylococcus haemolyticus This paten fusA-tuf Streptococci is ratti ATCC 1964.5 spacer Streptococci is salivarius ATCC 7073 2255 Abiotrophia adiacens This paten Streptococci is sanguinis ATCC 10556 2256 Acinetobacter battmannii This paten Streptococci is sobrinus ATCC 27352 2257 Actinomyces meyeri This paten 2O Streptococci is stiis ATCC 43765 2258 Clostridium difficile This paten Streptococci is liberis ATCC 19436 2259 Corynebacterium diphtheriae This paten Streptococci is vestibularis ATCC 49124 2260 Enterobacter cloacae This paten Bacteroides caccae ATCC 4318.5 2261 Klebsiella pneumoniae This paten Bacteroides vulgatus ATCC 84.82 Subsp. pneumoniae Bacteroides fragilis ATCC 2S285 2262 Listeria monocytogenes This paten 25 Candida albicans ATCC 11006 2263 Mycobacterium avium This paten Cliostridium innoculum ATCC 145O1 2264 Mycobacterium gordonae This paten Cliostridium ranosum ATCC 25582 2265 Mycobacterium kansasii This paten Lactobacilius casei Subsp. casei ATCC 393 2266 Mycobacterium terrae This paten Clostridium septicum ATCC 12464 2267 Neisseria polysaccharea This paten Corynebacterium cervicis NCTC 10604 2268 Staphylococcus epidermidis This paten 30 Corynebacterium genitalium ATCC 33031 2269 Staphylococcus haemolyticus This paten Corynebacterium urealyticum ATCC 43O42 2270 Aeromonas hydrophila This paten Enterococcus faecalis ATCC 29212 2271 Bilophila wadsworthia This paten Enterococci is faecium ATCC 19434 2272 Brevundimonas diminuta This paten Eubacterium ienium ATCC 43OSS 2273 Streptococcus mitis This paten pbpla Eubacterium nodultum ATCC 33099 2274 Streptococcus mitis This paten pbpla Gardnerella vaginalis ATCC 14018 2275 Streptococcus mitis This paten pbpla 35 Lactobacilius acidophilus ATCC 4356 2276 Streptococcus oralis This paten pbpla Lactobacilius crispatus ATCC 33820 2277 Escherichia coli This paten gyra Lactobacilitisgasseri ATCC 33323 2278 Escherichia coli This paten gyra Lactobacilius johnsonii ATCC 33200 2279 Escherichia coli T his paren gyra Lactococci is lactis Subsp. lactis ATCC 19435 2280 Escherichia coli S 8Cl gyra 40 Lactococci is lactis Subsp. lactis ATCC 11454 2288 Enterococcus faecium Database did Listeria innoctia ATCC 33090 2293 Enterococcus faecium Database VanA Micrococcus luteus ATCC 9341 2296 Enterococcus faecalis Database wanB Escherichia coi ATCC 25922 tufindicates tufsequences, tuf (C) indicates tufsequences divergent from main (usually A Micrococcus lyilae ATCC 27566 andB) copies E. factor-Tu, SEF, indicates E. of the SE Porphyromonas asaccharolytica ATCC 2S260 otic type (elongation factor 1C), tuf (M) indicates tuf sequences from organellar (mostly 45 Prevoteila corporis ATCC 33S47 E. : fusA-tuf indicates the int ic region between fusA Prevoteila melanogenica ATCC 2S845 and tuf, quences; IusA- spacer indicates the intergenic region between us Staphylococcits (iiietS ATCC 13301 atpD indicates atpd sequences of the F-type, atpd (V) indicates atpd sequences of the Staphylococci is epidermidis ATCC 14990 Ridicates recA sequences, recA(RadS1) indicates radiš1 sequences or homologs and Staphylococci is saprophyticus ATCC 1530S recA(Dmc1) indicates dimc1 sequences or homologs, 50 TABLE 8 TABLE 9 Bacterial species used to test the specificity of the Streptococcus Bacterial species used to test the specificity of the Streptococcus agalactiae-specific amplification primers derived from tuf sequences. agalactiae-specific amplification primers derived from atpD sequences. 55 Strain Reference number Strain Reference number Streptococci is acidominimits ATCC S1726 Streptococci is acidominimits ATCC 51726 Streptococci is agaiaciae ATCC 12403 Streptococci is agaiaciae ATCC 12400 Streptococci is agaiaciae ATCC 12973 Streptococci is agaiaciae ATCC 12403 Streptococci is agaiaciae ATCC 13813 60 Streptococci is agaiaciae ATCC 12973 Streptococci is agaiaciae ATCC 27591 Streptococci is agaiaciae ATCC 13813 Streptococci is agaiaciae CDCS 1073 Streptococci is agaiaciae ATCC 27591 Streptococci is anginostis ATCC 27335 Streptococci is agaiaciae CDCS-1073 Streptococci is anginostis ATCC 33397 Streptococci is anginostis ATCC 27335 Streptococcus bovis ATCC 33317 Streptococci is anginostis ATCC 27823 Streptococci is anginostis ATCC 27823 Streptococcus bovis ATCC 33317 Streptococci is cricetus ATCC 19642 65 Streptococci is cricetus ATCC 19642 Streptococci is cristatus ATCC S1100 Streptococci is cristatus ATCC S1100 US 8,182,996 B2 137 138 TABLE 9-continued TABLE 10-continued Bacterial species used to test the specificity of the Streptococcus Bacterial species used to test the specificity of the Enterococcus-specific agalactiae-specific amplification primers derived from atpD sequences. amplification primers derived from tufsequences. Strain Reference number 5 Strain Reference number Streptococci is downei ATCC 33748 Pediococcus acidiacii ATCC 33314 Streptococci is dysgalaciae ATCC 43078 Pediococcuspentosaceus ATCC 33.316 Streptococci is equi Subsp. equi ATCC 9528 Peptococci is niger ATCC 27731 Streptococci is fertis ATCC 33477 Peptostreptococci is anaerobius ATCC 27337 Streptococci isgordonii ATCC 10558 10 Peptostreptococci is indolicits ATCC 292.47 Streptococci is macacae ATCC 35911 Peptostreptococci is microS ATCC 33270 Streptococci is mitis ATCC 49456 Propionibacterium acnes ATCC 6919 Streptococci is mutans ATCC 251.75 Staphylococcusatiretts ATCC 43300 Streptococci is oralis ATCC 35037 Staphylococci is capitis ATCC 27840 Streptococci is parasanguinis ATCC 15912 Staphylococci is epidermidis ATCC 14990 Streptococci is paratiberis DSM 6631 15 Staphylococciis haemolyticus ATCC 2997O Streptococci is pneumoniae ATCC 27336 Staphylococcus hominis ATCC 27844 Streptococci is pyogenes ATCC 1961S Staphylococcits lugdunensis ATCC 43.809 Streptococci is ratti ATCC 1964.5 Staphylococcits saprophyticus ATCC 15305 Streptococci is Saivarius ATCC 7073 Staphylococci is Sinitians ATCC 27848 Streptococci is sanguinis ATCC 10556 Staphylococciis warneri ATCC 27836 Streptococci is agaiaciae ATCC 13813 Streptococcus sobrinus ATCC 27352 2O Streptococci is anginostis ATCC 33397 Streptococci is stiis ATCC 43765 Streptococcus bovis ATCC 33317 Streptococci is liberis ATCC 19436 Streptococci is constellatus ATCC 27823 Streptococcus vestibularis ATCC 49124 Streptococci is cristatus ATCC S1100 Streptococci is intermedius ATCC 27335 Streptococci is mitis ATCC 49456 25 Streptococci is mitis ATCC 3639 TABLE 10 Streptococci is mutans ATCC 271 75 Streptococci is parasanguinis ATCC 15912 Bacterial species used to test the specificity of the Enterococcus-specific Streptococci is pneumoniae ATCC 27736 amplification primers derived from tufsequences. Streptococci is pneumoniae ATCC 6303 Streptococci is pyogenes ATCC 1961S Strain Reference number 30 Streptococci is salivarius ATCC 7073 Streptococci is sanguinis ATCC 10556 Gram-positive species (n = 74) Streptococcus suis ATCC 43765 o Gram-negative species (n = 39) Abiotrophia adiacens ATCC 491.76 Abiotrophia defectiva ATCC 491.75 Acidominococci is fermenians ATCC 2508 Bacilius cereus ATCC 14579 35 Acinetobacter battmannii ATCC 19606 Bacilius subtiis ATCC 27370 Alcaligenes faecalis ATCC 8750 Bifidobacterium adolescentis ATCC 27534 Anaerobiospirilium ATCC 293 OS Bifidobacterium breve ATCC 15700 Sticciniproducers Bifidobacterium dentium ATCC 27534 Anaerorhabdits firCostis ATCC 25662 Bifidobacterium longum ATCC 15707 Bacteroides distasonis ATCC 8SO3 Clostridium perfingens ATCC 3124 40 Bacteroides theiaioiaomicron ATCC 29741 Clostridium septicum ATCC 12464 Bacteroides vulgatus ATCC 84.82 Corynebacterium aquaticits ATCC 14665 Bordeteila pertissis LSPQ 3702 Corynebacterium pseudodiphtheriticum ATCC 10700 Bulkhoideria cepacia LSPQ 2217 Enterococci is a vitin ATCC 14O2S Butyvibriofibrinosolvens ATCC 19171 Enterococci is cassellifiavits ATCC 25788 Cardiobacterium hominis ATCC 15826 Enterococcits ceCortin ATCC 431.99 Citrobacter fieundi ATCC 8090 Enterococcus columbae ATCCS1263 45 Desulfovibrio vulgaris ATCC 29579 Enterococci is dispar ATCCS1266 Edwardsieiae tarda ATCC 15947 Enterococcits durans ATCC 19432 Enterobacter cloacae ATCC 13047 Enterococci is faecalis ATCC 29212 Escherichia coi ATCC 25922 Enterococci is faecium ATCC 19434 Fusobacterium russi ATCC 25533 Enterococcits fiavescens ATCC 49996 Haemophilus influenzae ATCC 9007 Enterococcus gallinarum ATCC 49573 50 Hafnia alvei ATCC 13337 Enterococcus hirae ATCC 8044 Klebsiella Oxytoca ATCC 13182 Enterococcits maiodoratus ATCC 431.97 Meganomonas hypermegas ATCC 25560 Enterococcus mindtii ATCC 43186 Mitsukoeia multiacidus ATCC 27723 Enterococcus pseudoavium ATCC 493.72 Moraxeiia caiarrhais ATCC 43628 Enterococcits raffinostis ATCC 49.427 Morganella morgani ATCC 25830 Enterococci is saccharolyticals ATCC 43076 55 Neisseria meningitidis ATCC 13077 Enterococci is solitarius ATCC 49428 Pastetirella aerogenes ATCC 27883 Enterococcits sulfitre is ATCC 49903 Proteus vulgaris ATCC 13315 Etibacterium ientum ATCC 49903 Providencia alcalifaciens ATCC 9886 Gemella haemolysans ATCC 10379 Providencia retigeri ATCC 92SO Gemeia morbiorum ATCC 27842 Pseudomonas aeruginosa ATCC 27853 Lactobacilius acidophilus ATCC 4356 60 Salmonella typhimurium ATCC 14028 Leticonostoc mesenteroides ATCC 1922S Serraia marcescens ATCC 1388O Listeria gravi ATCC 1912O Shigella flexneri ATCC 12022 Listeria gravi ATCC 19123 Shigella sonnei ATCC 29930 Listeria innoctia ATCC 33090 Succini vibrio dextrinosolvens ATCC 19716 Listeria ivanovii ATCC 19119 Tissierelia praeactita ATCC 25539 Listeria monocytogenes ATCC 15313 Veillonella parvuala ATCC 10790 Listeria Seeigeri ATCC 35967 65 Yersinia enterocolitica ATCC 9610 Micrococcus initeus ATCC 9341 US 8,182,996 B2 139 140 TABLE 11 Microbial species for which tuf and/or atpD and/or recA sequences are available in public databases. Species Strain Accession number Coding gene tufsequences

Bacteria Actinobacilius actinomycetemcomitans HK1651 Genome project’ Actinobacilius actinomycetemcomitans HK1651 Genome project ( E G ) Agrobacterium timefaciens X99673 Agrobacterium timefaciens X99673 (EF-G) Agrobacterium timefaciens X99674 Anacystis nidulans PCC 6301 X17442

Aquifex aeolicits VF5 AEOOO669 Aquifex aeolicits VF5 AEOOO669 Aquifex pyrophilus Genome project’ Aquifex pyrophilus Y15787 Bacilius anthracis Ames Genome project Bacilius anthracis Ames Genome project’ ( E Bacilius halodurans C-125 ABO17508 Bacilius halodurans C-125 ABO17508 ( E Bacilius Stearothermophilus CCM 2184 AJOOO260 Bacilius subtiis 168 D64127 Bacilius subtiis 168 D64127 ( E Bacilius subtiis DSM 10 Z991.04 Bacilius subtiis DSM 10 Z991.04 ( E Bacteroides forsythus ATCC 43037 ABO3S466 Bacteroides fragilis DSM 1151 Bordeteila bronchiseptica RBSO Genome projec 2 Bordeteila pertissis Tohama 1 Genome project Bordeteila pertissis Tohama 1 Genome project (EF-G) Borrelia burdongferi B31 U78193 Borrelia burgdorferi AEOO115S (EF-G) Brevibacterium inens DSM 20425 X76863 Buchnera aphidicola Ap Y12307 Burkholderia pseudomaiei K96243 Genome project (EF-G) Campylobacterieitini NCTC 11168 Y17167 Campylobacterieitini NCTC 11168 CJ11168X2 (EF-G) Chlamydia pneumoniae CWLO29 AEOO1592 Chlamydia pneumoniae CWLO29 AEOO1639 (EF-G) Chlamydia trachomatis M74221 Chlamydia trachomatis D.UW-3, CX AEOO1317 (EF-G) Chlamydia trachomatis D.UW-3, CX AEOO130S Chlamydia trachomatis FIC-Ca-13 L22216 Chlorobium vibrioforme DSM 263 X77033 Chloroflexus aurantiacus DSM 636 X7686S Clostridium acetobutyllicum ATCC 824 Genome project Clostridium difficile 630 Genome projec Clostridium difficile 630 Genome projec (EF-G) Corynebacterium diphtheriae NCTC 13129 Genome project Corynebacterium diphtheriae NCTC 13129 Genome projec (EF-G) Corynebacterium glutamicum ASO 19 X77034 Corynebacterium glutamicum MJ-233 EO9634 Coxieia bunetii Nine Mile phase I AF13 6604 Cytophaga lytica DSM 2039 X77035 Deinococcus radiodurans R1 AEOO1891 (EF-G) Deinococcus radiodurans AE180092 Deinococcus radiodurans AEOO2O41 Deinonema sp. Eikeneia corrodens ATCC 23834 Eikeneia corrodens ATCC 23834 Z1261O (EF-G) Enterococci is faecalis Genome project’ (EF-G) Escherichia coi JO1690 Escherichia coi JO1717 Escherichia coi (EF-G) Escherichia coi X57091 Escherichia coi K-12 MG16SS UOOOOO6 Escherichia coi K-12 MG16SS UOOOO96 Escherichia coi K-12 MG16SS AEOOO410 (EF-G) Fervidobacterium islandicum DSM5733 Y15788 Fibrobacter succinogenes S85 X76866 Flavobacterium ferrigeneum DSM 13524 X76867 Flexistipes sinusarabici XS9461 tuf Gioeobacter violaceus PCC 7421 UO9433 Gloeothece sp. PCC 65O1 UO9434 Haemophilus actinomycetemcomitans HK1651 Genome project Haemophilus ducreyi 3SOOO AFO87414 (EF-G) Haemophilus influenzae Rd U32739 US 8,182,996 B2 141 142 TABLE 11-continued Microbial species for which tuf and/or atpD and/or recA sequences are available in public databases. Species Strain Accession number Coding gene Haemophilus influenzae U32746 Haemophilus influenzae U32739 ( E Helicobacter pylori AEOOOS11 Helicobacter pylori AEOO1539 ( E Helicobacter pylori AEOO1541 Herpetosiphon aurantiacus X76868 Klebsiella pneumoniae Genome project Klebsiella pneumoniae Genome project’ (E Lactobacilius paracasei E13922 Legionella pneumophila Philadelphia-1 Genome project Leptospira interrogans AF115283 Leptospira interrogans AF115283 Micrococcus luteus FO 3333 M17788 Micrococcus luteus FO 3333 M17788 Moraxella sp. TAC II 25 AJ249258 Mycobacterium avium O4 Genome project’ Mycobacterium avium O4 Genome project’ ( E Mycobacterium bovis AF2122,97 Genome project Mycobacterium bovis AF2122,97 Genome project ( E Mycobacterium leprae L13276 Mycobacterium leprae Z14314 Mycobacterium leprae Z14314 ( E Mycobacterium leprae Thai 53 D13869 Mycobacterium tuberculosis Erdmann S4O925 Mycobacterium tuberculosis H37Ry ALO21943 ( E Mycobacterium tuberculosis H37Ry Z84395 Mycobacterium tuberculosis y42 ADOOOOOS Mycobacterium tuberculosis CSU#93 Genome project’ Mycobacterium tuberculosis CSU#93 Genome project ( E Mycoplasma capricoium PG-31 X16462 Mycoplasma genitalium G37 U397.32 Mycoplasma genitalium G37 U39689 ( E Mycoplasma hominis X57136 Mycoplasma hominis PG21 M57675 Mycoplasma pneumoniae M129 AEOOOO19

Mycoplasma pneumoniae M129 AEOOOOS8 Neisseria gonorrhoeae MS11 L3638O Neisseria gonorrhoeae MS11 L3638O Neisseria meningitidis Z2491 Genome project 2 Neisseria meningitidis Z2491 Genome project 2 Pasteureia mitocida P70 Genome projec 2 Peptococci is niger DSM 20745 X76869 Phormidium ectocarpi PCC 7375 UO9443 Planobispora rosea ATCC 53773 U673O8 Planobispora rosea ATCC 53.733 X9883O Planobispora rosea ATCC 53.733 X9883O (EF-G) Plectonema bonyanum PCC 73110 UO9444 Porphyromonas gingivais W83 Genome project Porphyromonas gingivais W83 Genome project (EF-G) Porphyromonas gingivais FDC 381 ABO3S461 Porphyromonas gingivais W83 ABO3S462 Porphyromonas gingivais SUNY 1021 ABO3S463 Porphyromonas gingivais A7A1-28 ABO3.5464 Porphyromonas gingivais ATCC 33277 ABO3S465 Porphyromonas gingivais ATCC 33277 ABO3S471 (EF-G) Prochiorothrix holiandica UO9445 Pseudomonas aeruginosa PAO-1 Genome project Pseudomonas puttida Genome project’ Rickettsia prowazeki Madrid E A23S272 Rickettsia prowazeki Madrid E A23S270 (EF-G) Rickettsia prowazeki Madrid E ZS4171 (EF-G) Salmonella Choleraestis Subsp. choleraesuisserotype Typhimurium X64591 (EF-G) Salmonella Choleraestis Subsp. choleraesuisserotype Typhimurium LT2 trpE91 XSS 116 Salmonella Choleraestis Subsp. choleraesuisserotype Typhimurium X55117 Serputina hyodysenteriae U51635 Serraia marcescens AFOS8451 Shewanelia puttrefaciens DSMSO426 Shewanelia puttrefaciens MR-1 Genome project Spirochaeta aurantia DSM 1902 X76874 Staphylococcusatiretts A237696 (EF-G) Staphylococcusatiretts EMRSA-16 Genome project’ Staphylococcusatiretts NCTC 8325 Genome project US 8,182,996 B2 143 144 TABLE 11-continued Microbial species for which tuf and/or atpD and/or recA sequences are available in public databases. Species Strain Accession number Coding gene Staphylococcusatiretts COL Genome project tu Staphylococcusatiretts EMRSA-16 Genome project tuf (EF-G) Stigmatella aurantiaca DW4 X8282O Stigmatella aurantiaca Sga1 X76870 Streptococci is mutans GS-5 Kuramitsu U75481 Streptococci is mutans UAB159 Genome project tu Streptococci is oralis NTCC 11427 P331.701 Streptococci is pyogenes Genome project tuf (EF-G) Streptococci is pyogenes M1-GAS Genome project tu Streptomyces attreofaciens ATCC 10762 AFOOf12S Streptomyces cinnamonetis Tue&9 X98831 Streptomyces coelicolor A3(2) ALO31013 tuf (EF-G) Streptomyces coelicolor A3(2) X77039 tuf (EF-G) Streptomyces coelicolor M145 X77039 Streptomyces collinus BSM4O733 S794.08 Streptomyces neiropsis Tu1063 AF153618 Streptomyces ranocissini is X67.057 Streptomyces ranocissini is X67058 Streptomyces ranocissini is X67.057 tuf (E Synechococci is sp. PCC 6301 X17442 tuf (E Synechococci is sp. PCC 6301 X17442 Synechocystis sp. PCC 6803 D90913 tuf (EF-G) Synechocystis sp. PCC 6803 D90913 Synechocystis sp. PCC 6803 X651.59 tuf (EF-G) Taxeobacter occealits Myx 2105 X77.036 Thermotoga maritima Genome project tuf (EF-G) Thermotoga maritima M27479 Thermits aquaticits EP 00276 X66322 Thermus thermophilus HB8 X16278 tuf (EF-G) Thermus thermophilus HB8 XO5977 Thermus thermophilus HB8 XO6657 Thiomonas cuprina DSM5495 U783OO Thiomonas cuprina DSM5495 U783OO tuf (EF-G) Thiomonas cuprina Hoes X76871 Treponema denticola Genome project tu Treponema denticola Genome project tu Treponema pallidiin AEOO12O2 Treponema pallidiin AEOO1222 Treponema pallidiin AEOO1248 Ureaplasma trealytictim ATCC 33697 Z34275 Ureaplasma trealytictim Serovar 3 biovar 1 AE002151 Ureaplasma trealytictim Serovar 3 biovar 1 AE002151 tuf (EF-G) Vibrio choierae N1696.1 Genome project tu Wolinella succinogenes DSM 1740 X76872 Yersinia pestis CO-92 Genome project tu Yersinia pestis CO-92 Genome project tuf (EF-G) Archaebacteria Archaeoglobits filgidus Genome project tuf (EF-G) Haiobacterium marismortati X16677 Methanobacterium thermoautrophicum delta H AEOOO877 Methanococcus jannaschii ATCC 43067 U674.86 Meihanococcus vanniei XOS698 Pyrococcus abyssi Orsay AJ248.285 Thermoplasma acidophilum DSM 1728 XS3866 Fungi Absidia giatica CBS 101.48 X54730 ) Artila adeninivorans LS3 ZA7379 ) Aspergilius Oryzae KBN616 ABOO7770 ) Aureobasidium pitilitians R106 U19723 ) Candida albicans SCS314 Genome project tu Candida albicans SCS314 M2993.4 ) Candida albicans SCS314 M2993S ) Cryptococci is neoformans B3SO1 U818O3 ) Cryptococci is neoformans M1-106 U81804 ) Eremothecium gossypii ATCC 10895 X73978 ) Eremothecium gossypii A2982O ) Fusarium oxysportin NRRL 26037 AFOO8498 ) Histoplasma capsulatin 186AS U141OO ) Podospora aniserina X74799 ) Podospora curvicolia VLV X96614 ) Prototheca wickerhamii 263-11 AJ245.645 ) Puccinia graminis race 32 X73.529 ) Recinomonas a mericana ATCC SO394 AFOOf261 US 8,182,996 B2 145 146 TABLE 11-continued Microbial species for which tuf and/or atpD and/or recA sequences are available in public databases. Species Strain Accession number Coding gene

Rhizontcor racemosus ATCC 1216B X17475 Rhizontcor racemosus ATCC 1216B JO26OS Rhizontcor racemosus ATCC 1216B X17476 Rhodotoria mucilaginosa AFO16239 Saccharomyces cerevisiae KOO428 Saccharomyces cerevisiae MS9369 Saccharomyces cerevisiae XOO779 Saccharomyces cerevisiae XO1638 Saccharomyces cerevisiae M10992 Saccharomyces cerevisiae Alpha S288 X78993 Saccharomyces cerevisiae M15666 Saccharomyces cerevisiae Z35987 Saccharomyces cerevisiae S288C (AB972) U51033 Schizophyllum commune 1-40 X94913 Schizosaccharomyces pombe 972 ALO21816 Schizosaccharomyces pombe 972 ALO21813 Schizosaccharomyces pombe 972 D82571 ( E Schizosaccharomyces pombe tuf (EF-1) Schizosaccharomyces pombe PR745 D89112 Sordaria macrospora OOO X96615 Trichoderma reesei QM9414 Z23012 Yarrowia lipolytica AFOS4S10 Parasites

Blastocystis hominis HE87-1 D6408O Cryptosporidium parvum U69697 Eimeria teneia LS18 A1755521 Entamoeba histolytica HM1:IMSS X83565 Entamoeba histolytica NIH2OO M92O73 Giardia iambia D14342 Kentrophoros sp. AFOS 6101 Leishmania amazonensis IFLABRf67 PH8 M92653 Leishmania braziensis U72244 Onchocerca voivulus M64333 Porphyra purpurea Avonport UO8844 Plasmodium berghei ANKA AJ224150 Plasmodium falciparum X60488 Piasmodium knowiesi line H AJ224153 Toxoplasma gondii RH Y11431 Trichomonas tenax ATCC 30207 D784.79 Trypanosoma brucei LVH 75. U10562 USAMRU-K18 Trypanosoma Cruzi Y ( E ) Human and plants

Arabidopsis thaliana Columbia X89227 Glycine max Ceresia X890.58 Glycine max Ceresia Y15107 Glycine max Ceresia Y15108 Glycine max Maple Arrow X66062 Homo sapiens XO3558 Pyramimonas disomata ABOO8O10 atp) sequences

Bacteria

Acetobacterium woodi DSM 1030 U10505 Actinobacilius actinomycetemcomitans HK1651 Genome project Bacilius anthracis Ames Genome project Bacilius firmus OF4 M6O117 Bacilius negaterium QM B1551 M2O255 Bacilius Stearothermophilus D38058 Bacilius Stearothermophilus IFO1035 D38060 Bacilius subtiis 168 Z28592 Bacteroides fragilis DSM 2151 M22247 Bordeteila bronchiseptica RBSO Genome project Bordeteila pertissis Tohama 1 Genome project Borrelia burgdorferi B31 AEOO1122 ( V) Burkholderia cepacia DSMSO181 X76877 Burkholderia pseudomaiei K96243 Genome project Campylobacterieitini NCTC 11168 CJ11168X1 Chlamydia pneumoniae Genome projec 2 Chlamydia trachomatis MoPn Genome projec 2 V. Chlorobium vibrioforme DSM 263 X76873 Citrobacter fieundi JEO503 AFO371S6 D