Calcium-Induced Conformational Changes in the Regulatory Domain of the Human Mitochondrial ATP-Mg/Pi Carrier

Biochimica et Biophysica Acta 1847 (2015) 1245–1253

Contents lists available at ScienceDirect

Biochimica et Biophysica Acta

journal homepage: www.elsevier.com/locate/bbabio

Calcium-induced conformational changes in the regulatory domain of the human mitochondrial ATP-Mg/Pi carrier

Steven P.D. Harborne, Jonathan J. Ruprecht, Edmund R.S. Kunji ⁎

The Medical Research Council, Mitochondrial Biology Unit, Cambridge Biomedical Campus, Wellcome Trust/MRC Building, Hills Road, Cambridge CB2 0XY, UK article info abstract

Article history: The mitochondrial ATP-Mg/Pi carrier imports adenine nucleotides from the cytosol into the mitochondrial matrix Received 24 April 2015 and exports phosphate. The carrier is regulated by the concentration of cytosolic calcium, altering the size of the Received in revised form 15 June 2015 adenine nucleotide pool in the mitochondrial matrix in response to energetic demands. The protein consists of Accepted 6 July 2015 three domains; (i) the N-terminal regulatory domain, which is formed of two pairs of fused calcium-binding EF- Available online 9 July 2015 hands, (ii) the C-terminal mitochondrial carrier domain, which is involved in transport, and (iii) a linker region α Keywords: with an amphipathic -helix of unknown function. The mechanism by which calcium binding to the regulatory do- Calcium regulation mechanism main modulates substrate transport in the carrier domain has not been resolved. Here, we present two new crystal EF-hand conformational change structures of the regulatory domain of the human isoform 1. Careful analysis by SEC conﬁrmed that although the SCaMC regulatory domain crystallised as dimers, full-length ATP-Mg/Pi carrier is monomeric. Therefore, the ATP-Mg/Pi Adenine nucleotide translocase carrier must have a different mechanism of calcium regulation than the architecturally related aspartate/glutamate Regulation of adenine nucleotides carrier, which is dimeric. The structure showed that an amphipathic α-helix is bound to the regulatory domain in a hydrophobic cleft of EF-hand 3/4. Detailed bioinformatics analyses of different EF-hand states indicate that upon release of calcium, EF-hands close, meaning that the regulatory domain would release the amphipathic α-helix. We propose a mechanism for ATP-Mg/Pi carriers in which the amphipathic α-helix becomes mobile upon release of calcium and could block the transport of substrates across the mitochondrial inner membrane. Crown Copyright © 2015 Published by Elsevier B.V. This is an open access article under the CC BY license (http://creativecommons.org/licenses/by/4.0/).

1. Introduction total matrix adenine nucleotide pool. Therefore, APC has the important role of altering the mitochondrial adenine nucleotide pool in order to The mitochondrial ATP-Mg/Pi carrier (APC) is a member of the mito- adapt to changing cellular energetic demands [6–8]. chondrial carrier family of transport proteins. Mitochondrial carriers are In yeast only one APC ortholog exists (Sal1p) [9], whereas in humans typically located in the mitochondrial inner membrane and fulfil the four genes encode full-length APC paralogs; SLC25A24, SLC25A25, vital role of shuttling nucleotides, amino acids, inorganic ions, keto SLC25A23 and SLC25A54 encoding for the protein short calcium binding acids, fatty acids and cofactors between the mitochondrial matrix and mitochondrial carrier (SCaMC) isoform 1 (APC-1), SCaMC-2 (APC-3), the cytosol [1]. APC is involved in the import of cytosolic adenine nucle- SCaMC-3 (APC-2) and SCaMC-1L, respectively [3,10,11]. Another gene, otides into the mitochondrion and the export of inorganic phosphate SLC25A41, encodes for SCaMC-3L protein [12], which is shorter in from the mitochondrial matrix [2–4]. Mitochondria also have ADP/ATP sequence than the other APC isoforms (for a review see Satrústegui & carriers, a related but functionally distinct member of the mitochondrial Pardo, 2007) [13]. Mitochondrial carriers are fundamental to cellular carrier family [5]. In contrast to APC, ADP/ATP carriers catalyse the equi- metabolism, and have been implicated in many severe human diseases molar exchange of ADP from the cytosol for ATP synthesised in the [14]. There is experimental support for the notion that up-regulation of mitochondrial matrix, meaning that their activity does not influence human SCaMC-1 (HsAPC-1) expression in cancerous tissues may help the size of the adenine nucleotide pool [5]. The unequal exchange of these cells to evade cell death [15]. substrate catalysed by APC does have the potential to influence the APC has a three-domain structure. The N-terminal domain of APC forms a calcium-sensitive regulatory domain [3,10]. The consequence of calcium binding to the regulatory domain of APC is a stimulation of Abbreviations: APC, ATP-Mg/Pi carrier; SCaMC, short calcium binding mitochondrial the substrate transport activity of the carrier [2,4,7]. A structure of the carrier; LMNG, lauryl maltose neopentyl glycol; DTT, dithiothreitol; EGTA, ethylene glycol regulatory domain of human APC isoform-1 has recently been solved tetraacetic acid; RMSD, root-mean-squared deviation; SEC, size exclusion chromatogra- [16], confirming the presence of four EF-hands, each of which is occu- phy; RD, regulatory domain. ⁎ Corresponding author. pied by a bound calcium ion in a canonical pentagonal bi-pyramidal E-mail address: [email protected] (E.R.S. Kunji). fashion. The EF-hands group together into two pairs, forming two

http://dx.doi.org/10.1016/j.bbabio.2015.07.002 0005-2728/Crown Copyright © 2015 Published by Elsevier B.V. This is an open access article under the CC BY license (http://creativecommons.org/licenses/by/4.0/). 1246 S.P.D. Harborne et al. / Biochimica et Biophysica Acta 1847 (2015) 1245–1253 lobes connected by a long central α-helix, in a similar fashion to the four a pYES3/CT expression plasmid (Invitrogen), with the inducible galac- EF-hands of calmodulin [16]. tose promoter being replaced by the constitutive promoter for the The C-terminal domain of APC is a membrane protein with the yeast mitochondrial phosphate carrier, as described previously [26]. characteristic structural fold of mitochondrial carrier proteins [17].The The expression plasmid was transformed into S. cerevisiae haploid strain carrier fold is composed of three repeats [18], each containing two W303-1b [27], using established methods [28]. membrane-spanning α-helices connected by a matrix α-helix, making S. cerevisiae was cultured, and HsAPC-1 was expressed following a three-fold pseudo-symmetrical protein structure [19,20]. Atomic established methods [20], with the following modifications: pre- structures of both bovine [19] and yeast ADP/ATP carriers [20] provide cultures of yeast were set up in synthetic-complete tryptophan-dropout the basis for our understanding of the structure/function relationship medium (Formedium) supplemented with 2% glucose, and the main between key sequence elements conserved across the carrier family. cultures were carried out in an Applikon bioreactor with 100 L YEPD me- Based on the identification of a conserved central substrate binding dium. Mitochondria were prepared using established methods [29], flash site [21] flanked by two salt bridge networks on either side [22],anal- frozen in liquid nitrogen, and stored under liquid nitrogen until use. ternating access mechanism has been proposed for substrate transport HsAPC-1 was solubilised in lauryl maltose neopentyl glycol through carrier proteins [20,22]. (LMNG), and separated from insoluble protein by ultracentrifugation. The linker region between the N-terminal regulatory domain and Solubilised protein was passed through nickel sepharose affinity resin the C-terminal carrier domain contains an amphipathic α-helix of un- (GE Healthcare) to selectively bind full-length HsAPC-1, and washed known function. In the structure this α-helix is bound to EF-hand pair with 50 column volumes of buffer A (20 mM Tris pH 7.4, 150 mM 3 and 4, analogous to the binding of a calmodulin recognition sequence NaCl, 20 mM Imidazole, 0.1% (w/v) LMNG, 0.1 mg mL−1 tetra-oleoyl motif to the hydrophobic pockets in the EF-hands of calmodulin [16]. cardiolipin) and 30 column volumes of buffer B (20 mM Tris pH 7.4, Another member of the carrier family of proteins, the aspartate/ 50 mM NaCl, 0.1% (w/v) LMNG, 0.1 mg mL−1 tetra-oleoyl cardiolipin). glutamate carrier (AGC), also displays a calcium-dependence for activity Factor Xa protease (New England BioLabs) was used to specifically and has an N-terminal regulatory domain that contains EF-hands. cleave the HsAPC-1 protein from the affinity resin. After Factor Xa cleav- Structures of both the calcium-bound and calcium-free states of the age, HsAPC-1 was spun through an empty Proteus midi-spin column regulatory domain of the human AGC have recently been solved [23]. (Generon) to remove affinity resin. Protein concentrations were deter- The structures reveal eight EF-hand motifs, only one of which is in- mined using the bicinchoninic acid assay [30] against a bovine serum al- volved in calcium binding. Most mitochondrial carriers are monomeric bumin standard curve (Pierce). Purified protein was used immediately [24], but AGC was found to be dimeric [23]. EF-hands four to eight are for analysis using SEC. recruited to form an extensive interface for homo-dimerisation that is critical for the observed calcium-induced conformational changes 2.2. Expression and purification of HsAPC-1 regulatory domain within the regulatory domain of AGC [23]. Thus both APC and AGC have N-terminal regulatory domains consisting of EF-hands. Although Primers were design in order to create a construct of HsAPC-1 to in- no significant sequence similarity exists between these regulatory do- clude just the regulatory domain and the linker region (residues 14 to mains, there is the possibility that they share a common mechanism 174) of the protein (Forward primer: GAAGGTAGAACCTCCGAAGA. Re- of calcium-regulation, potentially based on a homo-dimer arrangement. verse primer: CCTAGGTCTAGACTCGAGTCATTATTATATATCAATACCTGT The protein construct used in the previous study of the HsAPC-1 regula- GGAATGTTT). The inter-domain loop was not included in this construct. tory domain was mutated at the extreme N-terminus to replace a cyste- The construct was cloned into the Lactococcus lactis expression plasmid ine residue at position 15 with a serine [16], raising the possibility that a pNZ8048, and the plasmid transformed into electrocompetent L. lactis native dimer could have been disrupted [25]. NZ9000 using established methods [31]. Expression of the construct NMR nuclear Overhauser effects have shown that the regulatory do- was carried out as described previously [23]. Purification of HsAPC-1 main of HsAPC-1 is more dynamic and less structured in the calcium- was achieved using a three-step chromatography protocol. First, clari- free state [16]. Binding studies with surface plasma resonance have fied L. lactis lysate was passed over Ni sepharose resin (GE Healthcare). indicated that the regulatory domain interacts with the carrier domain The resin was washed with 50 column volumes of purification buffer in the absence of calcium [16]. A mechanism was proposed in which (20 mM Tris pH 7.5, 150 mM NaCl, 1 mM DTT) containing 50 mM imid- the regulatory domain binds to the carrier domain in the absence of cal- azole and eluted in purification buffer containing 250 mM imidazole. cium, capping it in order to block substrate transport [16],howeverthat Second, recovered protein was concentrated, and desalted using a mechanism does not explain why the bound calcium-free regulatory PD10 column (GE Healthcare). The purification tag was removed from domain would be more dynamic. Therefore, the mechanism that cou- the construct by digestion with Factor Xa protease (Supplementary ples calcium binding in the regulatory domain to substrate transport Fig. 1). Finally protein was loaded onto a Superdex 200 pg 16/60 SEC in the carrier domain has not been resolved. column (GE Healthcare) in a running buffer of 20 mM Tris pH 7.5, Here, an independent structural determination of the native human 20 mM NaCl. Peak fractions were collected and concentrated to approx- APC-1 regulatory domain was completed, which was combined with an − imately10mgmL 1 for crystallography. investigation into the oligomeric state of the full-length human APC-1 protein. Furthermore, an extensive comparison of the conformations of EF-hand proteins in the calcium-free, calcium-bound and peptide- 2.3. Experimental analysis of oligomeric state bound state was undertaken, which has allowed us to propose a mechanism for the regulation of APC that is consistent with all available Superdex 200 pg 16/60 SEC columns (GE Healthcare) were cali- experimental data. brated with molecular weight standards from both the high and low molecular weight standards kits (GE Healthcare), and unknown protein 2. Materials and methods weights were estimated using the manufacturers recommended protocol. The SEC buffer used for analysis of the HsAPC-1 RD protein was 2.1. Expression and purification of full-length HsAPC-1 purification buffer with either 5 mM calcium or 5 mM EGTA, with or without 1 mM DTT added as stated. The SEC buffer used for analysis of A construct of HsAPC-1 (Uniprot: Q6NUK1) was designed to include the full-length HsAPC-1 was 20 mM Tris pH 7.4, 50 mM NaCl, 0.03% an eight-histidine tag followed by a Factor Xa cleavage site (IEGR) at the (w/v) LMNG and 0.03 mg mL−1 tetra-oleoyl cardiolipin. The buffers N-terminus, creating a cleavable purification-tag. The gene was codon- used to run the molecular weight standards in each case matched the optimized for expression in S. cerevisiae by GenScript and cloned into buffers being used in the analysis of each protein. S.P.D. Harborne et al. / Biochimica et Biophysica Acta 1847 (2015) 1245–1253 1247

Total detergent, phospholipid and protein contributions to the total [35] in the CCP4 suite [36]. The long-wavelength dataset was processed mass could be determined colorimetrically by sugar assay [32], phos- by the pipeline Xia2 [36] using 3D spot integration. For molecular re- phorus assay [33] and bicinchoninic acid assay [30], respectively. SDS- placement phenix.phaser within the PHENIX suite [37] of software was PAGE gels for the analysis of full-length HsAPC-1 were composed of used. After initial placement of molecular replacement models, 50 12% acrylamide and run using a Tris–Glycine buffer system. SDS-PAGE rounds of jelly body refinement in REFMAC5 [36] were used to improve gels for the analysis of HsAPC-1 RD were composed of 10% acrylamide phases before rounds of manual building and refinement were under- and run using a Tris–Tricine buffer system. Gels were stained with taken. Final rounds of refinement were carried out using phenix.refine Imperial coomassie stain (Bio-Rad), and de-stained in water. in the PHENIX suite [37] of software including the use of Translation/ Libration/Screw groups, selected using phenix.find_TLS_groups. 2.4. HsAPC-1 regulatory domain crystallisation, data collection and The long-wavelength dataset was phased by molecular replacement structural determination with the refined P212121 model using phenix.phaser. The anomalous difference map was calculated using phenix.find_peaks_and_holes. Crystallisation screening with purified HsAPC-1 RD yielded an ini- Phasing by molecular replacement of the P2 dataset was originally tial hit in drop H4 of the JBS Classics screen (Jena Bioscience) with only successful in P1 as the space-group was initially assigned as P21. a mother-liquor composed of 30% (w/v) polyethylene glycol 8000, The program ZANUDA in the CCP4 suite [36] was used to identify the 0.2 M ammonium sulfate. Optimisation around this hit produced square correct higher symmetry space-group as P2. For manual building of plate-like crystals in 29% (w/v) polyethylene glycol 8000, 0.2 M ammo- the model into density the program COOT was used [38]. nium sulfate, larger in both width and height than the original hit, approximately 200 × 200 μmindimension. 2.5. Structural interpretation and representation Crystals of a tetrahedral bi-pyramidal morphology could be grown in 25–30% (w/v) polyethylene glycol 8000, 0.2 M lithium sulfate condi- All structures were visualised and diagrams prepared using PyMOL tions. These crystals were smaller than the square plate-like crystals, (version 1.7.0.2) [39]. The program PISA in the CCP4 suite [36] was with dimensions of about 40 × 30 × 30 μm, and grew as well defined sin- used to evaluate the dimerisation interfaces of dimeric proteins in gle crystals. Table 3. The solvent filled cavity was visualised using the surface view High-resolution diffraction datasets were collected at Diamond mode in PyMOL [39] set to ‘cavities and pockets’, with surface cull set beamline I24 and ESRF beamline ID23-2 for the P2andP212121 crystals, to ‘47’, surface detection radius set to 5 solvent radii and surface cut- respectively. A long-wavelength dataset of the P212121 crystals used for off radius set to 4 solvent radii. a calcium-SAD experiment was also collected at Diamond beamline I24. Using the known HsAPC-1 RD structure as a molecular replacement 2.6. Comparison of EF-hand structures template [16] the structure of the HsAPC-1 RD was solved in two different space groups: to 2.1 Å resolution in space-group P2fromthesquare Uniprot was used to search for structures of EF-hand proteins with plate-like crystals, and to 2.6 Å in the space-group P212121 from the tet- a Pfam [40] assignment of EF-hand 7 or EF-hand 8, which both indi- rahedral bi-pyramidal type crystals. Refinement statistics are shown in cate pairs of EF-hands. Each EF-hand was superposed on EF-hand 1 of (Table 1). High-resolution datasets were integrated using iMOSFLM calcium-bound calmodulin using 10 residues of the entering α-helix [34], followed by scaling and merging with POINTLESS and AIMLESS to position 5 of the EF-hand loop. In total 129 EF-hands were aligned

Table 1 HsAPC-1 regulatory domain structure reﬁnement statistics.

2+ c Space group P212121 P2 P212121–Ca -SAD 4ZCV 4ZCU

Wavelength (Å) 1.002 0.873 1.823 Resolution range (Å) 40.10–2.80 (2.95–2.80) 39.39–2.1 (2.16–2.10) 40.40–4.35 (4.505–4.35) Unit cell 75.92 77.01 119.90 90 90 90 76.08 47.02 93.24 90 108.5 90 375.76 77.63 121.17 90 90 90 Total reﬂections 57586 118930 165332 Unique reﬂections 17779 36885 5031 Multiplicity 3.2 (3.2) 3.2 (3.2) 32.9 (27.5) Completeness (%) 99.6 (99.7) 99.67 (100.00) 99.7 (98.3) Anomalous multiplicity –– 17.9 (17.4) Anomalous completeness (%) –– 99.8 (98.3) Anomalous signala –– 0.1304 Mean I/sigma(I) 8.4 (2.8) 7.25 (1.47) 17.90 (5.94) Wilson B-factor 51.03 27.62 57.776 R-merge (%) 9.8 (40.0) 11.9 (95.8) 23.8 (102.8) R-meas (%) 12.2 (53.7) 14.3 (115.3) 24.8 (105.9) R-work 0.2110 0.2364 R-free 0.2590 0.2745 Number of non-hydrogen atoms 4859 3922 Water molecules 50 168 Protein residues 599 454 Number of molecules per ASUb 43 RMS(bonds) 0.011 0.0096 RMS(angles) 0.927 0.829 Ramachandran favoured (%) 97.5 97.5 Ramachandran outliers (%) 0 0.5 Clash score 8.66 9.09 Average B-factor 64 50

Statistics for the highest-resolution shell are shown in parentheses. a Anomalous signal calculated by phenix.Xtriage. b Asymmetric unit (ASU). c Single wavelength anomalous dispersion (SAD). 1248 S.P.D. Harborne et al. / Biochimica et Biophysica Acta 1847 (2015) 1245–1253 with one another (Supplementary Table 1). A line was drawn through were involved in experimental planning, data collection at synchro- the centre of both the entering and exiting α-helix, and the angle be- trons, data analysis and manuscript preparation. tween the lines calculated. A histogram of all the angles was plotted using Prism 5.0 (GraphPad) and a Gaussian distribution of the angles 2.9. Accession numbers each subset of EF-hands exhibit, were calculated. The coordinates and structure factors of the calcium-bound regulatory domain of the ATP-Mg/Pi carrier in both the P2andP2 2 2 2.7. Modelling calcium-free HsAPC-1 1 1 1 forms have been deposited in the Protein Data Bank under accession codes PDB ID: 4ZCU and PDB ID: 4ZCV, respectively. We propose α-helix 4/5 represents a static element connecting the two lobes of the protein together. The pitch of the α-helix 4/5 allowed 3. Results and discussion precise manual alignment [39] of the calcium-free EF-hand pair models independently of the position of the other α-helices of the calcium- 3.1. The HsAPC-1 regulatory domain structure bound lobes of the HsAPC-1 RD structure. This process was repeated, replacing both lobe 1 and 2 with each respective reference model. A construct of the regulatory domain (RD) and the linker region Residues from the end of α-helix 8 onwards were excluded from the (residues 14 to 174) of HsAPC-1 was expressed in L. lactis and purified. models, as no reference for the position of the amphipathic α-helix in HsAPC-1 RD was crystallised using sitting drop vapour diffusion tech- the calcium-free state is available. The MODELLER [41] web-server was niques, predominantly in two different conditions. Molecular replace- then used to perform comparative protein structure modelling in order ment using the recently solved structure of the HsAPC-1 RD (PDB ID: to replace the residues of the reference structures with those of HsAPC- 4N5X) [16], yielded solutions, which were refined to produce models 1 RD. This approach included the use of spatial restraints and CHARMM with good R-factors and geometry statistics in space-groups P2 2 2 energy terms in order to preserve the proper stereochemistry, and an op- 1 1 1 or P2(Table 1). timisation step using the variable target function method [42]. As was found previously [16], the HsAPC-1 RD structure is formed of two lobes connected by a long α-helix (helix 4/5) (Fig. 1A), with 2.8. Author contributions each lobe composed of a pair of EF-hands. Furthermore, each EF- hand displays an ‘open’ antiparallel arrangement of α-helices (in- S.P.D.H. expressed, purified and crystallised proteins, performed bio- cluding EF-hand 4), equivalent to that of calcium-bound calmodulin chemical assays and carried out the structure determination. All authors structures [43–47].

Fig. 1. Features of the HsAPC-1 RD structure. A) A single chain of the HsAPC-1 regulatory domain (RD) structure. B) Detailed views of the EF-hands where each observation in the seven chains is superposed. Electron density from an anomalous difference Fourier map, calculated from the P212121 space-group, is displayed as a mesh in red (σ-level of 5). C) View of hydrophobic pockets 1 and 2 that bind the loop preceding the amphipathic α-helix and the amphipathic α-helix itself, respectively, or D) the position of calmodulin recognition sequence motifs (black for calmodulin peptides or cyan for others) when EF-hands of other proteins are superposed on lobe 2 of the HsAPC-1 RD structure. In panels A and B a cartoon representation of the HsAPC-1 RD molecule is shown, but in panels C and D a surface representation is used. In all panels EF-hands 1 to 4 are coloured in purple, blue, yellow and orange respectively. The amphipathic α-helix is represented in red. Calcium ions are represented as lime green spheres, and red spheres represent water molecules. In all cases, where side chains are shown, they are represented as sticks, and nitrogen and oxygen atoms are coloured according to convention. S.P.D. Harborne et al. / Biochimica et Biophysica Acta 1847 (2015) 1245–1253 1249

Table 2 α-helix in each case matched the position of the amphipathic α-helix Superposition of signal peptides with the amphipathic α-helix. well (Fig. 1D), with α-helices bound to calmodulin being most similar Protein Peptide PDB Residuesa EF-hands Peptide Reference in position (Table 2). We conclude that this interaction is not an artefact, bound RMSD RMSD and propose that the amphipathic α-helix has a speciﬁc role in the b c (Å) (Å) regulatory mechanism. Calmodulin Rs20 1QS7 5–74 0.753 2.780 Unpublished One unusual feature of the interaction between the hydrophobic Calmodulin MLCK 2BBN 5–74 1.510 5.094 [53] pocket and its target, the amphipathic α-helix, is that they are both – Calmodulin PMCA 4AQR 5 74 1.113 9.631 [54] part of the same polypeptide chain. Other EF-hand proteins, such as cal- R-domain α Troponin C Troponin I 3TZ1 83–149 3.112 9.301 [55] modulin, interact with target -helices of other proteins. However, the KCNIP1 Selfd 1S1E 123–170 0.163 11.403 [48] APC regulatory domain is not unique in this type of ‘self-sequestered’ GCAP1 Selfd 2R2I 86–129 0.419 9.665 [49] interaction. Other examples are Kv channel interacting protein-1 e d Citrin Self 4P5W 12–87 0.959 12.062 [23] [48], Guanylate activating protein 1 [49],AGC[23], stroma interacting Abbreviations: Myosin light chain kinase (MLCK), Calcium-transporting ATPase 8, Plasma molecule-1 [50], and Calcyphosin [51]. membrane type (PMCA), Kv channel interacting protein-1 (KCNIP1), Guanylate activating The interaction between regulatory domain and the amphipathic protein 1 (GCAP1). α-helix resembles that of AGC and the C-terminal α-helix, and given a EF-hands were aligned to residues 88–151 of the HsAPC-1 RD structure. b RMSD calculated using the align function in PyMOL (version 1.7.0.2) and represents that they are both members of the mitochondrial carrier family of pro- the value after outlier rejection. teins it is tempting to conclude that they might have an analogous c RMSD calculated using rms_cur function in PyMOL (version 1.7.0.2) and represents mechanism. However, a fundamental difference is that in AGC the car- the value without superposition and without rejecting outliers. rier domain is inserted between the EF-hands and the target α-helix, d The α-helix with which the EF-hands are interacting is part of the same polypeptide whereas in APC the target α-helix is inserted between the EF-hands chain. e Synonym for citrin is AGC-2. and the carrier domain.

3.2. Oligomeric state of HsAPC-1 For each chain, electron density was observed for residues 23 to 174. For four of the chains there was a break in electron density between In both crystal space-groups, HsAPC-1 RD was crystallised as a paral- residues 139 and 141 (EF-hand 4), and calcium could only be modelled lel homo-dimer (Fig. 2A). In the previous study, it was crystallised as a into EF-hand 4 in the three chains of the P2 space group, but not the four monomer, but Cys15 was replaced by serine [16]. The dimer interface chains in the P212121 space-group (Fig. 1B). This is in contrast with the is composed of the α-helices of the EF-hands (helices 1, 2, 3, 6, and 7), previously solved structure, which showed calcium binding in all four and is focussed at two contact points, one point from each EF-hand EF-hands [16]. pair. All of the HsAPC-1 RD chains observed here differ slightly from It was previously suggested that an interaction between the terminal the previous HsAPC-1 RD structure (PDB ID: 4N5X) around α-helices 2 amphipathic α-helix and the hydrophobic pocket of HsAPC-1 RD might and 3 (Fig. 2B). These α-helices are involved in the first contact point be a crystallisation artefact [16]. Here we independently confirm this of the dimerisation interface, which could explain these differences. interaction (Fig. 1C), even though the expression, purification and In total, between the two space groups, seven copies of the HsAPC-1 crystallisation procedures, and the crystal packing was different. It was RD were observed in this study. Each chain has a solvent accessible sur- previously noted that the interaction of the amphipathic α-helix with face area of approximately 8800 Å [36], of which 1400 Å [36] is buried pocket-2 mimics the binding of signal-peptides into the hydrophobic by the dimer interface. All seven copies can be superposed upon pockets in calmodulin [16]. This analysis was extended (Table 2)by one another with good agreement: RMSD 0.552 Å (±0.270 Å)over superimposing structures of other α-helix binding EF-hand pairs onto all atoms in each chain. Furthermore, the dimers can also be superposed lobe 2 of HsAPC-1 RD independently of the bound α-helix. The bound with good agreement: RMSD 0.629 Å (±0.475 Å) over all atoms in each

Fig. 2. Crystal packing of HsAPC-1 RD chains, and comparison to previous HsAPC-1 RD structure. A) Seven unique dimer combinations of HsAPC-1 RD in total were superposed upon one another. Each dimer is represented as a cartoon and coloured according to B-factor values as indicated in the key. The two main points of contact between each chain of the dimer are labelled I and II respectively. B) The seven observed chains of the HsAPC-1 RD were superposed on the previously published one (PDB ID: 4N5X). The structures in panel B are coloured by the RMSD difference from 4N5X as in the key. Calcium ions are represented as lime green spheres. 1250 S.P.D. Harborne et al. / Biochimica et Biophysica Acta 1847 (2015) 1245–1253

Table 3 Comparison of dimerisation interfaces in EF-hand containing proteins.

Protein PDB code Monomer or dimer Surface of monomer (Å2) Surface area buried hydrogen bonds salt-bridges Solvation energy gain in solution by dimerization (kcal mol−1)

(Å2) (%)

HsAPC-1 RD 4ZCV – 8716 1394 16 4 0 −16.6 Calmodulin 1CLL Monomer 9721.0 612.4 6 2 4 1.0 Calcyphosin 3E3R Monomer 11376.8 824.5 7 7 0 −7.5 Recoverin 1REC Monomer/dimer 9565 1060 11 9 1 −13.9 Neurocalcin 1BJF Monomer/dimer 10554 1161 11 8 4 −9.5 AGC RD 4P5W Dimer 15719 2242 14 15 2 −22.0 S100A15 4AQI Dimer 6248 1136 18 13 0 −21.3 Calpain 1DVI Dimer 10781 2085 19 20 1 −21.8

Crystal contacts 2–5% in all cases.

dimer. Thus the configuration of the dimers is very similar between the crystal contacts observed between chains of calmodulin or calcyphosin two space groups, even though they are packed very differently. (Table 3). One of the contact points of dimerisation involves the calcium- To clarify this issue further, an independent experimental analysis of binding loop of EF-hand 4, a site that had notably high B-factors and the oligomeric state of the HsAPC-1 was conducted, first on the full- poor electron density (Fig. 2A). Between the two contact points there length HsAPC-1 (Fig. 3). The protein was expressed in yeast, solubilised is a large solvent-filled cavity. In comparison to structures of proteins in LMNG, purified and analysed by size exclusion chromatography with proven dimerisation interfaces, the two chains of HsAPC-1 bury a (SEC) (Fig. 3A). Compared to molecular weight standards, the total comparable surface area, however the theoretical solvation energy mass of the HsAPC-1 protein:detergent:lipid micelle was 223.5 kDa. gain was more comparable to that of recoverin or neurocalcin that An experimental assessment of the individual contributions to the have an interface for transient dimerisation (Table 3). The interface total mass revealed that 153.2 kDa could be attributed to detergent, between HsAPC-1 protomers contains relatively few hydrogen bonds 18.7 kDa could be attributed to lipid, with the remaining mass, and no salt-bridge interactions, which is more comparable to the 51.2 kDa, being attributed to protein. Full-length HsAPC-1 has a

Fig. 3. Full-length HsAPC-1 is monomeric. A) SEC trace for full-length HsAPC-1 and protein quantification by SDS-PAGE gel (inset). B) Contributions of protein, detergent and lipid to the total mass. C) SEC trace for crudely isolated HsAPC-1 RD. Peak 1 was found to contain a contaminant, and identified as the 56.1 kDa E2 component of the L. lactis pyruvate dehydrogenase complex (Supplementary Fig. 1). In panels A and C the elution volume of molecular weight standards are indicated and annotated with the mass of the standard. D) Protein from each of the peaks 2 and 3 run on an SDS-PAGE gel in the presence or absence of DTT. S.P.D. Harborne et al. / Biochimica et Biophysica Acta 1847 (2015) 1245–1253 1251 theoretical molecular mass of 53.4 kDa, demonstrating that the protein is monomeric in detergent (Fig. 3B). Next the oligomeric state of the isolated HsAPC-1 RD construct was investigated. During purification, two dominant peaks with retention volumes of 85 mL and 94.5 mL were observed in SEC traces (peak 2 and peak 3) (Fig. 3C). By SDS-PAGE analysis combined with peptide mass fingerprinting, both peaks 2 and 3 were found to contain HsAPC- 1 RD (Supplementary Fig. 1). The theoretical mass of the HsAPC-1 RD protein construct is 21 kDa. The estimated molecular weight of the protein in peak 2 (56 kDa) corresponds to the theoretical mass of a regulatory domain dimer, and peak 3 (28 kDa) is consistent with the mass of a monomer (Supplementary Fig. 2). It was important to determine whether the observed dimerisation of the isolated RD could be influenced by calcium. Fractions from peak 2 and peak 3 were pooled separately, and analysed by SEC in the presence of calcium or ethylene glycol tetraacetic acid (EGTA), and with or without the reducing agent dithiothreitol (DTT). The elution volumes of the dimer and monomer species were both affected (Table 4 and Supplementary Fig. 2), but the shift in estimated size between the two conditions was not enough to account for the difference between a monomer and a dimer. The addition of the reducing agent DTT caused the protein in peak 2 to shift in size closer to the mass expected for the monomeric species in both calcium and EGTA conditions (Table 4 and Supplementary Fig. 2). Therefore, dimerisation appears to be caused by disulphide bond formation between proteins (Fig. 3D), and is not influenced by calcium binding (Table 4 and Supplementary Fig. 2). The cysteine residue in the HsAPC-1 RD sequence (Cys15) that is involved in the disulphide bond is not conserved in other APC orthologs (Supplementary Fig. 3). To conclude; (i) the dimerisation interface between the two chains of HsAPC-1 does not conform to expected characteristics for a physi- ologically relevant dimer, (ii) the cysteine involved in covalent dimerisation is not conserved and (iii) no effect of calcium on disulphide bond formation could be observed. Therefore, APC is monomeric and dimers of the HsAPC-1 RD observed in SEC traces and in crystal structures appear to be caused by non-specific disulphide bond formation between Cys15 residues and by crystal packing, respectively. Thus the Fig. 4. Calcium-induced conformational changes in EF-hands. Views of 129 EF-hands – mechanism of calcium regulation of transport must be different from superposed on EF-hand 1 of calcium-bound calmodulin, in the calcium-free (A C) and calcium-bound (D–F) states. Entering and exiting α-helices are represented as a line that of AGC, which is dimeric. though the α-helix centre. G) A histogram of the angles between the entering and exiting α-helices of conventional (not S100-like) EF-hands. 3.3. Modelling conformational changes in the HsAPC-1 regulatory domain

The HsAPC-1 RD has been solved in a calcium-bound state. However, Calcium-bound EF-hands displayed open or semi-open conforma- to appreciate the mechanism by which the regulatory domain would in- tions. The angle of the exiting α-helix relative to the entering α-helix ﬂuence substrate transport, the calcium-free state must also be investi- was 70° to 90° and 55° to 70°, respectively (Fig. 4). Calcium-free EF- gated. Even though attempts have been made here and previously [16], hands displayed generally a closed conformation (45° to 65°). These it was not possible to obtain crystal hits in the presence of EGTA. Instead results agree with a previous study [52], but expand the reference set structures of other EF-hand proteins within the PDB were studied to de- to include a larger number of EF-hands published since the previous rive the most likely conformational change in the absence of calcium. study was conducted. A diverse reference set of EF-hand containing proteins was selected The largest variations were seen for the S100-like EF-hands, which from the PDB with a preference for those containing EF-hands organised have an additional two residues in the calcium-binding loop, and in pairs. Both crystal structures and NMR models of calcium-bound and therefore provide a wider variety of possible conformations of the calcium-free states were selected (Supplementary Table 1). In total, exiting α-helix. Some of the EF-hands within AGC are S100-like, but over 100 EF-hands were structurally superposed. all four EF-hands of HsAPC-1 are conventional EF-hands, and adopt the fully open conformation as expected for calcium-bound EF-hands Table 4 ( Fig. 4 and Supplementary Table 1). Oligomeric state of HsAPC-1 RD under different conditions. In order to understand the conformational changes that occur when Original Conditions of second Elution Estimated Oligomeric state HsAPC-1 goes from the calcium-bound to the calcium-free state, models oligomeric SEC column volume molecular after second SEC of the calcium-free state were generated based on deposited structures. state (mL) weight (kDa) column Ca2+ EGTA DTT Three models of known calcium-free EF-hand pairs (with conventional EF-hand motifs) were chosen as reference structures for modelling; Monomer ✓ 93.8 25 Monomer Dimer ✓ 84.8 51 Dimer centrin(PDBID:1ZMZ)withanangleof~40°,N-terminallobeofcalmod- Dimer ✓✓93.8 25 Monomer ulin (PDB ID: 1CFD) with an angle of ~55° and the N-terminal lobe of Monomer ✓ 90.3 34 Monomer calcium-dependent protein kinase (PDB ID: 3HZT) with an angle of ~65°. Dimer ✓ 79.3 80 Dimer Although the three resulting models had some structural differences Dimer ✓✓90.3 34 Monomer from one another, the general motion that they described was 1252 S.P.D. Harborne et al. / Biochimica et Biophysica Acta 1847 (2015) 1245–1253

Fig. 5. A model for the calcium regulation of HsAPC-1 RD. A) Three models for calcium-free HsAPC-1 RD based on centrin (model-1), calmodulin (model-2) and calcium-dependent protein kinase (model-3) were superposed onto the calcium-bound HsAPC-1 RD structure and coloured cyan, magenta and green respectively. The calcium-bound HsAPC-1 structure is coloured by RMSD difference from the calcium-free models as in the key. B) A close up view of hydrophobic pocket 2 into which the amphipathic α-helix (red) is bound. The calcium-bound HsAPC- 1 RD structure is shown as a surface representation and coloured blue, whereas the superposed calcium-free models are represented as cartoon (coloured as in panel A). C) The proposed regulatory mechanism between calcium-bound state of HsAPC-1 where the carrier is active and the calcium-free state of HsAPC-1 where the carrier is inactive. The calcium-free model presented in panel C is based on model 2. α-helices are represented as cylinders in panel C. Calcium ions are presented as lime green spheres. consistent (Fig. 5A). All calcium-free models show that α-helices 6 and Importantly, any mechanism for calcium regulation of transport must 7 adopt a position that would prevent the binding of the amphipathic α- be based on APC functioning as a monomer. helix to hydrophobic pocket 2 (Fig. 5B). Therefore, in the absence So far only structures of the calcium-bound state have been solved of calcium, the hydrophobic pockets of HsAPC-1 RD close, and as a (Fig. 1) [16], but it was possible to propose a model for the calcium-free consequence the amphipathic α-helix is excluded (Supplementary state based on known structures of calcium-free EF-hand pairs (Fig. 5). video 1). All three models agree with this mechanism, but model 2 We propose a conformational change in the HsAPC-1 RD where the am- is preferred, as it represents the median of calcium-free EF-hand phipathic α-helix fulﬁls a role similar to that of a calmodulin recognition structures (Fig. 4G). In support of this mechanism, the isolated APC sequence motif, even though it is part of the same protein. We propose regulatory domain becomes more dynamic in the absence of calcium, that upon the removal of calcium, the EF-hands close, leading to displace- particularly in the region of the amphipathic α-helix as demonstrated ment of the amphipathic α-helix from the hydrophobic pocket. Once re- by nuclear Overhauser effect experiments [16]. Furthermore, we dem- leased, the amphipathic α-helix would be in an ideal position to interact onstrate here using SEC that under calcium-free condition the hydrody- with the carrier domain and block transport of substrates. namic radius of the isolated APC regulatory domain is increased in Supplementary data to this article can be found online at http://dx. comparison with the calcium-bound state (Table 4), consistent with doi.org/10.1016/j.bbabio.2015.07.002. the exclusion of the amphipathic α-helix from the pocket. It is possible that when the amphipathic α-helix is released, it could Transparency document interact with the carrier domain to inhibit substrate transport, either by blocking access to the binding site or by preventing conformational The Transparency document associated with this article can be changes required for transport by the carrier domain (Fig. 5D). This found, in the online version. model for the mechanism has more consistent features with an EF- hand mechanism than the “capping and uncapping” mechanism, previ- Acknowledgements ously proposed [16]. We gratefully acknowledge support from the Medical Research 4. Conclusion Council (MC_U105663139). We thank Shane Palmer for the large- scale fermentation, Gay Chalklin for the preparation of media, and The evidence presented here indicates that the functional unit of Kamburapola Jayawardena for the protein identiﬁcation. We acknowl- APC, including the isolated regulatory domain, is a monomer. Therefore, edge the European Synchrotron Radiation Facility (Grenoble, France) APC differs from AGC, which has a regulatory mechanism based on con- for provision of the synchrotron radiation facilities and access to formational changes within a dimeric regulatory domain. Thus they beamline ID23-2 that contributed to the results presented here. We must be different in the key functional elements involved in regulation. thank Diamond Light Source (Harwell, UK) for the access to beamlines S.P.D. Harborne et al. / Biochimica et Biophysica Acta 1847 (2015) 1245–1253 1253

I24 (proposal numbers mx6641 and mx8547) that also contributed to insights into ancestry and physiology of a laboratory mutt, Open Biol. 2 (2012) (120093-120093). the results presented here. [28] R.D. Gietz, R.H. Schiestl, High-efficiency yeast transformation using the LiAc/SS carrier DNA/PEG method, Nat. Protoc. 2 (2007) 31–34. [29] E.R.S. Kunji, M. Harding, Projection structure of the atractyloside-inhibited mito- References chondrial ADP/ATP carrier of Saccharomyces cerevisiae, J. Biol. Chem. 278 (2003) 36985–36988. [1] F. Palmieri, The mitochondrial transporter family SLC25: identification, properties [30] P.K. Smith, R.I. Krohn, G.T. Hermanson, A.K. Mallia, F.H. Gartner, M.D. Provenzano, and physiopathology, Mol. Asp. Med. 34 (2013) 465–484. E.K. Fujimoto, N.M. Goeke, B.J. Olson, D.C. Klenk, Measurement of protein using [2] J. Austin, J.R. Aprille, Carboxyatractyloside-insensitive influx and efflux of adenine bicinchoninic acid, Anal. Biochem. 150 (1985) 76–85. nucleotides in rat liver mitochondria, J. Biol. Chem. 259 (1984) 154–160. [31] E.R. Geertsma, B. Poolman, High-throughput cloning and expression in Lactococcus [3] G. Fiermonte, F. De Leonardis, S. Todisco, L. Palmieri, F.M. Lasorsa, F. Palmieri, lactis, Nat. Methods (2007)http://dx.doi.org/10.1038/nprot.2007.290. Identification of the mitochondrial ATP-Mg/Pi transporter. Bacterial expression, re- [32] A. Urbani, T. Warne, A colorimetric determination for glycosidic and bile salt-based constitution, functional characterization, and tissue distribution, J. Biol. Chem. 279 detergents: applications in membrane protein research, Anal. Biochem. 336 (2005) (2004) 30722–30730. 117–124. [4] S. Cavero, J. Traba, A. del Arco, J. Satrustegui, The calcium-dependent ATP-Mg/Pi mi- [33] B.N. Ames, Assay of inorganic phosphate, total phosphate and phosphatases, tochondrial carrier is a target of glucose-induced calcium signalling in Saccharomyces Complex Carbohydr. 8 (1966) 115–118. cerevisiae, Biochem. J. 392 (2005) 537–544. [34] T.G.G. Battye, L. Kontogiannis, O. Johnson, H.R. Powell, A.G.W. Leslie, iMOSFLM: [5] M. Klingenberg, The ADP and ATP transport in mitochondria and its carrier, Biochim. a new graphical interface for diffraction-image processing with MOSFLM, Acta Biophys. Acta Biomembr. 1778 (2008) 1978–2021. Crystallogr. D D67 (2011) 271–281. [6] J. Aprille, Mechanism and regulation of the mitochondrial ATP-Mg/Pi carrier, [35] P.R. Evans, G.N. Murshudov, How good are my data and what is the resolution? Acta J. Bioenerg. Biomembr. 25 (1993) 473–481. Crystallogr. D D69 (2013) 1204–1214. [7] I. Amigo, J. Traba, M.M. Gonzalez-Barroso, C.B. Rueda, M. Fernandez, E. Rial, A. [36] M.D. Winn, C.C. Ballard, K.D. Cowtan, E.J. Dodson, P. Emsley, P.R. Evans, R.M. Keegan, Sanchez, J. Satrústegui, A. del Arco, Glucagon regulation of oxidative phosphoryla- E.B. Krissinel, A.G.W. Leslie, A. McCoy, S.J. McNicholas, G.N. Murshudov, N.S. Pannu, tion requires an increase in matrix adenine nucleotide content through Ca2+- E.A. Potterton, H.R. Powell, R.J. Read, A. Vagin, K.S. Wilson, Overview of the CCP4 activation of the mitochondrial ATP-Mg/Pi carrier SCaMC-3, J. Biol. Chem. 288 suite and current developments, Acta Crystallogr. D D67 (2011) 235–242. (2013) 7791–7802. [37] P.D. Adams, P.V. Afonine, G. Bunkoczi, V.B. Chen, I.W. Davis, N. Echols, J.J. Headd, L.W. [8] C.B. Rueda, I. Llorente-Folch, I. Amigo, L. Contreras, P. González-Sánchez, P. Martínez- Hung, G.J. Kapral, R.W. Grosse-Kunstleve, A.J. McCoy, N.W. Moriarty, R. Oeffner, R.J. Valero, I. Juaristi, B. Pardo, A. del Arco, J. Satrustegui, Ca2+ regulation of mitochondrial Read, D.C. Richardson, J.S. Richardson, T.C. Terwilliger, P.H. Zwart, PHENIX: a com- function in neurons, Biochim. Biophys. Acta Bioenerg. 1837 (2014) 1617–1624. prehensive python-based system for macromolecular structure solution, Acta [9] X.J. Chen, Sal1p, a calcium-dependent carrier protein that suppresses an essential Crystallogr. D D66 (2010) 213–221. cellular function associated with the Aac2 Isoform of ADP/ATP translocase in [38] P. Emsley, B. Lohkamp, W.G. Scott, K. Cowtan, Features and development of Coot, Saccharomyces cerevisiae, Genetics 167 (2004) 607–617. Acta Crystallogr. D 66 (2010) 486–501. [10] A. del Arco, J. Satrustegui, Identification of a novel human subfamily of mitochondrial [39] W.L. DeLano, The PyMOL Molecular Graphics System, DeLano Scientific, San Carlos, carriers with calcium-binding domains, J. Biol. Chem. 279 (2004) 24701–24713. CA, 2002. (http://www.pymol.org., cited 2015 Jan 10). [11] I. Amigo, J. Traba, J. Satrustegui, A. del Arco, SCaMC-1Like a member of the [40] R.D. Finn, A. Bateman, J. Clements, P. Coggill, R.Y. Eberhardt, S.R. Eddy, A. Heger, K. mitochondrial carrier (MC) family preferentially expressed in testis and localized Hetherington, L. Holm, J. Mistry, E.L.L. Sonnhammer, J. Tate, M. Punta, Pfam: the pro- in mitochondria and chromatoid body, PLoS ONE 7 (2012) e40470. tein families database, Nucleic Acids Res. 42 (2013) D222–D230. [12] J. Traba, J. Satrustegui, A. del Arco, Characterization of SCaMC-3-like/slc25a41, [41] B. Webb, A. Sali, Comparative Protein Structure Modeling Using MODELLER, Curr. a novel calcium-independent mitochondrial ATP-Mg/Pi carrier, Biochem. J. 418 Protoc. Bioinformatics (2014) (Chapter 5, Unit 5.6, 1–32). (2009) 125–133. [42] W. Braun, N. Gō, Calculation of protein conformations by proton–proton distance [13] J. Satrústegui, B. Pardo, A. del Arco, Mitochondrial transporters as novel targets for constraints: a new efficient algorithm, J. Mol. Biol. 186 (1985) 611–626. intracellular calcium signaling, Physiol. Rev. 87 (2007) 29–67. [43] Y.S. Babu, C.E. Bugg, W.J. Cook, Structure of calmodulin refined at 2.2 Å resolution, [14] F. Palmieri, Mitochondrial transporters of the SLC25 family and associated diseases: J. Mol. Biol. 204 (1988) 191–204. a review, J. Inherit. Metab. Dis. 37 (2014) 565–575. [44] D.A. Taylor, J.S. Sack, J.F. Maune, K. Beckingham, F.A. Quiocho, Structure of a recom- [15] J. Traba, A. del Arco, M.R. Duchen, G. Szabadkai, J. Satrústegui, SCaMC-1 promotes binant calmodulin from Drosophila melanogaster refined at 2.2 Å resolution, J. Biol. cancer cell survival by desensitizing mitochondrial permeability transition via Chem. 266 (1991) 21375–21380. ATP/ADP-mediated matrix Ca2+ buffering, Cell Death Differ. 19 (2012) 650–660. [45] R. Chattopadhyaya, W.E. Meador, A.R. Means, F.A. Quiocho, Calmodulin structure [16] Q. Yang, S. Brüschweiler, J.J. Chou, A Self-Sequestered calmodulin-like Ca2+ sensor refined at 1.7 Å resolution, J. Mol. Biol. 228 (1992) 1177–1192. of mitochondrial SCaMC carrier and its implication to Ca2+-dependent ATP-Mg/Pi [46] S.T. Rao, S. Wu, K.A. Satyshur, K.Y. Ling, C. Kung, M. Sundaralingam, Structure of transport, Structure 22 (2014) 209–217. Paramecium tetraurelia calmodulin at 1.8 Å resolution, Protein Sci. 2 (1993) 436–447. [17] E. Kunji, A.J. Robinson, The conserved substrate binding site of mitochondrial [47] J.L. Fallon, F.A. Quiocho, A closed compact structure of native Ca2+-calmodulin, carriers, Biochim. Biophys. Acta 1757 (2006) 1237–1248. Structure 11 (2003) 1303–1307. [18] M. Saraste, J.E. Walker, Internal sequence repeats and the path of polypeptide in [48] R.H. Scannevin, K. Wang, F. Jow, J. Megules, D.C. Kopsco, W. Edris, K.C. Carroll, Q. Lü, mitochondrial ADP/ATP translocase, FEBS Lett. 144 (1982) 250–254. W. Xu, Z. Xu, A.H. Katz, S. Olland, L. Lin, M. Taylor, M. Stahl, K. Malakian, W. Somers, [19] E. Pebay-Peyroula, C. Dahout-Gonzalez, R. Kahn, V. Trézéguet, G.J.M. Lauquin, L. Mosyak, M.R. Bowlby, P. Chanda, K.J. Rhodes, Two N-terminal domains of Kv4 K+ G. Brandolin, Structure of mitochondrial ADP/ATP carrier in complex with channels regulate binding to and modulation by KChIP1, Neuron 41 (2004) carboxyatractyloside, Nature 426 (2003) 39–44. 587–598. [20] J.J. Ruprecht, A.M. Hellawell, M. Harding, P.G. Crichton, A.J. McCoy, E.R.S. Kunji, [49] R. Stephen, G. Bereta, M. Golczak, K. Palczewski, M.C. Sousa, Stabilizing function for Structures of yeast mitochondrial ADP/ATP carriers support a domain-based myristoyl group revealed by the crystal structure of a neuronal calcium sensor, alternating-access transport mechanism, Proc. Natl. Acad. Sci. U. S. A. 111 (2014) guanylate cyclase-activating protein 1, Structure 15 (2007) 1392–1402. E426–E434. [50] L. Zheng, P.B. Stathopulos, R. Schindl, G.-Y. Li, C. Romanin, M. Ikura, Auto-inhibitory [21] A.J. Robinson, E.R.S. Kunji, Mitochondrial carriers in the cytoplasmic state have a role of the EF-SAM domain of STIM proteins in store-operated calcium entry, Proc. common substrate binding site, Proc. Natl. Acad. Sci. U. S. A. 103 (2006) 2617–2622. Natl. Acad. Sci. U. S. A. 108 (2011) 1337–1342. [22] A.J. Robinson, C. Overy, E.R.S. Kunji, The mechanism of transport by mitochondrial [51] H. Dong, X. Li, Z. Lou, X. Xu, D. Su, X. Zhou, W. Zhou, M. Bartlam, Z. Rao, Crystal- carriers based on analysis of symmetry, Proc. Natl. Acad. Sci. U. S. A. 105 (2008) structure and biochemical characterization of recombinant human calcyphosine 17766–17771. delineates a novel EF-hand-containing protein family, J. Mol. Biol. 383 (2008) [23] C. Thangaratnarajah, J.J. Ruprecht, E.R.S. Kunji, Calcium-induced conformational 455–464. changes of the regulatory domain of human mitochondrial aspartate/glutamate [52] K.L. Yap, J.B. Ames, M.B. Swindells, M. Ikura, Diversity of conformational states and carriers, Nat. Commun. 5 (2014) e5491. changes within the EF-hand protein superfamily, Proteins 37 (1999) 499–507. [24] E.R.S. Kunji, P.G. Crichton, Mitochondrial carriers function as monomers, Biochim. [53] M. Ikura, G.M. Clore, A.M. Gronenborn, G. Zhu, C.B. Klee, A. Bax, Solution structure of Biophys. Acta Bioenerg. 1797 (2010) 817–831. a calmodulin-target peptide complex by multidimensional NMR, Science 256 [25] J.M. Herrmann, J. Riemer, Mitochondrial disulfide relay: redox-regulated protein (1992) 632–638. import into the intermembrane space, J. Biol. Chem. 287 (2012) 4426–4433. [54] H. Tidow, L.R. Poulsen, A. Andreeva, M. Knudsen, K.L. Hein, C. Wiuf, M.G. Palmgren, [26] P.G. Crichton, M. Harding, J.J. Ruprecht, Y. Lee, E.R.S. Kunji, Lipid, detergent, and P. Nissen, A bimodular mechanism of calcium control in eukaryotes, Nature 491 Coomassie Blue G-250 affect the migration of small membrane proteins in blue na- (2013) 468–472. tive gels: mitochondrial carriers migrate as monomers not dimers, J. Biol. Chem. 288 [55] Y.S. Kato, F. Yumoto, H. Tanaka, T. Miyakawa, Y. Miyauchi, D. Takeshita, Y. Sawano, T. (2013) 22163–22173. Ojima, I. Ohtsuki, M. Tanokura, Structure of the Ca2+ -saturated C-terminal domain [27] M. Ralser, H. Kuhl, M. Ralser, M. Werber, H. Lehrach, M. Breitenbach, B. Timmermann, of scallop troponin C in complex with a troponin I fragment, Biol. Chem 394 (2013) The Saccharomyces cerevisiae W303-K6001 cross-platform genome sequence: 55–68.