DOCSLIB.ORG

UC Irvine UC Irvine Electronic Theses and Dissertations

Total Page：16

File Type：pdf, Size：1020Kb

Download full-text PDF Read full-text
UC Irvine UC Irvine Electronic Theses and Dissertations UC Irvine UC Irvine Electronic Theses and Dissertations Title Generation and application of a chimeric model to examine human microglia responses to amyloid pathology Permalink https://escholarship.org/uc/item/38g5s0sj Author Hasselmann, Jonathan Publication Date 2021 Supplemental Material https://escholarship.org/uc/item/38g5s0sj#supplemental Peer reviewed|Thesis/dissertation eScholarship.org Powered by the California Digital Library University of California UNIVERSITY OF CALIFORNIA, IRVINE Generation and application of a chimeric model to examine human microglia responses to amyloid pathology DISSERTATION Submitted in partial satisfaction of the requirements for the degree of DOCTOR OF PHILOSOPHY In Biological Sciences By Jonathan Hasselmann Dissertation Committee: Associate Professor Mathew Blurton-Jones, Chair Associate Professor Kim Green Professor Brian Cummings 2021 Portions of the Introduction and Chapter 2 © 2020 Wiley Periodicals, Inc. Chapter 1 and a portion of Chapter 2 © 2019 Elsevier Inc. All other materials © 2021 Jonathan Hasselmann DEDICATION To Nikki and Isla: During this journey, I have been fortunate enough to have the love and support of two of the strongest ladies I have ever met. I can say without a doubt that I would not have made it here without the two of you standing behind me. I love you both with all my heart and this achievement belongs to the two of you just as much as it belongs to me. Thank you for always having my back. ii TABLE OF CONTENTS LIST OF FIGURES .......................................................................................................................v LIST OF TABLES ...................................................................................................................... vii ACKNOWLEDGEMENTS ...................................................................................................... viii CURRICULUM VITAE .............................................................................................................. xi ABSTRACT OF THE DISSERTATION ................................................................................ xiv INTRODUCTION..........................................................................................................................1 A. MICROGLIA AND THEIR ROLES IN ALZHEIMER’S DISEASE ...................................3 History of Microglia ............................................................................................................3 Microglia in Alzheimer’s Disease .......................................................................................5 B. CURRENT METHODS OF STUDYING MICROGLIA ......................................................8 Mouse Microglia ..................................................................................................................8 Primary Human Microglia ...................................................................................................9 iPSC-derived Human Microglia ........................................................................................11 Organoid Microglia ............................................................................................................14 C. PITFALLS ASSOCIATED WITH THE CURRENT MODELS ........................................16 D. MICROGLIA XENOTRANSPLANTATION INTO THE MOUSE BRAIN .....................19 CHAPTER 1: TRANSPLANTATION OF HUMAN IPSC-DERIVED MICROGLIA INTO THE MOUSE BRAIN INDUCES APPROPRIATE TRANSCRIPTOMIC PROGRAMMING AND REVEALS HUMAN SPECIFIC AMYLOID RESPONSES ........21 INTRODUCTION ......................................................................................................................21 MATERIALS AND METHODS ...............................................................................................23 RESULTS ...................................................................................................................................40 DISCUSSION ............................................................................................................................69 CHAPTER 2: THE ALZHEIMER’S DISEASE-ASSOCIATED TREM2 R47H GENETIC POLYMORPHISM DRIVES TRANSCRIPTOMIC AND FUNCTIONAL ALTERATIONS IN XENOTRANSPLANTED MICROGLIA ..............................................71 INTRODUCTION ......................................................................................................................71 MATERIALS AND METHODS ...............................................................................................72 RESULTS ...................................................................................................................................79 DISCUSSION ............................................................................................................................85 CHAPTER 3: ALTERATIONS TO CHROMATIN STRUCTURE AND TRANSCRIPTOMIC PROGRAMMING UNDERLIE THE MICROGLIA RESPONSE TO AMYLOID PATHOLOGY ..................................................................................................87 INTRODUCTION ......................................................................................................................87 iii MATERIALS AND METHODS ...............................................................................................88 RESULTS ...................................................................................................................................94 DISCUSSION ..........................................................................................................................101 CONCLUSIONS AND FUTURE DIRECTIONS ...................................................................105 REFERENCES ...........................................................................................................................111 iv LIST OF FIGURES INTRODUCTION FIGURE 1: Homology between human and mouse proteins associated with Alzheimer’s disease risk ...................................................................................................................................1 FIGURE 2: In vivo and in vitro microglia ontogeny .................................................................12 CHAPTER 1 FIGURE 1.1: iPSC-derived human HPCs differentiate into microglia and display robust engraftment within the forebrain of MITRG mice .....................................................................41 FIGURE 1.2: Xenotransplanted human cells express microglia markers ..................................43 FIGURE 1.3: Chimeric distribution of human xMG is influenced by age of transplantation and hCSF1 expression level ..............................................................................................................44 FIGURE 1.4: Transplanted iHPCs adapt to diverse niches within the brain and differentiate into the four CNS macrophage subtypes in a context-dependent manner .................................45 FIGURE 1.5: Methods of tissue dissociation and validation of the human microglia flow cytometry paradigm ....................................................................................................................48 FIGURE 1.6: Transplantation of human iHPCs into the murine brain recapitulates an in vivo human transcriptome ..................................................................................................................49 FIGURE 1.7: xMG cluster closely with brain-derived human microglia ..................................52 FIGURE 1.8: xMG survey their surroundings, rapidly respond to laser ablation, and interact with neuronal components after trauma .....................................................................................55 FIGURE 1.9: Differential responses of xMG and iMG to LPS administration .........................57 FIGURE 1.10: LPS treatment upregulates numerous inflammatory pathways and induces a transcriptomic profile resembling disease-affected microglia ...................................................59 FIGURE 1.11: xMG gene expression profiles are indicative of known microglial activation signatures ....................................................................................................................................61 FIGURE 1.12: xMG down-regulate homeostatic markers and upregulate activation markers around Aβ plaques ......................................................................................................................63 FIGURE 1.13: Single-cell sequencing of xMG from MITRG and MITRG-5X mice reveals altered population distributions and human-specific genetic responses ....................................65 FIGURE 1.14: Analysis of scRNA-seq by individual sex or genes reveals additional aspects of xMG transcriptomics ..................................................................................................................67 CHAPTER 2 FIGURE 2.1: Deletion of TREM2 suppresses the development of Disease-Associated Microglia in vivo ........................................................................................................................80 FIGURE 2.2: CRISPR/Cas9 editing to create a homozygous TREM2 R47H mutant human iPSC line .....................................................................................................................................81 v FIGURE 2.3: xMG response to Aβ plaques is altered by the TREM2 R47H mutation .............82 FIGURE 2.4: The TREM2 R47H mutation alters the population-level response to amyloid in xMG ..........................................................................................................................................83
Load more

Recommended publications
  • Human OMG Blocking Peptide (CDBP2120) This Product Is for Research Use Only and Is Not Intended for Diagnostic Use
    Human OMG blocking peptide (CDBP2120) This product is for research use only and is not intended for diagnostic use. PRODUCT INFORMATION Product Overview Blocking/Immunizing peptide for anti-OMG antibody Antigen Description OMG (oligodendrocyte myelin glycoprotein) is a protein-coding gene. Diseases associated with OMG include patulous eustachian tube, and internuclear ophthalmoplegia, and among its related super-pathways are p75NTR regulates axonogenesis and Development MAG-dependent inhibition of neurite outgrowth. GO annotations related to this gene include identical protein binding. Nature Synthetic Expression System N/A Species Human Species Reactivity Human Conjugate Unconjugated Applications Apuri, BL, ELISA Procedure None Format Lyophilized powder Size 100 μg Preservative None Storage Shipped at ambient temperature, store at -20°C. ANTIGEN GENE INFORMATION Gene Name OMG oligodendrocyte myelin glycoprotein [ Homo sapiens ] Official Symbol OMG Synonyms OMG; oligodendrocyte myelin glycoprotein; oligodendrocyte-myelin glycoprotein; OMGP; Entrez Gene ID 4974 mRNA Refseq NM_002544 45-1 Ramsey Road, Shirley, NY 11967, USA Email: [email protected] Tel: 1-631-624-4882 Fax: 1-631-938-8221 1 © Creative Diagnostics All Rights Reserved Protein Refseq NP_002535 UniProt ID P23515 Chromosome Location 17q11-q12 Pathway Axonal growth inhibition (RHOA activation), organism-specific biosystem; Signal Transduction, organism-specific biosystem; Signalling by NGF, organism-specific biosystem; p75 NTR receptor-mediated signalling, organism-specific biosystem; p75(NTR)-mediated signaling, organism-specific biosystem; p75NTR regulates axonogenesis, organism-specific biosystem; Function identical protein binding; 45-1 Ramsey Road, Shirley, NY 11967, USA Email: [email protected] Tel: 1-631-624-4882 Fax: 1-631-938-8221 2 © Creative Diagnostics All Rights Reserved.
    [Show full text]
  • Primepcr™Assay Validation Report
    PrimePCR™Assay Validation Report Gene Information Gene Name interferon, alpha-inducible protein 27 Gene Symbol IFI27 Organism Human Gene Summary Description Not Available Gene Aliases FAM14D, ISG12, ISG12A, P27 RefSeq Accession No. NC_000014.8, NT_026437.12 UniGene ID Hs.532634 Ensembl Gene ID ENSG00000165949 Entrez Gene ID 3429 Assay Information Unique Assay ID qHsaCEP0024638 Assay Type Probe - Validation information is for the primer pair using SYBR® Green detection Detected Coding Transcript(s) ENST00000557098, ENST00000298902, ENST00000557634, ENST00000555744, ENST00000444961, ENST00000448882 Amplicon Context Sequence GAGCAACTGGACTCTCCGGATTGACCAAGTTCATCCTGGGCTCCATTGGGTCTG CCATTGCGGCTGTCATTGCGAGGTTCTACTAGCTCCCTGCCCCTCGCCCTGCAG AGAAGAGAACCATGCCAGGGGAGAAGGCACCCAGCCA Amplicon Length (bp) 115 Chromosome Location 14:94582779-94582923 Assay Design Exonic Purification Desalted Validation Results Efficiency (%) 100 R2 0.9997 cDNA Cq 23.09 cDNA Tm (Celsius) 86 gDNA Cq 23.06 Specificity (%) 100 Information to assist with data interpretation is provided at the end of this report. Page 1/4 PrimePCR™Assay Validation Report IFI27, Human Amplification Plot Amplification of cDNA generated from 25 ng of universal reference RNA Melt Peak Melt curve analysis of above amplification Standard Curve Standard curve generated using 20 million copies of template diluted 10-fold to 20 copies Page 2/4 PrimePCR™Assay Validation Report Products used to generate validation data Real-Time PCR Instrument CFX384 Real-Time PCR Detection System Reverse Transcription Reagent iScript™ Advanced cDNA Synthesis Kit for RT-qPCR Real-Time PCR Supermix SsoAdvanced™ SYBR® Green Supermix Experimental Sample qPCR Human Reference Total RNA Data Interpretation Unique Assay ID This is a unique identifier that can be used to identify the assay in the literature and online. Detected Coding Transcript(s) This is a list of the Ensembl transcript ID(s) that this assay will detect.
    [Show full text]
  • 22 Ultra-Conserved Elements in Vertebrate and Fly Genomes Mathias Drton Nicholas Eriksson Garmay Leung
    22 Ultra-Conserved Elements in Vertebrate and Fly Genomes Mathias Drton Nicholas Eriksson Garmay Leung Ultra-conserved elements in an alignment of multiple genomes are consecutive nucleotides that are in perfect agreement across all the genomes. For aligned vertebrate and fly genomes, we give descriptive statistics of ultra-conserved elements, explain their biological relevance, and show that the existence of ultra-conserved elements is highly improbable in neutrally evolving regions. 22.1 The data Our analyses of ultra-conserved elements are based on multiple sequence align- ments produced by MAVID [Bray and Pachter, 2004]. Prior to the alignment of multiple genomes, homology mappings (from Mercator [Dewey, 2005]) group into bins genomic regions that are anchored together by neighboring homolo- gous exons. A multiple sequence alignment is then produced for each of these alignment bins. MAVID is a global multiple alignment program, and therefore homologous regions with more than one homologous hit to another genome may not be found aligned together. Table 22.1 shows an example of Merca- tor’s output for a single region along with the beginning of the resulting MAVID multiple sequence alignment. Species Chrom. Start End Alignment Dog chrX 752057 864487 + A----AACCAAA--------- Chicken chr1 122119382 122708162 − TGCTGAGCTAAAGATCAGGCT Zebrafish chr9 19018916 19198136 + ------ATGCAACATGCTTCT Pufferfish chr2 7428614 7525502 + ---TAGATGGCAGACGATGCT Fugufish asm1287 21187 82482 + ---TCAAGGG----------- Table 22.1. Mercator output for a single bin, giving the position and orientation on the chromosome. Notice that the Fugu fish genome has not been fully assembled into chromosomes (cf. Section 4.2). The vertebrate dataset consists of 10,279 bins over 9 genomes (Table 22.2).
    [Show full text]
  • S41467-020-18249-3.Pdf
    ARTICLE https://doi.org/10.1038/s41467-020-18249-3 OPEN Pharmacologically reversible zonation-dependent endothelial cell transcriptomic changes with neurodegenerative disease associations in the aged brain Lei Zhao1,2,17, Zhongqi Li 1,2,17, Joaquim S. L. Vong2,3,17, Xinyi Chen1,2, Hei-Ming Lai1,2,4,5,6, Leo Y. C. Yan1,2, Junzhe Huang1,2, Samuel K. H. Sy1,2,7, Xiaoyu Tian 8, Yu Huang 8, Ho Yin Edwin Chan5,9, Hon-Cheong So6,8, ✉ ✉ Wai-Lung Ng 10, Yamei Tang11, Wei-Jye Lin12,13, Vincent C. T. Mok1,5,6,14,15 &HoKo 1,2,4,5,6,8,14,16 1234567890():,; The molecular signatures of cells in the brain have been revealed in unprecedented detail, yet the ageing-associated genome-wide expression changes that may contribute to neurovas- cular dysfunction in neurodegenerative diseases remain elusive. Here, we report zonation- dependent transcriptomic changes in aged mouse brain endothelial cells (ECs), which pro- minently implicate altered immune/cytokine signaling in ECs of all vascular segments, and functional changes impacting the blood–brain barrier (BBB) and glucose/energy metabolism especially in capillary ECs (capECs). An overrepresentation of Alzheimer disease (AD) GWAS genes is evident among the human orthologs of the differentially expressed genes of aged capECs, while comparative analysis revealed a subset of concordantly downregulated, functionally important genes in human AD brains. Treatment with exenatide, a glucagon-like peptide-1 receptor agonist, strongly reverses aged mouse brain EC transcriptomic changes and BBB leakage, with associated attenuation of microglial priming. We thus revealed tran- scriptomic alterations underlying brain EC ageing that are complex yet pharmacologically reversible.
    [Show full text]
  • Endolysosomal Cation Channels and MITF in Melanocytes and Melanoma
    biomolecules Review Endolysosomal Cation Channels and MITF in Melanocytes and Melanoma Carla Abrahamian and Christian Grimm * Walther Straub Institute of Pharmacology and Toxicology, Faculty of Medicine, Ludwig-Maximilians-University, 80336 Munich, Germany; [email protected] * Correspondence: [email protected] Abstract: Microphthalmia-associated transcription factor (MITF) is the principal transcription fac- tor regulating pivotal processes in melanoma cell development, growth, survival, proliferation, differentiation and invasion. In recent years, convincing evidence has been provided attesting key roles of endolysosomal cation channels, specifically TPCs and TRPMLs, in cancer, including breast cancer, glioblastoma, bladder cancer, hepatocellular carcinoma and melanoma. In this review, we provide a gene expression profile of these channels in different types of cancers and decipher their roles, in particular the roles of two-pore channel 2 (TPC2) and TRPML1 in melanocytes and melanoma. We specifically discuss the signaling cascades regulating MITF and the relationship between endolysosomal cation channels, MAPK, canonical Wnt/GSK3 pathways and MITF. Keywords: TPC; two-pore; lysosome; TPC1; TPC2; TRPML; mucolipin; MCOLN; TRPML1; MITF; melanocytes; melanoma; mTOR; TFEB; calcium Citation: Abrahamian, C.; Grimm, C. 1. Introduction Endolysosomal Cation Channels and Melanocytes are neural-crest derived cells that produce melanin, the primary de- MITF in Melanocytes and Melanoma. terminant of skin color. Melanin is also found in hair, in the iris of the eye, and in the Biomolecules 2021, 11, 1021. https:// stria vascularis of the inner ear and, to a lesser degree, in a broad range of other tissues doi.org/10.3390/biom11071021 throughout the body [1]. There are two major types of melanin called eumelanin (dark, brown, black) and pheomelanin (yellow, red, light brown).
    [Show full text]
  • Association of Gene Ontology Categories with Decay Rate for Hepg2 Experiments These Tables Show Details for All Gene Ontology Categories
    Supplementary Table 1: Association of Gene Ontology Categories with Decay Rate for HepG2 Experiments These tables show details for all Gene Ontology categories. Inferences for manual classification scheme shown at the bottom. Those categories used in Figure 1A are highlighted in bold. Standard Deviations are shown in parentheses. P-values less than 1E-20 are indicated with a "0". Rate r (hour^-1) Half-life < 2hr. Decay % GO Number Category Name Probe Sets Group Non-Group Distribution p-value In-Group Non-Group Representation p-value GO:0006350 transcription 1523 0.221 (0.009) 0.127 (0.002) FASTER 0 13.1 (0.4) 4.5 (0.1) OVER 0 GO:0006351 transcription, DNA-dependent 1498 0.220 (0.009) 0.127 (0.002) FASTER 0 13.0 (0.4) 4.5 (0.1) OVER 0 GO:0006355 regulation of transcription, DNA-dependent 1163 0.230 (0.011) 0.128 (0.002) FASTER 5.00E-21 14.2 (0.5) 4.6 (0.1) OVER 0 GO:0006366 transcription from Pol II promoter 845 0.225 (0.012) 0.130 (0.002) FASTER 1.88E-14 13.0 (0.5) 4.8 (0.1) OVER 0 GO:0006139 nucleobase, nucleoside, nucleotide and nucleic acid metabolism3004 0.173 (0.006) 0.127 (0.002) FASTER 1.28E-12 8.4 (0.2) 4.5 (0.1) OVER 0 GO:0006357 regulation of transcription from Pol II promoter 487 0.231 (0.016) 0.132 (0.002) FASTER 6.05E-10 13.5 (0.6) 4.9 (0.1) OVER 0 GO:0008283 cell proliferation 625 0.189 (0.014) 0.132 (0.002) FASTER 1.95E-05 10.1 (0.6) 5.0 (0.1) OVER 1.50E-20 GO:0006513 monoubiquitination 36 0.305 (0.049) 0.134 (0.002) FASTER 2.69E-04 25.4 (4.4) 5.1 (0.1) OVER 2.04E-06 GO:0007050 cell cycle arrest 57 0.311 (0.054) 0.133 (0.002)
    [Show full text]
  • (12) Patent Application Publication (10) Pub. No.: US 2006/0088532 A1 Alitalo Et Al
    US 20060O88532A1 (19) United States (12) Patent Application Publication (10) Pub. No.: US 2006/0088532 A1 Alitalo et al. (43) Pub. Date: Apr. 27, 2006 (54) LYMPHATIC AND BLOOD ENDOTHELIAL Related U.S. Application Data CELL GENES (60) Provisional application No. 60/363,019, filed on Mar. (76) Inventors: Kari Alitalo, Helsinki (FI); Taija 7, 2002. Makinen, Helsinki (FI); Tatiana Petrova, Helsinki (FI); Pipsa Publication Classification Saharinen, Helsinki (FI); Juha Saharinen, Helsinki (FI) (51) Int. Cl. A6IR 48/00 (2006.01) Correspondence Address: A 6LX 39/395 (2006.01) MARSHALL, GERSTEIN & BORUN LLP A6II 38/18 (2006.01) 233 S. WACKER DRIVE, SUITE 6300 (52) U.S. Cl. .............................. 424/145.1: 514/2: 514/44 SEARS TOWER (57) ABSTRACT CHICAGO, IL 60606 (US) The invention provides polynucleotides and genes that are (21) Appl. No.: 10/505,928 differentially expressed in lymphatic versus blood vascular endothelial cells. These genes are useful for treating diseases (22) PCT Filed: Mar. 7, 2003 involving lymphatic vessels, such as lymphedema, various inflammatory diseases, and cancer metastasis via the lym (86). PCT No.: PCT/USO3FO6900 phatic system. Patent Application Publication Apr. 27, 2006 Sheet 1 of 2 US 2006/0088532 A1 integrin O9 integrin O1 KIAAO711 KAAO644 ApoD Fig. 1 Patent Application Publication Apr. 27, 2006 Sheet 2 of 2 US 2006/0088532 A1 CN g uueleo-gº US 2006/0O88532 A1 Apr. 27, 2006 LYMPHATIC AND BLOOD ENDOTHELLAL CELL lymphatic vessels, such as lymphangiomas or lymphang GENES iectasis. Witte, et al., Regulation of Angiogenesis (eds. Goldber, I. D. & Rosen, E. M.) 65-112 (Birkauser, Basel, BACKGROUND OF THE INVENTION Switzerland, 1997).
    [Show full text]
  • CALIFORNIA STATE UNIVERSITY, NORTHRIDGE Bioinformatic
    CALIFORNIA STATE UNIVERSITY, NORTHRIDGE Bioinformatic Comparison of the EVI2A Promoter and Coding Regions A thesis submitted in partial fulfillment of the requirements for the degree of Master of Science in Biology By Max Weinstein May 2020 The thesis of Max Weinstein is approved: Professor Rheem D. Medh Date Professor Virginia Oberholzer Vandergon Date Professor Cindy Malone, Chair Date California State University Northridge ii Table of Contents Signature Page ii List of Figures v Abstract vi Introduction 1 Ecotropic Viral Integration Site 2A, a Gene within a Gene 7 Materials and Methods 11 PCR and Cloning of Recombinant Plasmid 11 Transformation and Cell Culture 13 Generation of Deletion Constructs 15 Transfection and Luciferase Assay 16 Identification of Transcription Factor Binding Sites 17 Determination of Region for Analysis 17 Multiple Sequence Alignment (MSA) 17 Model Testing 18 Tree Construction 18 Promoter and CDS Conserved Motif Search 19 Results and Discussion 20 Choice of Species for Analysis 20 Mapping of Potential Transcription Factor Binding Sites 20 Confirmation of Plasmid Generation through Gel Electrophoresis 21 Analysis of Deletion Constructs by Transient Transfection 22 EVI2A Coding DNA Sequence Phylogenetics 23 EVI2A Promoter Phylogenetics 23 EVI2A Conserved Leucine Zipper 25 iii EVI2A Conserved Casein kinase II phosphorylation site 26 EVI2A Conserved Sox-5 Binding Site 26 EVI2A Conserved HLF Binding Site 27 EVI2A Conserved cREL Binding Site 28 EVI2A Conserved CREB Binding Site 28 Summary 29 Appendix: Figures 30 Literature Cited 44 iv List of Figures Figure 1. EVI2A is nested within the gene NF1 30 Figure 2 Putative Transcriptions Start Site 31 Figure 3. Gel Electrophoresis of pGC Blue cloned, Restriction Digested Plasmid 32 Figure 4.
    [Show full text]
  • IFI27 May Predict and Evaluate the Severity of Respiratory Syncytial Virus
    Gao et al. Hereditas (2021) 158:3 https://doi.org/10.1186/s41065-020-00167-5 RESEARCH Open Access IFI27 may predict and evaluate the severity of respiratory syncytial virus infection in preterm infants Junyan Gao1, Xueping Zhu2, Mingfu Wu1, Lijun Jiang1, Fudong Wang1 and Shan He2,3* Abstract Background: Preterm infants are a special population that vulnerable to respiratory syncytial virus (RSV) infection and the lower respiratory tract infections (LRTIs) caused by RSV could be severe and even life-threating. The purpose of the present study was to identify candidate genes of preterm infants who are susceptible to RSV infection and provide a new insight into the pathogenesis of RSV infection. Methods: Three datasets (GSE77087, GSE69606 and GSE41374) containing 183 blood samples of RSV infected patients and 33 blood samples of healthy controls from Gene Expression Omnibus (GEO) database were downloaded and the differentially expressed genes (DEGs) were screened out. The function and pathway enrichments were analyzed through Database for Annotation, Visualization and Integrated Discovery (DAVID) website. The protein-protein interaction (PPI) network for DEGs was constructed through Search Tool for the Retrieval of Interacting Genes (STRING). The module analysis was performed by Cytoscape software and hub genes were identified. Clinical verification was employed to verify the expression level of top five hub genes among 72 infants including 50 RSV infected patients and 22 non-RSV-infected patients hospitalized in our center. Further, the RSV infected infants with high-expression IFI27 and those with low-expression IFI27 were compared (defined as higher or lower than the median mRNA level).
    [Show full text]
  • IFI27 May Predict and Evaluate the Severity of Respiratory Syncytial Virus Infection in Preterm Infants
    IFI27 May Predict and Evaluate the Severity of Respiratory Syncytial Virus Infection in Preterm Infants Junyan Gao Aliated Hospital of Yangzhou University https://orcid.org/0000-0001-6678-6147 Xueping Zhu Children's Hospital of Soochow University Mingfu Wu Aliated Hospital of Yangzhou University Lijun Jiang Aliated Hospital of Yangzhou University Fudong Wang Aliated Hospital of Yangzhou University Shan He ( [email protected] ) Research Keywords: respiratory syncytial virus, preterm infants, differentially expressed genes, protein‐protein interaction, pathway enrichment, interferon alpha inducible protein 27 Posted Date: July 15th, 2020 DOI: https://doi.org/10.21203/rs.3.rs-42880/v1 License: This work is licensed under a Creative Commons Attribution 4.0 International License. Read Full License Version of Record: A version of this preprint was published on January 2nd, 2021. See the published version at https://doi.org/10.1186/s41065-020-00167-5. Page 1/21 Abstract Background: Preterm infants are a special population that vulnerable to respiratory syncytial virus (RSV) infection and the lower respiratory tract infection (LRTIs) caused by RSV could be severe and even life- threating. The purpose of the present study was to identify candidate genes of preterm infants who are susceptible to RSV infection and provide a new insight into the pathogenesis of RSV infection. Methods: Three datasets (GSE77087, GSE69606 and GSE41374) containing 183 blood samples of RSV infected patients and 33 blood samples of healthy controls from Gene Expression Omnibus (GEO) database were downloaded and the differentially expressed genes (DEGs) were screened out. The function and pathway enrichments were analyzed through Database for Annotation, Visualization and Integrated Discovery (DAVID) website.
    [Show full text]
  • Mitf and Tfe3, Two Members of the Mitf-Tfe Family of Bhlh-Zip Transcription Factors, Have Important but Functionally Redundant Roles in Osteoclast Development
    Mitf and Tfe3, two members of the Mitf-Tfe family of bHLH-Zip transcription factors, have important but functionally redundant roles in osteoclast development Eiri´kur Steingri´msson*†, Lino Tessarollo‡, Bhavani Pathak§¶, Ling Houʈ**, Heinz Arnheiterʈ, Neal G. Copeland§, and Nancy A. Jenkins§ *Department of Biochemistry and Molecular Biology, Faculty of Medicine, University of Iceland, 101 Reykjavik, Iceland; ‡Neural Development Group and §Mouse Cancer Genetics Program, National Cancer Institute, Frederick, MD 21702-1201; and ʈLaboratory of Developmental Neurogenetics, National Institute of Neurological Disorders and Stroke, National Institutes of Health, Bethesda, MD 20892 Communicated by Liane B. Russell, Oak Ridge National Laboratory, Oak Ridge, TN, February 6, 2002 (received for review December 1, 2001) The Mitf-Tfe family of basic helix–loop–helix-leucine zipper (bHLH- neuroepithelial-derived retinal pigment epithelium of the eye, Zip) transcription factors encodes four family members: Mitf, Tfe3, ultimately resulting in microphthalmia, and some Mitf mutations Tfeb, and Tfec. In vitro, each protein in the family can bind DNA as result in a reduction in mast cell numbers. Thus, the Mitf a homo- or heterodimer with other family members. Mutational mutations are pleiotropic, affect many different cell types, and studies in mice have shown that Mitf is essential for melanocyte can be arranged in an allelic series (4). and eye development, whereas Tfeb is required for placental A mutation has been made in the Tfeb gene (TfebFcr) and vascularization. Here, we uncover a role for Tfe3 in osteoclast results in embryonic lethality because of defects in placental development, a role that is functionally redundant with Mitf.
    [Show full text]
  • Discoveryspace: an Interactive Data Analysis Application
    Open Access Software2007RobertsonetVolume al. 8, Issue 1, Article R6 DiscoverySpace: an interactive data analysis application comment Neil Robertson, Mehrdad Oveisi-Fordorei, Scott D Zuyderduyn, Richard J Varhol, Christopher Fjell, Marco Marra, Steven Jones and Asim Siddiqui Address: Canada's Michael Smith Genome Sciences Centre, British Columbia Cancer Research Centre (BCCRC), British Columbia Cancer Agency (BCCA), Vancouver, BC, Canada. reviews Correspondence: Neil Robertson. Email: [email protected]. Mehrdad Oveisi-Fordorei. Email: [email protected]. Asim Siddiqui. Email: [email protected] Published: 08 January 2007 Received: 24 March 2006 Revised: 4 July 2006 Genome Biology 2007, 8:R6 (doi:10.1186/gb-2007-8-1-r6) Accepted: 8 January 2007 The electronic version of this article is the complete one and can be found online at http://genomebiology.com/2007/8/1/R6 reports © 2007 Robertson et al.; licensee BioMed Central Ltd. This is an open access article distributed under the terms of the Creative Commons Attribution License (http://creativecommons.org/licenses/by/2.0), which permits unrestricted use, distribution, and reproduction in any medium, provided the original work is properly cited. Interactive<p>DiscoverySpace, data analysis a graphical application for bioinformatics data analysis, in particular analysis of SAGE data, is described</p> deposited research Abstract DiscoverySpace is a graphical application for bioinformatics data analysis. Users can seamlessly traverse references between biological databases and draw together annotations in an intuitive tabular interface. Datasets can be compared using a suite of novel tools to aid in the identification of significant patterns. DiscoverySpace is of broad utility and its particular strength is in the analysis of serial analysis of gene expression (SAGE) data.
    [Show full text]