DOCSLIB.ORG

In This Table Protein Name, Uniprot Code, Gene Name P-Value

Total Page：16

File Type：pdf, Size：1020Kb

Download full-text PDF Read full-text

Load more

Supplementary Table S1: In this table protein name, uniprot code, gene name p-value and Fold change (FC) for each comparison are shown, for 299 of the 301 significantly regulated proteins found in both comparisons (p-value<0.01, fold change (FC) >+/-0.37) ALS versus control and FTLD-U versus control. Two uncharacterized proteins have been excluded from this list Protein name Uniprot Gene name p value FC FTLD-U p value FC ALS FTLD-U ALS Cytochrome b-c1 complex P14927 UQCRB 1.534E-03 -1.591E+00 6.005E-04 -1.639E+00 subunit 7 NADH dehydrogenase O95182 NDUFA7 4.127E-04 -9.471E-01 3.467E-05 -1.643E+00 [ubiquinone] 1 alpha subcomplex subunit 7 NADH dehydrogenase O43678 NDUFA2 3.230E-04 -9.145E-01 2.113E-04 -1.450E+00 [ubiquinone] 1 alpha subcomplex subunit 2 NADH dehydrogenase O43920 NDUFS5 1.769E-04 -8.829E-01 3.235E-05 -1.007E+00 [ubiquinone] iron-sulfur protein 5 ARF GTPase-activating A0A0C4DGN6 GIT1 1.306E-03 -8.810E-01 1.115E-03 -7.228E-01 protein GIT1 Methylglutaconyl-CoA Q13825 AUH 6.097E-04 -7.666E-01 5.619E-06 -1.178E+00 hydratase, mitochondrial ADP/ATP translocase 1 P12235 SLC25A4 6.068E-03 -6.095E-01 3.595E-04 -1.011E+00 MIC J3QTA6 CHCHD6 1.090E-04 -5.913E-01 2.124E-03 -5.948E-01 MIC J3QTA6 CHCHD6 1.090E-04 -5.913E-01 2.124E-03 -5.948E-01 Protein kinase C and casein Q9BY11 PACSIN1 3.837E-03 -5.863E-01 3.680E-06 -1.824E+00 kinase substrate in neurons protein 1 Tubulin polymerization- O94811 TPPP 6.466E-03 -5.755E-01 6.943E-06 -1.169E+00 promoting protein MIC C9JRZ6 CHCHD3 2.912E-02 -6.187E-01 2.195E-03 -9.781E-01 Mitochondrial 2- Q02978 SLC25A11 5.385E-03 -5.642E-01 2.067E-04 -6.783E-01 oxoglutarate/malate carrier protein NADH dehydrogenase O75380 NDUFS6 6.385E-04 -5.636E-01 2.521E-04 -1.344E+00 [ubiquinone] iron-sulfur protein 6, mitochondrial ATP-dependent RNA helicase Q08211 DHX9 6.206E-03 -5.489E-01 5.978E-04 -7.282E-01 A Cytochrome b-c1 complex P07919 UQCRH 2.555E-03 -5.462E-01 3.774E-05 -1.112E+00 subunit 6, mitochondrial ATP synthase subunit e, P56385 ATP5I 3.812E-03 -4.960E-01 5.590E-03 -7.127E-01 mitochondrial D-tyrosyl-tRNA(Tyr) Q8TEA8 DTD1 4.453E-03 -4.480E-01 5.201E-04 -6.216E-01 deacylase 1 1 Isoform 2 of NADH Q16718-2 NDUFA5 8.172E-04 -4.311E-01 3.914E-04 -7.745E-01 dehydrogenase [ubiquinone] 1 alpha subcomplex subunit 5 Isoform 2 of Fructose- P04075-2 ALDOA 2.564E-03 -4.256E-01 7.392E-03 -6.171E-01 bisphosphate aldolase A Peptidyl-prolyl cis-trans Q13526 PIN1 1.130E-03 -3.917E-01 9.565E-06 -9.878E-01 isomerase NIMA-interacting 1 Mitochondrial import inner Q9Y5L4 TIMM13 1.759E-04 -3.875E-01 2.658E-03 -4.346E-01 membrane translocase subunit Tim13 14-3-3 protein eta Q04917 YWHAH 4.999E-01 -2.994E-01 5.756E-03 -1.635E+00 26S protease regulatory A0A087X2I1 PSMC6 5.644E-01 1.464E-01 2.276E-03 -8.141E-01 subunit 10B 3-hydroxyacyl-CoA Q99714 HSD17B10 5.735E-01 -7.288E-02 1.485E-04 -6.069E-01 dehydrogenase type-2 3-ketoacyl-CoA thiolase, A0A0B4J2A4 ACAA2 1.972E-01 -1.698E-01 4.707E-04 -5.742E-01 mitochondrial A-kinase anchor protein 12 Q02952 AKAP12 3.603E-01 -9.134E-02 1.614E-03 -4.658E-01 ATP synthase F(0) complex P24539 ATP5F1 2.646E-02 -5.400E-01 2.014E-04 -1.195E+00 subunit B1, mitochondrial ATP synthase subunit O, P48047 ATP5O 2.770E-02 -3.439E-01 1.684E-05 -9.332E-01 mitochondrial ATP synthase subunit alpha, P25705 ATP5A1 3.394E-01 -1.653E-01 3.065E-03 -6.564E-01 mitochondrial ATP synthase subunit P56381 ATP5E 2.914E-02 -3.728E-01 1.281E-03 -8.244E-01 epsilon, mitochondrial Alpha-internexin Q16352 INA 5.864E-01 -1.547E-01 8.300E-03 -9.529E-01 Ankyrin-2 I6L894 ANK2 4.074E-01 -2.006E-01 1.965E-01 3.564E-01 Ankyrin-2 Q01484 ANK2 1.885E-01 -3.857E-01 7.451E-03 -7.517E-01 Aspartate aminotransferase, P17174 GOT1 1.663E-01 -2.206E-01 3.226E-04 -8.068E-01 cytoplasmic Aspartate aminotransferase, P00505 GOT2 9.215E-02 -4.124E-01 3.229E-03 -8.777E-01 mitochondrial Beta-adducin P35612 ADD2 9.875E-01 -2.137E-03 3.014E-03 -4.535E-01 Beta-synuclein Q16143 SNCB 7.097E-01 -7.728E-02 8.855E-04 -9.587E-01 Brain acid soluble protein 1 P80723 BASP1 5.027E-01 -3.308E-01 2.776E-05 -2.879E+00 CAP-Gly domain-containing Q9UDT6 CLIP2 2.721E-01 1.044E-01 3.807E-03 -3.988E-01 linker protein 2 CLIP-associating protein 2 E7EW49 CLASP2 8.832E-02 2.676E-01 1.164E-04 -6.969E-01 Calcium/calmodulin- Q13554 CAMK2B 6.042E-01 -1.136E-01 2.690E-04 -1.095E+00 dependent protein kinase type II subunit beta Calcyclin-binding protein Q9HB71 CACYBP 9.103E-02 -1.277E-01 6.298E-05 -4.090E-01 Clathrin light chain B P09497 CLTB 1.425E-02 -3.531E-01 9.393E-05 -7.432E-01 Collagen alpha-2(IV) chain P08572 COL4A2 3.343E-02 -6.581E-01 5.603E-03 -9.356E-01 2 Creatine kinase U-type, P12532 CKMT1A 5.027E-01 -1.007E-01 1.093E-06 -9.984E-01 mitochondrial Crk-like protein P46109 CRKL 1.811E-01 -1.899E-01 1.996E-04 -6.290E-01 Cyclin-dependent-like kinase Q00535 CDK5 4.768E-01 -9.335E-02 7.319E-03 -5.475E-01 5 Cystatin-C P01034 CST3 1.337E-01 -3.599E-01 6.755E-03 -6.734E-01 Cysteine and histidine-rich Q9UHD1 CHORDC1 2.767E-01 -1.879E-01 3.906E-03 -6.403E-01 domain-containing protein 1 Cytochrome b-c1 complex P31930 UQCRC1 2.439E-02 -2.676E-01 1.033E-03 -5.904E-01 subunit 1, mitochondrial Cytochrome b-c1 complex P22695 UQCRC2 8.842E-01 3.131E-02 2.903E-04 -1.011E+00 subunit 2, mitochondrial Cytochrome c oxidase subunit P20674 COX5A 1.070E-01 -2.671E-01 4.390E-05 -1.232E+00 5A, mitochondrial Cytochrome c oxidase subunit P10606 COX5B 3.017E-02 -5.270E-01 2.304E-04 -1.864E+00 5B, mitochondrial Cytochrome c oxidase subunit P12074 COX6A1 6.820E-01 -1.015E-01 1.479E-04 -1.462E+00 6A1, mitochondrial Cytochrome c oxidase subunit P14854 COX6B1 4.828E-02 -3.545E-01 2.623E-05 -9.959E-01 6B1 Dihydrolipoyl P09622 DLD 2.040E-01 -1.761E-01 1.535E-03 -5.779E-01 dehydrogenase, mitochondrial Dihydrolipoyllysine-residue P10515 DLAT 9.583E-01 1.003E-02 2.903E-03 -5.745E-01 acetyltransferase component of pyruvate dehydrogenase complex, mitochondrial Drebrin Q16643 DBN1 1.708E-01 -3.295E-01 1.635E-03 -8.918E-01 Elongation factor 1-alpha 2 Q05639 EEF1A2 5.839E-02 -7.670E-01 1.248E-03 -1.765E+00 Endophilin-A3 Q99963 SH3GL3 7.411E-01 5.451E-02 5.477E-04 -8.744E-01 Eukaryotic translation I3L504 EIF5A 7.102E-01 -5.812E-02 1.125E-04 -1.150E+00 initiation factor 5A-1 Fatty acid-binding protein, S4R371 FABP3 1.889E-02 -3.356E-01 1.435E-03 -7.746E-01 heart (Fragment) Fructose-bisphosphate P09972 ALDOC 3.917E-01 -1.088E-01 5.564E-05 -7.127E-01 aldolase C Fumarate hydratase, P07954 FH 3.974E-01 -1.306E-01 8.325E-04 -5.567E-01 mitochondrial Gamma-enolase P09104 ENO2 7.987E-02 -1.478E-01 5.903E-04 -5.851E-01 Gamma-soluble NSF Q99747 NAPG 7.597E-02 -1.588E-01 2.599E-04 -5.203E-01 attachment protein Gamma-synuclein O76070 SNCG 2.869E-01 -1.793E-01 8.657E-05 -7.801E-01 Glucose-6-phosphate A0A0A0MTS2 GPI 3.983E-01 -1.014E-01 2.509E-03 -4.165E-01 isomerase (Fragment) Glutathione S-transferase Q9Y2Q3 GSTK1 9.588E-01 1.509E-02 5.204E-03 -1.161E+00 kappa 1 3 HIG1 domain family member C9JNU6 HIGD1A 3.272E-01 -2.261E-01 4.101E-04 -1.001E+00 1A, mitochondrial Heterogeneous nuclear P52272 HNRNPM 7.168E-01 -1.616E-02 1.937E-04 -4.287E-01 ribonucleoprotein M Hyaluronan and proteoglycan Q9GZV7 HAPLN2 9.009E-02 -5.195E-01 4.286E-05 -1.562E+00 link protein 2 Hypoxanthine-guanine P00492 HPRT1 6.308E-01 -7.132E-02 3.900E-03 -5.122E-01 phosphoribosyltransferase Immunoglobulin superfamily Q969P0 IGSF8 6.157E-02 -2.599E-01 3.015E-04 -7.467E-01 member 8 Interferon-inducible double- O75569 PRKRA 4.241E-02 -4.771E-01 4.848E-04 -1.147E+00 stranded RNA-dependent protein kinase activator A Isoaspartyl peptidase/L- Q7L266 ASRGL1 8.671E-01 -2.464E-02 7.620E-03 -5.145E-01 asparaginase Isoform 2 of Cytoplasmic O14576-2 DYNC1I1 2.327E-02 -8.297E-01 5.765E-04 -1.651E+00 dynein 1 intermediate chain 1 Isoform 2 of MIC Q16891-2 IMMT 2.545E-01 -1.080E-01 3.325E-05 -4.886E-01 Isoform 2 of NADH O95168-2 NDUFB4 1.728E-02 -4.495E-01 1.082E-06 -2.206E+00 dehydrogenase [ubiquinone] 1 beta subcomplex subunit 4 Isoform 2 of Serine/arginine- Q01130-2 SRSF2 4.255E-01 -1.399E-01 2.264E-03 -6.406E-01 rich splicing factor 2 Isoform 3 of Neurochondrin Q9UBB6-3 NCDN 8.974E-01 -3.598E-02 1.296E-03 -1.165E+00 Isoform 4 of Clathrin coat O60641-4 SNAP91 5.556E-02 -3.402E-01 8.500E-03 -5.470E-01 assembly protein AP180 Isoform 5 of Actin-binding Q6H8Q1-5 ABLIM2 2.073E-01 -3.341E-01 4.047E-03 -1.110E+00 LIM protein 2 Isoform 7 of Cytosolic acyl O00154-7 ACOT7 8.427E-01 -3.136E-02 1.739E-06 -1.556E+00 coenzyme A thioester hydrolase Isoform 9 of Calpastatin P20810-9 CAST 4.090E-01 -1.721E-01 3.625E-03 -1.020E+00 Leucine-rich repeat- Q8N1G4 LRRC47 3.200E-02 -3.239E-01 1.376E-04 -7.923E-01 containing protein 47 MAP6 domain-containing Q9H9H5 MAP6D1 3.703E-01 -2.553E-01 1.834E-04 -1.477E+00 protein 1 ATP synthase subunit d, O75947 ATP5H 3.103E-03 -3.821E-01 4.434E-04 -5.497E-01 mitochondrial MIC C9JRZ6 CHCHD3 2.912E-02 -6.187E-01 2.195E-03 -9.781E-01 Macrophage migration P14174 MIF 6.514E-02 -5.958E-01 7.627E-03 -8.703E-01 inhibitory factor Malate dehydrogenase, P40925 MDH1 7.469E-01 -3.783E-02 6.571E-05 -6.417E-01 cytoplasmic Malate dehydrogenase, P40926 MDH2 2.991E-02 -3.994E-01 1.317E-04 -7.848E-01 mitochondrial 4 Microtubule-associated F8W9U4 MAP4 2.742E-01 -2.519E-01 4.201E-03 -9.554E-01 protein Microtubule-associated E7EVA0 MAP4 3.660E-01 2.141E-01 9.383E-01 -1.732E-02 protein Microtubule-associated P11137 MAP2 1.979E-01 -4.528E-01 3.386E-03 -1.073E+00 protein 2 Microtubule-associated Q96JE9 MAP6 4.823E-02 -3.578E-01 2.345E-05 -1.030E+00 protein 6 Microtubule-associated Q9UPY8 MAPRE3 3.929E-01 3.012E-01 6.312E-03 -9.822E-01 protein RP/EB family member 3 NADH
Recommended publications
  • Calcium-Induced Conformational Changes in the Regulatory Domain of the Human Mitochondrial ATP-Mg/Pi Carrier

    Calcium-Induced Conformational Changes in the Regulatory Domain of the Human Mitochondrial ATP-Mg/Pi Carrier

    Biochimica et Biophysica Acta 1847 (2015) 1245–1253 Contents lists available at ScienceDirect Biochimica et Biophysica Acta journal homepage: www.elsevier.com/locate/bbabio Calcium-induced conformational changes in the regulatory domain of the human mitochondrial ATP-Mg/Pi carrier Steven P.D. Harborne, Jonathan J. Ruprecht, Edmund R.S. Kunji ⁎ The Medical Research Council, Mitochondrial Biology Unit, Cambridge Biomedical Campus, Wellcome Trust/MRC Building, Hills Road, Cambridge CB2 0XY, UK article info abstract Article history: The mitochondrial ATP-Mg/Pi carrier imports adenine nucleotides from the cytosol into the mitochondrial matrix Received 24 April 2015 and exports phosphate. The carrier is regulated by the concentration of cytosolic calcium, altering the size of the Received in revised form 15 June 2015 adenine nucleotide pool in the mitochondrial matrix in response to energetic demands. The protein consists of Accepted 6 July 2015 three domains; (i) the N-terminal regulatory domain, which is formed of two pairs of fused calcium-binding EF- Available online 9 July 2015 hands, (ii) the C-terminal mitochondrial carrier domain, which is involved in transport, and (iii) a linker region α Keywords: with an amphipathic -helix of unknown function. The mechanism by which calcium binding to the regulatory do- Calcium regulation mechanism main modulates substrate transport in the carrier domain has not been resolved. Here, we present two new crystal EF-hand conformational change structures of the regulatory domain of the human isoform 1. Careful analysis by SEC confirmed that although the SCaMC regulatory domain crystallised as dimers, full-length ATP-Mg/Pi carrier is monomeric. Therefore, the ATP-Mg/Pi Adenine nucleotide translocase carrier must have a different mechanism of calcium regulation than the architecturally related aspartate/glutamate Regulation of adenine nucleotides carrier, which is dimeric.
  • Proteomic Profile of Human Spermatozoa in Healthy And

    Proteomic Profile of Human Spermatozoa in Healthy And

    Cao et al. Reproductive Biology and Endocrinology (2018) 16:16 https://doi.org/10.1186/s12958-018-0334-1 REVIEW Open Access Proteomic profile of human spermatozoa in healthy and asthenozoospermic individuals Xiaodan Cao, Yun Cui, Xiaoxia Zhang, Jiangtao Lou, Jun Zhou, Huafeng Bei and Renxiong Wei* Abstract Asthenozoospermia is considered as a common cause of male infertility and characterized by reduced sperm motility. However, the molecular mechanism that impairs sperm motility remains unknown in most cases. In the present review, we briefly reviewed the proteome of spermatozoa and seminal plasma in asthenozoospermia and considered post-translational modifications in spermatozoa of asthenozoospermia. The reduction of sperm motility in asthenozoospermic patients had been attributed to factors, for instance, energy metabolism dysfunction or structural defects in the sperm-tail protein components and the differential proteins potentially involved in sperm motility such as COX6B, ODF, TUBB2B were described. Comparative proteomic analysis open a window to discover the potential pathogenic mechanisms of asthenozoospermia and the biomarkers with clinical significance. Keywords: Proteome, Spermatozoa, Sperm motility, Asthenozoospermia, Infertility Background fertilization failure [4] and it has become clear that iden- Infertility is defined as the lack of ability to achieve a tifying the precise proteins and the pathways involved in clinical pregnancy after one year or more of unprotected sperm motility is needed [5]. and well-timed intercourse with the same partner [1]. It is estimated that around 15% of couples of reproductive age present with infertility, and about half of the infertil- Application of proteomic techniques in male ity is associated with male partner [2, 3].
  • Biomarker Discovery for Chronic Liver Diseases by Multi-Omics

    Biomarker Discovery for Chronic Liver Diseases by Multi-Omics

    www.nature.com/scientificreports OPEN Biomarker discovery for chronic liver diseases by multi-omics – a preclinical case study Daniel Veyel1, Kathrin Wenger1, Andre Broermann2, Tom Bretschneider1, Andreas H. Luippold1, Bartlomiej Krawczyk1, Wolfgang Rist 1* & Eric Simon3* Nonalcoholic steatohepatitis (NASH) is a major cause of liver fbrosis with increasing prevalence worldwide. Currently there are no approved drugs available. The development of new therapies is difcult as diagnosis and staging requires biopsies. Consequently, predictive plasma biomarkers would be useful for drug development. Here we present a multi-omics approach to characterize the molecular pathophysiology and to identify new plasma biomarkers in a choline-defcient L-amino acid-defned diet rat NASH model. We analyzed liver samples by RNA-Seq and proteomics, revealing disease relevant signatures and a high correlation between mRNA and protein changes. Comparison to human data showed an overlap of infammatory, metabolic, and developmental pathways. Using proteomics analysis of plasma we identifed mainly secreted proteins that correlate with liver RNA and protein levels. We developed a multi-dimensional attribute ranking approach integrating multi-omics data with liver histology and prior knowledge uncovering known human markers, but also novel candidates. Using regression analysis, we show that the top-ranked markers were highly predictive for fbrosis in our model and hence can serve as preclinical plasma biomarkers. Our approach presented here illustrates the power of multi-omics analyses combined with plasma proteomics and is readily applicable to human biomarker discovery. Nonalcoholic fatty liver disease (NAFLD) is the major liver disease in western countries and is ofen associated with obesity, metabolic syndrome, or type 2 diabetes.
  • Pharmacogenomic Characterization in Bipolar Spectrum Disorders

    Pharmacogenomic Characterization in Bipolar Spectrum Disorders

    pharmaceutics Review Pharmacogenomic Characterization in Bipolar Spectrum Disorders Stefano Fortinguerra 1,2 , Vincenzo Sorrenti 1,2,3 , Pietro Giusti 2, Morena Zusso 2 and Alessandro Buriani 1,2,* 1 Maria Paola Belloni Center for Personalized Medicine, Data Medica Group (Synlab Limited), 35131 Padova, Italy; [email protected] (S.F.); [email protected] (V.S.) 2 Department of Pharmaceutical & Pharmacological Sciences, University of Padova, 35131 Padova, Italy; [email protected] (P.G.); [email protected] (M.Z.) 3 Bendessere™ Study Center, Solgar Italia Multinutrient S.p.A., 35131 Padova, Italy * Correspondence: [email protected] Received: 25 November 2019; Accepted: 19 December 2019; Published: 21 December 2019 Abstract: The holistic approach of personalized medicine, merging clinical and molecular characteristics to tailor the diagnostic and therapeutic path to each individual, is steadily spreading in clinical practice. Psychiatric disorders represent one of the most difficult diagnostic challenges, given their frequent mixed nature and intrinsic variability, as in bipolar disorders and depression. Patients misdiagnosed as depressed are often initially prescribed serotonergic antidepressants, a treatment that can exacerbate a previously unrecognized bipolar condition. Thanks to the use of the patient’s genomic profile, it is possible to recognize such risk and at the same time characterize specific genetic assets specifically associated with bipolar spectrum disorder, as well as with the individual response to the various therapeutic options. This provides the basis for molecular diagnosis and the definition of pharmacogenomic profiles, thus guiding therapeutic choices and allowing a safer and more effective use of psychotropic drugs. Here, we report the pharmacogenomics state of the art in bipolar disorders and suggest an algorithm for therapeutic regimen choice.
  • Systems Analysis Implicates WAVE2&Nbsp

    Systems Analysis Implicates WAVE2&Nbsp

    JACC: BASIC TO TRANSLATIONAL SCIENCE VOL.5,NO.4,2020 ª 2020 THE AUTHORS. PUBLISHED BY ELSEVIER ON BEHALF OF THE AMERICAN COLLEGE OF CARDIOLOGY FOUNDATION. THIS IS AN OPEN ACCESS ARTICLE UNDER THE CC BY-NC-ND LICENSE (http://creativecommons.org/licenses/by-nc-nd/4.0/). PRECLINICAL RESEARCH Systems Analysis Implicates WAVE2 Complex in the Pathogenesis of Developmental Left-Sided Obstructive Heart Defects a b b b Jonathan J. Edwards, MD, Andrew D. Rouillard, PHD, Nicolas F. Fernandez, PHD, Zichen Wang, PHD, b c d d Alexander Lachmann, PHD, Sunita S. Shankaran, PHD, Brent W. Bisgrove, PHD, Bradley Demarest, MS, e f g h Nahid Turan, PHD, Deepak Srivastava, MD, Daniel Bernstein, MD, John Deanfield, MD, h i j k Alessandro Giardini, MD, PHD, George Porter, MD, PHD, Richard Kim, MD, Amy E. Roberts, MD, k l m m,n Jane W. Newburger, MD, MPH, Elizabeth Goldmuntz, MD, Martina Brueckner, MD, Richard P. Lifton, MD, PHD, o,p,q r,s t d Christine E. Seidman, MD, Wendy K. Chung, MD, PHD, Martin Tristani-Firouzi, MD, H. Joseph Yost, PHD, b u,v Avi Ma’ayan, PHD, Bruce D. Gelb, MD VISUAL ABSTRACT Edwards, J.J. et al. J Am Coll Cardiol Basic Trans Science. 2020;5(4):376–86. ISSN 2452-302X https://doi.org/10.1016/j.jacbts.2020.01.012 JACC: BASIC TO TRANSLATIONALSCIENCEVOL.5,NO.4,2020 Edwards et al. 377 APRIL 2020:376– 86 WAVE2 Complex in LVOTO HIGHLIGHTS ABBREVIATIONS AND ACRONYMS Combining CHD phenotype–driven gene set enrichment and CRISPR knockdown screening in zebrafish is an effective approach to identifying novel CHD genes.
  • Supplementary Materials

    Supplementary Materials

    1 Supplementary Materials: Supplemental Figure 1. Gene expression profiles of kidneys in the Fcgr2b-/- and Fcgr2b-/-. Stinggt/gt mice. (A) A heat map of microarray data show the genes that significantly changed up to 2 fold compared between Fcgr2b-/- and Fcgr2b-/-. Stinggt/gt mice (N=4 mice per group; p<0.05). Data show in log2 (sample/wild-type). 2 Supplemental Figure 2. Sting signaling is essential for immuno-phenotypes of the Fcgr2b-/-lupus mice. (A-C) Flow cytometry analysis of splenocytes isolated from wild-type, Fcgr2b-/- and Fcgr2b-/-. Stinggt/gt mice at the age of 6-7 months (N= 13-14 per group). Data shown in the percentage of (A) CD4+ ICOS+ cells, (B) B220+ I-Ab+ cells and (C) CD138+ cells. Data show as mean ± SEM (*p < 0.05, **p<0.01 and ***p<0.001). 3 Supplemental Figure 3. Phenotypes of Sting activated dendritic cells. (A) Representative of western blot analysis from immunoprecipitation with Sting of Fcgr2b-/- mice (N= 4). The band was shown in STING protein of activated BMDC with DMXAA at 0, 3 and 6 hr. and phosphorylation of STING at Ser357. (B) Mass spectra of phosphorylation of STING at Ser357 of activated BMDC from Fcgr2b-/- mice after stimulated with DMXAA for 3 hour and followed by immunoprecipitation with STING. (C) Sting-activated BMDC were co-cultured with LYN inhibitor PP2 and analyzed by flow cytometry, which showed the mean fluorescence intensity (MFI) of IAb expressing DC (N = 3 mice per group). 4 Supplemental Table 1. Lists of up and down of regulated proteins Accession No.
  • Figure S1. Quality Control Validation of MS Data. (A‑C) Mass Error Distribution of All Peptides Identified in the Acetylome

    Figure S1. Quality Control Validation of MS Data. (A‑C) Mass Error Distribution of All Peptides Identified in the Acetylome

    Figure S1. Quality control validation of MS data. (A‑C) Mass error distribution of all peptides identified in the acetylome, succi- nylome and quantitative proteome, respectively. (D‑F) Length distribution of peptides identified in the acetylome, succinylome and quantitative proteome, respectively. Figure S2. Comparison of modification level between breast cancer tissue and normal tissue. Comparison of acetylation level (A) and succinylation level (B) between breast cancer tissue and normal tissue. Data are medians and were analyzed using Wilcoxon Signed Rank Test. **P<0.01. Table SI. Protein sites whose acetylation and succinylation levels were both significantly upregulated in breast cancer tissues (fold change ≥1.5 compared with normal tissues). Protein ID Protein name Modification site P54868 HMCS2 310K Q15063 POSTN 549K Q99715 COCA1 1601K P51572 BAP31 72K P07237 PDLA1 328K Q06830 PRDX1 192K P48735 IDHP 180K P30101 PDIA3 417K P0DMV9 HS71B 526K Q01995 TAGL 21K P06748 NPM1 27K Q00325 MPCP 209K P00488 F13A 69K P02545 LMNA 260K P08133 ANXA6 478K P02452 CO1A1 751K Table SII. Protein sites whose acetylation and succinylation levels were both significantly downregulated in breast cancer tissues (fold change ≥1.5 compared with normal tissues). Protein ID Protein name Modification site RET4 P02753 30K PSG2 P07585 142K HBA P69905 12K IGKC P01834 80K HBA P69905 8K Table SIII. All proteins whose expression level were significantly upregulated in breast cancer tissues (fold change ≥1.5 compared with normal tissues). Protein ID Protein description
  • Deubiquitinase UCHL1 Maintains Protein Homeostasis Through PSMA7-APEH- Proteasome Axis in High-Grade Serous Ovarian Carcinoma

    Deubiquitinase UCHL1 Maintains Protein Homeostasis Through PSMA7-APEH- Proteasome Axis in High-Grade Serous Ovarian Carcinoma

    bioRxiv preprint doi: https://doi.org/10.1101/2020.09.28.316810; this version posted October 9, 2020. The copyright holder for this preprint (which was not certified by peer review) is the author/funder. All rights reserved. No reuse allowed without permission. Deubiquitinase UCHL1 Maintains Protein Homeostasis through PSMA7-APEH- Proteasome Axis in High-Grade Serous Ovarian Carcinoma Apoorva Tangri1*, Kinzie Lighty1*, Jagadish Loganathan1, Fahmi Mesmar2, Ram Podicheti3, Chi Zhang1, Marcin Iwanicki4, Harikrishna Nakshatri1,5, Sumegha Mitra1,5,# 1 Indiana University School of Medicine, Indianapolis, IN, USA 2 Indiana University, Bloomington, IN, USA 3Center for Genomics and Bioinformatics, Indiana University, Bloomington, IN, USA 4Stevens Institute of Technology, Hoboken, NJ, USA 5Indiana University Melvin & Bren Simon Cancer Center, Indianapolis, USA *Equal contribution # corresponding author; to whom correspondence may be addressed. E-mail: [email protected] 1 bioRxiv preprint doi: https://doi.org/10.1101/2020.09.28.316810; this version posted October 9, 2020. The copyright holder for this preprint (which was not certified by peer review) is the author/funder. All rights reserved. No reuse allowed without permission. Abstract High-grade serous ovarian cancer (HGSOC) is characterized by chromosomal instability, DNA damage, oxidative stress, and high metabolic demand, which exacerbate misfolded, unfolded and damaged protein burden resulting in increased proteotoxicity. However, the underlying mechanisms that maintain protein homeostasis to promote HGSOC growth remain poorly understood. In this study, we report that the neuronal deubiquitinating enzyme, ubiquitin carboxyl-terminal hydrolase L1 (UCHL1) is overexpressed in HGSOC and maintains protein homeostasis. UCHL1 expression was markedly increased in HGSOC patient tumors and serous tubal intraepithelial carcinoma (HGSOC precursor lesions).
  • Cacybp (NM 009786) Mouse Tagged ORF Clone Product Data

    Cacybp (NM 009786) Mouse Tagged ORF Clone Product Data

    OriGene Technologies, Inc. 9620 Medical Center Drive, Ste 200 Rockville, MD 20850, US Phone: +1-888-267-4436 [email protected] EU: [email protected] CN: [email protected] Product datasheet for MR202748 Cacybp (NM_009786) Mouse Tagged ORF Clone Product data: Product Type: Expression Plasmids Product Name: Cacybp (NM_009786) Mouse Tagged ORF Clone Tag: Myc-DDK Symbol: Cacybp Synonyms: SIP Vector: pCMV6-Entry (PS100001) E. coli Selection: Kanamycin (25 ug/mL) Cell Selection: Neomycin ORF Nucleotide >MR202748 ORF sequence Sequence: Red=Cloning site Blue=ORF Green=Tags(s) TTTTGTAATACGACTCACTATAGGGCGGCCGGGAATTCGTCGACTGGATCCGGTACCGAGGAGATCTGCC GCCGCGATCGCC ATGGCTTCCGTTTTGGAAGAGTTGCAGAAAGACCTAGAAGAGGTCAAAGTATTGCTGGAAAAGTCCACTA GGAAAAGACTACGTGATACTCTTACAAGTGAAAAGTCCAAGATTGAGACGGAACTCAAGAACAAGATGCA ACAGAAGTCGCAGAAGAAACCAGAACTTGATAATGAAAAGCCAGCTGCTGTGGTTGCTCCTCTTACAACA GGATACACCGTGAAAATCAGTAATTATGGATGGGATCAGTCAGATAAGTTTGTGAAAATCTACATTACCT TGACTGGCGTCCATCAGGTGCCCACTGAGAACGTGCAGGTGCACTTCACAGAGAGGTCATTTGATCTTCT GGTAAAAAACCTCAATGGCAAGAATTACTCCATGATTGTGAACAATCTTTTGAAACCTATCTCTGTGGAA AGCAGTTCAAAAAAAGTCAAGACTGATACAGTAATTATTCTATGTAGAAAGAAAGCAGAAAACACAAGAT GGGACTACTTAACACAGGTGGAAAAGGAATGCAAAGAGAAAGAAAAGCCTTCCTACGACACGGAGGCAGA CCCTAGTGAGGGATTAATGAATGTTCTAAAGAAAATTTATGAAGACGGAGACGATGATATGAAGCGAACC ATTAATAAAGCGTGGGTGGAATCCAGAGAGAAGCAAGCCAGAGAAGACACGGAATTT ACGCGTACGCGGCCGCTCGAGCAGAAACTCATCTCAGAAGAGGATCTGGCAGCAAATGATATCCTGGATT ACAAGGATGACGACGATAAGGTTTAA This product is to be used for laboratory only. Not for diagnostic or therapeutic use. View online
  • Supplemental Information

    Supplemental Information

    Supplemental information Dissection of the genomic structure of the miR-183/96/182 gene. Previously, we showed that the miR-183/96/182 cluster is an intergenic miRNA cluster, located in a ~60-kb interval between the genes encoding nuclear respiratory factor-1 (Nrf1) and ubiquitin-conjugating enzyme E2H (Ube2h) on mouse chr6qA3.3 (1). To start to uncover the genomic structure of the miR- 183/96/182 gene, we first studied genomic features around miR-183/96/182 in the UCSC genome browser (http://genome.UCSC.edu/), and identified two CpG islands 3.4-6.5 kb 5’ of pre-miR-183, the most 5’ miRNA of the cluster (Fig. 1A; Fig. S1 and Seq. S1). A cDNA clone, AK044220, located at 3.2-4.6 kb 5’ to pre-miR-183, encompasses the second CpG island (Fig. 1A; Fig. S1). We hypothesized that this cDNA clone was derived from 5’ exon(s) of the primary transcript of the miR-183/96/182 gene, as CpG islands are often associated with promoters (2). Supporting this hypothesis, multiple expressed sequences detected by gene-trap clones, including clone D016D06 (3, 4), were co-localized with the cDNA clone AK044220 (Fig. 1A; Fig. S1). Clone D016D06, deposited by the German GeneTrap Consortium (GGTC) (http://tikus.gsf.de) (3, 4), was derived from insertion of a retroviral construct, rFlpROSAβgeo in 129S2 ES cells (Fig. 1A and C). The rFlpROSAβgeo construct carries a promoterless reporter gene, the β−geo cassette - an in-frame fusion of the β-galactosidase and neomycin resistance (Neor) gene (5), with a splicing acceptor (SA) immediately upstream, and a polyA signal downstream of the β−geo cassette (Fig.
  • Aldolase C (C-Terminus Specific) Data Sheet

    Aldolase C (C-Terminus Specific) Data Sheet

    Aldolase C (C-terminus Specific) Data Sheet Catalog Number: MO22157 Host: Mouse Product Type: Monoclonal IgG1 Species Human, horse, cow, pig, Affinity Purified Antibody Reactivity: chicken, rat, mouse Immunogen Sequence: C-terminal sequence Format: Liquid, 100 ul aliquot KYEGSGEDGGAAAQSLYIANHAY Concentration: 1 mg/ml HGNC name for this protein is ALDOC Applications: Immunofluorescence/Immunocytochemistry: 1:500-1:1,000 Immunohistochemistry: 1: 500-1:1,000 Western Blot: 1:1,000 Dilutions listed as a recommendation. Optimal dilution should be determined by investigator. Storage: Antibody can also be aliquoted and stored frozen at -20° C to -70° C in a manual defrost freezer for six months without detectable loss of activity. The antibody can be stored at 2° - 8° C for 1 month without detectable loss of activity. Avoid repeated freeze-thaw cycles. Application Notes Description/Data: Aldolase A is generally considered to be a muscle enzyme. Northern analysis of cultured cells suggests that it is present in both neurons and glia. Aldolase C shares 81% amino acid identity with aldolase A and 70% identity with aldolase B. Earlier studies using isozyme-specific antibodies report its location in gray matter astrocytes and cells of the pia mater. In situ hybridization of mouse central nervous system using isozyme-specific probes revealed that aldolase A and C are expressed in complementary cell types: aldolase A mRNA is found in neurons; aldolase C message is detected in astrocytes, some cells of the pia mater, and Purkinje cells. Aldolase C can in some situations be used as an astrocyte marker. However Purkinje cells of the cerebellum contain high levels of the enzyme, so the enzyme is not totally astrocyte specific.
  • Datasheet: VPA00226

    Datasheet: VPA00226

    Datasheet: VPA00226 Description: RABBIT ANTI ALDOA Specificity: ALDOA Format: Purified Product Type: PrecisionAb™ Polyclonal Isotype: Polyclonal IgG Quantity: 100 µl Product Details Applications This product has been reported to work in the following applications. This information is derived from testing within our laboratories, peer-reviewed publications or personal communications from the originators. Please refer to references indicated for further information. For general protocol recommendations, please visit www.bio-rad-antibodies.com/protocols. Yes No Not Determined Suggested Dilution Western Blotting 1/1000 PrecisionAb antibodies have been extensively validated for the western blot application. The antibody has been validated at the suggested dilution. Where this product has not been tested for use in a particular technique this does not necessarily exclude its use in such procedures. Further optimization may be required dependant on sample type. Target Species Human Species Cross Reacts with: Mouse, Rat Reactivity N.B. Antibody reactivity and working conditions may vary between species. Product Form Purified IgG - liquid Preparation Rabbit Ig fraction prepared by ammonium sulphate precipitation Buffer Solution Phosphate buffered saline Preservative 0.09% Sodium Azide (NaN3) Stabilisers Immunogen KLH conjugated synthetic peptide between 66-95 amino acids from the N-terminal region of human ALDOA External Database UniProt: Links P04075 Related reagents Entrez Gene: 226 ALDOA Related reagents Page 1 of 2 Synonyms ALDA Specificity Rabbit anti Human ALDOA antibody recognizes fructose-bisphosphate aldolase A, also known as epididymis secretory sperm binding protein Li 87p, fructose-1,6-bisphosphate triosephosphate-lyase, lung cancer antigen NY-LU-1 and muscle-type aldolase. Encoded by the ALDOA gene, fructose-bisphosphate aldolase A is a glycolytic enzyme that catalyzes the reversible conversion of fructose-1,6-bisphosphate to glyceraldehyde 3-phosphate and dihydroxyacetone phosphate.