DOCSLIB.ORG

(12) Patent Application Publication (10) Pub. No.: US 2005/0009771 A1 Levanon Et Al

Total Page：16

File Type：pdf, Size：1020Kb

Download full-text PDF Read full-text
(12) Patent Application Publication (10) Pub. No.: US 2005/0009771 A1 Levanon Et Al US 2005OOO9771A1 (19) United States (12) Patent Application Publication (10) Pub. No.: US 2005/0009771 A1 LeVanOn et al. (43) Pub. Date: Jan. 13, 2005 (54) METHODS AND SYSTEMS FOR (22) Filed: Jan. 27, 2004 IDENTIFYING NATURALLY OCCURRING ANTISENSE TRANSCRIPTS AND METHODS, Related U.S. Application Data KITS AND ARRAYS UTILIZING SAME (63) Continuation-in-part of application No. 10/441,281, (76) Inventors: Erez. Levanon, Petach Tikva (IL); filed on May 20, 2003. Jeanne Bernstein, Kfar Yona (IL); Sarah Pollock, Tel Aviv (IL); Alex Publication Classification Diber, Herzlia (IL); Zurit Levine, Herzlia (IL); Sergey Nemzer, Ramat 51)1) Int. Cl.C.7 ............................ A61K 48700 ; C12O 1/68; Gan (IL); Vladimir Grebinsky, G06F 19/00; G01N 33/48; Highland Park, NJ (US); Hanqing Xie, GO1N 33/50 Lambertville, NJ (US); Brian Meloon, (52) U.S. Cl. .................................... 514/44; 435/6; 702/20 Plainsboro, NJ (US); Andrew Olson, Westfield, NJ (US); Dvir Dahary, Tel Aviv (IL); Yossi Cohen, Woking (GB); (57) ABSTRACT Avi Shoshan, Kiryat Gat (IL); Shira Walach, Hod Hasharon (IL); Alon A method of identifying putative naturally occurring anti Wasserman, New York, NY (US); Sense transcripts is provided. The method is effected by (a) Rami Khosravi, Herzlia (IL); Galit computationally aligning a first database including Sense Rotman, Herzlia (IL) oriented polynucleotide Sequences with a Second database Correspondence Address: including expressed polynucleotide Sequences; and (b) iden G.E. EHRLICH (1995) LTD. tifying expressed polynucleotide Sequences from the Second c/o ANTHONY CASTORINA database being capable of forming a duplex with at least one 2001 JEFFERSON DAVIS HIGHWAY, SUITE Sense-oriented polynucleotide Sequence of the first database, 207 thereby identifying putative naturally occurring antisense ARLINGTON, VA 2.2202 (US) transcripts. Also provided are polynucleotides and polypep tide sequences identified by the above-described methodol (21) Appl. No.: 10/764,503 Ogy. Patent Application Publication Jan. 13, 2005 Sheet 1 of 48 US 2005/0009771 A1 No.==================--~~)=====::====::================= Patent Application Publication Jan. 13, 2005 Sheet 2 of 48 US 2005/0009771 A1 Patent Application Publication Jan. 13, 2005 Sheet 3 of 48 US 2005/0009771 A1 Fig. 4a 57oo Av7055320 90 Z4.4352.15 783 O. : 52 Query; l. gg acco agga tatgagcggaaaacactittct ct acttagatacaactttitt c 52 | | | | | | | Sbict : S2 ggaccCaggatatgagcggaaaacactittct ctact tagataca acttitt to 1 Fig. 4b 570 a Av705532 0 OO 2443.5214 649 O. : S2 Query: l ggacccaggatatgagcggaaaacactittctotacttagatacaacttitttc. 52 | | | | | | | | | | | | | | | | | | | | | | | | | | | | | | | | | | | Sbjct: 52 gga Cocaggatatgagcggaaaa cact ttctotact tagataca acttitt to l Fig. 4c 570 2 AV7055320 90 Z4.4352 l3 86. OLS 52 Query: l gg accCaggatatgagcggaaaacactittctotact tagataca acttittt c 52 . Sbjct: 52 ggacccaggatatgagcggaaaa cactittct ct acttagata caacttitt to l Fig. 4d 5710 AWO708600 2l 4 TBll 427 934 O. : 54 Query: 1 gtaaggga actittggcqact tagtgcgat cactgggaga attgtagagtccact 54 . Sbjct: l2.5 g taggga act t t gg.cgact tagtgcqat cactgggagaattgtagagt ccact ll 62 Score = 22 - 3 bits ( il), Expect r O. 66 Identities = 1 1/l ( l (O$ ) St. rand = Plus / Minus Query: 146 act tcca gagg l56 i ; Snjot.: 760 act tccagagg 750 Fig. 4e 571 l AWO708600 2l 4 T811426 2353 Os 54 Cuery gta agg gaa Ctttgg.cg act tagt gcgat cactgg gaga attgtagagt ccact 54 . Sajct. : l 215 gta agg gaa ct ttgg.cgact tagtgcgat cactgggaga attgtagagticcact lie2 Score = 22, 3 bits (ll, Expect s 0. 66 identities - il f l l Qs Stranc = Plus in JS Cuery: l (; 6 attacca gagg St. ; : S: ct; F 63 a ci Patent Application Publication Jan. 13, 2005 Sheet 4 of 48 US 2005/0009.771 A1 Score = 22.3 bits (1 l), Expect = 0.66 Identities = hl/ (OO } Strand = Plus / Plus Query: l 00 ggaaaacacac il 0 Sbjct : 1900 ggaaaa.ca cac 910 Fig. 4f 5712 AW0708600 214 T811424 2500 O. : 54 Query: 1 gtaagggaact ttgg.cgact tagt gcg at Cactgggaga attgtagagtccact 54 | | | | | | | | | | | | Sbjct : 1317 gtaagggaactittggcgact tagtgcgat cactgggaga attgttgagt ccact l264 Score = 22.3 bits (li), Expect O. 66 Identities s ll Will ( i 00) Strand = Plus / Minus Query: 146 act tcca gagg 56 Sbict: 862 act tccagagg 852 Score = 22.3 bits (ll), Expect as 0. 66 identities s ll Ali ( 0.0%) St. rand a Plus / Plus Query: 100 gyaaaacacac l 10 Sbict : 284 ggaaaa.ca cac 2C5 S713 Aw0708600 2l 4 T811423 94 OL: 54 Query: 1 gta aggga actittgg.cg act tagt g c gat cact g g gagaattgtagagt coact 54 i | | | | | | | | | | | | | | | | | | | | | | | | | | | | | | | Spict 224 gtaaggga a Ctttgg.cga ct tag togcq at Cactgg gaga attgtagagticcact ill 571.4 Awo708600 2l?. T8l. 1422 366 OL: S 4 Quer: gta agggia act t t ggag act tag toggat. cact gg gaga attgtagag tocact 54 i Shigt : 22 gta aggge & c. t.tggig act tag targat cactgg gaga attgtagag tecact lil Score = 22.3 bits l ; , Expect. is O. g. 6 Patent Application Publication Jan. 13, 2005 Sheet 5 of 48 US 2005/0009771 A1 Identities = lili fill (100) Strand = Plus / Plus Query : 10?) ggaaaa.ca cac l l () Sbct: 913 ggaaaacacac 923 Fig. 4i 572 O BE046369 O 422 W265533 1532 OL: 52 Query: aatctt cataatccCcatgtgtcaaaggaga gaccaggtggagglta actgaa 52 | | | | | | | | | | | | | | | | | | | | | | | | | | | | | | | | | | | | | | | | | | | | | | | | | | Sbjct: l 48l aat ctitcataatccccatgtgtcaaaggagagaccaggtggaggta actgaa 532 Fig. 4.j 5721 BE046369 O 422 w26553 2 753 OL: 52 Query: ll aatct toataatcc.ccatgtgtcaaaggaga gaccaggtggaggta actgaa 52 | | | | | | | | | | | | | | | | | | | | | | | | | | | Sbjct : 1702 aatct tca taatcccCatgtgtcaaaggagagaccagg toggaggta act gaa i753 Fig. 4k 5722 BE0463690 A22 W265531 832 OL, 52 Query: datctt cata at coccat gt at Caaaggaga gaccaggtggaggta act gaa 52 | | | | | | | | | | | | | | | | | | | | | | | | | | | | | | | | | | | | | | | | | | | | | | | | | | Sbjct : 78 aatctt cataatccc.catgttgttcaaaggaga gaccaggtggaggta actgaa l832 Patent Application Publication Jan. 13, 2005 Sheet 6 of 48 US 2005/0009771 A1 53BP1 76P 53BP1 lO394 6P 6837 OL: 304 6 OF : 54, 63 OF2: 208 Score = 1659 bits (837), Expect = 0.0 Identities - 840/84 (99%) Strand = P2 tas / Minus Query: 7432 gagacggaattitcgctottgttgccCaggctggaatgcaatggcacaatctoagct cact 749 | | | | | | | | | | | Sbict: 3il3 gagacggaattitcgcticttgttgcccagagctoggaatgcaatggcacaatctoragct cact 3054 Query: 7492 gcagogtctgct tcccaggttcaa.gcaattctectgtctoagcct cotgagtagctggga 755 . | | | | | | | | | | | | | | | | | | | | | Sbjct: 3053 gCagcgtotgct tcc.caggttcaagcaattct cotgtctoagcctoct9agtagctggga 2994 Query: 7552 ttacaggcacatgccaccacacctggctaattitttgtatttittagtagaatcgaggttt c 75. Sbict : 2993 ttacaggcacatgccaccacacctggctaattitttgtattitt tag tagaatcgaggtttc 2934 Que Ly: 7612 dually liggu digg.cgyuct caaact cuttgact tcaggtgat cog CCC90ct.cggcct 767 Sbict: 2933 at catgttgg toaggctgg totcaaacticctgact tcaggtgatcc.gc.ccgcctcggcct 287.4 Query : 7672 cccaaaq togct g g g atta caggtgtgagccaccatgccoggcctaagaaatacttittaag 77 3 | | | | | | | | | | | | | | Sbjct : 2873 cucaaagtgctgggatta caggtgtgagccaccatgcccggcctaagaaa cacttittaag 284 Query : 7732 tatattitt cattagctagaattgcccaatctgttgtaggtataaattact toggtataggga Sbict: 28 l3 tata t t t t cattagctaga attgcc.caatctgttgtagg tataa attacttggtataggga ry: F2 gaga gaaag.cct atct tacct gttgct ttct tacttggtgg taa.catccagoagittagt c | | | | | | | | | | | | | | | | | | | | | | | | | | | | | | | | | | | ct: 2753 gaga gaaagcci.atct tacct gttgctittct tact toggtgg taa.catccagoagttagt c Fig. 5a Patent Application Publication Jan. 13, 2005 Sheet 7 of 48 US 2005/0009771 A1 Query : 7852 tatttataaacataattact tttt cacatatgaaccataaaatatttaactittctgctict 791 | | | | | | | | | | | | | | | | | | | | | | | | | Sbjct: 2693 tatttataaacataattacttitt toacatatgaaccataaaatatttaactittctgctict 2634 Query: 792 a tattgtttgtttaccgct g tat ct cocacagottgaacagtaccaaggtacg tagtagg 7971. Sbjct: 2633 at attgtttgttctaccgctgtatic toccacagottgaacagtacca aggtacgtagtagg 2574 Query 7.972 togctcaataaatgactattgaataaatgaacatatocaacaaatgttctoaatgtaaagg 803 Sbjct : 2573 tyctoaataaatgactattgaataaatgaacatatocaacaaatgttctoaatgtaaagg 254 Query 8032 atcagagatgccacatgttct cottgatgggagaga.ccct tcca catgggaatgatggga 809 Sbjct: 25l3 at Cagagatgccacatgttct cottgatgggagagaccott.ccacatgggaatgatggga 245 4 Query : 8092 aggagttgtact cotggatgttcagta actgcttctaggagaaaagg tagagt cetatica 85. Sbct: 2453 aggagttgtacticctggatgttcagtaactgct tctaggagaaaaggtagagt cotatoa 23.93 Query : 8152 cta agcc.gcagatatttatttgttgtgtggctagaatgggatgttittgaatct tctgttac 82. Sbict : 2393 ct aag.ccgcag at attt atttgttge gtggetagaatgggatgtt t t gaatct tctgttac 2334 Query: 82l2 aacct togggaacgtggct gttatt toaattitatgagccagaaattitt cacatcccgaaac 8271 | | | | | | | | | | | | | | Sbj ct: 2333 a accttgggaacgtggctgttatt toaatt tatgagccagaaattt toacatcccgaaac 227. Query: 8272 822 ct: 2273 it 22 S Score = 1655 bits 835), Expect = O. C. Identi ties s. 849/85 6 (99& Strand Plus / Minus Fig. 5a continued Patent Application Publication Jan. 13, 2005 Sheet 8 of 48 US 2005/0009771 A1 Query: 5903 agatattgctittagggg tatttgatgtggtggtgacggaccCcticatgcc.cagoctoggt 59.62 | | | | | | | | | | | | | | | | | | | | | | | | | Sbct: 4642 aga tattgctt tagggg tatttgatgtggtggtgacggaCCCCtcatgcccagcctcggit 4583 Query: 5963 gctgaagtgtgctgaagcattgcagct gcctgtggtgtcaca agagtgggtgat coagtg 6022 | | | | | | | | | | | | | | | | | | | | | | | | | | | | | | | | | | | | | | | | | | | | | | | | | | | | | | | | | | | Sbict: 4582 gctgaagtgtgctgaag cattgcagct gcctgtggtgtcaca agagtgggtgatccagtg 1523 Query: 6023 cct cattgttggggagaga attggatt caagcagoat coaaaatataaacacgattatgt 6082 Sbjct
Load more

Recommended publications
  • Functional Characterization of the New 8Q21 Asthma Risk Locus
    Functional characterization of the new 8q21 Asthma risk locus Cristina M T Vicente B.Sc, M.Sc A thesis submitted for the degree of Doctor of Philosophy at The University of Queensland in 2017 Faculty of Medicine Abstract Genome wide association studies (GWAS) provide a powerful tool to identify genetic variants associated with asthma risk. However, the target genes for many allergy risk variants discovered to date are unknown. In a recent GWAS, Ferreira et al. identified a new association between asthma risk and common variants located on chromosome 8q21. The overarching aim of this thesis was to elucidate the biological mechanisms underlying this association. Specifically, the goals of this study were to identify the gene(s) underlying the observed association and to study their contribution to asthma pathophysiology. Using genetic data from the 1000 Genomes Project, we first identified 118 variants in linkage disequilibrium (LD; r2>0.6) with the sentinel allergy risk SNP (rs7009110) on chromosome 8q21. Of these, 35 were found to overlap one of four Putative Regulatory Elements (PREs) identified in this region in a lymphoblastoid cell line (LCL), based on epigenetic marks measured by the ENCODE project. Results from analysis of gene expression data generated for LCLs (n=373) by the Geuvadis consortium indicated that rs7009110 is associated with the expression of only one nearby gene: PAG1 - located 732 kb away. PAG1 encodes a transmembrane adaptor protein localized to lipid rafts, which is highly expressed in immune cells. Results from chromosome conformation capture (3C) experiments showed that PREs in the region of association physically interacted with the promoter of PAG1.
    [Show full text]
  • (12) Patent Application Publication (10) Pub. No.: US 2014/0155567 A1 Burk Et Al
    US 2014O155567A1 (19) United States (12) Patent Application Publication (10) Pub. No.: US 2014/0155567 A1 Burk et al. (43) Pub. Date: Jun. 5, 2014 (54) MICROORGANISMS AND METHODS FOR (60) Provisional application No. 61/331,812, filed on May THE BIOSYNTHESIS OF BUTADENE 5, 2010. (71) Applicant: Genomatica, Inc., San Diego, CA (US) Publication Classification (72) Inventors: Mark J. Burk, San Diego, CA (US); (51) Int. Cl. Anthony P. Burgard, Bellefonte, PA CI2P 5/02 (2006.01) (US); Jun Sun, San Diego, CA (US); CSF 36/06 (2006.01) Robin E. Osterhout, San Diego, CA CD7C II/6 (2006.01) (US); Priti Pharkya, San Diego, CA (52) U.S. Cl. (US) CPC ................. CI2P5/026 (2013.01); C07C II/I6 (2013.01); C08F 136/06 (2013.01) (73) Assignee: Genomatica, Inc., San Diego, CA (US) USPC ... 526/335; 435/252.3:435/167; 435/254.2: (21) Appl. No.: 14/059,131 435/254.11: 435/252.33: 435/254.21:585/16 (22) Filed: Oct. 21, 2013 (57) ABSTRACT O O The invention provides non-naturally occurring microbial Related U.S. Application Data organisms having a butadiene pathway. The invention addi (63) Continuation of application No. 13/101,046, filed on tionally provides methods of using Such organisms to produce May 4, 2011, now Pat. No. 8,580,543. butadiene. Patent Application Publication Jun. 5, 2014 Sheet 1 of 4 US 2014/O155567 A1 ?ueudos!SMS |?un61– Patent Application Publication Jun. 5, 2014 Sheet 2 of 4 US 2014/O155567 A1 VOJ OO O Z?un61– Patent Application Publication US 2014/O155567 A1 {}}} Hººso Patent Application Publication Jun.
    [Show full text]
  • Supplementary Data for “Sequence and Annotation of the 369-Kb NY-2A and the 345-Kb AR158 Viruses That Infect Chlorella NC64A”: Appendix D: Gene Names C006R – C815L
    University of Nebraska - Lincoln DigitalCommons@University of Nebraska - Lincoln Virology Papers Virology, Nebraska Center for 2-20-2007 Supplementary Data for “Sequence and annotation of the 369-kb NY-2A and the 345-kb AR158 viruses that infect Chlorella NC64A”: Appendix D: Gene Names C006R – C815L Lisa A. Fitzgerald University of Nebraska-Lincoln, [email protected] Michael V. Graves University of Massachusetts–Lowell, [email protected] Xiao Li University of Massachusetts–Lowell Tamara Feldblyum The Institute for Genomic Research, Rockville, MD Willaim C. Nierman The Institute for Genomic Research, Rockville, MD, [email protected] See next page for additional authors Follow this and additional works at: https://digitalcommons.unl.edu/virologypub Part of the Virology Commons Fitzgerald, Lisa A.; Graves, Michael V.; Li, Xiao; Feldblyum, Tamara; Nierman, Willaim C.; and Van Etten, James L., "Supplementary Data for “Sequence and annotation of the 369-kb NY-2A and the 345-kb AR158 viruses that infect Chlorella NC64A”: Appendix D: Gene Names C006R – C815L" (2007). Virology Papers. 10. https://digitalcommons.unl.edu/virologypub/10 This Article is brought to you for free and open access by the Virology, Nebraska Center for at DigitalCommons@University of Nebraska - Lincoln. It has been accepted for inclusion in Virology Papers by an authorized administrator of DigitalCommons@University of Nebraska - Lincoln. Authors Lisa A. Fitzgerald, Michael V. Graves, Xiao Li, Tamara Feldblyum, Willaim C. Nierman, and James L. Van Etten This article is available at DigitalCommons@University of Nebraska - Lincoln: https://digitalcommons.unl.edu/ virologypub/10 Main article published in Virology 358:2 (February 20, 2007), pp.
    [Show full text]
  • Supplementary Table S4. FGA Co-Expressed Gene List in LUAD
    Supplementary Table S4. FGA co-expressed gene list in LUAD tumors Symbol R Locus Description FGG 0.919 4q28 fibrinogen gamma chain FGL1 0.635 8p22 fibrinogen-like 1 SLC7A2 0.536 8p22 solute carrier family 7 (cationic amino acid transporter, y+ system), member 2 DUSP4 0.521 8p12-p11 dual specificity phosphatase 4 HAL 0.51 12q22-q24.1histidine ammonia-lyase PDE4D 0.499 5q12 phosphodiesterase 4D, cAMP-specific FURIN 0.497 15q26.1 furin (paired basic amino acid cleaving enzyme) CPS1 0.49 2q35 carbamoyl-phosphate synthase 1, mitochondrial TESC 0.478 12q24.22 tescalcin INHA 0.465 2q35 inhibin, alpha S100P 0.461 4p16 S100 calcium binding protein P VPS37A 0.447 8p22 vacuolar protein sorting 37 homolog A (S. cerevisiae) SLC16A14 0.447 2q36.3 solute carrier family 16, member 14 PPARGC1A 0.443 4p15.1 peroxisome proliferator-activated receptor gamma, coactivator 1 alpha SIK1 0.435 21q22.3 salt-inducible kinase 1 IRS2 0.434 13q34 insulin receptor substrate 2 RND1 0.433 12q12 Rho family GTPase 1 HGD 0.433 3q13.33 homogentisate 1,2-dioxygenase PTP4A1 0.432 6q12 protein tyrosine phosphatase type IVA, member 1 C8orf4 0.428 8p11.2 chromosome 8 open reading frame 4 DDC 0.427 7p12.2 dopa decarboxylase (aromatic L-amino acid decarboxylase) TACC2 0.427 10q26 transforming, acidic coiled-coil containing protein 2 MUC13 0.422 3q21.2 mucin 13, cell surface associated C5 0.412 9q33-q34 complement component 5 NR4A2 0.412 2q22-q23 nuclear receptor subfamily 4, group A, member 2 EYS 0.411 6q12 eyes shut homolog (Drosophila) GPX2 0.406 14q24.1 glutathione peroxidase
    [Show full text]
  • The Microbiota-Produced N-Formyl Peptide Fmlf Promotes Obesity-Induced Glucose
    Page 1 of 230 Diabetes Title: The microbiota-produced N-formyl peptide fMLF promotes obesity-induced glucose intolerance Joshua Wollam1, Matthew Riopel1, Yong-Jiang Xu1,2, Andrew M. F. Johnson1, Jachelle M. Ofrecio1, Wei Ying1, Dalila El Ouarrat1, Luisa S. Chan3, Andrew W. Han3, Nadir A. Mahmood3, Caitlin N. Ryan3, Yun Sok Lee1, Jeramie D. Watrous1,2, Mahendra D. Chordia4, Dongfeng Pan4, Mohit Jain1,2, Jerrold M. Olefsky1 * Affiliations: 1 Division of Endocrinology & Metabolism, Department of Medicine, University of California, San Diego, La Jolla, California, USA. 2 Department of Pharmacology, University of California, San Diego, La Jolla, California, USA. 3 Second Genome, Inc., South San Francisco, California, USA. 4 Department of Radiology and Medical Imaging, University of Virginia, Charlottesville, VA, USA. * Correspondence to: 858-534-2230, [email protected] Word Count: 4749 Figures: 6 Supplemental Figures: 11 Supplemental Tables: 5 1 Diabetes Publish Ahead of Print, published online April 22, 2019 Diabetes Page 2 of 230 ABSTRACT The composition of the gastrointestinal (GI) microbiota and associated metabolites changes dramatically with diet and the development of obesity. Although many correlations have been described, specific mechanistic links between these changes and glucose homeostasis remain to be defined. Here we show that blood and intestinal levels of the microbiota-produced N-formyl peptide, formyl-methionyl-leucyl-phenylalanine (fMLF), are elevated in high fat diet (HFD)- induced obese mice. Genetic or pharmacological inhibition of the N-formyl peptide receptor Fpr1 leads to increased insulin levels and improved glucose tolerance, dependent upon glucagon- like peptide-1 (GLP-1). Obese Fpr1-knockout (Fpr1-KO) mice also display an altered microbiome, exemplifying the dynamic relationship between host metabolism and microbiota.
    [Show full text]
  • Transient Kinetics of Aminoglycoside Phosphotransferase(30)-Iiia Reveals a Potential Drug Target in the Antibiotic Resistance Mechanism
    FEBS Letters 586 (2012) 4223–4227 journal homepage: www.FEBSLetters.org Transient kinetics of aminoglycoside phosphotransferase(30)-IIIa reveals a potential drug target in the antibiotic resistance mechanism Perrine Lallemand a, Nadia Leban a, Simone Kunzelmann b, Laurent Chaloin a, Engin H. Serpersu c, ⇑ Martin R. Webb b, Tom Barman d, Corinne Lionne a, a Centre d’études d’agents Pathogènes et Biotechnologies pour la Santé (CPBS), UMR 5236 CNRS, University Montpellier I & II, 1919 Route de Mende, 34293 Montpellier Cedex 5, France b Division of Physical Biochemistry, MRC National Institute for Medical Research, The Ridgeway, Mill Hill, London NW7 1AA, United Kingdom c Department of Biochemistry and Cellular and Molecular Biology, University of Tennessee, Knoxville, TN 37996, USA d Volunteer, 8 rue Dom Vaissette, 34000 Montpellier, France article info abstract Article history: Aminoglycoside phosphotransferases are bacterial enzymes responsible for the inactivation of ami- Received 25 September 2012 noglycoside antibiotics by O-phosphorylation. It is important to understand the mechanism of Revised 11 October 2012 enzymes in order to find efficient drugs. Using rapid-mixing methods, we studied the transient Accepted 12 October 2012 kinetics of aminoglycoside phosphotransferase(30)-IIIa. We show that an ADP-enzyme complex is Available online 26 October 2012 the main steady state intermediate. This intermediate interacts strongly with kanamycin A to form Edited by Peter Brzezinski an abortive complex that traps the enzyme in an inactive state. A good strategy to prevent the inac- tivation of aminoglycosides would be to develop uncompetitive inhibitors that interact with this key ADP-enzyme complex. Keywords: Quench flow Ó 2012 Federation of European Biochemical Societies.
    [Show full text]
  • Thermodynamic Characterization of Aminoglycoside-3•²
    University of Tennessee, Knoxville TRACE: Tennessee Research and Creative Exchange Doctoral Dissertations Graduate School 12-2007 Thermodynamic Characterization of Aminoglycoside-3′- Phosphotransferase IIIa Can Özen University of Tennessee - Knoxville Follow this and additional works at: https://trace.tennessee.edu/utk_graddiss Part of the Life Sciences Commons Recommended Citation Özen, Can, "Thermodynamic Characterization of Aminoglycoside-3′-Phosphotransferase IIIa. " PhD diss., University of Tennessee, 2007. https://trace.tennessee.edu/utk_graddiss/259 This Dissertation is brought to you for free and open access by the Graduate School at TRACE: Tennessee Research and Creative Exchange. It has been accepted for inclusion in Doctoral Dissertations by an authorized administrator of TRACE: Tennessee Research and Creative Exchange. For more information, please contact [email protected]. To the Graduate Council: I am submitting herewith a dissertation written by Can Özen entitled "Thermodynamic Characterization of Aminoglycoside-3′-Phosphotransferase IIIa." I have examined the final electronic copy of this dissertation for form and content and recommend that it be accepted in partial fulfillment of the equirr ements for the degree of Doctor of Philosophy, with a major in Life Sciences. Engin H. Serpersu, Major Professor We have read this dissertation and recommend its acceptance: Michael Best, Hong Guo, Nitin Jain Accepted for the Council: Carolyn R. Hodges Vice Provost and Dean of the Graduate School (Original signatures are on file with official studentecor r ds.) To the Graduate Council: I am submitting herewith a dissertation written by Can Özen entitled “Thermodynamic Characterization of Aminoglycoside-3′-Phosphotransferase IIIa.” I have examined the final electronic copy of this dissertation for form and content and recommend that it be accepted in partial fulfillment of the requirements for the degree of Doctor of Philosophy, with a major in Life Sciences.
    [Show full text]
  • Termin Translat Trna Utr Mutat Protein Signal
    Drugs & Chemicals 1: Tumor Suppressor Protein p53 2: Heterogeneous-Nuclear Ribonucleo- (1029) proteins (14) activ apoptosi arf cell express function inactiv induc altern assai associ bind mdm2 mutat p53 p73 pathwai protein regul complex detect exon famili genom respons suppress suppressor tumor wild-typ interact intron isoform nuclear protein sensit site specif splice suggest variant 3: RNA, Transfer (110) 4: DNA Primers (1987) codon contain differ eukaryot gene initi amplifi analysi chain clone detect dna express mrna protein region ribosom rna fragment gene genotyp mutat pcr sequenc site speci suggest synthesi polymorph popul primer reaction region restrict sequenc speci termin translat trna utr 5: Saccharomyces cerevisiae Proteins 6: Apoptosis Regulatory Proteins (291) (733) activ apoptosi apoptosis-induc albican bud candida cerevisia complex encod apoptot bcl-2 caspas caspase-8 cell eukaryot fission function growth interact involv death fasl induc induct ligand methyl necrosi pathwai program sensit surviv trail mutant pomb protein requir saccharomyc strain suggest yeast 7: Plant Proteins (414) 8: Membrane Proteins (1608) access arabidopsi cultivar flower hybrid leaf leav apoptosi cell conserv domain express function gene human identifi inhibitor line maiz plant pollen rice root seed mammalian membran mice mous mutant seedl speci thaliana tomato transgen wheat mutat protein signal suggest transport 1 9: Tumor Suppressor Proteins (815) 10: 1-Phosphatidylinositol 3-Kinase activ arrest cell cycl cyclin damag delet dna (441) 3-kinas activ
    [Show full text]
  • Conserved Phosphoryl Transfer Mechanisms Within Kinase Families
    Kenyon et al. BMC Research Notes 2012, 5:131 http://www.biomedcentral.com/1756-0500/5/131 RESEARCHARTICLE Open Access Conserved phosphoryl transfer mechanisms within kinase families and the role of the C8 proton of ATP in the activation of phosphoryl transfer Colin P Kenyon*, Robyn L Roth, Chris W van der Westhuyzen and Christopher J Parkinson Abstract Background: The kinome is made up of a large number of functionally diverse enzymes, with the classification indicating very little about the extent of the conserved kinetic mechanisms associated with phosphoryl transfer. It has been demonstrated that C8-H of ATP plays a critical role in the activity of a range of kinase and synthetase enzymes. Results: A number of conserved mechanisms within the prescribed kinase fold families have been identified directly utilizing the C8-H of ATP in the initiation of phosphoryl transfer. These mechanisms are based on structurally conserved amino acid residues that are within hydrogen bonding distance of a co-crystallized nucleotide. On the basis of these conserved mechanisms, the role of the nucleotide C8-H in initiating the formation of a pentavalent intermediate between the g-phosphate of the ATP and the substrate nucleophile is defined. All reactions can be clustered into two mechanisms by which the C8-H is induced to be labile via the coordination of a backbone carbonyl to C6-NH2 of the adenyl moiety, namely a “push” mechanism, and a “pull” mechanism, based on the protonation of N7. Associated with the “push” mechanism and “pull” mechanisms are a series of proton transfer cascades, initiated from C8-H, via the tri-phosphate backbone, culminating in the formation of the pentavalent transition state between the g-phosphate of the ATP and the substrate nucleophile.
    [Show full text]
  • Product Sheet Info
    Master Clone List for NR-19279 ® Vibrio cholerae Gateway Clone Set, Recombinant in Escherichia coli, Plates 1-46 Catalog No. NR-19279 Table 1: Vibrio cholerae Gateway® Clones, Plate 1 (NR-19679) Clone ID Well ORF Locus ID Symbol Product Accession Position Length Number 174071 A02 367 VC2271 ribD riboflavin-specific deaminase NP_231902.1 174346 A03 336 VC1877 lpxK tetraacyldisaccharide 4`-kinase NP_231511.1 174354 A04 342 VC0953 holA DNA polymerase III, delta subunit NP_230600.1 174115 A05 388 VC2085 sucC succinyl-CoA synthase, beta subunit NP_231717.1 174310 A06 506 VC2400 murC UDP-N-acetylmuramate--alanine ligase NP_232030.1 174523 A07 132 VC0644 rbfA ribosome-binding factor A NP_230293.2 174632 A08 322 VC0681 ribF riboflavin kinase-FMN adenylyltransferase NP_230330.1 174930 A09 433 VC0720 phoR histidine protein kinase PhoR NP_230369.1 174953 A10 206 VC1178 conserved hypothetical protein NP_230823.1 174976 A11 213 VC2358 hypothetical protein NP_231988.1 174898 A12 369 VC0154 trmA tRNA (uracil-5-)-methyltransferase NP_229811.1 174059 B01 73 VC2098 hypothetical protein NP_231730.1 174075 B02 82 VC0561 rpsP ribosomal protein S16 NP_230212.1 174087 B03 378 VC1843 cydB-1 cytochrome d ubiquinol oxidase, subunit II NP_231477.1 174099 B04 383 VC1798 eha eha protein NP_231433.1 174294 B05 494 VC0763 GTP-binding protein NP_230412.1 174311 B06 314 VC2183 prsA ribose-phosphate pyrophosphokinase NP_231814.1 174603 B07 108 VC0675 thyA thymidylate synthase NP_230324.1 174474 B08 466 VC1297 asnS asparaginyl-tRNA synthetase NP_230942.2 174933 B09 198
    [Show full text]
  • Q 297 Suppl USE
    The following supplement accompanies the article Atlantic salmon raised with diets low in long-chain polyunsaturated n-3 fatty acids in freshwater have a Mycoplasma dominated gut microbiota at sea Yang Jin, Inga Leena Angell, Simen Rød Sandve, Lars Gustav Snipen, Yngvar Olsen, Knut Rudi* *Corresponding author: [email protected] Aquaculture Environment Interactions 11: 31–39 (2019) Table S1. Composition of high- and low LC-PUFA diets. Stage Fresh water Sea water Feed type High LC-PUFA Low LC-PUFA Fish oil Initial fish weight (g) 0.2 0.4 1 5 15 30 50 0.2 0.4 1 5 15 30 50 80 200 Feed size (mm) 0.6 0.9 1.3 1.7 2.2 2.8 3.5 0.6 0.9 1.3 1.7 2.2 2.8 3.5 3.5 4.9 North Atlantic fishmeal (%) 41 40 40 40 40 30 30 41 40 40 40 40 30 30 35 25 Plant meals (%) 46 45 45 42 40 49 48 46 45 45 42 40 49 48 39 46 Additives (%) 3.3 3.2 3.2 3.5 3.3 3.4 3.9 3.3 3.2 3.2 3.5 3.3 3.4 3.9 2.6 3.3 North Atlantic fish oil (%) 9.9 12 12 15 16 17 18 0 0 0 0 0 1.2 1.2 23 26 Linseed oil (%) 0 0 0 0 0 0 0 6.8 8.1 8.1 9.7 11 10 11 0 0 Palm oil (%) 0 0 0 0 0 0 0 3.2 3.8 3.8 5.4 5.9 5.8 5.9 0 0 Protein (%) 56 55 55 51 49 47 47 56 55 55 51 49 47 47 44 41 Fat (%) 16 18 18 21 22 22 22 16 18 18 21 22 22 22 28 31 EPA+DHA (% diet) 2.2 2.4 2.4 2.9 3.1 3.1 3.1 0.7 0.7 0.7 0.7 0.7 0.7 0.7 4 4.2 Table S2.
    [Show full text]
  • Exploring the Data Work Organization of the Gene Ontology Shuheng Wu
    Florida State University Libraries Electronic Theses, Treatises and Dissertations The Graduate School 2014 Exploring the Data Work Organization of the Gene Ontology Shuheng Wu Follow this and additional works at the FSU Digital Library. For more information, please contact [email protected] FLORIDA STATE UNIVERSITY COLLEGE OF COMMUNICATION AND INFORMATION EXPLORING THE DATA WORK ORGANIZATION OF THE GENE ONTOLOGY By SHUHENG WU A Dissertation submitted to the School of Information in partial fulfillment of the requirements for the degree of Doctor of Philosophy Degree Awarded: Fall Semester, 2014 Shuheng Wu defended this dissertation on October 24, 2014. The members of the supervisory committee were: Besiki Stvilia Professor Directing Dissertation Henry W. Bass University Representative Corinne L. Jörgensen Committee Member Michelle M. Kazmer Committee Member The Graduate School has verified and approved the above-named committee members, and certifies that the dissertation has been approved in accordance with university requirements. ii I dedicate this dissertation to my beloved mother Peiqiong Ou, and my father, my husband, and those who have supported and helped me. It is all of you who have helped me grow and become who I am today. iii ACKNOWLEDGMENTS My deepest appreciation is owed to my major professor Dr. Besiki Stvilia and his family. Without his advice and help, I cannot even imagine if I could finish my doctoral coursework. Thanks go to him for introducing Activity Theory to me and for developing a theoretical framework that I can use in my current and future studies. Because of working with him, I learned about the beauty of theory and the power of methodology, which will benefit my future research and career.
    [Show full text]