Searching for the mechanism that mediates the mefenoxam-acquired resistance phenomenon in Phytophthora infestans and how it is regulated

Juliana González Tobón

Director: Giovanna Danies Turano

Co-director: Silvia Restrepo Restrepo

Department of Biological Sciences

Faculty of Sciences

Universidad de los Andes

October 21st 2018

1 1 Searching for the mechanism that mediates the mefenoxam-acquired resistance

2 phenomenon in Phytophthora infestans and how it is regulated

3

4 Juliana González-Tobón1, Richard Childers2, Alejandra Rodríguez1, William Fry3, Kevin L.

5 Myers3, Keith L. Perry3, Jeremy R. Thompson3, Silvia Restrepo1, and Giovanna Danies4,*

6

7 1 Department of Biological Sciences, Universidad de los Andes, Bogotá, Colombia

8 2 Department of Organismic and Evolutionary Biology, Harvard University, Cambridge, MA,

9 USA

10 3 School of Integrative Plant Science, Plant Pathology and Plant-Microbe Biology Section,

11 Cornell University, Ithaca, NY, USA

12 4 Department of Design, Universidad de los Andes, Bogotá, Colombia

13

14 *Corresponding author: G. Danies; E-mail address: [email protected]

15

2 16 Abstract

17 Phytophthora infestans, the causal agent of late blight disease of potatoes and tomatoes, is

18 mainly controlled by the use of fungicides. Isolates of P. infestans that are resistant to commonly

19 used fungicides have already been reported. Aside from natural resistance, several studies have

20 shown that isolates of P. infestans that are originally sensitive to the fungicide mefenoxam are

21 able to acquire resistance to this fungicide when exposed to sub-lethal concentrations of it. This

22 phenomenon termed ‘mefenoxam-acquired resistance’ has been observed in different species of

23 the Phytophthora genus and seems to be unique to mefenoxam. The first objective of this study

24 was to elucidate the molecular mechanism mediating this acquisition of resistance. For this

25 purpose, we were specifically interested in determining the genes that might be associated with

26 the acquisition of resistance to mefenoxam in Phytophthora infestans. Additionally, we wanted

27 to investigate if the RNA polymerase I (pol I) could be involved in its occurrence. Our results

28 indicate no clear interaction between RNA pol I and the acquisition of resistance in P. infestans.

29 However, differentially expressed genes that might be related to this phenomenon were

30 determined and classified in seven functional groups. Altogether they seem to be involved in a

31 pleiotropic drug resistance (PDR) phenotype, thus elucidating a plausible mechanism for this

32 special type of resistance to mefenoxam. The second objective was to investigate if there is a

33 regulatory epigenetic process, such as small non-coding RNAs, adenine DNA methylation or

34 chromatin remodeling, mediating this mechanism. Interestingly, several small ncRNAs were

35 found to be differentially expressed in the originally sensitive isolates when comparing them

36 before and after acquiring resistance. The majority of these small ncRNAs seem to be

37 specifically related to some of the genes found to be mediating the PDR phenotype, thus

38 accounting for a possible regulatory system to this phenomenon.

3 39 Introduction

40 Phytophthora infestans, a plant pathogenic oomycete, is the causal agent of late blight disease of

41 potatoes and tomatoes. This disease was responsible for the great Irish famine in the mid XIX

42 century and it still causes billion dollar losses worldwide (CIP, 2004). The principal control

43 strategy for this disease, is the use of fungicides (Schoina & Govers, 2015). However,

44 individuals of P. infestans can present natural resistance against them (Fry et al., 2013).

45 Moreover, it has been shown that isolates of P. infestans are able to acquire resistance in vitro to

46 one of the most commonly used fungicides, mefenoxam (containing primarily the active R-

47 enantiomer of metalaxyl) (Childers et al., 2015; Monkiedje & Spiteller, 2002).

48 The phenomenon of mefenoxam-acquired resistance was originally reported in studies

49 dating back to 1979 and 1981 (Bruin & Edgington, 1981; Staub, Dahmen, Urech, & Schwinn,

50 1979). Childers et al., (2015) showed that the acquisition of mefenoxam resistance occurred on

51 different genotypes of P. infestans after a single passage on mefenoxam-containing medium

52 amended with sub-lethal concentrations of the fungicide. Furthermore, they showed that after a

53 few passages on mefenoxam-free medium the isolates that had acquired resistance slightly

54 recovered their sensitivity. Recently, in González-Tobón et al., (in preparation) it was shown that

55 the phenomenon also occurs in isolates of a newly described species termed Phytophthora

56 betacei, closely related to P. infestans (Mideros et al., 2018). Interestingly, in this same study it

57 was shown that the acquisition of resistance to fluopicolide and cymoxanil does not seem to

58 occur. These fungicides contain different chemical compounds (benzamide and cyanoacetamide-

59 oxime, respectively) to that of mefenoxam (phenylamide) (FRAC, 2017).

60 The molecular mechanism behind the phenomenon of mefenoxam-acquired resistance is

61 still unknown. Childers et al., (2015) implemented a whole-transcriptome sequencing assay, to

4 62 isolates of P. infestans before and after the acquisition of resistance, and found a set of genes that

63 were most highly differentially expressed between these two conditions. Mainly, two ABC

64 transporter proteins, the phospholipase D (PLD) gene, some RXLR effectors and several

65 conserved hypothetical proteins were identified. These proteins have been reported in organisms

66 from different phylogenetic lineages but have not been functionally characterized (Galperin &

67 Koonin, 2004). From the 32 genes that were found to be differentially expressed and common

68 among the four isolates tested, almost half of them were annotated as conserved hypothetical

69 proteins. From these, seven had a blastp hit that provided information about it. However, all the

70 others remained unknown (Childers et al., 2015).

71 On the other hand, given that mefenoxam is a phenylamide fungicide known to inhibit

72 the synthesis of rRNAs (Leen C. Davidse, Gerritsma, Ideler, Pie, & Velthuis, 1988; Fisher &

73 Hayes, 1982). a modification or alteration on this process might be expected. So far, it has been

74 reported that metalaxyl has a negative effect on the incorporation of uridine into RNA (L. C.

75 Davidse, 1990). Also, it is known that only a part of the synthesis of rRNAs is sensitive to the

76 fungicide because only RNA Polymerase I (RNA Pol I) is affected by it when in complex with

77 its template (L. C. Davidse, 1990). However, additional information on this matter is not

78 available.

79 A widely known mechanism used by bacteria to respond towards changing or extreme

80 environmental conditions is the use of alternate sigma factors, the recognizing elements of the

81 bacterial RNA polymerase (Decker & Hinton, 2013). These alternate factors seem to be quite

82 important for bacterial pathogenesis (Decker & Hinton, 2013) as seen, for example, in

83 Pseudomonas aeruginosa (Ishimoto & Lory, 1989) and Clostridium difficile (Mani & Dupuy,

84 2001). A similar situation has been reported for RNA Polymerase II in eukaryotes, where this

5 85 enzyme can alternate among a set of binding sequences and transcription factors in order to use

86 available promoters efficiently (Decker & Hinton, 2013). Even though this has not been yet

87 reported for the RNA Polymerase I, a similar mechanism might be expected (Decker & Hinton,

88 2013). Specially under situations that force the organisms to overcome a certain pressure.

89 It was previously suggested in Childers et al., (2015) that a mutation seemed unlikely

90 because of the speed on which the acquisition of mefenoxam resistance occurs, its apparent

91 reversibility, and its occurrence in different genotypes of P. infestans. Therefore, a regulatory

92 mechanism mediating the molecular process behind it is most plausible. An epigenetic

93 mechanism has been considered (Childers et al., 2015). The four principal epigenetic processes,

94 chromatin remodeling, small non-coding RNA regulation (ncRNA), histone tail modifications

95 such as methylation and acetylation, and m6A-type DNA methylation (Chen et al., 2017; Kasuga

96 & Gijzen, 2013; Raffaele et al., 2010; Vetukuri et al., 2011) have been reported in P. infestans.

97 This study aimed to investigate both the mechanism behind the phenomenon of

98 mefenoxam-acquired resistance in P. infestans as well as the regulatory process mediating it. For

99 our first objective, we were specifically interested in determining the genes that might be

100 associated with the acquisition of resistance to mefenoxam in P. infestans. Additionally, we

101 wanted to investigate if the RNA Pol I could be involved in its occurrence. Mainly, by

102 evidencing changes on the 25S and 18S rRNAs genes’ expression or by means of alternative

103 enzyme subunits encoded in the P. infestans genome. For our second objective, we investigated

104 if there is a regulatory epigenetic mechanism, such as small ncRNAs, adenine DNA methylation,

105 or histone modifications, mediating the molecular process that accounts for the mefenoxam-

106 acquired resistance phenomenon.

107

6 108 Materials and Methods

109 Isolates and growth conditions.

110 Three isolates of P. infestans were evaluated in this study, US140120 (US-23 clonal lineage),

111 IMK-1 (US-22 clonal lineage), and RC1#10 (EC-1 clonal lineage). Isolates US140120 and IMK-

112 1 are naturally sensitive to mefenoxam and have been shown to acquire resistance to mefenoxam

113 after exposure to sub-lethal concentrations of the fungicide (Childers et al., 2015); González-

114 Tobón et al., in preparation). Isolate RC1#10 is naturally resistant to mefenoxam. All isolates

115 were kept and routinely transferred onto pea agar (120 g of frozen pea, 15 g of agar, 20 g of

116 sugar, and 2 g of CaCO3 for 1 L of medium) (Jaime-Garcia et al., 2000) and incubated at 20 ± 0.5

117 °C.

118

119 Initial sensitivity, acquisition of resistance to mefenoxam, and total RNA extraction.

120 The initial sensitivity of the isolates was confirmed and subsequently the isolates were exposed to

121 sub-lethal concentrations of mefenoxam in order to trigger their acquisition of resistance. To

122 confirm the initial sensitivity, each isolate was grown on five pea agar plates amended with

123 mefenoxam (RidomilGold SL, 45.3% a.i.; Syngenta) at concentrations final concentrations of 0,

124 1, 5, 10, and 100 µg ml-1 of its active ingredient (Childers et al., 2015; Saville et al., 2014). Colony

125 diameter at each mefenoxam-amended plate was recorded when mycelial radial growth on the

126 control plate (0 µg ml-1) covered 80 to 90% of the petri plate. Thus, mycelial radial growth was

127 presented as a percentage of the growth on the control plate (see Step A in Figure 1). For the

128 acquired resistance assays, subcultures from isolates growing at 1 and 5 µg ml-1 of mefenoxam,

129 were transferred to media containing 0, 5, and 100 µg ml-1 of mefenoxam. Mycelial growth was

130 assessed as done for the initial sensitivity assays (see Step B in Figure 1). Both assays were done

7 131 in triplicate (technical replicates) for each isolate and fungicide concentration. The whole

132 experiment was repeated three times (biological replicates), each with freshly prepared medium.

133 All Petri plates were incubated at 20 ± 0.5 °C. In order to confirm that there was a significant effect

134 of previous fungicide exposure on mycelial radial growth of the isolates, a mixed model was

135 constructed using restricted maximum likelihood (REML) in the R platform (R Core Team 2012).

136 Biological replicates were considered random terms and previous fungicide exposure was

137 considered a fixed effect.

138 After these isolates acquired resistance, subcultures from mycelia growing at 100 µg ml-1,

139 that had been previously exposed to 5 µg ml-1, were transferred to medium amended with 100 µg

140 ml-1 of mefenoxam as well as to a control plate (0 µg ml-1). This was done for at least four

141 successive subcultures to ensure that genes associated to the acquisition of resistance to

142 mefenoxam were being expressed. The samples resulting from this treatment will be referred to

143 as “treated” from now on. In addition, subcultures from these same isolates growing at 0 µg ml-1,

144 that had never been exposed to mefenoxam, were transferred to mefenoxam-free plates for the

145 same number of times. The samples resulting from this treatment will be referred to as

146 “untreated” from now on. All subcultures were done when the colony diameter was

147 approximately 2 cm (see Step C in Figure 1). After these successive subcultures, a final transfer

148 was done to pea broth with 0 µg ml-1 for untreated samples and to pea broth with 100 µg ml-1 of

149 mefenoxam for treated ones.

150 Total RNA was extracted from each isolate growing in pea broth with 0 µg ml-1

151 (untreated) and in pea broth with 100 µg ml-1 (treated) (see Step D in Figure 1) using the RNeasy

152 Plant Mini kit (with the following modification: RWT instead of RW1 buffer so that small RNAs

153 will not be discarded) (QIAGEN, Hilden, Germany). Total RNA quality and quantity were

8 154 assessed with an agarose gel electrophoresis and using a NanoDrop 1000 Spectrophotometer

155 (Thermo Fisher, Waltham, MA, USA), respectively.

156

157 In silico analyses of the whole transcriptome profile.

158 Re-analysis.

159 In order to identify the genes that might be associated with the acquisition of resistance, a re-

160 analysis of previously published data was done. The re-analysis involved raw sequencing data

161 from Childers and collaborators (2015) but was done using Trinity (Haas et al., 2013), a RNA-

162 Seq de novo assembler. De novo assemblers predict transcripts without the need of a reference

163 genome. This is helpful for organisms such as P. infestans whose genome is very complex and

164 thus lacks sequencing quality. These sets of raw data include sequencing data from four different

165 isolates. Three isolates were originally sensitive to mefenoxam (isolate IMK-270 from the US-23

166 clonal lineage, and isolates 1032 & 1034 both from the US-24 clonal lineage). The fourth isolate

167 was originally resistant to this fungicide (isolate 4432, clonal lineage US-8). To estimate

168 transcript abundance and identify differentially expressed (DE) transcripts RSEM (Li & Dewey,

169 2011) and edgeR (M. D. Robinson, McCarthy, & Smyth, 2009) were used, respectively. Only

170 transcripts that were at least 4-fold differentially expressed with a significance of P ≤ 0.001,

171 when comparing both treatments, were annotated using the Blast2GO suite (Götz et al., 2008).

172 Based on this annotation, those that were common to two, three, or the four tested isolates were

173 selected (see Supplementary Table 1).

174

175 Expanded analysis including rRNAs.

176 With the purpose of determining whether the expression of 25S and 18S rRNA genes could be

9 177 affected by the acquisition of resistance to mefenoxam, an expanded analysis on the same set of

178 raw RNA-Seq data was done. In in this case only tRNA sequences were removed as

179 contaminants, thus leaving rRNA sequences for further alignment to the P. infestans T30-4

180 genome (available from the Broad Institute, http://www.broadinstitute.org). Alignments were

181 done using Bowtie 2 (Langmead, Trapnell, Pop, & Salzberg, 2009) allowing for one mismatch

182 per segment. Afterwards, the ‘Rsubread’ R package (Liao, Smyth, & Shi, 2014) was

183 implemented to estimate each gene’s abundance. Furthermore, significant DE genes were

184 identified using the NOISeqBIO R package (Tarazona, García-Alcalde, Dopazo, Ferrer, &

185 Conesa, 2011). Only those genes with a probability of 0.95 (1 – FDR) or higher of being

186 significantly differentially expressed when comparing both treatments were kept. Genes that

187 were common among all four tested isolates were selected (see Supplementary Table 2).

188

189 Exhaustive annotation of hypothetical proteins.

190 Because some of the DEGs found by Childers et al. (2015) were hypothetical proteins, a more

191 exhaustive annotation process was done in order to obtain further information on their potential

192 functional roles. We complemented the previously used protein-protein BLAST results by

193 running a set of three nucleotide-nucleotide BLAST analyses: blastn, discontiguous megablast,

194 and megablast with default parameters. We also implemented a conserved domain analysis on

195 these sequences using the CDD (Conserved Domain Database) from NCBI Entrez (Marchler-

196 Bauer et al., 2013). Subsequently, a search of specific sequence features and protein signatures

197 was done using Blast2GO (Götz et al., 2008). This tool was also implemented to classify the

198 proteins in known protein families.

199

10 200 In silico search for alternative RNA Polymerase I subunits in the genome of Phytophthora

201 infestans.

202 In order to identify alternative RNA polymerase I subunits in the genome of P. infestans, a set of

203 BLAST analyses were done. Fourteen expected subunits of P. infestans RNA Pol I were

204 published previously (see Table 1) (Randall et al., 2014). We included these sequences as part of

205 our query as well as sequences belonging to closely related species of the genus that were

206 available at Ensembl Protists (http://protists.ensembl.org/index.html) (see Table 1). All

207 sequences were individually blasted against the P. infestans T30-4 genome to search for multiple

208 alignments. The test was done using three different stringency parameters: megablast (highly

209 similar sequences), discontiguous megablast (more dissimilar sequences), and blastn (somewhat

210 similar sequences).

211

212 qRT-PCR profiles.

213 A real-time reverse-transcription PCR (qRT-PCR) was done to obtain an expression profile of 12

214 genes selected from all the genes that were identified as DE in the previously described in silico

215 analyses. Total RNA that was previously extracted from untreated and treated samples was

216 reverse-transcribed using the RevertAid H Minus First Strand cDNA Synthesis Kit (Thermo

217 Scientific, Waltham, MA, USA). Total transcript levels were determined using the Maxima

218 SYBR Green/ROX qPCR Master Mix (2X) (Thermo Scientific, Waltham, MA, USA) and the

219 Luna Universal qPCR Master Mix (2X) (New England BioLabs, Ipswich, MA, USA), following

220 the manufacturers’ protocols. All genes were assayed in triplicate in MicroAmp™ Fast Optical

221 96-Well Reaction Plates (Applied Biosystems, Foster City, CA, USA), and three biological

222 replicates of each treatment were performed. A control lacking template was included in the

11 223 plates as well as a control lacking reverse transcriptase for all extracted RNA samples. RNA

224 from untreated isolates was used as the calibrator, as done by Childers et al., (2015). Gene

225 primers were designed exon to exon using Primer-BLAST software (Ye et al., 2012) and taking

226 into account all recommendations provided by the Maxima SYBR Green/ROX qPCR Master

227 Mix (2X) kit (Thermo Scientific, Waltham, MA, USA) (see Table 2). The P. infestans 40S

228 ribosomal proteins S3A (PITG_04425) was used as a constitutively expressed endogenous

229 control (Yan & Liou, 2006). Results were analyzed with the 7500 Fast Real-Time PCR System

230 (Applied Biosystems, Foster City, CA, USA) and relative expression was calculated using the

231 REST software (Pfaffl, Horgan, & Dempfle, 2002).

232

233 Small non-coding RNA–seq profiling and analysis.

234 A small ncRNA profiling was done for all three isolates both before and after exposure to sub-

235 lethal concentrations of mefenoxam. Total RNA from untreated and treated samples was used.

236 Illumina sequencing libraries for small RNA sequencing were prepared using the protocol

237 described by Vargas-Asencio and collaborators, (2017) and the sequencing reactions were run on

238 a HiSeq 2500 platform. Reads resulting from the sequencing process were analyzed in search of

239 significant differential expression with a pipeline designed for small ncRNA analysis in P.

240 infestans (González-Tobón et al, in preparation). Only minor modifications were done when

241 running the pipeline in order to adjust the trimming and alignment parameters so that they could

242 suit better the raw sequencing data. Furthermore, the alignment position of the reads to the

243 genome was visualized using IGV (Integrative Genomics Viewer) (J. T. Robinson et al., 2011).

244

245

12 246 Results

247 Initial sensitivity and acquired resistance assays.

248 As shown in Figure 2, isolates US140120 (clonal lineage US-23) and IMK-1 (clonal lineage US-

249 22) are sensitive to mefenoxam, while isolate RC1#10 is resistant to this fungicide. After

250 exposing these isolates to sub-lethal concentrations of mefenoxam (1 and 5 µg ml-1) both

251 sensitive isolates, US140120 (as seen in Figure 3A) and IMK-1 (as seen in Figure 3B), acquired

252 resistance to mefenoxam and therefore were able to grow in medium amended with 5 and 100 µg

253 ml-1 of mefenoxam, significantly more than they did prior to the exposure. Percent growth

254 relative to the control (0 µg ml-1) of isolate US140120 differed significantly when growing at 5

255 µg ml-1 (P ≤ 0.001) and at 100 µg ml-1 (P ≤ 0.001) after being exposed to 1 and 5 µg ml-1 of

256 mefenoxam. The same result was obtained for isolate IMK-1 when growing at 5 µg ml-1 (0.001 ≤

257 P ≤ 0.01). Moreover, isolate RC1#10 was able to grow at all tested concentrations regardless of

258 a previous exposure to 1 or 5 µg ml-1 of mefenoxam without presenting any significant

259 differences between them (see Figure 3C).

260

261 In silico re-analyses of the whole transcriptome profile obtained by Childers et al. (2015).

262 Both the re-analysis and the expanded analysis, determined significant DE genes for each of the

263 evaluated isolates when comparing them before and after the acquisition of resistance. In both

264 analyses, isolate IMK-270 (clonal lineage US-23) showed the fewer DE genes while isolate 1032

265 (clonal lineage US-24) presented the highest number of DE genes (see Figure 4). In overall, the

266 expanded analysis identified a notably higher number of DE genes in comparison to the number

267 identified by the re-analysis. However, in both cases, some DE genes were found to be unique to

268 certain isolates and others were shared among them (see Figure 4). In both the re-analysis and

13 269 the expanded analysis, it became evident that the tested isolates present a dramatically different

270 expression pattern when compared before and after the acquisition of resistance as shown in

271 Figure 5.

272 Both analyses identified genes that had been previously reported by Childers et al.,

273 (2015) (see Figure 6). Additionally, new genes that had not been formerly associated to the

274 phenomenon were discovered. Some of these code for proteins that belong to the same or to very

275 similar families as those previously reported, thus supporting their involvement in the acquisition

276 of resistance. Some others were found to have completely different functions. In this sense, the

277 re-analysis identified genes coding for retrotransposons and to transposon reverse transcriptases,

278 which had not been yet reported for this phenomenon and were not found in the expanded

279 analysis (see Figure 6). Furthermore, the expanded analysis identified more genes associated to

280 cellular growth and proliferation than did the previous analyses (see Figure 6). Interestingly,

281 when classifying all DE genes in functional categories, some of these groups presented a clear

282 pattern of upregulation or downregulation, while others lacked it (see Figure 7). For example, all

283 genes belonging to the group proliferation and cell formation were found to be upregulated in all

284 conditions (Figure 7D), and the groups containing both transporters and membrane-like proteins

285 (Figure 7B), as well as genes related to structure and movement (Figure 7C), contained genes

286 that were mostly upregulated. On the other hand, the group that included effectors and elicitins

287 (see Figure 7A) did not present a clear pattern of up or downregulation. Full detailed information

288 on each gene identified as significantly DE in the re-analysis and in the expanded analysis can be

289 found in Supplementary Tables 1 and 2, respectively.

290

291 Exhaustive annotation of hypothetical proteins.

14 292 The sequences that were identified as hypothetical proteins that appeared to be differentially

293 expressed as a result of the acquisition of resistance in all RNA-seq analyses, were annotated

294 exhaustively. It was possible to identify 10 of the 17 conserved hypothetical DE proteins

295 identified in Childers et al., (2015) (see Table 3 and Figure 6). None of the five conserved

296 hypothetical proteins that were found by the re-analysis could be annotated. Moreover, several

297 sequences with unknown annotation were found as significantly DE using this analysis (see

298 Table 3 and Figure 6). Of the 66 conserved DE hypothetical proteins found in the expanded

299 analysis, it was possible to annotate only 10 (see Table 3 and Figure 6).

300

301 In silico search for alternative RNA Polymerase I subunits in the genome of Phytophthora

302 infestans.

303 No evidence was found for the existence of alternative RNA Polymerase I subunits when

304 running megablast, discontiguous blast, and blastn analyses against the P. infestans genome. For

305 the megablast and the discontiguous blast analysis, a unique hit was obtained for each sequence

306 in almost all of the queries. There was no hit for the sequences belonging to subunits RPABC10b

307 and RPABC10a and for the subunit belonging to P. parasitica. The genes encoding for three

308 different subunits (PITG_18777, PITG_16659, and PITG_16658) seem to be near-identical

309 paralogues and therefore they presented multiple hits to themselves. There was no hit for the

310 sequences belonging to subunits RPABC10b and RPABC10a and for the subunit belonging to

311 P. parasitica.

312 With the blastn analysis, all query sequences obtained at least one hit. In every query, the

313 hit with the highest coverage and identity percentages was the same as that obtained in the

314 megablast analysis. Even though the other hits had a high identity percentage their query

15 315 coverage was around 4 - 10%, meaning that only short sections of the sequence were generating

316 these hits. This was also the case for subunits RPABC10b, RPABC10a, and P. parasitica

317 subunits which lacked a hit in the megablast analysis.

318

319 qRT-PCR profiles.

320 Based on the DE genes found with the two in silico analyses, the re-analysis and the expanded

321 analysis, as well as on the genes that were previously found as DE in Childers et al. (2015), 12

322 genes were chosen to evaluate their expression profiles using qPCR. Four of these genes (ABC,

323 RxLR, Zinc, and Myb) were upregulated in both isolates that acquire resistance (US140120 and

324 IMK-1) but downregulated in the originally resistant isolate (RC1#10) (Figure 8 and

325 Supplementary Figures 1, 2 & 3). Furthermore, other four genes (PD, TonB, ATS1-RCC1, and

326 PCNA) present a completely opposite expression pattern when comparing isolate US140120

327 (upregulated) and RC1#10 (downregulated). However, these genes were also downregulated in

328 isolate IMK-1 (Figure 8 and Supplementary Figures 1, 2 & 3). The opposite occurs for the genes

329 Gypsy and HA, which are downregulated in isolates US140120 and RC1#10 and upregulated in

330 isolate IMK-1 (Figure 8 and Supplementary Figures 1, 2 & 3). Lastly, the gene Ago seems to be

331 downregulated in all isolates and the gene AAT_I seems to show no DE (Figure 8 and

332 Supplementary Figures 1, 2 & 3).

333 In overall, all genes the were DE except for the Gypsy gene present levels of –up and –

334 downregulation ranging approximately between +7.0 and -3.8. Interestingly the Gypsy gene,

335 which refers to the Gypsy-like retrotransposon GypsyPi-3a gene, presented a much higher level

336 of DE than any other of the evaluated genes in all isolates (Figure 8 and Supplementary Figures

337 1, 2 & 3). This gene had a 10.0-fold and 60.0-fold decrease in isolate US140120 and RC1#10,

16 338 respectively, and an 80.0-fold increase in isolate IMK-1. The in silico analyses predicted this

339 gene to be downregulated at one isolate that acquires resistance (1032 (clonal lineage US-24))

340 and one that is naturally resistant (4432 (clonal lineage US-8)). Interestingly, this pattern is

341 maintained by isolates US140120 and RC1#10. However, a completely different expression is

342 seen for this gene in isolate IMK-1 which also acquires resistance (see Figure 8 and

343 Supplementary Figures 1, 2 & 3).

344

345 Small non-coding RNA–seq profiling and analysis.

346 For isolates US140120 (clonal lineage US-23) and IMK-1 (clonal lineage US-22) several small

347 ncRNAs were found to be significantly downregulated when comparing them before and after

348 the acquisition of resistance to mefenoxam. Interestingly, there were no DE small ncRNAs found

349 for isolate RC1#10. Moreover, only one small ncRNA was found to be upregulated in isolate

350 IMK-1 (clonal lineage US-22) which corresponds to the small nucleolar RNA snR56Ê

351 (Supplementary Tables 3 and 4).

352 Isolate US140120 (clonal lineage US-23) presented a higher number of DE small

353 ncRNAs (248) than isolate IMK-1 (clonal lineage US-22) (178) and they both shared a total of

354 31 of these DE small ncRNAs. Some of the significantly downregulated small ncRNAs found in

355 these isolates are related to genes that were found to be DE in the previous analyses.

356 Interestingly, in most cases, the significantly downregulated small ncRNAs belong to

357 significantly upregulated genes (Table 4), thus, indicating a potential regulatory connection

358 between them. As well, these small ncRNAs that were found to be DE between treatments can be

359 classified in functional groups according to their identity. For example, those related to RxLR

360 effectors were classified as part of the functional group containing effectors and elicitins (Figure

17 361 9).

362

363 Discussion

364 The results obtained in this study provide a clearer image on the molecular mechanisms that may

365 be behind the acquisition of resistance to mefenoxam in P. infestans. More specifically, it was

366 possible to determine a precise set of candidate genes as well as to identify a probable regulatory

367 mechanism behind this phenomenon. A model on the molecular mechanisms that might be acting

368 within the cell in order for P. infestans to acquire resistance after being exposed to sub-lethal

369 concentrations of mefenoxam is proposed (Figure 10).

370 It was possible to identify several genes that seem to be involved in the acquisition of

371 resistance to mefenoxam in P. infestans isolates. These candidate genes were classified into

372 seven different functional groups. Genes belonging to three of these groups (transporters,

373 interactors, and enzymes; Figure 6) seem to be connected with each other in order to initiate and

374 propel what resembles a pleiotropic drug resistance (PDR) phenotype (Sipos & Kuchler, 2006).

375 This phenotype is common in several organisms including bacteria, yeast, fungi, plants, and even

376 humans (Nawrocki, Fey, Larsen, Goffeau, & Roepstorff, 2001). It implies the participation of

377 several genes that facilitate the expulsion of diverse metabolites, drugs, and other substances out

378 of the cell (Bauer, Wolfger, & Kuchler, 1999) as a response to both biotic and abiotic stress

379 (Crouzet, Trombik, Fraysse, & Boutry, 2006).

380 The PDR phenotype is mainly based on an overproduction of membrane-associated

381 transporters that extrude drugs out of the cell (Kolaczkowska & Goffeau, 1999) (Figure 10,

382 section 1). The ATP-binding cassette (ABC) superfamily transporters are usually related to this

383 phenotype (Sipos & Kuchler, 2006). They can be subdivided into three families, one of them

18 384 which specifically includes genes involved in PDR (Crouzet et al., 2006). This family, known as

385 the PDR ATP transporters, imports and exports various toxic and drug-like substances (Sipos &

386 Kuchler, 2006), which include but are not limited to, fungicides, herbicides, pesticides,

387 antibiotics, and detergents (Crouzet et al., 2006). Most interestingly, this type of resistance is

388 known to mediate fungicide resistance in several pathogenic microorganisms as Candida

389 albicans, Penicillium digitadum, Plasmodium sp., Leishmania sp., Aspergillus sp., among others

390 (Bauer et al., 1999; Crouzet et al., 2006).

391 The pleiotropic drug resistance has been very well documented in yeasts like

392 Saccharomyces cerevisiae, which is known to acquire resistance to multiple cytotoxic

393 compounds when certain genes involved in its own PDR mutate (Nawrocki et al., 2001). A

394 similar situation occurs for yeasts such as C. albicans, which have acquired clinical resistance to

395 antifungals by means of overexpressing ABC transporters or proteins from the Major Facilitator

396 Superfamily (MFS) which are non-ABC transporters also involved in PDR (Kolaczkowski &

397 Goffeau, 1997). Along with these two transporter types, a third group of proteins represent a very

398 important input to this detoxification system. This latter one involves a different family of ABC

399 transporters called the Multi Drug Resistance family, which promote vacuolar sequestering of

400 both endogenous and exogenous harmful compounds as heavy metals, metalloids, and

401 catabolites (Stukkens et al., 2005; Wolfger, Mamnun, & Kuchler, 2001). All of these proteins

402 contribute to the very complex detoxifying network that the PDR response implies (Wolfger et

403 al., 2001).

404 Most importantly, the differential expression of one of these ABC transporters was

405 validated by our qPCR analyses where the gene was upregulated in both isolates that acquired

406 resistance (US140120 and IMK-1) but downregulated in the originally resistant isolate (RC1#10)

19 407 probably because it does not need to expel the fungicide from the cell. Furthermore, small

408 ncRNAs related to this type of transporters were highly downregulated in the isolates belonging

409 to clonal lineages US-23 and US-22, which is consistent with their overexpression in these

410 isolates after acquiring resistance to mefenoxam. In fact, membrane permeases of the major

411 facilitator family (MFS), were also found to be differentially expressed in this study along with

412 similar vacuolar pumps.

413 It has been very well documented that the overexpression of drug-resistant genes as ABC

414 and MFS transporters imply a primary cellular stress response (Ro et al., 2008) (Figure 10,

415 section 2). In fact, it is known to be a functional crosstalk between the PDR network and the

416 cell’s stress response pathways (Kolaczkowska & Goffeau, 1999; Wolfger et al., 2001). This

417 stress response can be activated in the form of downstream enzymatic cascades (Sipos &

418 Kuchler, 2006). Interestingly, we found both DE genes and small ncRNAs that seem to be

419 related to this type of response by grouping into a very clear unit related to enzymatic reactions.

420 Specifically, we found different zinc finger genes that seem to be DE between treatments. In S.

421 cerevisiae, two zinc finger proteins are known to be part of the PDR phenotype by controlling

422 the ABC transporters’ expression (Mamnun, Pandjaitan, Mahé, Delahodde, & Kuchler, 2002).

423 Interestingly, we were able to validate this upregulation by our qPCR expression assays where

424 the evaluated Zinc finger gene was upregulated in both US140120 and IMK-1 but downregulated

425 for isolate RC1#10. As mentioned earlier for the tested ABC transporter, this suggests that the

426 originally resistant isolate most probably does not require to overexpress this type of proteins

427 since it already presents a different mechanism of resistance.

428 Additionally, it has been reported that the downstream processes that happen to be

429 triggered by the development of a PDR usually imply alterations in the nuclear transport of

20 430 different transcription factors, kinases, and replication factors, between the nucleus and the

431 cytoplasm (Kolaczkowska & Goffeau, 1999) (Figure 10, section 2). This strong relationship may

432 not only affect the expression of zinc fingers, which are an important group of transcription

433 factors, but may also alter cellular activities related to these enzymes. Interestingly, a long list of

434 DE enzymes (which include kinases, transcription factors, among others) and of small ncRNAs

435 related to them was found in this study. This provides further evidence for the PDR phenotype

436 and additional details on how it occurs.

437 One known consequence of these enzymatic alterations is the modulation of the

438 membrane’s permeability, which also involves variations in sterols’ and phospholipids’

439 transportation and biogenesis, most likely helping maintain the PDR phenotype (Kolaczkowska

440 & Goffeau, 1999). A pair of enzymes that might be strongly associated to this process were

441 found (Figure 10, section 2). Phospholipases are enzymes that hydrolyze the phosphodiester

442 bond of glycerophospholipids. This not only alters the structure and stability of the cellular

443 membrane but also regulates other cellular functions (Meijer, Latijnhouwers, Ligterink, &

444 Govers, 2005) by means of receptor signaling and intracellular membrane transport (Meijer,

445 Hassen, & Govers, 2011; Meijer et al., 2005). Both their role in membrane stability and in

446 downstream cellular processes agree with the fact that enzymes found to be DE between

447 treatments in this study work collaboratively with the transporters and membrane-like proteins to

448 orchestrate the beginning and the perpetuation of what seems to be a PDR phenotype in P.

449 infestans. Both phospholipases D and A-2 were found to be DE between treatments, as did

450 Childers and collaborators (2015) previously. Phospholipase D was upregulated in isolate

451 US140120 (clonal lineage US-23), confirmed by our qPCR analyses, after the acquisition of

452 resistance. Also, small ncRNAs that were related to this gene were found to be downregulated in

21 453 this same clonal lineage and treatment.

454 Interestingly, phospholipases in P. infestans are also known to be involved in zoospore

455 encystment (Latijnhouwers, Munnik, & Govers, 2002) and in actin cytoskeleton organization

456 (Meijer et al., 2011, 2005) (Figure 10, section 2). The latter concurs with the membrane stability

457 changes that were previously mentioned and refers to one of the functional groups found in this

458 study which involves DE genes related to cellular structure and movement (Figure 6).

459 Accordingly, tubulin, actin, and flagellar-like proteins were found to be DE between treatments

460 in this study. On the other hand, the phospholipase’s involvement in zoospore encystment brings

461 into attention another one of these functional groups, which involves DE genes related to

462 proliferation and cell formation. Some of the genes found to be DE in this group account for

463 proteins with the Myb-like DNA-binding domains. These are commonly found as transcription

464 factors that bind specifically to certain regions of the DNA. Moreover, they have been shown to

465 be extremely diverse in P. infestans and seem to be upregulated during spore formation or

466 germination (Xiang & Judelson, 2014). Interestingly, with our qPCR assays, we confirmed that

467 one Myb-like protein was upregulated in those isolates that acquire resistance but not in the

468 originally resistant isolate. Likewise, this supports the idea that after the initial steps possibly

469 regarding a fungicide expulsion from the inside of the cell, P. infestans’ expression patterns

470 change towards a more active and proliferative life cycle stage.

471 Furthermore, we found that the proliferating cell nuclear antigen (PCNA), an important

472 actor for cell division and cell replication (Strzalka & Ziemienowicz, 2011), was upregulated in

473 isolate US140120 and downregulated in isolate RC1#10 and curiously, in isolate IMK-1. This

474 further supports the idea previously exposed by Childers and collaborators (2015) that some

475 section of the molecular mechanism behind the acquisition of resistance may be common among

22 476 isolates but some other details of the process may be isolate-dependent. Complementing these

477 findings, we also found small ncRNAs related to genes involved in cellular structure and

478 movement, and some involved in cellular proliferation and formation. Specifically, we found

479 small ncRNAs related to genes as actin and tubulin, as well as to others as the PCNA. These

480 small ncRNAs were all significantly downregulated, thus supporting their plausible role as

481 regulators of the expression patterns of these genes (Figure 10, section 2).

482 The importance of all previously mentioned enzymes and enzymatic downstream

483 processes on the occurrence of the mefenoxam-acquired resistance mechanism imply additional

484 proteins that aid them in their functions, which we refer to as interactors. A very clear example is

485 the finding that annexin genes seem to be DE when comparing the isolates before and after the

486 acquisition of resistance. Annexins are lipid-binding proteins known to be very important for

487 development, stress, and defense of pathogens as Phytophthora sp. by interacting principally

488 with lipid-processing enzymes as the phospholipases (Laohavisit & Davies J, 2008) (Figure 10,

489 section 2). Interestingly, small ncRNAs related to annexins were also found to be downregulated

490 in isolates belonging to clonal lineages US-23 and US-22. In the same sense as annexins

491 contribute to the phospholipases’ functions, several DE genes that seem to code for proteins

492 interacting and thus aiding others were also found. Most of them are ATP binding molecules,

493 which are known to be important in processes as regulating ion transport, chromosome

494 condensation, mRNA processing, and siRNA processing (Morris & Phuntumart, 2009). Others,

495 are actually involved in siRNA processing (as the Argonaute protein), in chromosome

496 condensation processes (as the ATS1-RCC1 gene), in histone modifications (as the histone

497 arginine demethylase gene), among others (Figure 10, section 3). All these genes were validated

498 through a qPCR analyses, finding contrasting DE profiles between isolates (Figure 8). However,

23 499 taking into account that small ncRNAs, chromatin remodeling complexes, and histone

500 modifications have all been reported as epigenetic processes involved in P. infestans’ epigenetics

501 (Chen et al., 2017; Kasuga & Gijzen, 2013; Vetukuri et al., 2011), their involvement as

502 regulators of the mefenoxam-acquired resistance phenotype seems likely. In fact, the

503 contribution of one of these regulatory mechanisms to the PDR phenotype occurrence was

504 confirmed by the small ncRNAs sequencing process which will be discussed shortly. This

505 provides a closer look into the interactors that regulate the expression of the PDR genes, both at a

506 pre and post transcriptional level.

507 Interestingly, the PDR phenotype is not restricted to the secretion of drug-like substances.

508 It actually entails other functions regarding cell detoxification and resistance (Crouzet et al.,

509 2006). For example, MFS transporters are known to mediate nutrient uptake (Kolaczkowski &

510 Goffeau, 1997) and PDR genes have also been reported to help pathogens defend from

511 antimicrobials produced by the plants they are attacking (Crouzet et al., 2006). As well,

512 pleiotropic ABC transporters have also been reported to provide durable resistance in wheat

513 towards multiple fungal pathogens (Krattinger, S et al., 2007). This interesting crosstalk between

514 pathogens and their host plants could explain why such a clear group of effector and elicitin

515 genes were found to be DE between treatments. Genes from this group had also been found to be

516 DE by Childers and collaborators (2015). However, the exact reason why they present this

517 expression patterns was elusive. Based on the idea that the PDR phenotype can also be triggered

518 by plant-pathogen interactions, one could propose that it could further activate the

519 overexpression of certain effector and elicitin genes to aid in the defense of the pathogen.

520 Therefore, it could be expected to find them DE when other PDR genes are presenting significant

521 variations in their expression. Aspergillus nidulans is a good example to support this idea. In this

24 522 pathogen PDR genes are upregulated both as a consequence of azoles and antibiotics, and of

523 plant secreted toxins (Wolfger et al., 2001). Interestingly, the DE patterns of one RxLR effector

524 was validated using the qPCR assays. This gene was found to be upregulated for both isolates

525 US140120 and IMK-1 but downregulated for isolate RC1#10. As well, some small ncRNAs

526 related to these genes were found to be downregulated in isolates US140120 and IMK-1.

527 Finally, another group of genes that was found to be DE in this study included

528 transposons and repetitive-like proteins. These genes comprise a third of the genome in P.

529 infestans (Jiang et al., 2005) and are an important source of spontaneous variation and mutations

530 leading to alterations of chromosome structure and a recombination of genomic regions

531 (Judelson, 2002). One of the most interesting things related to this overwhelming number of

532 repetitive-like regions is that they seem to contain clusters of effector and elicitin-type genes

533 interspersed between them (Jiang et al., 2005). It has been suggested that this close location has

534 the purpose of regulating effectors’ and elicitins’ expression easily (Whisson, Vetukuri, Avrova,

535 & Dixelius, 2012). Because of this important role that transposons seem to have in P. infestans, it

536 is very interesting to consider why the Gypsy Pi-3a retrotransposon is so significantly

537 differentially expressed when comparing the isolates before and after the acquisition of

538 resistance in the qPCR assays. Actually this family of retrotransposons has been studied

539 previously and it seems to be one of the major forces in the evolution of Phytophthora

540 chromosomes (Judelson, 2002). Based on the previously described relationship between effectors

541 and PDR genes, it could be interesting to consider if transposons could be involved in regulating

542 their DE patterns. Interestingly, no small ncRNAs related to these genes were found to be DE in

543 this study.

544 Along with determining these candidate genes, the in silico analyses that were done in

25 545 order to elucidate the possible genes mediating this phenomenon indicated how different P.

546 infestans isolates are in terms of gene expression when comparing them before and after their

547 acquisition of resistance to mefenoxam. Interestingly, isolate RC1#10 which was originally

548 resistant to mefenoxam, seemed to present differences in its expression pattern as well.

549 Importantly, they do not seem to be as clear as the ones found in the originally sensitive isolates.

550 This could support the idea previously proposed by Childers and collaborators (2015) which

551 suggested that the acquisition of resistance may be retained among isolates of P. infestans

552 regarding their sensitivity to the fungicide but masked on originally resistant isolates because it

553 may be unnecessary for them.

554 With regards to the second objective, the findings support a possible epigenetic

555 mechanism turning genes on or off depending on the environment to which P. infestans is

556 exposed (Figure 10, sections 3 and 4). Isolate RC1#10 lacked DE small ncRNAs when

557 comparing it before and after the acquisition of resistance, contrary to what was observed for

558 isolates US140120 and IMK-1. If this mechanism is indeed regulating the DE in the isolates, it is

559 highly likely that it may not be as active in originally resistant isolates as it is in originally

560 sensitive ones. Therefore, it could account for the less clear DE pattern found in the genes of the

561 originally resistant isolate. Also, in a broad sense, most of the DE genes seem to be upregulated

562 in isolates US140120 and IMK-1 which are able to acquire resistance while the small ncRNAs

563 found to be DE in these isolates are almost all downregulated.

564 A directed-silencing method is needed in order to test exactly which of these candidate

565 genes, or if all, are really necessary for the mefenoxam-acquired resistance phenomenon to occur

566 and to determine if the small ncRNAs might indeed be regulating the process by having a

567 targeted effect on the genes. However, this study was able to expand the available molecular

26 568 information on this topic as well as to provide important insights into P. infestans’ cellular and

569 regulatory functionalities.

570

571 Acknowledgements:

572 We thank the American Phytopathological Society (APS) Foundation who supported this work

573 through the French-Monar Latin American Award of 2018. As well as the Faculty of Sciences of

574 Universidad de los Andes for the financial support they provided and the Banco de la República

575 de Colombia who supported this work through the Foundation for the Promotion of Research and

576 Technology.

577

578 References:

579 Bauer, B. E., Wolfger, H., & Kuchler, K. (1999). Inventory and function of yeast ABC proteins:

580 About sex, stress, pleiotropic drug and heavy metal resistance. Biochimica et Biophysica

581 Acta - Biomembranes, 1461(2), 217–236. https://doi.org/10.1016/S0005-2736(99)00160-1

582 Bruin, G. C. A., & Edgington, L. V. (1981). Adaptive resistance in Peronosporales to metalaxyl.

583 Canadian Journal of Plant Pathology, 3(4), 201–206.

584 https://doi.org/10.1080/07060668109501348

585 Chen, H., Shu, H., Wang, L., Zhang, F., Li, X., Ochola, S., … Dong, S. (2017). Phytophthora

586 methylomes modulated by expanded 6mA methyltransferases are associated with adaptive

587 genome regions. BioRxiv, 217646. https://doi.org/10.1101/217646

588 Childers, R., Danies, G., Myers, K., Fei, Z., Small, I. M., & Fry, W. E. (2015). Acquired

589 Resistance to Mefenoxam in Sensitive Isolates of Phytophthora infestans. Phytopathology,

590 105(3), 342–9. https://doi.org/10.1094/PHYTO-05-14-0148-R

27 591 Crouzet, J., Trombik, T., Fraysse, Å. S., & Boutry, M. (2006). Organization and function of the

592 plant pleiotropic drug resistance ABC transporter family. FEBS Letters, 580(4), 1123–1130.

593 https://doi.org/10.1016/j.febslet.2005.12.043

594 Davidse, L. C. (1990). Biochemical basis of resistance to phenylamide fungicides. Radiotherapy

595 and Oncology, 19(4), 297–305.

596 Davidse, L. C., Gerritsma, O. C. M., Ideler, J., Pie, K., & Velthuis, G. C. M. (1988). Antifungal

597 modes of action of metalaxyl, cyprofuram, benalaxyl and oxadixyl in phenylamide-sensitive

598 and phenylamide-resistant strains of Phytophthora megasperma f. sp. medicaginis and

599 Phytophthora infestans. Crop Protection, 7(6), 347–355. https://doi.org/10.1016/0261-

600 2194(88)90001-4

601 Decker, K. B., & Hinton, D. M. (2013). Transcription Regulation at the Core: Similarities

602 Among Bacterial, Archaeal, and Eukaryotic RNA Polymerases. Annual Review of

603 Microbiology, 67(1), 113–139. https://doi.org/10.1016/j.medcli.2016.01.013

604 Fisher, D. J., & Hayes, A. L. (1982). Mode of action of the systemic fungicides furalaxyl,

605 metalaxyl and ofurace. Pesticide Science, 13(3), 330–339.

606 https://doi.org/10.1002/ps.2780130316

607 FRAC. (2017). Mode of Action of Fungicides Unknown Mode of Action. FRAC - Fungicide

608 Resistance Action Committee, (January), 2013.

609 Fry, W. E., McGrath, M. T., Seaman, A., Zitter, T. a., McLeod, A., Danies, G., … Smart, C. D.

610 (2013). The 2009 late blight pandemic in Eastern USA – causes and results. Plant Disease,

611 97(3), 296–306. https://doi.org/10.1094/PDIS-08-12-0791-FE

612 Galperin, M. Y., & Koonin, E. V. (2004). “Conserved hypothetical” proteins: Prioritization of

613 targets for experimental study. Nucleic Acids Research, 32(18), 5452–5463.

28 614 https://doi.org/10.1093/nar/gkh885

615 Götz, S., García-Gómez, J. M., Terol, J., Williams, T. D., Nagaraj, S. H., Nueda, M. J., …

616 Conesa, A. (2008). High-throughput functional annotation and data mining with the

617 Blast2GO suite. Nucleic Acids Research, 36(10), 3420–3435.

618 https://doi.org/10.1093/nar/gkn176

619 Haas, B. J., Papanicolaou, A., Yassour, M., Grabherr, M., Blood, P. D., Bowden, J., … Regev,

620 A. (2013). De novo transcript sequence reconstruction from RNA-seq using the Trinity

621 platform for reference generation and analysis. Nature Protocols, 8(8), 1494–1512.

622 https://doi.org/10.1038/nprot.2013.084

623 Ishimoto, K. S., & Lory, S. (1989). Formation of pilin in Pseudomonas aeruginosa requires the

624 alternative sigma factor (RpoN) of RNA polymerase. Proceedings of the National Academy

625 of Sciences, 86(6), 1954–1957. https://doi.org/10.1073/pnas.86.6.1954

626 Jaime-Garcia, R., Trinidad-Correa, R., Felix-Gastelum, R., Orum, T. V., Wasmann, C. C., &

627 Nelson, M. R. (2000). Temporal and Spatial Patterns of Genetic Structure of Phytophthora

628 infestans from Tomato and Potato in the Del Fuerte Valley. Phytopathology, 90(11), 1188–

629 1195. https://doi.org/10.1094/PHYTO.2000.90.11.1188

630 Jiang, R. H. Y., Dawe, A. L., Weide, R., Van Staveren, M., Peters, S., Nuss, D. L., & Govers, F.

631 (2005). Elicitin genes in Phytophthora infestans are clustered and interspersed with various

632 transposon-like elements. Molecular Genetics and Genomics, 273(1), 20–32.

633 https://doi.org/10.1007/s00438-005-1114-0

634 Judelson, H. S. (2002). Sequence variation and genomic amplification of a family of Gypsy-like

635 elements in the oomycete genus Phytophthora. Molecular Biology and Evolution, 19(8),

636 1313–1322. https://doi.org/10.1093/oxfordjournals.molbev.a004192

29 637 Kasuga, T., & Gijzen, M. (2013). Epigenetics and the evolution of virulence. Trends in

638 Microbiology, 21(11), 575–582. https://doi.org/10.1016/j.tim.2013.09.003

639 Kolaczkowska, A., & Goffeau, A. (1999). Regulation of pleiotropic drug resistance in yeast.

640 Drug Resistance Updates, 2(6), 403–414. https://doi.org/10.1054/drup.1999.0113

641 Kolaczkowski, M., & Goffeau, A. (1997). Active efflux by multidrug transporters as one of the

642 strategies to evade chemotherapy and novel practical implications of yeast pleiotropic drug

643 resistance. Pharmacology and Therapeutics, 76(1–3), 219–242.

644 https://doi.org/10.1016/S0163-7258(97)00094-6

645 Krattinger, S, G., Lagudah, E, S., Spielmeyer, W., Singh, R, P., Huerta-Espino, J., McFadden,

646 H., … Keller, B. (2007). A Putative ABC Transporter Confers Durable Resistance to

647 Multiple Fungal Pathogens in Wheat. Science, 1360(MARCH), 387. Retrieved from

648 https://books.google.com.au/books?hl=en&lr=&id=zQxtAAAAQBAJ&oi=fnd&pg=PA142

649 &dq=%22narrative+theory%22&ots=5_0IwYd-

650 xA&sig=QElnacEZlLTOLgfnIc6jvo1gvWY#v=onepage&q=%22narrative

651 theory%22&f=false

652 Langmead, B., Trapnell, C., Pop, M., & Salzberg, S. L. (2009). Ultrafast and memory-efficient

653 alignment of short DNA sequences to the human genome. Genome Biology, 10(3), R25.

654 https://doi.org/gb-2009-10-3-r25 [pii]\n10.1186/gb-2009-10-3-r25

655 Laohavisit, A., & Davies J, M. (2008). Annexins. New Phytologist, 189, 40–53.

656 Latijnhouwers, M., Munnik, T., & Govers, F. (2002). Phospholipase D in Phytophthora infestans

657 and its role in zoospore encystment. Mol. Plant-Microbe Interact, 15(9), 939–946.

658 https://doi.org/10.1094/MPMI.2002.15.9.939

659 Li, B., & Dewey, C. N. (2011). RSEM: accurate transcript quantification from RNA-Seq data

30 660 with or without a reference genome. BMC Bioinformatics, 12(1), 323.

661 https://doi.org/10.1186/1471-2105-12-323

662 Liao, Y., Smyth, G. K., & Shi, W. (2014). FeatureCounts: An efficient general purpose program

663 for assigning sequence reads to genomic features. Bioinformatics, 30(7), 923–930.

664 https://doi.org/10.1093/bioinformatics/btt656

665 Mamnun, Y. M., Pandjaitan, R., Mahé, Y., Delahodde, A., & Kuchler, K. (2002). The yeast zinc

666 finger regulators Pdr1p and Pdr3p control .pdf. Molecular Microbiology, 46(5), 1429–1440.

667 https://doi.org/10.1046/j.1365-2958.2002.03262.x

668 Mani, N., & Dupuy, B. (2001). Regulation of toxin synthesis in Clostridium difficile by an

669 alternative RNA polymerase sigma factor. Proceedings of the National Academy of

670 Sciences, 98(10), 5844–5849. https://doi.org/10.1073/pnas.101126598

671 Marchler-Bauer, A., Zheng, C., Chitsaz, F., Derbyshire, M. K., Geer, L. Y., Geer, R. C., …

672 Bryant, S. H. (2013). CDD: Conserved domains and protein three-dimensional structure.

673 Nucleic Acids Research, 41(D1), 348–352. https://doi.org/10.1093/nar/gks1243

674 Meijer, H. J. G., Hassen, H. H., & Govers, F. (2011). Phytophthora infestans has a plethora of

675 phospholipase D enzymes including a subclass that has extracellular activity. PLoS ONE,

676 6(3), 1–12. https://doi.org/10.1371/journal.pone.0017767

677 Meijer, H. J. G., Latijnhouwers, M., Ligterink, W., & Govers, F. (2005). A transmembrane

678 phospholipase D in Phytophthora; a novel PLD subfamily. Gene, 350(2), 173–182.

679 https://doi.org/10.1016/j.gene.2005.02.012

680 Mideros, M. F., Turissini, D. A., N, G., Ibarra-Avila, H., Danies, G., Cárdenas, M, Myers, K., …

681 Restrepo, S. (2018). Phytophthora betacei, a new species within Phytophthora clade 1c

682 causing late blight on Solanum betaceum in Colombia. Persoonia: Molecular Phylogeny

31 683 and Evolution of Fungi, 41, 39–55.

684 Monkiedje, A., & Spiteller, M. (2002). Effects of the phenylamide fungicides, mefenoxam and

685 metalaxyl, on the microbiological properties of a sandy loam and a sandy clay soil. Biology

686 and Fertility of Soils, 35(6), 393–398. https://doi.org/10.1007/s00374-002-0485-1

687 Morris, P. F., & Phuntumart, V. (2009). Inventory and comparative evolution of the ABC

688 superfamily in the genomes of Phytophthora ramorum and Phytophthora sojae. Journal of

689 Molecular Evolution, 68(5), 563–575. https://doi.org/10.1007/s00239-009-9231-8

690 Nawrocki, A., Fey, S. J., Larsen, P. M., Goffeau, A., & Roepstorff, P. (2001). The effects of

691 transcription regulating genes PDR1, pdr1-3 and PDR3 in pleiotropic drug resistance. Eur.

692 J. Mass Spectrom, 7(1), 195–205.

693 Pfaffl, M. ., Horgan, G. ., & Dempfle, L. (2002). Relative expression software tool (REST©) for

694 group-wise comparison and statistical analysis of relative expression results in real-time

695 PCR. Nucleic Acids Research, 30(9). https://doi.org/10.1093/nar/30.9.e36

696 Raffaele, S., Farrer, R. A., Cano, L. M., Studholme, D. J., MacLean, D., Thines, M., … Kamoun,

697 S. (2010). Genome Evolution Following Host Jumps in the Irish Potato Famine Pathogen

698 Lineage. Science, 330(6010), 1540–1543. https://doi.org/10.1126/science.1193070

699 Randall, E., Young, V., Sierotzki, H., Scalliet, G., Birch, P. R. J., Cooke, D. E. L., … Whisson,

700 S. C. (2014). Sequence diversity in the large subunit of RNA polymerase I contributes to

701 Mefenoxam insensitivity in Phytophthora infestans. Molecular Plant Pathology, 15(7),

702 664–676. https://doi.org/10.1111/mpp.12124

703 Ro, D. K., Ouellet, M., Paradise, E. M., Burd, H., Eng, D., Paddon, C. J., … Keasling, J. D.

704 (2008). Induction of multiple pleiotropic drug resistance genes in yeast engineered to

705 produce an increased level of anti-malarial drug precursor, artemisinic acid. BMC

32 706 Biotechnology, 8, 1–15. https://doi.org/10.1186/1472-6750-8-83

707 Robinson, J. T., Thorvaldsdóttir, H., Winckler, W., Guttman, M., Lander, E. S., Getz, G., &

708 Mesirov, J. P. (2011). Integrative Genome Viewer. Nature Biotechnology, 29(1), 24–6.

709 https://doi.org/10.1038/nbt.1754.Integrative

710 Robinson, M. D., McCarthy, D. J., & Smyth, G. K. (2009). edgeR: A Bioconductor package for

711 differential expression analysis of digital gene expression data. Bioinformatics, 26(1), 139–

712 140. https://doi.org/10.1093/bioinformatics/btp616

713 Saville, A., Graham, K., Grünwald, N. J., Myers, K., Fry, W. E., & Ristaino, J. B. (2014).

714 Fungicide Sensitivity of U.S. Genotypes of Phytophthora infestans to Six Oomycete-

715 Targeted Compounds. Plant Disease, 99(5), 659–666. https://doi.org/10.1094/pdis-05-14-

716 0452-re

717 Schoina, C., & Govers, F. (2015). The Oomycete Phytophthora infestans, the Irish Potato

718 Famine Pathogen. In B. Lugtenberg (Ed.), Principles of Plant-Microbe Interactions (1st ed.,

719 pp. 371–378). Wageningen, The Netherlands: Springer International Publishing.

720 https://doi.org/10.1007/978-3-319-08575-3

721 Sipos, G., & Kuchler, K. (2006). Fungal ATP-binding cassette (ABC) transporters in drug

722 resistance & detoxification. Current Drug Targets, 7(4), 471–481.

723 https://doi.org/10.2174/138945006776359403

724 Staub, T., Dahmen, H., Urech, P. A., & Schwinn, F. (1979). Failure to select for in vivo

725 resistance in Phytophthora infestans to acylalanine fungicides. Plant Disease Reporter,

726 64(May), 385–389.

727 Strzalka, W., & Ziemienowicz, A. (2011). Proliferating cell nuclear antigen (PCNA): A key

728 factor in DNA replication and cell cycle regulation. Annals of Botany, 107(7), 1127–1140.

33 729 https://doi.org/10.1093/aob/mcq243

730 Stukkens, Y., Bultreys, A., Grec, S., Trombik, T., Vanham, D., & Boutry, M. (2005). NpPDR1, a

731 Pleiotropic Drug Resistance-Type ATP-Binding Cassette Transporter from Nicotiana

732 plumbaginifolia, Plays a Major Role in Plant Pathogen Defense. Plant Physiology, 139(1),

733 341–352. https://doi.org/10.1104/pp.105.062372

734 Tarazona, S., García-Alcalde, F., Dopazo, J., Ferrer, A., & Conesa, A. (2011). Differential

735 expression in RNA-seq: A matter of depth. Genome Research, 21(12), 2213–2223.

736 https://doi.org/10.1101/gr.124321.111

737 Vargas-Asencio, J., Wojciechowska, K., Baskerville, M., Gomez, A. L., Perry, K. L., &

738 Thompson, J. R. (2017). The complete nucleotide sequence and genomic characterization of

739 grapevine asteroid mosaic associated virus. Virus Research, 227, 82–87.

740 https://doi.org/10.1016/j.virusres.2016.10.001

741 Vetukuri, R. R., Avrova, A. O., Grenville-Briggs, L. J., Van West, P., Söderbom, F., Savenkov,

742 E. I., … Dixelius, C. (2011). Evidence for involvement of Dicer-like, Argonaute and histone

743 deacetylase proteins in gene silencing in Phytophthora infestans. Molecular Plant

744 Pathology, 12, 772–785. https://doi.org/10.1111/j.1364-3703.2011.00710.x

745 Whisson, S. C., Vetukuri, R. R., Avrova, A. O., & Dixelius, C. (2012). Can silencing of

746 transposons contribute to variation in effector gene expression in Phytophthora infestans ?

747 Mobile Genetic Elements, 2(2), 110–114. https://doi.org/10.4161/mge.20265

748 Wolfger, H., Mamnun, Y. M., & Kuchler, K. (2001). Fungal ABC proteins: Pleiotropic drug

749 resistance, stress response and cellular detoxification. Research in Microbiology, 152(3–4),

750 375–389. https://doi.org/10.1016/S0923-2508(01)01209-8

751 Xiang, Q., & Judelson, H. S. (2014). Myb Transcription Factors and Light Regulate Sporulation

34 752 in the Oomycete Phytophthora infestans. PLoS ONE, 9(4), e92086.

753 https://doi.org/10.1371/journal.pone.0092086

754 Yan, H. Z., & Liou, R. F. (2006). Selection of internal control genes for real-time quantitative

755 RT-PCR assays in the oomycete plant pathogen Phytophthora parasitica. Fungal Genetics

756 and Biology, 43(6), 430–438. https://doi.org/10.1016/j.fgb.2006.01.010

757 Ye, J., Coulouris, G., Zaretskaya, I., Cutcutache, I., Rozen, S., & Madden, T. L. (2012). Primer-

758 BLAST: A tool to design target-specific primers for polymerase chain reaction. BMC

759 Bioinformatics, 13. https://doi.org/10.1186/1471-2105-13-134

760

761

762

763

764

765

766

767

768

769

770

771

772

773

774

35 775 Table 1. Gene sequences for all known RNA Pol I subunits of Phytophthora infestans, 776 Phytophthora nicotianae, and Phytophthora parasitica. Subunit Gene ID Species Source RPA190 PITG_03855 P. infestans NCBI RPA135 PITG_02420 P. infestans NCBI RPABC14.5(RPB8) PITG_09712 P. infestans NCBI RPABC27(RPB5) PITG_10445 P. infestans NCBI RPABC23(RPB6) PITG_10445 P. infestans NCBI RPAC40 PITG_16659 P. infestans NCBI PITG_18777 P. infestans NCBI PITG_16658 P. infestans NCBI RPA12.2 PITG_06706 P. infestans NCBI RPAC19 PITG_05854 P. infestans NCBI RPABC10β(RPB10) Supercontig1.27 1022726–1022969 P. infestans NCBI Supercontig1.1 297200–297548 P. infestans NCBI RPABC10α(RPB12) PITG_14613 P. infestans NCBI PITG_11365 P. infestans NCBI RPA43 AM587_10008558 P. infestans NCBI RPA49 AM587_10007347 P. infestans NCBI RPA43 AM587_10007275 P. nicotianae Ensembl Protists RPA12 AM587_10011244 P. nicotianae Ensembl Protists RPA12 AM587_10009227 P. nicotianae Ensembl Protists RPAC2 L915_02164 P. nicotianae Ensembl Protists RPAC1 P. nicotianae Ensembl Protists RPABC5 P. parasitica Ensembl Protists 777

778

36 779 Table 2. Exon to exon primers designed for the qRT-PCR assays of significantly differentially

780 expressed genes and transcripts.

Gene ID Name Forward primer Reverse primer Source* PITG_04425 40S Ribosomal protein CTGTCCATCCAAGCGCTACT TTGAGGAACTGCTCGTGGTC (Yan & Liou, S3A 2006)

PITG_11969 ATP-binding cassette GACGCCCAAGAGTAAAGATG CCGTTAATGCCCTTGAGTAG Childers et al., (ABC) Superfamily 2015 PITG_00923 Phospholipase D, Pi- TACCGTTCCCTACCTCATC GCCATCCCACTGACATTT Childers et al., PLD-like-3 2015 and expanded analysis PITG_05795 CHP annotated as a GTTGGAGAAGATGAAAGTCAATATG GTGGGTTGCGGTTCTTT Childers et al., TonB receptor 2015 + CHP annotation

PITG_16256 CHP annotated as part AGGCAGACCGAATGGTTGTT TGTGAGTCGTGCGTCATCAA Childers et al., of the AAT_I 2015 + CHP annotation superfamily PITG_02748 CHP annotated as CGCTCCTTCGACGAGTACAA TCCCGGGAAGTAGCTCTTGA Childers et al., RING Zinc finger 2015 + CHP annotation PITG_16013 CHP annotated as CGACATTCGCTACCGTCTGA GATGACGCGGACGTGAATTG Childers et al., ATS1 alfa tubulin 2015 + CHP annotation suppresor / RCC1 multidomain PITG_20025 Avr2 family secreted AAGAGAGAGGTTTTGGGGGC CATTTTCTCCAGCCATGCCG Re-analysis RxLR effector peptide protein AY830104.1 Gypsy-like CTGCATTCCCCCATCTCACT CTCTTGTGCTGCAAGACGTT Re-analysis retrotransposon GypsyPi-3a

PITG_19361 Myb-like DNA Binding ACTCATCTGTAAGCCCCACG ATAGATGCGAGTTCCGCCAG Expanded protein analysis

PITG_14397 Proliferating Cell TTGTGGAGGCCATGAAGGAC GCAGAAGCGACACTAGGGAA Expanded Nuclear Antigen analysis

PITG_01400 Argonaute 3 TATGGTCCTTCTGGGGCTGA CTCGTCCTTGCCTTCCTGTT Expanded analysis PITG_19607 Histone Arginine TGCAAACCCGACATTTGCAG TCAAACTCGCCCCAGTTCTC Expanded demethylase analysis

781 * This column contains information on the source from which these DE genes were obtained. Re-analysis makes reference to the de novo

782 analysis done using Trinity, RSEM and edgeR. The expanded analysis makes reference to the genome-guided analysis done using Bowtie,

783 Rsubread and NOISeq. 784

37 785 Table 3. Exhaustive annotation of conserved hypothetical proteins found in all three RNA-Seq

786 analyses done (previous analysis done by Childers and collaborators (2015), and the two analysis

787 done in this study named re-analysis and expanded analysis).

788 Source Gene ID Annotation Childers and |PITG_16256| Phytophthora capsici AAT_I superfamily collaborators (2015) |PITG_05795| TonB receptor activity of Phytophthora sojae

|PITG_15627| Phosphodiesterase domain, DUF3552 superfamily

|PITG_02748| RING Zinc finger

|PITG_10995| FVE Zinc binding DEP Phosphatidyl inositol kinase

|PITG_16013| ATS1 alfa-tubulin suppresor and RCC1 multidomain

|PITG_10079| RpsERibosomal protein S5 domain

|PITG_16795| Domain of unknown function (DNF4470) and dynein assembly factor 3, C-term domain

|PITG_04948| Phytophthora parasitica mucin 1 (MUCL1)

|PITG_07573| Predicted GPI-anchored protein

Other 7 conserved None hypothetical proteins

RNA-seq re-analysis 5 conserved None using Trinity, RSEM hypothetical and edgeR. proteins

Expanded RNA-seq |PITG_19125| Plasmopara halstedii F-box protein containing LRR analysis including |PITG_13405| Plasmopara halstedii Calponin homology domain rRNAs using Bowtie, Rsubread and |PITG_02586| Plasmopara halstedii cytoplasmic dynein 1 heavy chain 1 NOISeq. |PITG_16801| Plasmopara halstedii Histone transcription regulator HIRA, WD repeat superfamily

|PITG_05505| Plasmopara halstedii transmembrane protein

|PITG_06806| Carbohydrate-binding protein (PITG_06805)

|PITG_10269| Phytophthora sojae putative lectin

|PITG_19813| Plasmopara halstedii Transcription factor IIS

|PITG_15895| Plasmopara halstedii FYVE-Finger-containing RAB5 effector protein rabenosyn-5-related

|PITG_19814| Plasmopara halstedii Ferredoxin

Other 56 conserved None hypothetical proteins 789

38 790 Table 4. Small ncRNAs presenting significant differential expression (DE) that are associated to previously identified DE genes

791 between isolate US140120 (clonal lineage US-23) and isolate IMK-1 (clonal lineage US-22).

792 General Specific DE Small ncRNAs DE Genes group group Gene ID Gene name logFC Isolates (clonal lineage) logFC Isolates (clonal lienage) Analysis

ABC or PITG_06860 ATP-binding Cassette Downregulated IMK-1 (US-22) Upregulated All Expanded analysis other drug (ABC) Superfamily transporters

Transporters PITG_05615 Pyrophosphate- Downregulated IMK-1 (US-22) Upregulated All Expanded analysis and energized vacuolar membrane- membrane proton related Other pump, putative proteins transporters

PITG_01644 Sodium/hydrogen Downregulated US140120 (US-23) Upregulated 1034 (US-24) Re-analysis exchanger

PITG_00156 Beta-tubulin Downregulated IMK-1 (US-22) Upregulated All Expanded analysis

Structure and movement PITG_15117 Actin-1 Downregulated IMK-1 (US-22) Upregulated All Expanded analysis

PITG_21187 Myoferlin-like protein Downregulated US140120 (US-23) Upregulated All Expanded analysis

PITG_13014 Proliferation- Downregulated US140120 (US-23) Upregulated All Expanded analysis associated protein, Proliferation and cell metalloprotease family formation M24X, putative PITG_16760 Elongation of very Downregulated US140120 (US-23) Upregulated All Expanded analysis long chain fatty acids protein, putative

PITG_11329 Annexin (Annexin) Downregulated IMK-1 (US-22) and Downregulated 1032 (US-24) Re-analysis Family US140120 (US-23) PITG_00804 T-complex protein 1 Downregulated IMK-1 (US-22) Upregulated All Expanded analysis Chaperones, subunit delta Interactors binding and recognition PITG_11047 T-complex protein 1 Downregulated IMK-1 (US-22) Upregulated All Expanded analysis subunit eta PITG_01862 Glucose-6-phosphate Downregulated IMK-1 (US-22) Upregulated 4432 (US-8) Re-analysis isomerase

39 PITG_01862 Glucose-6-phosphate Downregulated IMK-1 (US-22) Upregulated All Expanded analysis isomerase PITG_19017 14-3-3 protein epsilon Downregulated IMK-1 (US-22) Upregulated All Expanded analysis

Electron PITG_00492 Cytochrome c Downregulated US140120 (US-23) Upregulated All Expanded analysis transfer peroxidase, mitochondrial Kinases PITG_13551 Creatine kinase, Downregulated US140120 (US-23) Upregulated All Expanded analysis mitochondrial Cysteine-rich PITG_10198 Adenosylhomocystein Downregulated US140120 (US-23) Upregulated All Expanded analysis ase Sugars PITG_10218 Glucan 1,3-beta- Downregulated IMK-1 (US-22) and Upregulated All Expanded analysis glucosidase, putative US140120 (US-23)

PITG_11926 glu/Leu/Phe/Val Downregulated US140120 (US-23) Downregulated 4432 (US-8) Re-analysis dehydrogenase family

Enzymes and Amino acids enzymatic- PITG_10858 Glycine cleavage Downregulated US140120 (US-23) Upregulated All Expanded analysis like proteins system H protein, mitochondrial PITG_07056 Isocitrate Downregulated US140120 (US-23) Upregulated All Expanded analysis dehydrogenase [NADP]

PITG_12462 Downregulated US140120 (US-23) Upregulated All Expanded analysis Other Aconitate hydratase, enzymes putative

PITG_18187 Sulfite reductase Downregulated IMK-1 (US-22) Upregulated All Expanded analysis [NADPH] subunit beta, putative RNA PITG_15723 60S ribosomal protein Downregulated US140120 (US-23) Downregulated 4432 (US-8) Re-analysis L14

PITG_20718 Putative Downregulated US140120 (US-23) Upregulated All Expanded analysis uncharacterized protein

PITG_16058 Downregulated IMK-1 (US-22) Upregulated All Expanded analysis Putative uncharacterized Putative proteins uncharacterized protein PITG_02772 Conserved Downregulated US140120 (US-23) Downregulated 4432 (US-8) Re-analysis hypothetical protein

793

40 794 795

796

797 Figure 1. Methodological process to identify initial sensitivity and acquisition of resistance

798 to mefenoxam. Initial sensitivity to mefenoxam of the three Phytophthora infestans isolates,

799 (US140120 (clonal lineage US-23), IMK-1 (clonal lineage US-22), and RC1#10 (clonal lineage

800 EC-1)), was assessed as shown in Step A (encircled in purple). Acquired resistance was assessed

801 as shown in Step B (encircled in blue). Successive subcultures from exposed and non-exposed

802 individuals of the three isolates were done as shown in Step C (encircled in orange). Lastly, they

803 were transferred to pea broth as shown in Step D (encircled in grey) and used for total RNA

804 extraction.

805

41 806 807

808

809 Figure 2. Initial mefenoxam sensitivity of three Phytophthora infestans isolates (US140120

810 (clonal lineage US-23), IMK-1 (clonal lineage US-22), and RC1#10 (clonal lineage EC-1).

811 Isolates US140120 and IMK-1 were sensitive to mefenoxam and isolate RC1#10 was resistant to

812 the fungicide. The sensitive isolates were those that grew less than 40% of the control at

813 mefenoxam concentrations of 5 and 100 µg ml-1. While the resistant isolate was able to grow at

814 40% or more of the control at these same concentrations (Childers et al., 2015) Error bars

815 represent 1 standard error from the mean.

816

42 817

818 A) B)

819 C)

820 Figure 3. Mefenoxam acquired resistance assays. Isolates A) US140120 (clonal lineage US-

821 23) B) IMK-1 (clonal lineage US-22), and C) RC1#10 (clonal lineage EC-1) growing at 1 µg ml-

822 1 and 5 µg ml-1 of mefenoxam were once again transferred to a control plate (0 µg ml-1) and to

823 plates containing 5 µg ml-1 and 100 µg ml-1 of mefenoxam. Error bars represent 1 standard error

824 from the mean and asterisks represent significant differences (*** ! ≤ 0.001 and ** 0.001 ≤ P

825 ≤ 0.01).

826

43 827

828 A. B.

829 Figure 4. Number of differentially expressed (DE) genes that were found using the in silico

830 approximations between isolates IMK-270 (clonal lineage US23), 1032 and 1034 (clonal

831 lineage US-24) and 4432 (clonal lineage US-8). A. DE genes found in re-analysis (de novo

832 analysis done using Trinity, RSEM and edgeR) and B. DE genes found in the expanded analysis

833 (genome-guided analysis done using bowtie, Rsubread and NOISeq).

834

44 835

836 A. B.

837 C. D.

838

839 Figure 5. Heat maps representing significantly differentially expressed (DE) transcripts

840 found in the re-analysis (de novo analysis done using Trinity, RSEM and edgeR). A. Isolate

841 IMK-270 (clonal lineage US-23). B. Isolate 1032 (clonal lineage US-24). C. Isolate 1034 (clonal

45 842 lineage US-24). D. Isolate 4432 (clonal lineage US-8). Purple color represents downregulation

843 and yellow color represents upregulation.

844

46 845

846

47 847 Figure 6. Summary of the significantly differentially expressed (DE) genes and transcripts

848 when comparing before and after the acquisition of mefenoxam resistance. Subsequent to

849 the annotation, DE genes were grouped according to their principal function. These groups are

850 shown here in different colors. Genes identified by Childers et al. (2015) are shown in the first

851 column of each group. Genes identified by the re-analysis are shown in the second column of

852 each group, and genes identified by the expanded analysis are shown in the third column of each

853 group. Genes in bold were originally annotated as conserved hypothetical proteins and the table

854 includes the annotation that was found using various sources of information in this study (see the

855 Methods section).

856

48 857

858 A. B.

859 C. D.

860 E.

49 861 F.

862 G.

863 H. 864 865 866 Figure 7. Number of differentially expressed (DE) genes that were found to be upregulated

867 or downregulated per functional group. The functional groups are: A. Elicitors and elicitins.

50 868 B. Transporters and membrane-related proteins. C. Structure and movement. D. Proliferation and

869 cell formation. E. Interactors. F. Transposons and/or repetitive-like proteins. G. Enzymes and

870 enzymatic-like proteins. H. Predicted and hypothetical proteins.

871

51 872

873 Figure 8. Expression levels of 12 genes assessed by qPCR. Each colored box represents one

874 gene. Arrows facing upwards represent that the gene was upregulated and arrows facing

875 downwards that it was downregulated. The arrow style indicates this for each of the tested

876 isolates when comparing them before and after the acquisition of resistance. A horizontal line

877 indicates that the gene was not found to be differentially expressed between these conditions.

878 The color accounts for the functional group in which the gene was classified: effectors and

879 elicitins (light blue), transporters and membrane-like proteins (green), (enzymes and enzymatic-

880 like proteins (grey), interactors (pink), cellular proliferation and formation (yellow), transposons

881 and repetitive-like proteins (dark blue). The genes are as follows: RxLR: Avr2 family secreted

882 RxLR effector peptide protein (PITG_20025), ABC: ATP-binding cassette (ABC) Superfamily

883 (PITG_11969), TonB: CHP annotated as a TonB receptor (PITG_05795), PD: Phospholipase

884 D, Pi-PLD-like-3 (PITG_00923), AAT_I: CHP annotated as part of the AAT_I superfamily

885 (PITG_16256), ATS1-RCC1: CHP annotated as ATS1 alfa tubulin suppresor / RCC1

886 multidomain (PITG_16013), HA: Histone Arginine demethylase (PITG_19607), Zinc: CHP

887 annotated as RING Zinc finger (PITG_02748), Ago: Argonaute 3 (PITG_01400), PCNA:

52 888 Proliferating Cell Nuclear Antigen (PITG_14397), Myb: Myb-like DNA Binding protein

889 (PITG_19361), and Gypsy: Gypsy-like retrotransposon GypsyPi-3a (AY830104.1).

890

891 892

53 893

894 A. B.

895 C. D.

896 E. 897

54 898 F.

899 G. H. 900

901 Figure 9. Number of differentially expressed (DE) small ncRNAs that were found to be

902 upregulated or downregulated per functional group. The functional groups are: A. Elicitors

903 and elicitins. B. Transporters and membrane-related proteins. C. Structure and movement. D.

904 Proliferation and cell formation. E. Interactors. F. Enzymes and enzymatic-like proteins. G.

905 RNAs. H. Predicted and conserved hypothetical proteins.

906

55 907

908 Figure 10. Proposed model for the molecular mechanisms and regulatory processes behind

909 the phenomenon of mefenoxam-acquired resistance in Phytophthora infestans. The cell on

910 the upper left corner indicates the four principal components of this model. The right side image

911 is zoomed-in to better appreciate each of these components. For details on the proposed model

912 please refer to the Discussion section.

56 913 Supplementary Figures

914 Supplementary Table 1. Significant differentially expressed (DE) transcripts found in the re-analysis (de novo analysis done

915 using Trinity, RSEM and edgeR).

General Annotation Organism NCBI identifier IMK-270 (US-23) 1032 (US-24) 1034 (US-24) 4432 (US-8) group

Expression logFC Expression logFC Expression logFC Expression logFC

Effectors- Secreted RxLR Phytophthora PITG_09160 NA NA Downregulated -5.318846071 Downregulated -7.98734685 Downregulated -5.770946765 elicitors effector peptide infestans T30-4 protein Avr2 family Phytophthora PITG_20025 NA NA NA NA Downregulated -7.253342219 Downregulated -5.208557822 secreted RxLR infestans T30-4 effector peptide protein Necrosis Phytophthora NA NA NA Upregulated 10.46918668 NA NA Upregulated 2.599202044 inducing-like sojae protein NPP1 type Transport Pleiotropic drug Phytophthora NA NA NA Downregulated between -2.29 and -3.78 Downregulated -2.01987871 Downregulated -2.395274582 ers and resistance protein sojae membran ABC superfamily e-like things MFS lactate Saprolegnia NA NA NA Upregulated 2.586640404 NA NA Upregulated 2.409802759 transporter, SHS diclina VS20 family, lactate transporter Croquemort-like Phytophthora PITG_12545 NA NA Upregulated 3.5711325 NA NA Upregulated 2.88561107 mating protein infestans T30-4 M82

TonB receptor Phytophthora NA NA NA Downregulated -7.943495817 NA NA Downregulated -2.442343927 activity sojae

Transpos Gypsy-like Phytophthora AY830104.1 NA NA Downregulated -7.365696183 NA NA Downregulated -7.046587077 on-like - retrotransposon infestans repeats GypsyPi-3a

Transposon Phytophthora DQ645745.1 NA NA Upregulated 6.826364867 Upregulated 8.052656573 NA NA reverse ramorum transcriptase GypsyPr-0 Transposon Phytophthora DQ645743.1 NA NA Downregulated -3.414972979 NA NA Downregulated between -2.07 CopiaPr-1 ramorum and -7.16 reverse transcriptase Enzymes Serine/threonine Phytophthora NA NA NA Downregulated between -2.98 and -4.04 Downregulated -2.314928609 NA NA - peptides protein kinase parasitica INRA- 310

57 Protein kinase Phytophthora PITG_16734 NA NA Downregulated -6.44419202 NA NA Upregulated 7.387189809 infestans T30-4

Phospholipase D- Phytophthora NA NA NA Downregulated between -7.2 and -9.19 NA NA Downregulated -6.764456831 like protein sojae

Putative zinc Phytophthora NA NA NA Downregulated -2.457664089 NA NA Downregulated -9.823074265 finger protein 2 sojae

Retinol Phytophthora PITG_20320 NA NA Upregulated 6.682188332 NA NA Upregulated 2.516276465 dehydrogenase infestans T30-4

Kazal-like serine Phytophthora EPI12 NA NA Downregulated -4.056270626 NA NA Downregulated between -2.99 protease inhibitor infestans and -3.08

Serine protease Phytophthora NA Downregula - Upregulated 2.156784039 NA NA Upregulated 2.615673654 trypsin-like sojae ted 3.132004 protein 094

Cytochrome Phytophthora PITG_07424 NA NA Downregulated -6.866327781 NA NA Upregulated 2.187992252 P450 infestans T30-4

Hypotheti Conserved Phytophthora PITG_16121 Upregulated 9.976758 Upregulated 4.436769071 NA NA Upregulated 4.175284606 cal hypothetical infestans T30-4 936 proteins protein

Conserved Phytophthora PITG_22127 NA NA Downregulated -7.478638738 NA NA Downregulated -3.624714128 hypothetical infestans T30-4 protein

Conserved Phytophthora PITG_18943 NA NA Upregulated 6.849730791 Upregulated 8.103571481 NA NA hypothetical infestans T30-4 protein

Conserved Phytophthora PITG_02501 NA NA Downregulated -2.183162311 NA NA Upregulated 2.532529967 hypothetical infestans T30-4 protein

Conserved Phytophthora PITG_14530 NA NA NA NA Upregulated 9.936471604 Upregulated 7.236104464 hypothetical infestans T30-4 protein

Non- Clone Phytophthora CBOT105-I15 Upregulated 8.777621 Upregulated 7.869217552 NA NA NA NA classified capsici 956

Clone Phytophthora CBOU61-C07 Upregulated 10.96603 Upregulated 7.266048316 NA NA Downregulated -9.752068217 capsici 94

Clone Phytophthora PI-BAC-49P21 Downregula - Up_between 5.04 and 9.57 Down_between -5.38 and - Upregulated between 8.19 and 8.63 Downregulated between -4.31 infestans ted 5.155341 7.33 and -10.9 139

Clone Phytophthora PI-BAC-35J4 NA NA Up_between 6.97 and 7.83 Down_between -4.9 and - NA NA Downregulated between -5.22 infestans 9.04 and -10.47

Clone H. parasitica HpEmoy2-17E12 NA NA NA NA Downregulated -9.955191618 Upregulated 9.056476061

58 Clone - Phytophthora PpMs39 NA NA Downregulated between -3.4 and -3.94 NA NA Downregulated between -2.26 microsatellite plurivora and -2.74 sequence

Genome section Cyprinus carpio Scaffold NA NA Upregulated 11.24420902 NA NA Downregulated -10.00792932 common carp 000001323

Genome section Cyprinus carpio Chromosome: 1, NA NA NA NA Upregulated 5.510546948 Downregulated -4.688594827 common carp Scaffold: LG1

Genome section Zymoseptoria Chromosome: 14 NA NA Downregulated -5.749949954 NA NA Downregulated -4.449241715 tritici aseembly ST99CH_1A5

Genome section Albugo laibachii CONTIG_1_NC1 NA NA Upregulated 6.801661812 NA NA Upregulated 2.515461368 Nc14 4_v4_580768_24 0

Genome section Albugo laibachii CONTIG_25_Em NA NA Upregulated 9.590085493 NA NA Upregulated 9.227628292 Alem1 1_cons_v4_1622 53_173_4944

Genome section Albugo laibachii CONTIG_41_Em NA NA Downregulated -3.621527486 Downregulated -2.747508825 NA NA Alem1 1_cons_v4_1325 28_243_56652

Secreted protein Achlya hypogyna NA NA NA Upregulated 2.938821497 NA NA Upregulated 2.125403114 isolate S_ACHHYP_002 26 916 Notes:

917 Many of the hypothethical proteins from Phytophthora sojae and Phytophthora parasitica INRA-310 were identified in two or more of the data sets. However, since they lack NCBI identifiers it is impossible to

918 identify which ones are shared between data sets and therefore proceed to further annotate them. The same thing occurred for cDNA sections of Aphanomyces euteiches.

919 All datasets contained transcripts whose identity could not be annotated.

920 The transcripts whose names are in bold were found in common between the de novo results and either Childers et al., (2015) results or the re-analysis including rRNAs.

921

59 922 923 Supplementary Table 2. Significant differentially expressed (DE) genes found in the expanded analysis including rRNAs

924 (genome-guided using Bowtie, Rsubread and NOISeq) that were shared among the four isolates that were analyzed.

Functional agrupation Annotation Gene name IMK-270 (US-23) 1032 (US-24) 1034 (US-24) 4432 (US-8)

Diff_Exp logFC Diff_Exp logFC Diff_Exp logFC Diff_Exp logFC

Effectors and elicitors Avrblb2 family secreted RxLR effector peptide protein, putative PITG_04090 Upregulated 1.992430625 Upregulated 1.508325357 Upregulated 2.241403991 Upregulated 0.563477279

Secreted RxLR effector peptide protein, putative PITG_09316 Upregulated 2.442688182 Upregulated 2.955211326 Upregulated 2.68828701 Upregulated 0.817461234

Avrblb2 family secreted RxLR effector peptide, putative PITG_20300 Upregulated 1.991623516 Upregulated 1.440865472 Upregulated 2.250700471 Upregulated 0.724274808

Secreted RxLR effector peptide protein, putative PITG_22922 Upregulated 2.306084198 Upregulated 0.851317589 Upregulated 1.409059128 Upregulated 1.427367994

Elicitin INF2A-like protein PITG_12561 Upregulated 0.876300071 Upregulated 1.369944352 Upregulated 0.745481285 Upregulated 1.660151338

Transporters / membrane-like Drug/Metabolite Transporter (DMT) Superfamily PITG_00494 Upregulated 0.690657275 Upregulated 0.394784464 Upregulated 0.386541846 Upregulated 0.345673377

Ammonium Transporter (Amt) Family PITG_02174 Upregulated 1.540280079 Upregulated 0.447258358 Upregulated 0.827493939 Upregulated 0.741538208

Sugar transporter, putative PITG_07710 Upregulated 1.875974882 Upregulated 2.278977845 Upregulated 1.291080236 Upregulated 1.300426433

Ammonium Transporter (Amt) Family PITG_10226 Upregulated 3.217792014 Upregulated 1.373298988 Upregulated 3.691325119 Upregulated 1.266078144

Glucose transporter, putative PITG_13003 Upregulated 1.495440084 Upregulated 1.891074842 Upregulated 0.454637169 Upregulated 0.753558694

Inorganic phosphate transporter, putative PITG_13020 Upregulated 2.842158067 Upregulated 0.626716227 Upregulated 1.426435041 Upregulated 0.584070346

Ammonium Transporter (Amt) Family PITG_20291 Upregulated 3.882523467 Upregulated 0.849008536 Upregulated 2.870829387 Upregulated 1.737572127

ATP-binding Cassette (ABC) Superfamily PITG_06860 Upregulated 1.459554023 Upregulated 1.052182923 Upregulated 0.862742407 Upregulated 1.214826487

ATP-binding Cassette (ABC) Superfamily PITG_16910 Upregulated 2.645147914 Upregulated 1.555674318 Upregulated 1.538269826 Upregulated 4.022747243

Major Facilitator Superfamily (MFS) PITG_00329 Upregulated 4.396847145 Upregulated 1.912627562 Upregulated 0.782557671 Upregulated 3.765679039

Pyrophosphate-energized vacuolar membrane proton pump, putative PITG_05615 Upregulated 0.548567727 Upregulated 0.729945593 Upregulated 0.706822091 Upregulated 0.636159369

Aquaporin, putative PITG_08297 Upregulated 1.944972646 Upregulated 1.341620925 Upregulated 1.077404643 Upregulated 3.350311351

Major Facilitator Superfamily (MFS) PITG_07711 Upregulated 1.857443795 Upregulated 2.045105808 Upregulated 1.227484911 Upregulated 0.969659274

Croquemort-like mating protein M82, putative PITG_12545 Upregulated 2.597702253 Upregulated 3.595663947 Upregulated 0.998646812 Upregulated 3.112054017

ATP-binding cassette sub-family E member 1 PITG_19281 Upregulated 0.58114536 Upregulated 0.252848874 Upregulated 0.356384011 Upregulated 0.224326292

Major Facilitator Superfamily (MFS) PITG_16383 Upregulated 1.708427799 Upregulated 2.238948001 Upregulated 1.395686458 Upregulated 1.999040369

Major Facilitator Superfamily (MFS) PITG_22157 Upregulated 1.523726024 Upregulated 1.847223177 Upregulated 0.406671545 Upregulated 0.652971167

60 Major Facilitator Superfamily (MFS) PITG_13473 Upregulated 3.388283742 Upregulated 0.661218814 Upregulated 2.797768606 Upregulated 2.983600023

Animal inward rectifier K channel (IRK-C) family protein PITG_16052 Upregulated 1.359973059 Upregulated 0.516679265 Upregulated 0.324160664 Upregulated 0.284195361

GPI-anchored leucine-rich lipoprotein PITG_14270 Upregulated 1.264731781 Upregulated 0.780535148 Upregulated 0.70166706 Upregulated 2.101927528

Putative GPI-anchored serine rich elicitin SOL13E-like protein PITG_20412 Upregulated 1.229816154 Upregulated 1.433573051 Upregulated 0.662874767 Upregulated 1.723617805

Structure / binding Beta-tubulin PITG_00156 Upregulated 0.837066088 Upregulated 0.547386239 Upregulated 1.029090991 Upregulated 0.470422537

T-complex protein 1 subunit delta PITG_00804 Upregulated 0.829978197 Upregulated 0.488825266 Upregulated 0.367079543 Upregulated 0.368235457

T-complex protein 1 subunit theta PITG_02479 Upregulated 0.837148582 Upregulated 0.31005965 Upregulated 0.492004887 Upregulated 0.374304556

T-complex protein 1 subunit zeta PITG_02502 Upregulated 0.915256898 Upregulated 0.333601663 Upregulated 0.255014745 Upregulated 0.323917649

T-complex protein 1 subunit alpha PITG_02567 Upregulated 1.129727105 Upregulated 0.376630333 Upregulated 0.374883385 Upregulated 0.659314269

NUK6 PITG_02706 Upregulated 0.808573849 Upregulated -0.542520834 Upregulated 0.262955954 Upregulated 0.25270039

Cellulose binding elicitor lectin (CBEL), putative PITG_03637 Upregulated 2.660046528 Upregulated 0.928013207 Upregulated -0.881257165 Upregulated 1.720502807

Cellulose binding elicitor lectin (CBEL), putative PITG_03639 Upregulated 2.652978388 Upregulated 0.978540026 Upregulated -0.913949365 Upregulated 1.789437456

T-complex protein 1 subunit epsilon PITG_06320 Upregulated 1.175835037 Upregulated 0.458936924 Upregulated 0.32203065 Upregulated 0.316828587

Calmodulin PITG_06514 Upregulated 0.577383218 Upregulated 0.103904303 Upregulated 0.445368925 Upregulated 0.103685518

Alpha-tubulin, putative PITG_07960 Upregulated 0.962628095 Upregulated 0.731016171 Upregulated 0.71039808 Upregulated 0.468416009

T-complex protein 1 subunit eta PITG_11047 Upregulated 1.14031327 Upregulated 0.716760909 Upregulated 0.6526965 Upregulated 0.540348675

Cellulose binding elicitor lectin (CBEL), putative PITG_10284 Upregulated 3.574218945 Upregulated 2.492953265 Upregulated -0.846827177 Upregulated 2.47411797

Electron transfer flavoprotein subunit beta PITG_10300 Upregulated 0.667370813 Upregulated 0.349540745 Upregulated 0.454725683 Upregulated 0.364239418

GTP-binding protein, putative PITG_13153 Upregulated 1.461009264 Upregulated 1.505919454 Upregulated 0.800458204 Upregulated 0.856047025

Alpha-actinin-1, putative PITG_13237 Upregulated 1.619756844 Upregulated 0.371959591 Upregulated 0.525603304 Upregulated 0.474448337

Actin-1 PITG_15117 Upregulated 0.506137051 Upregulated 0.270531257 Upregulated 0.231817062 Upregulated 0.338996682

Tubulin-specific chaperone D, putative PITG_16797 Upregulated 1.245661979 Upregulated 0.531517612 Upregulated 0.988695993 Upregulated 0.70063317

T-complex protein 1 subunit beta PITG_18392 Upregulated 1.041131591 Upregulated 0.61693574 Upregulated 0.626365042 Upregulated 0.460345145

WD domain-containing protein, putative PITG_13431 Upregulated 0.721907954 Upregulated 0.533161578 Upregulated 0.456390636 Upregulated 0.412420285

GTP-binding protein, putative PITG_16555 Upregulated 2.080482345 Upregulated 1.201597283 Upregulated 0.486380245 Upregulated 0.453527132

14-3-3 protein epsilon PITG_19017 Upregulated 0.534132744 Upregulated 0.388255014 Upregulated 0.683973393 Upregulated 0.391965034

Elongation of very long chain fatty acids protein, putative PITG_16760 Upregulated 1.169108151 Upregulated 1.194614717 Upregulated 1.138093085 Upregulated 1.125453285

Development - formation processes Myb-like DNA-binding protein, putative PITG_19361 Upregulated 0.564619207 Upregulated 0.265079826 Upregulated 0.234830201 Upregulated 0.530059185

Protoplast secreted protein 2 PITG_13761 Upregulated 0.804090572 Upregulated 0.635501365 Upregulated 0.41892991 Upregulated 0.667752989

61 Proliferating cell nuclear antigen PITG_14397 Upregulated 1.230939173 Upregulated 0.694288492 Upregulated 0.690025391 Upregulated 0.286043032

Myoferlin-like protein PITG_21187 Upregulated 1.162519609 Upregulated 0.342892899 Upregulated 0.436100311 Upregulated 0.909949539

Proliferation-associated protein, metalloprotease family M24X, putative PITG_13014 Upregulated 0.590001077 Upregulated 0.231315848 Upregulated 0.329221098 Upregulated 0.288747584

Enzymes and enzymatic-like processes Transcription initiation factor TFIID subunit, putative PITG_16023 Upregulated 1.057484264 Upregulated 0.586983362 Upregulated 0.463222369 Upregulated 0.506981146

26S protease regulatory subunit S10B PITG_00229 Upregulated 0.780082012 Upregulated 0.301685011 Upregulated 0.334077356 Upregulated 0.229157906

Phenylalanyl-tRNA synthetase beta chain PITG_00302 Upregulated 0.70778642 Upregulated 0.294119209 Upregulated 0.694692951 Upregulated 0.243936223

Cytochrome c peroxidase, mitochondrial PITG_00492 Upregulated 0.967295236 Upregulated 0.971579826 Upregulated 1.194459876 Upregulated 0.886154208

Carbonic anhydrase PITG_00682 Upregulated 0.957724407 Upregulated 0.662113828 Upregulated 0.451740853 Upregulated 0.762920298

2,4-dienoyl-CoA reductase PITG_00703 Upregulated 1.025996488 Upregulated 0.483847936 Upregulated 0.729678688 Upregulated 1.070529205

Thioredoxin, putative PITG_00708 Upregulated 1.368516651 Upregulated 0.920229278 Upregulated 0.391642645 Upregulated 1.016323114

Phospholipase D, Pi-PLD-like-3 PITG_00923 Downregulated -3.537772059 Downregulate -9.172751798 Downregulated -3.394564426 Downregulated -3.986253097 d

5-methlytetrahydropteroyltriglutamate-homocysteine methyltransferease PITG_01072 Upregulated 1.131154483 Upregulated 0.807437712 Upregulated 1.239502245 Upregulated 0.956356449

Aspartate aminotransferase, putative PITG_01193 Upregulated 1.142349084 Upregulated 1.113786461 Upregulated 0.533387104 Upregulated 0.829511829

Lysophospholipid acyltransferase, putative PITG_01330 Upregulated 1.223111161 Upregulated 0.741948621 Upregulated 0.349926899 Upregulated 0.742587092

Argonaute3 (AGO3) PITG_01400 Upregulated 1.302453421 Upregulated 0.761622786 Upregulated 0.534836691 Upregulated 0.882803871

Serine protease family S33 PITG_01429 Upregulated 2.228280315 Upregulated 1.611388819 Upregulated 0.897588192 Upregulated 1.66292996

Delta(5) fatty acid desaturase, putative PITG_01654 Upregulated 1.405961884 Upregulated 0.326970596 Upregulated 0.819591853 Upregulated 0.251145602

Glucose-6-phosphate isomerase PITG_01862 Upregulated 1.281536855 Upregulated 0.402558886 Upregulated 0.942092375 Upregulated 0.816985501

Aspartate aminotransferase PITG_02256 Upregulated 0.8254527 Upregulated 0.215469602 Upregulated 0.30953708 Upregulated 0.399673982

Cyclopropane-fatty-acyl-phospholipid synthase PITG_02277 Upregulated 1.048500491 Upregulated 1.011200468 Upregulated 0.351024121 Upregulated 0.809514888

Maspardin-like protein PITG_02484 Upregulated 1.615757248 Upregulated 1.704268615 Upregulated 1.421506846 Upregulated 1.507735694

Glutamate decarboxylase PITG_02594 Upregulated 1.301350656 Upregulated -0.494409267 Upregulated -0.435263605 Upregulated 0.305787658

Ketol-acid reductoisomerase PITG_02925 Upregulated 0.954055552 Upregulated 1.314533411 Upregulated 0.459803604 Upregulated 1.249568625

Glutathione S-transferase, putative PITG_03226 Upregulated 0.717792408 Upregulated 0.44757202 Upregulated 0.469323355 Upregulated 0.950575221

Histidinol-phosphate aminotransferase, putative PITG_03620 Upregulated 0.883418782 Upregulated 1.2722431 Upregulated 0.94704005 Upregulated 0.779602649

APS kinase/ATP sulfurlyase/pyrophosphatase fusion protein PITG_04010 Upregulated 1.053690178 Upregulated 1.185267622 Upregulated 0.705732208 Upregulated 0.478729152

Tripeptidyl-peptidase, putative PITG_04457 Upregulated 0.763836982 Upregulated 0.923679112 Upregulated 0.470923886 Upregulated 0.748405877

Peptidyl-prolyl cis-trans isomerase PITG_04522 Upregulated 0.485576559 Upregulated 0.456169848 Upregulated 0.158654003 Upregulated 0.200913812

Glycine amidinotransferase, mitochondrial PITG_05117 Upregulated 0.895977065 Upregulated 1.10201472 Upregulated 0.458738736 Upregulated 0.71576466

62 Glutathione S-transferase omega-like protein PITG_05516 Upregulated 1.149666318 Upregulated 0.481274846 Upregulated 0.263254994 Upregulated 0.854392091

UDP-glucose 4-epimerase, putative PITG_05616 Upregulated 0.682086687 Upregulated 1.630313639 Upregulated 0.159550908 Upregulated 1.213099073

ATP synthase subunit beta PITG_06595 Upregulated 0.536313725 Upregulated 0.296441453 Upregulated 0.38794472 Upregulated 0.049519049

ADP-ribosylation factor family PITG_06619 Upregulated 0.566927484 Upregulated -0.388757765 Upregulated 0.234808788 Upregulated -0.285229713

Isocitrate dehydrogenase [NADP] PITG_07056 Upregulated 0.458734128 Upregulated 0.212942703 Upregulated 0.343728708 Upregulated 0.268395312

Serine protease family S10, putative PITG_07164 Upregulated 0.936468494 Upregulated 1.184908892 Upregulated 1.532710817 Upregulated 0.454110734

Superoxide dismutase PITG_07328 Upregulated 0.477439521 Upregulated 0.659326112 Upregulated 0.575753345 Upregulated 0.47587717

ATP synthase subunit delta', putative PITG_07792 Upregulated 0.724606923 Upregulated 0.207226013 Upregulated 0.201415754 Upregulated 0.119869915

Glycylpeptide N-tetradecanoyltransferase PITG_07846 Upregulated 0.849818921 Upregulated 0.796101468 Upregulated 0.960444848 Upregulated 0.379652887

Thimet oligopeptidase PITG_08599 Upregulated 0.864495814 Upregulated 0.421933346 Upregulated 0.906335347 Upregulated 0.726105534

Cell 5A endo-1,4-betaglucanase, putative PITG_08611 Upregulated 1.738299246 Upregulated 0.476228958 Upregulated 0.38854614 Upregulated 0.992984443

26S proteasome non-ATPase regulatory subunit 14, putative PITG_08676 Upregulated 0.89316493 Upregulated 0.183902972 Upregulated 0.720287267 Upregulated 0.585928304

Serine protease family S33, putative PITG_11573 Upregulated 0.628514635 Upregulated 0.568930255 Upregulated 0.924076423 Upregulated 0.421949542

Protein kinase, putative PITG_09664 Upregulated 1.130988321 Upregulated 0.406177892 Upregulated 0.606302518 Upregulated 1.032799241

Glucan 1,3-beta-glucosidase, putative PITG_09798 Upregulated 1.293979782 Upregulated 0.301092999 Upregulated 0.31441436 Upregulated 0.611512692

Glycine cleavage system H protein, mitochondrial PITG_10858 Upregulated 0.947573845 Upregulated 0.702934928 Upregulated 0.731444789 Upregulated 0.526906276

6-phosphogluconate dehydrogenase PITG_10032 Upregulated 0.586590627 Upregulated 0.473374203 Upregulated 0.590173711 Upregulated 0.495152804

Multidrug/Oligosaccharidyl-lipid/Polysaccharide (MOP) Flippase Superfamily PITG_10107 Upregulated 1.442171315 Upregulated 0.801764566 Upregulated 0.963444825 Upregulated 0.704279511

Omega-3 fatty acid desaturase, endoplasmic reticulum, putative PITG_10063 Upregulated 1.026898582 Upregulated 0.475323621 Upregulated 0.635031728 Upregulated 0.702307335

Adenosylhomocysteinase PITG_10198 Upregulated 0.602544839 Upregulated 1.202505374 Upregulated 0.999803253 Upregulated 0.535355683

Glucan 1,3-beta-glucosidase, putative PITG_10218 Upregulated 1.286739505 Upregulated 0.303957213 Upregulated 0.322455055 Upregulated 0.701450598

Endoplasmic reticulum-Golgi intermediate compartment protein, putative PITG_10616 Upregulated 0.704842787 Upregulated 0.29456574 Upregulated 0.64329939 Upregulated 0.572630028

ADP-ribosylation factor family PITG_12286 Upregulated 0.462730175 Upregulated 0.405528224 Upregulated 0.49773518 Upregulated 0.162346702

Aconitate hydratase, putative PITG_12462 Upregulated 1.315225271 Upregulated 1.282407891 Upregulated 0.828164241 Upregulated 1.172939431

Cytochrome c PITG_12682 Upregulated 0.652630486 Upregulated 0.664531842 Upregulated 0.798942112 Upregulated 0.652516043

Cysteine synthase PITG_12727 Upregulated 0.608475542 Upregulated 0.90489618 Upregulated 0.44193354 Upregulated 0.369149029

Nitrite reductase [NAD(P)H], putative PITG_13013 Upregulated 2.452931334 Upregulated 1.332970937 Upregulated 2.168684124 Upregulated 5.056761494

Threonine synthase PITG_13139 Upregulated 1.226338554 Upregulated 1.047649638 Upregulated 0.753660795 Upregulated 0.662216082

Adenosine kinase PITG_13265 Upregulated 1.186911757 Upregulated 1.406680047 Upregulated 1.157447861 Upregulated 1.071304189

63 Asparagine synthetase PITG_13399 Upregulated 1.624964344 Upregulated 1.941715726 Upregulated 0.77478298 Upregulated 0.784288147

Sphingolipid delta(4)-desaturase DES1-like protein PITG_13403 Upregulated 0.693586893 Upregulated 0.744439362 Upregulated 0.570341204 Upregulated 0.625413065

Creatine kinase, mitochondrial PITG_13551 Upregulated 0.919629505 Upregulated 1.148885878 Upregulated 1.242506686 Upregulated 0.914477638

Phosphoglycerate mutase PITG_13749 Upregulated 1.103450952 Upregulated 0.906819432 Upregulated 0.60781971 Upregulated 0.638662924

Endo-1,3(4)-beta-glucanase, putative PITG_14173 Upregulated 1.046135354 Upregulated 0.311391698 Upregulated 0.166462637 Upregulated 0.711599685

Glutamine synthetase PITG_14180 Upregulated 0.583743876 Upregulated 0.636700633 Upregulated 0.625703186 Upregulated 0.279631731

Dimeric dihydrodiol dehydrogenase, putative PITG_14357 Upregulated 1.788282201 Upregulated 0.813314034 Upregulated 0.764222804 Upregulated 0.765607731

Ubiquinone biosynthesis monooxygenase, putative PITG_14563 Upregulated 0.477438211 Upregulated 0.313647141 Upregulated 0.184651769 Upregulated 0.196824929

Serine hydroxymethyltransferase PITG_14696 Upregulated 1.30103817 Upregulated 0.929051152 Upregulated 1.089890848 Upregulated 0.691601066

Protein kinase, putative PITG_14970 Upregulated 0.70930759 Upregulated 0.853615487 Upregulated 0.513562135 Upregulated 0.718543085

Protein kinase, putative PITG_15735 Upregulated 0.639970823 Upregulated 0.35292746 Upregulated 0.153869977 Upregulated 0.295202266

Serine protease family S33, putative PITG_15958 Upregulated 1.331390132 Upregulated 2.068977937 Upregulated 0.760766568 Upregulated 1.701821821

Phospholipase A-2-activating protein, putative PITG_15998 Upregulated 1.135219763 Upregulated 0.838512429 Upregulated 1.028034622 Upregulated 0.626525093

Methylmalonate-semialdehyde dehydrogenase, mitochondrial PITG_16005 Upregulated 0.983941526 Upregulated 0.655931468 Upregulated 0.799876444 Upregulated 1.253875722

Lysosomal Pro-X carboxypeptidase, putative PITG_16055 Upregulated 1.295334255 Upregulated 1.001250475 Upregulated 0.402447048 Upregulated 0.718347241

Glyoxylate/hydroxypyruvate reductase A, putative PITG_16083 Upregulated 1.47992143 Upregulated 0.984874847 Upregulated 0.714943621 Upregulated 0.60330794

26S proteasome non-ATPase regulatory subunit 3 PITG_16671 Upregulated 0.925939091 Upregulated 0.364406079 Upregulated 0.570340808 Upregulated 0.62344826

Di-N-acetylchitobiase, putative PITG_16794 Upregulated 1.407543856 Upregulated 1.381592708 Upregulated 1.260689219 Upregulated 1.444727039

Phospholipase D; Pi-TM-PLD PITG_16798 Upregulated 1.626279822 Upregulated 0.750779994 Upregulated 0.330290464 Upregulated 0.479524317

Glyceraldehyde-3-phosphate dehydrogenase, putative PITG_17130 Upregulated 1.854454795 Upregulated 0.731683469 Upregulated 0.521590394 Upregulated 0.855940025

Chitinase, putative PITG_17947 Upregulated 2.418190315 Upregulated 0.862631095 Upregulated 0.323570914 Upregulated 1.339036663

Sulfite reductase [NADPH] subunit beta, putative PITG_18187 Upregulated 0.784062703 Upregulated 0.675392008 Upregulated 0.620953436 Upregulated 0.726417437

Trans-1,2-dihydrobenzene-1,2-diol dehydrogenase, putative PITG_18535 Upregulated 1.773955275 Upregulated 0.528909582 Upregulated 0.83343187 Upregulated 0.627648146

Putative dolichyl-diphosphooligosaccharide-protein glycosyltransferase 48kD subunit PITG_19557 Upregulated 0.438432647 Upregulated 0.341851665 Upregulated 0.513592298 Upregulated 0.578834472

Histone arginine demethylase, putative PITG_19607 Upregulated 1.550686047 Upregulated -0.493701338 Upregulated 0.408534703 Upregulated 0.365009352

Dihydroxy-acid dehydratase PITG_20759 Upregulated 1.107312589 Upregulated 0.956920412 Upregulated 1.495530287 Upregulated 1.446043221

Protein phosphatase 1E, putative PITG_21172 Upregulated 0.95994702 Upregulated 0.8453802 Upregulated 0.42240824 Upregulated 0.334205592

Protein disulfide-isomerase, putative PITG_21378 Upregulated 0.414900884 Upregulated 0.251708711 Upregulated 0.240412789 Upregulated 0.323700011

Putative uncharacterized proteins Putative uncharacterized protein PITG_00455 Upregulated 0.866126054 Upregulated 0.931708596 Upregulated 0.310159961 Upregulated 0.912721467

64 Putative uncharacterized protein PITG_01557 Upregulated 0.933096683 Upregulated 0.342659006 Upregulated 0.994715585 Upregulated 0.711132541

Putative uncharacterized protein PITG_01784 Upregulated 1.345153938 Upregulated 1.117202663 Upregulated 1.166798139 Upregulated 0.867315693

Putative uncharacterized protein PITG_01966 Upregulated 0.679665714 Upregulated 1.013640089 Upregulated 0.814164491 Upregulated 0.568096102

Putative uncharacterized protein PITG_02058 Upregulated -0.945136924 Upregulated 0.257451068 Upregulated 0.435232662 Upregulated 0.620598161

Putative uncharacterized protein PITG_02205 Upregulated 1.197757824 Upregulated 0.300523037 Upregulated 0.397103105 Upregulated 0.710623947

Putative uncharacterized protein PITG_02475 Upregulated 1.000524728 Upregulated -0.58342733 Downregulated -1.47693676 Downregulated -1.011130738

Putative uncharacterized protein PITG_02586 Upregulated 0.805487881 Upregulated 0.584869531 Upregulated 0.830487059 Upregulated 0.642485417

Putative uncharacterized protein PITG_02599 Upregulated 1.032752605 Upregulated 0.513493935 Upregulated 0.21643618 Upregulated 0.438928935

Putative uncharacterized protein PITG_02809 Upregulated 2.018868662 Upregulated 0.818515447 Upregulated 1.143088942 Upregulated 0.846911714

Putative uncharacterized protein PITG_03636 Upregulated 1.897945669 Upregulated 0.727599613 Downregulated -1.36671788 Upregulated 0.873524487

Putative uncharacterized protein PITG_04481 Upregulated 1.310628226 Upregulated 0.986196247 Upregulated 0.401390292 Upregulated 0.565849413

Putative uncharacterized protein PITG_04948 Upregulated 2.528401261 Upregulated 1.529923856 Upregulated 1.735802733 Upregulated 2.456717735

Putative uncharacterized protein PITG_05505 Upregulated 0.887494945 Upregulated 0.474762586 Upregulated 0.675113597 Upregulated 0.759068968

Putative uncharacterized protein PITG_06408 Upregulated 0.997351897 Upregulated 0.436813285 Upregulated 0.376105426 Upregulated 0.560016029

Putative uncharacterized protein PITG_06430 Upregulated 0.545154205 Upregulated 0.216041446 Upregulated 0.238052248 Upregulated 0.390440095

Putative uncharacterized protein PITG_06806 Upregulated 1.115824947 Upregulated 1.2400985 Upregulated 1.160082622 Upregulated 1.370267896

Putative uncharacterized protein PITG_06847 Upregulated 1.40323268 Upregulated 1.418992564 Upregulated 0.924432642 Upregulated 1.609447837

Putative uncharacterized protein PITG_07271 Upregulated 1.484839297 Upregulated 0.591807156 Upregulated 1.423938307 Upregulated 1.799086462

Putative uncharacterized protein PITG_07340 Upregulated 0.519257271 Upregulated 0.576529761 Upregulated 0.415701882 Upregulated 0.546379168

Putative uncharacterized protein PITG_08043 Upregulated 0.944382214 Upregulated -0.310552872 Upregulated 0.609652719 Upregulated 0.430019929

Putative uncharacterized protein PITG_08344 Upregulated 4.45098764 Upregulated 3.804364814 Upregulated 3.894011594 Upregulated 3.900720341

Putative uncharacterized protein PITG_08376 Upregulated 0.963469542 Upregulated -0.815626804 Upregulated 0.618223305 Upregulated 0.367695555

Putative uncharacterized protein PITG_08377 Upregulated 1.032135207 Upregulated -0.897438834 Upregulated 0.562888988 Upregulated 0.349579303

Putative uncharacterized protein PITG_08442 Upregulated 2.772610209 Upregulated 1.737790966 Upregulated 3.060482895 Upregulated 2.876079348

Putative uncharacterized protein PITG_08594 Upregulated 0.613870576 Upregulated -0.318942032 Upregulated 0.669146675 Upregulated 0.442542217

Putative uncharacterized protein PITG_08692 Upregulated 1.074156496 Upregulated 0.435508187 Upregulated 0.548247452 Upregulated 0.308148108

Putative uncharacterized protein PITG_09936 Upregulated 1.294527411 Upregulated 1.41200507 Upregulated 0.965946092 Upregulated 0.940607695

Putative uncharacterized protein PITG_10058 Upregulated 1.782143264 Upregulated 0.611190247 Upregulated 1.094876705 Upregulated 1.509656499

Putative uncharacterized protein PITG_10079 Upregulated 1.802106008 Upregulated 1.031774068 Upregulated 2.00668734 Upregulated 1.111619882

65 Putative uncharacterized protein PITG_10185 Upregulated 0.556756802 Upregulated 0.190275252 Upregulated 0.31679944 Upregulated 0.291998161

Putative uncharacterized protein PITG_10269 Upregulated 1.501091484 Upregulated 3.645004699 Upregulated 1.413789623 Upregulated 1.243870831

Putative uncharacterized protein PITG_10747 Upregulated 0.892614915 Upregulated -0.282463223 Upregulated 0.262337228 Upregulated 0.233693926

Putative uncharacterized protein PITG_11450 Upregulated 0.358536765 Upregulated 0.391185878 Upregulated 0.184125023 Upregulated 0.173179151

Putative uncharacterized protein PITG_11598 Upregulated 1.884521037 Upregulated 7.27306987 Upregulated 0.607480299 Upregulated 2.942861262

Putative uncharacterized protein PITG_11601 Upregulated 1.684671341 Upregulated 5.982470206 Upregulated 0.479498231 Upregulated 3.465792575

Putative uncharacterized protein PITG_11676 Upregulated 1.961184846 Upregulated 0.81377688 Upregulated 0.675446842 Upregulated 1.680014718

Putative uncharacterized protein PITG_19813 Upregulated 1.254833432 Upregulated 0.445003957 Upregulated 0.699049327 Upregulated 0.497733839

Putative uncharacterized protein PITG_19814 Upregulated 0.664403842 Upregulated 0.562122991 Upregulated 0.640487874 Upregulated 0.340857431

Putative uncharacterized protein PITG_20102 Upregulated 1.707147163 Upregulated 1.715874278 Upregulated 0.553614986 Upregulated 1.034186092

Putative uncharacterized protein PITG_20498 Upregulated 4.073727961 Upregulated 1.024818189 Upregulated 0.865154433 Upregulated 1.031678713

Putative uncharacterized protein PITG_20559 Upregulated 1.260828218 Upregulated 0.444216487 Upregulated 0.326372968 Upregulated 1.158559054

Putative uncharacterized protein PITG_20670 Upregulated 2.121733195 Upregulated -0.700444506 Upregulated 1.042644291 Upregulated 2.505907086

Putative uncharacterized protein PITG_20718 Upregulated 1.015250966 Upregulated 0.461100487 Upregulated 0.350248247 Upregulated 0.481378163

Putative uncharacterized protein PITG_12852 Upregulated 0.775404781 Upregulated 0.355858541 Upregulated 0.782039533 Upregulated 0.551610257

Putative uncharacterized protein PITG_13159 Upregulated 1.025621262 Upregulated 0.253502967 Upregulated 0.399355779 Upregulated 0.218468679

Putative uncharacterized protein PITG_13271 Upregulated 1.482094803 Upregulated 0.56705487 Upregulated -0.575377757 Upregulated 0.715113823

Putative uncharacterized protein PITG_13273 Upregulated 1.118774137 Upregulated 1.82888763 Upregulated 1.253160119 Upregulated 1.206443756

Putative uncharacterized protein PITG_13366 Upregulated 0.890681891 Upregulated 0.73219572 Upregulated 0.327193849 Upregulated 1.464281394

Putative uncharacterized protein PITG_13405 Upregulated 1.026713708 Upregulated 0.592220566 Upregulated 0.339960344 Upregulated 0.60252558

Putative uncharacterized protein PITG_13428 Upregulated 1.395445043 Upregulated 0.712206676 Upregulated 0.346808962 Upregulated 0.683568367

Putative uncharacterized protein PITG_13861 Upregulated 1.113929714 Upregulated 0.414867373 Upregulated 0.308839722 Upregulated 0.688885101

Putative uncharacterized protein PITG_14008 Upregulated 0.690518933 Upregulated 0.870224596 Upregulated 0.763654202 Upregulated 0.649317289

Putative uncharacterized protein PITG_14023 Upregulated 1.583338347 Upregulated 0.871836756 Upregulated 1.256107306 Upregulated 1.354956134

Putative uncharacterized protein PITG_14047 Upregulated 1.694377693 Upregulated 1.67695008 Upregulated 1.431304258 Upregulated 1.407500024

Putative uncharacterized protein PITG_14489 Upregulated 3.408747559 Upregulated 3.836629575 Upregulated 1.40519373 Upregulated 3.749521975

Putative uncharacterized protein PITG_14861 Upregulated 4.527708341 Upregulated 2.729995678 Upregulated 1.035161532 Upregulated 4.250717885

Putative uncharacterized protein PITG_15398 Upregulated 1.786576715 Upregulated -0.837210548 Upregulated 0.939074254 Upregulated 2.63200098

Putative uncharacterized protein PITG_15399 Upregulated 3.707728187 Upregulated 0.635700758 Upregulated 1.429512084 Upregulated 3.655252181

66 Putative uncharacterized protein PITG_15895 Upregulated 2.284941523 Upregulated 1.362284178 Upregulated 0.84932808 Upregulated 1.263680878

Putative uncharacterized protein PITG_19024 Upregulated 1.9748508 Upregulated 1.371374215 Upregulated 1.044170752 Upregulated 2.291886865

Putative uncharacterized protein PITG_19125 Upregulated 1.495845473 Upregulated 1.320325781 Upregulated 0.96030523 Upregulated 0.47044667

Putative uncharacterized protein PITG_16058 Upregulated 1.481336605 Upregulated 0.859973069 Upregulated 1.1082992 Upregulated 0.48683646

Putative uncharacterized protein PITG_16206 Upregulated 0.775437215 Upregulated 0.766122785 Upregulated 0.375358267 Upregulated 0.679142872

Putative uncharacterized protein PITG_21525 Upregulated 1.613708413 Upregulated 0.602765825 Upregulated 1.008689141 Upregulated 1.12845495

Putative uncharacterized protein PITG_16801 Upregulated 0.963233744 Upregulated 0.630218428 Upregulated 0.866669417 Upregulated 0.840915594

925

926

67 927

928 Supplementary Table 3. Significant differential expressed (DE) small ncRNAs found for isolate US140120 (clonal lineage US-

929 23).

Gene ID Gene description prob log2FC EPrPING00000004091 tRNA-Ser for anticodon GCU 1 -1.926074619 PITG_03653 Protein phosphatase 2 0.995621389 -1.850800321 PITG_11329 Annexin (Annexin) Family 0.999994328 -1.708468412 PITG_05012 Putative uncharacterized protein 0.99672057 -1.697820017 PITG_06355 Putative uncharacterized protein 0.99672057 -1.697820017 PITG_10218 Glucan 1,3-beta-glucosidase, putative 0.996630498 -1.572687206 PITG_21697 conserved hypothetical protein 0.996630498 -1.572687206 PITG_08809 60S ribosomal protein L12, putative 0.999999208 -1.510412502 PITG_15723 60S ribosomal protein L14, putative 0.999999208 -1.510412502 PITG_06722 Elongation factor 1-alpha 0.995708221 -1.499764108 EPrPING00000003074 tRNA-Ser for anticodon GCU 0.995407154 -1.425748341 PITG_11913 Heat shock cognate 70 kDa protein [Source:UniProtKB/TrEMBL;Acc:D0NHI7] 0.995407154 -1.425748341 PITG_12745 40S ribosomal protein S17, putative [Source:UniProtKB/TrEMBL;Acc:D0NL21] 0.995407154 -1.425748341 EPrPING00000001238 28s_rRNA 0.996360642 -1.424268121 EPrPING00000001545 28s_rRNA 0.996360642 -1.424268121 EPrPING00000005877 Eukaryotic type signal recognition particle RNA [Source:RFAM;Acc:RF00017] 0.996360642 -1.424268121 PITG_00205 Putative uncharacterized protein [Source:UniProtKB/TrEMBL;Acc:D0MQ74] 0.996360642 -1.424268121 PITG_00437 Putative uncharacterized protein [Source:UniProtKB/TrEMBL;Acc:D0MQT1] 0.996360642 -1.424268121 PITG_01108 Putative uncharacterized protein [Source:UniProtKB/TrEMBL;Acc:D0MSH2] 0.996360642 -1.424268121 PITG_04384 Ribosome biogenesis regulatory protein [Source:UniProtKB/TrEMBL;Acc:D0N154] 0.996360642 -1.424268121 PITG_04860 Putative uncharacterized protein [Source:UniProtKB/TrEMBL;Acc:D0N275] 0.996360642 -1.424268121 PITG_05374 Argininosuccinate synthase [Source:UniProtKB/TrEMBL;Acc:D0N471] 0.996360642 -1.424268121

68 PITG_06719 Glycerol-3-phosphate dehydrogenase, mitochondrial [Source:UniProtKB/TrEMBL;Acc:D0N7X9] 0.996360642 -1.424268121 PITG_09247 Neurobeachin-like protein [Source:UniProtKB/TrEMBL;Acc:D0NB84] 0.996360642 -1.424268121 PITG_09940 Putative uncharacterized protein [Source:UniProtKB/TrEMBL;Acc:D0NDW6] 0.996360642 -1.424268121 PITG_10378 Putative uncharacterized protein [Source:UniProtKB/TrEMBL;Acc:D0NF63] 0.996360642 -1.424268121 PITG_13371 60S ribosomal protein L31, putative [Source:UniProtKB/TrEMBL;Acc:D0NLT7] 0.996360642 -1.424268121 PITG_16328 Tyrosyl-tRNA synthetase, putative [Source:UniProtKB/TrEMBL;Acc:D0NU10] 0.996360642 -1.424268121 PITG_16833 Putative uncharacterized protein [Source:UniProtKB/TrEMBL;Acc:D0NU79] 0.996360642 -1.424268121 PITG_17606 Cation-transporting ATPase, putative [Source:UniProtKB/TrEMBL;Acc:D0NWS9] 0.996360642 -1.424268121 PITG_16275 Secreted RxLR effector peptide protein, putative [Source:UniProtKB/TrEMBL;Acc:D0NTI4] 0.995342889 -1.41278433 PITG_23065 General transcription factor IIH subunit, putative [Source:UniProtKB/TrEMBL;Acc:D0NSP9] 0.995342889 -1.41278433 EPrPING00000004173 tRNA-Ser for anticodon GCU 0.99651807 -1.260470641 EPrPING00000004304 Small nucleolar RNA U3 0.996735649 -1.260470641 EPrPING00000004460 tRNA-Met for anticodon CAU [Source:TRNASCAN_SE;Acc:tRNA-Met] 0.99651807 -1.260470641 EPrPING00000006598 Small nucleolar RNA U3 [Source:RFAM;Acc:RF00012] 0.99651807 -1.260470641 PITG_00268 Putative uncharacterized protein [Source:UniProtKB/TrEMBL;Acc:D0MQD4] 0.99651807 -1.260470641 PITG_00710 Isoamyl acetate-hydrolyzing esterase, putative [Source:UniProtKB/TrEMBL;Acc:D0MRH9] 0.99651807 -1.260470641 PITG_02627 Putative uncharacterized protein [Source:UniProtKB/TrEMBL;Acc:D0MWT8] 0.99651807 -1.260470641 PITG_06120 Putative uncharacterized protein [Source:UniProtKB/TrEMBL;Acc:D0N6F7] 0.99651807 -1.260470641 PITG_08704 Fatty acid desaturase, putative [Source:UniProtKB/TrEMBL;Acc:D0ND01] 0.99651807 -1.260470641 PITG_09272 Putative uncharacterized protein [Source:UniProtKB/TrEMBL;Acc:D0NBA6] 0.99651807 -1.260470641 PITG_09447 Putative uncharacterized protein [Source:UniProtKB/TrEMBL;Acc:D0NC10] 0.99651807 -1.260470641 PITG_10160 NADPH-cytochrome P450 reductase, putative [Source:UniProtKB/TrEMBL;Acc:D0NEG8] 0.99651807 -1.260470641 PITG_10664 Intraflagellar Transport Protein 122 [Source:UniProtKB/TrEMBL;Acc:D0NGT2] 0.99651807 -1.260470641 PITG_10971 Protein kinase, putative [Source:UniProtKB/TrEMBL;Acc:D0NFV3] 0.99651807 -1.260470641 PITG_11138 Fumarate reductase flavoprotein subunit, putative [Source:UniProtKB/TrEMBL;Acc:D0NGA0] 0.99651807 -1.260470641 PITG_11710 Putative uncharacterized protein [Source:UniProtKB/TrEMBL;Acc:D0NID7] 0.99651807 -1.260470641 PITG_11743 Nuclear pore complex protein, putative [Source:UniProtKB/TrEMBL;Acc:D0NIG0] 0.99651807 -1.260470641 PITG_14380 Lon protease, putative [Source:UniProtKB/TrEMBL;Acc:D0NPP4] 0.99651807 -1.260470641 PITG_18170 12-oxophytodienoate reductase, putative [Source:UniProtKB/TrEMBL;Acc:D0NX66] 0.99651807 -1.260470641

69 PITG_18233 Putative uncharacterized protein [Source:UniProtKB/TrEMBL;Acc:D0NXN6] 0.99651807 -1.260470641 PITG_20689 Eukaryotic translation initiation factor 3 subunit H, putative [Source:UniProtKB/TrEMBL;Acc:D0P2T1] 0.99651807 -1.260470641 PITG_07887 26S proteasome non-ATPase regulatory subunit 6 [Source:UniProtKB/TrEMBL;Acc:D0NA25] 0.994009381 -1.226212212 PITG_18306 Putative uncharacterized protein [Source:UniProtKB/TrEMBL;Acc:D0NXU7] 0.994009381 -1.226212212 PITG_13500 40S ribosomal protein S4 [Source:UniProtKB/TrEMBL;Acc:D0NM53] 0.995888097 -1.214728421 PITG_14936 ATP synthase gamma chain [Source:UniProtKB/TrEMBL;Acc:D0NPC9] 0.995888097 -1.214728421 EPrPING00000004340 Small nucleolar RNA SNORD36 [Source:RFAM;Acc:RF00049] 0.995655208 -1.084520122 EPrPING00000001280 U5 spliceosomal RNA 0.994486869 -1.062414732 PITG_18414 Phosphoglucomutase [Source:UniProtKB/TrEMBL;Acc:D0NWZ2] 0.994486869 -1.062414732 EPrPING00000000099 28s_rRNA 0.995813273 -1.057212123 EPrPING00000001842 tRNA-Tyr for anticodon GUA 0.995813273 -1.057212123 EPrPING00000003499 tRNA-Tyr for anticodon GUA 0.995813273 -1.057212123 EPrPING00000004201 28s_rRNA 0.995813273 -1.057212123 PITG_00058 Cystatin-like cysteine protease inhibitor EPIC4 [Source:UniProtKB/TrEMBL;Acc:A1L019] 0.995813273 -1.057212123 PITG_00133 Phosphoserine aminotransferase, putative [Source:UniProtKB/TrEMBL;Acc:D0MSZ0] 0.995813273 -1.057212123 PITG_00179 40S ribosomal protein S12 [Source:UniProtKB/TrEMBL;Acc:D0MT34] 0.995813273 -1.057212123 PITG_00333 Dihydroflavonol-4-reductase, putative [Source:UniProtKB/TrEMBL;Acc:D0MQJ1] 0.995813273 -1.057212123 PITG_00787 CRM1 C terminal Exportin 1-like protein [Source:UniProtKB/TrEMBL;Acc:D0MRP5] 0.995813273 -1.057212123 PITG_00854 Putative uncharacterized protein [Source:UniProtKB/TrEMBL;Acc:D0MRU7] 0.995813273 -1.057212123 PITG_01282 Putative uncharacterized protein [Source:UniProtKB/TrEMBL;Acc:D0MV42] 0.995813273 -1.057212123 PITG_01580 Putative uncharacterized protein [Source:UniProtKB/TrEMBL;Acc:D0MTK6] 0.995813273 -1.057212123 PITG_01644 Sodium/hydrogen exchanger [Source:UniProtKB/TrEMBL;Acc:D0MTQ7] 0.995813273 -1.057212123 PITG_02096 Polycomb-like protein [Source:UniProtKB/TrEMBL;Acc:D0MVG7] 0.995813273 -1.057212123 PITG_03348 RNA polymerase-associated protein CTR9 [Source:UniProtKB/TrEMBL;Acc:D0N009] 0.995813273 -1.057212123 PITG_03711 Serine/threonine-protein phosphatase 2A regulatory subunit B', putative [Source:UniProtKB/TrEMBL;Acc:D0MYB3] 0.995813273 -1.057212123 PITG_04065 Glycerol-3-phosphate dehydrogenase [Source:UniProtKB/TrEMBL;Acc:D0N0G8] 0.995813273 -1.057212123 PITG_04603 Putative uncharacterized protein [Source:UniProtKB/TrEMBL;Acc:D0N1M0] 0.995813273 -1.057212123 PITG_04754 Putative uncharacterized protein [Source:UniProtKB/TrEMBL;Acc:D0N1Z2] 0.995813273 -1.057212123 PITG_05011 5A endo-1,4-betaglucanase, putative [Source:UniProtKB/TrEMBL;Acc:D0N2K6] 0.995813273 -1.057212123

70 PITG_05079 Glycosyltransferase [Source:UniProtKB/TrEMBL;Acc:D0N3I0] 0.995813273 -1.057212123 PITG_05757 Structural maintenance of chromosomes protein, putative [Source:UniProtKB/TrEMBL;Acc:D0N5L8] 0.995813273 -1.057212123 PITG_06369 Myosin-like protein [Source:UniProtKB/TrEMBL;Acc:D0N4P6] 0.995813273 -1.057212123 PITG_06663 Putative uncharacterized protein [Source:UniProtKB/TrEMBL;Acc:D0N5D6] 0.995813273 -1.057212123 PITG_06953 Histone H3 [Source:UniProtKB/TrEMBL;Acc:D0N6W3] 0.995813273 -1.057212123 PITG_07285 Putative uncharacterized protein [Source:UniProtKB/TrEMBL;Acc:D0N7Q1] 0.995813273 -1.057212123 PITG_07300 60S ribosomal protein L35 [Source:UniProtKB/TrEMBL;Acc:D0N7R5] 0.995813273 -1.057212123 PITG_07841 Glycyl-tRNA synthetase [Source:UniProtKB/TrEMBL;Acc:D0N9Y4] 0.995813273 -1.057212123 PITG_08024 Putative uncharacterized protein [Source:UniProtKB/TrEMBL;Acc:D0N9A7] 0.995813273 -1.057212123 PITG_08834 Ribosomal protein L37 [Source:UniProtKB/TrEMBL;Acc:D0NDA7] 0.995813273 -1.057212123 PITG_09722 Thioredoxin H-type [Source:UniProtKB/TrEMBL;Acc:D0NCN3] 0.995813273 -1.057212123 PITG_10198 Adenosylhomocysteinase [Source:UniProtKB/TrEMBL;Acc:D0NEK2] 0.995813273 -1.057212123 PITG_10777 Imidazoleglycerol-phosphate dehydratase [Source:UniProtKB/TrEMBL;Acc:D0NH24] 0.995813273 -1.057212123 PITG_10827 Nuclease, putative [Source:UniProtKB/TrEMBL;Acc:D0NH63] 0.995813273 -1.057212123 PITG_11215 DnaJ subfamily C protein [Source:UniProtKB/TrEMBL;Acc:D0NGG3] 0.995813273 -1.057212123 PITG_11254 Exocyst complex component, putative [Source:UniProtKB/TrEMBL;Acc:D0NGK2] 0.995813273 -1.057212123 PITG_11425 Transcriptional repressor TUP1-like protein [Source:UniProtKB/TrEMBL;Acc:D0NIR3] 0.995813273 -1.057212123 PITG_11626 Proteasome subunit beta type [Source:UniProtKB/TrEMBL;Acc:D0NI70] 0.995813273 -1.057212123 PITG_11926 Glu/Leu/Phe/Val dehydrogenase family, putative [Source:UniProtKB/TrEMBL;Acc:D0NHJ6] 0.995813273 -1.057212123 PITG_12462 Aconitate hydratase, putative [Source:UniProtKB/TrEMBL;Acc:D0NKK5] 0.995813273 -1.057212123 PITG_12556 Elicitin-like INF6 [Source:UniProtKB/TrEMBL;Acc:D0NKU0] 0.995813273 -1.057212123 PITG_13014 Proliferation-associated protein, metalloprotease family M24X, putative [Source:UniProtKB/TrEMBL;Acc:D0NK33] 0.995813273 -1.057212123 PITG_13017 ATP-dependent RNA helicase, putative [Source:UniProtKB/TrEMBL;Acc:D0NK36] 0.995813273 -1.057212123 PITG_13551 Creatine kinase, mitochondrial [Source:UniProtKB/TrEMBL;Acc:D0NM91] 0.995813273 -1.057212123 PITG_14401 Myb-like DNA-binding protein, putative [Source:UniProtKB/TrEMBL;Acc:D0NPR6] 0.995813273 -1.057212123 PITG_14456 Glutamyl-tRNA synthetase, putative [Source:UniProtKB/TrEMBL;Acc:D0NPW4] 0.995813273 -1.057212123 PITG_14808 Ferrochelatase, mitochondrial [Source:UniProtKB/TrEMBL;Acc:D0NP35] 0.995813273 -1.057212123 PITG_15057 Cysteine desulfurase 1, mitochondrial [Source:UniProtKB/TrEMBL;Acc:D0NRJ8] 0.995813273 -1.057212123 PITG_16430 Putative uncharacterized protein [Source:UniProtKB/TrEMBL;Acc:D0NTM0] 0.995813273 -1.057212123

71 PITG_16854 Putative uncharacterized protein [Source:UniProtKB/TrEMBL;Acc:D0NU95] 0.995813273 -1.057212123 PITG_17312 SUMO-activating enzyme (SAE), putative [Source:UniProtKB/TrEMBL;Acc:D0NVS3] 0.995813273 -1.057212123 PITG_17674 5'-3' exoribonuclease 1, putative [Source:UniProtKB/TrEMBL;Acc:D0NWL1] 0.995813273 -1.057212123 PITG_18072 Putative uncharacterized protein [Source:UniProtKB/TrEMBL;Acc:D0NY46] 0.995813273 -1.057212123 PITG_18931 Putative uncharacterized protein [Source:UniProtKB/TrEMBL;Acc:D0P017] 0.995813273 -1.057212123 PITG_20796 Putative uncharacterized protein [Source:UniProtKB/TrEMBL;Acc:D0P2Q5] 0.995813273 -1.057212123 PITG_21398 DEAD/DEAH box RNA helicase, putative [Source:UniProtKB/TrEMBL;Acc:D0P3V7] 0.995813273 -1.057212123 EPrPING00000003667 tRNA-Ser for anticodon GCU 0.995581267 -0.946051689 EPrPING00000002266 28s_rRNA 0.987987656 -0.896742884 EPrPING00000002851 Eukaryotic type signal recognition particle RNA 0.993653196 -0.859156214 EPrPING00000003651 Small nucleolar RNA U3 0.993653196 -0.859156214 PITG_17261 60S acidic ribosomal protein P0 [Source:UniProtKB/TrEMBL;Acc:D0NVM9] 0.993653196 -0.859156214 PITG_19022 Putative uncharacterized protein [Source:UniProtKB/TrEMBL;Acc:D0NYS3] 0.993653196 -0.859156214 EPrPING00000001584 Small nucleolar RNA U3 0.992119087 -0.828447581 PITG_01922 40S ribosomal protein SA [Source:UniProtKB/TrEMBL;Acc:D0MUE8] 0.989130493 -0.812247569 PITG_11750 Serine/threonine protein phosphatase 2A 59 kDa regulatory subunit B' gamma, putative [Source:UniProtKB/TrEMBL;Acc:D0NIG3] 0.985062858 -0.802209516 PITG_17921 P-type ATPase (P-ATPase) Superfamily [Source:UniProtKB/TrEMBL;Acc:D0NXA0] 0.985062858 -0.802209516 PITG_05658 Putative uncharacterized protein [Source:UniProtKB/TrEMBL;Acc:D0N3D2] 0.97613373 -0.695884058 EPrPING00000000452 28s_rRNA 0.978659777 -0.641990011 EPrPING00000000538 28s_rRNA 0.978659777 -0.641990011 EPrPING00000000575 Eukaryotic type signal recognition particle RNA 0.978659777 -0.641990011 EPrPING00000000912 tRNA-Glu for anticodon CUC 0.978659777 -0.641990011 EPrPING00000001462 tRNA-Met for anticodon CAU 0.978659777 -0.641990011 EPrPING00000001790 28s_rRNA 0.978659777 -0.641990011 EPrPING00000001889 28s_rRNA 0.978659777 -0.641990011 EPrPING00000002013 28s_rRNA 0.978659777 -0.641990011 EPrPING00000002096 tRNA-Leu for anticodon CAG 0.978659777 -0.641990011 EPrPING00000002348 28s_rRNA 0.978659777 -0.641990011 EPrPING00000004466 tRNA-Gly for anticodon CCC [Source:TRNASCAN_SE;Acc:tRNA-Gly] 0.978659777 -0.641990011

72 EPrPING00000004716 tRNA-Tyr for anticodon GUA [Source:TRNASCAN_SE;Acc:tRNA-Tyr] 0.978659777 -0.641990011 EPrPING00000004847 28s_rRNA [Source:RNAMMER;Acc:28s_rRNA] 0.978659777 -0.641990011 EPrPING00000005880 28s_rRNA [Source:RNAMMER;Acc:28s_rRNA] 0.978659777 -0.641990011 EPrPING00000006981 28s_rRNA [Source:RNAMMER;Acc:28s_rRNA] 0.978659777 -0.641990011 EPrPING00000006996 Eukaryotic type signal recognition particle RNA [Source:RFAM;Acc:RF00017] 0.978659777 -0.641990011 EPrPING00000007286 28s_rRNA [Source:RNAMMER;Acc:28s_rRNA] 0.978659777 -0.641990011 PITG_00034 Aldehyde dehydrogenase, putative [Source:UniProtKB/TrEMBL;Acc:D0MSP9] 0.978659777 -0.641990011 PITG_00154 Crinkler (CRN) family protein, putative [Source:UniProtKB/TrEMBL;Acc:D0MT11] 0.978659777 -0.641990011 PITG_00183 Dynamin-2 [Source:UniProtKB/TrEMBL;Acc:D0MQ53] 0.978659777 -0.641990011 PITG_00412 Putative uncharacterized protein [Source:UniProtKB/TrEMBL;Acc:D0MQR0] 0.978659777 -0.641990011 PITG_00492 Cytochrome c peroxidase, mitochondrial [Source:UniProtKB/TrEMBL;Acc:D0MQY5] 0.978659777 -0.641990011 PITG_00720 Acetyl-coenzyme A synthetase [Source:UniProtKB/TrEMBL;Acc:D0MRI9] 0.978659777 -0.641990011 PITG_00734 Putative uncharacterized protein [Source:UniProtKB/TrEMBL;Acc:D0MRK2] 0.978659777 -0.641990011 PITG_00770 Putative uncharacterized protein [Source:UniProtKB/TrEMBL;Acc:D0MRN4] 0.978659777 -0.641990011 PITG_01361 Putative uncharacterized protein [Source:UniProtKB/TrEMBL;Acc:D0MVB9] 0.978659777 -0.641990011 PITG_01389 Proteasome subunit beta type [Source:UniProtKB/TrEMBL;Acc:D0MT45] 0.978659777 -0.641990011 PITG_02038 Fructose 1,6 bisphosphatase [Source:UniProtKB/TrEMBL;Acc:D0MUQ5] 0.978659777 -0.641990011 PITG_02207 Putative uncharacterized protein [Source:UniProtKB/TrEMBL;Acc:D0MVR5] 0.978659777 -0.641990011 PITG_02687 Putative uncharacterized protein [Source:UniProtKB/TrEMBL;Acc:D0MWZ3] 0.978659777 -0.641990011 PITG_02772 Putative uncharacterized protein [Source:UniProtKB/TrEMBL;Acc:D0MX66] 0.978659777 -0.641990011 PITG_03225 Putative uncharacterized protein [Source:UniProtKB/TrEMBL;Acc:D0MZP3] 0.978659777 -0.641990011 PITG_03308 Putative uncharacterized protein [Source:UniProtKB/TrEMBL;Acc:D0MZX1] 0.978659777 -0.641990011 PITG_03353 60S ribosomal protein L17-2 [Source:UniProtKB/TrEMBL;Acc:D0N014] 0.978659777 -0.641990011 PITG_03467 Putative uncharacterized protein [Source:UniProtKB/TrEMBL;Acc:D0N0C3] 0.978659777 -0.641990011 PITG_03695 Putative uncharacterized protein [Source:UniProtKB/TrEMBL;Acc:D0MYA0] 0.978659777 -0.641990011 PITG_03871 Putative uncharacterized protein [Source:UniProtKB/TrEMBL;Acc:D0MYR3] 0.978659777 -0.641990011 PITG_04483 Putative uncharacterized protein [Source:UniProtKB/TrEMBL;Acc:D0N1D2] 0.978659777 -0.641990011 PITG_04561 Putative uncharacterized protein [Source:UniProtKB/TrEMBL;Acc:D0N1I4] 0.978659777 -0.641990011 PITG_04680 Phosphoinositol transporter [Source:UniProtKB/TrEMBL;Acc:D0N1T0] 0.978659777 -0.641990011

73 PITG_04726 Mitochondrial-processing peptidase subunit alpha, putative [Source:UniProtKB/TrEMBL;Acc:D0N1W9] 0.978659777 -0.641990011 PITG_04736 crinkler (CRN) family protein, pseudogene [Source:BROAD_P_infestans;Acc:PITG_04736] 0.978659777 -0.641990011 PITG_04843 60S ribosomal protein L13 [Source:UniProtKB/TrEMBL;Acc:D0N258] 0.978659777 -0.641990011 PITG_04868 ADP/ATP translocase, putative [Source:UniProtKB/TrEMBL;Acc:D0N283] 0.978659777 -0.641990011 PITG_05211 ATP-binding Cassette (ABC) Superfamily [Source:UniProtKB/TrEMBL;Acc:D0N3T6] 0.978659777 -0.641990011 PITG_05433 STIP-like protein [Source:UniProtKB/TrEMBL;Acc:D0N2T4] 0.978659777 -0.641990011 PITG_05631 Myosin-like protein [Source:UniProtKB/TrEMBL;Acc:D0N3A7] 0.978659777 -0.641990011 PITG_05636 Transaldolase [Source:UniProtKB/TrEMBL;Acc:D0N3B2] 0.978659777 -0.641990011 PITG_06025 Putative uncharacterized protein [Source:UniProtKB/TrEMBL;Acc:D0N691] 0.978659777 -0.641990011 PITG_06491 Transient receptor potential Ca2 channel (TRP-CC) family protein [Source:UniProtKB/TrEMBL;Acc:D0N4Z2] 0.978659777 -0.641990011 PITG_06799 Ribosomal protein L27 [Source:UniProtKB/TrEMBL;Acc:D0N851] 0.978659777 -0.641990011 PITG_07056 Isocitrate dehydrogenase [NADP] [Source:UniProtKB/TrEMBL;Acc:D0N755] 0.978659777 -0.641990011 PITG_07269 60S ribosomal protein L7 [Source:UniProtKB/TrEMBL;Acc:D0N7N5] 0.978659777 -0.641990011 PITG_07274 Mitogen-activated protein kinase [Source:UniProtKB/TrEMBL;Acc:D0N7P0] 0.978659777 -0.641990011 PITG_07296 Nucleolar protein 10, putative [Source:UniProtKB/TrEMBL;Acc:D0N7R1] 0.978659777 -0.641990011 PITG_07882 Putative uncharacterized protein [Source:UniProtKB/TrEMBL;Acc:D0NA20] 0.978659777 -0.641990011 PITG_08440 tRNA (Uracil-5-)-methyltransferase [Source:UniProtKB/TrEMBL;Acc:D0NAM0] 0.978659777 -0.641990011 PITG_08458 Kinesin-like protein [Source:UniProtKB/TrEMBL;Acc:D0NAN4] 0.978659777 -0.641990011 PITG_08701 Putative uncharacterized protein [Source:UniProtKB/TrEMBL;Acc:D0NCZ8] 0.978659777 -0.641990011 PITG_08808 Calcyphosin-like protein [Source:UniProtKB/TrEMBL;Acc:D0ND90] 0.978659777 -0.641990011 PITG_09282 Calcium-transporting ATPase 1, endoplasmic reticulum-type, putative [Source:UniProtKB/TrEMBL;Acc:D0NBB4] 0.978659777 -0.641990011 PITG_09288 Nephrocystin-4-like protein [Source:UniProtKB/TrEMBL;Acc:D0NBC0] 0.978659777 -0.641990011 PITG_09438 Putative uncharacterized protein [Source:UniProtKB/TrEMBL;Acc:D0NC01] 0.978659777 -0.641990011 PITG_09526 Transcription factor BTF3-like protein [Source:UniProtKB/TrEMBL;Acc:D0NC73] 0.978659777 -0.641990011 PITG_09564 Vacuolar protein sorting-associated protein 41 [Source:UniProtKB/TrEMBL;Acc:D0NCA3] 0.978659777 -0.641990011 PITG_10207 Mitochondrial Carrier (MC) Family [Source:UniProtKB/TrEMBL;Acc:D0NEK9] 0.978659777 -0.641990011 PITG_10858 Glycine cleavage system H protein, mitochondrial [Source:UniProtKB/TrEMBL;Acc:D0NH90] 0.978659777 -0.641990011 PITG_10916 Eukaryotic translation initiation factor 3, putative [Source:UniProtKB/TrEMBL;Acc:D0NHD9] 0.978659777 -0.641990011 PITG_10974 Elongation factor 1-gamma, putative [Source:UniProtKB/TrEMBL;Acc:D0NFV6] 0.978659777 -0.641990011

74 PITG_11116 NAD-specific glutamate dehydrogenase, putative [Source:UniProtKB/TrEMBL;Acc:D0NG78] 0.978659777 -0.641990011 PITG_11125 Putative uncharacterized protein [Source:UniProtKB/TrEMBL;Acc:D0NG87] 0.978659777 -0.641990011 PITG_11146 Putative uncharacterized protein [Source:UniProtKB/TrEMBL;Acc:D0NGA6] 0.978659777 -0.641990011 PITG_11524 Serine protease family S10, putative [Source:UniProtKB/TrEMBL;Acc:D0NIZ0] 0.978659777 -0.641990011 PITG_11735 Putative uncharacterized protein [Source:UniProtKB/TrEMBL;Acc:D0NIF7] 0.978659777 -0.641990011 PITG_11766 40S ribosomal protein S3a [Source:UniProtKB/TrEMBL;Acc:D0NIH7] 0.978659777 -0.641990011 PITG_11855 C2 domain-containing protein, putative [Source:UniProtKB/TrEMBL;Acc:D0NHE3] 0.978659777 -0.641990011 PITG_11895 Putative uncharacterized protein [Source:UniProtKB/TrEMBL;Acc:D0NHH4] 0.978659777 -0.641990011 PITG_11906 Proton-dependent Oligopeptide Transporter (POT) Family [Source:UniProtKB/TrEMBL;Acc:D0NHI1] 0.978659777 -0.641990011 PITG_12023 Crinkler (CRN) family protein [Source:UniProtKB/TrEMBL;Acc:D0NHR7] 0.978659777 -0.641990011 PITG_12027 Crinkler (CRN) family protein [Source:UniProtKB/TrEMBL;Acc:D0NHR8] 0.978659777 -0.641990011 PITG_12277 Putative uncharacterized protein [Source:UniProtKB/TrEMBL;Acc:D0NJH0] 0.978659777 -0.641990011 PITG_12433 Putative uncharacterized protein [Source:UniProtKB/TrEMBL;Acc:D0NKI0] 0.978659777 -0.641990011 PITG_12609 Crinkler (CRN) family protein [Source:UniProtKB/TrEMBL;Acc:D0NND8] 0.978659777 -0.641990011 PITG_12882 Electron transfer flavoprotein subunit alpha, mitochondrial [Source:UniProtKB/TrEMBL;Acc:D0NLD7] 0.978659777 -0.641990011 PITG_12961 Alanyl-tRNA synthetase, mitochondrial [Source:UniProtKB/TrEMBL;Acc:D0NJY9] 0.978659777 -0.641990011 PITG_13301 H-or Na-translocating F-type, V-type and A-type ATPase (F-ATPase) Superfamily [Source:UniProtKB/TrEMBL;Acc:D0NLM9] 0.978659777 -0.641990011 PITG_13362 Microtubule-associated protein, putative [Source:UniProtKB/TrEMBL;Acc:D0NLT0] 0.978659777 -0.641990011 PITG_13386 Putative uncharacterized protein [Source:UniProtKB/TrEMBL;Acc:D0NLV2] 0.978659777 -0.641990011 PITG_13763 Flavodoxin-like protein [Source:UniProtKB/TrEMBL;Acc:D0NMR1] 0.978659777 -0.641990011 PITG_14610 Putative uncharacterized protein [Source:UniProtKB/TrEMBL;Acc:D0NQP2] 0.978659777 -0.641990011 PITG_14731 Putative uncharacterized protein [Source:UniProtKB/TrEMBL;Acc:D0NQY8] 0.978659777 -0.641990011 PITG_15270 Putative uncharacterized protein [Source:UniProtKB/TrEMBL;Acc:D0NQB0] 0.978659777 -0.641990011 PITG_15722 60S ribosomal protein L5 [Source:UniProtKB/TrEMBL;Acc:D0NSE8] 0.978659777 -0.641990011 PITG_15863 Putative uncharacterized protein [Source:UniProtKB/TrEMBL;Acc:D0NRX2] 0.978659777 -0.641990011 PITG_15892 Calcium/calmodulin dependent protein kinase, putative [Source:UniProtKB/TrEMBL;Acc:D0NRZ9] 0.978659777 -0.641990011 PITG_16008 40S ribosomal protein S27-like protein [Source:UniProtKB/TrEMBL;Acc:D0NSM9] 0.978659777 -0.641990011 PITG_16058 Putative uncharacterized protein [Source:UniProtKB/TrEMBL;Acc:D0NSS1] 0.978659777 -0.641990011 PITG_17049 ATP-binding Cassette (ABC) Superfamily [Source:UniProtKB/TrEMBL;Acc:D0NUP4] 0.978659777 -0.641990011

75 PITG_17069 Coatomer protein complex, putative [Source:UniProtKB/TrEMBL;Acc:D0NUY3] 0.978659777 -0.641990011 PITG_17093 60S ribosomal protein L24, putative [Source:UniProtKB/TrEMBL;Acc:D0NV06] 0.978659777 -0.641990011 PITG_17287 AP-1 complex subunit beta, putative [Source:UniProtKB/TrEMBL;Acc:D0NVQ0] 0.978659777 -0.641990011 PITG_17926 Putative uncharacterized protein [Source:UniProtKB/TrEMBL;Acc:D0NXA3] 0.978659777 -0.641990011 PITG_18048 Aconitate hydratase, mitochondrial [Source:UniProtKB/TrEMBL;Acc:D0NY26] 0.978659777 -0.641990011 PITG_18161 Putative uncharacterized protein [Source:UniProtKB/TrEMBL;Acc:D0NX58] 0.978659777 -0.641990011 PITG_18962 DNA repair protein, putative [Source:UniProtKB/TrEMBL;Acc:D0NZ76] 0.978659777 -0.641990011 PITG_19419 Putative uncharacterized protein [Source:UniProtKB/TrEMBL;Acc:D0P096] 0.978659777 -0.641990011 PITG_19970 Putative uncharacterized protein [Source:UniProtKB/TrEMBL;Acc:D0P1M8] 0.978659777 -0.641990011 PITG_19999 40S ribosomal protein S14 0.978659777 -0.641990011 PITG_20073 Pyruvate-flavodoxin oxidoreductase, putative [Source:UniProtKB/TrEMBL;Acc:D0P130] 0.978659777 -0.641990011 PITG_20078 Putative uncharacterized protein [Source:UniProtKB/TrEMBL;Acc:D0P135] 0.978659777 -0.641990011 PITG_20718 Putative uncharacterized protein [Source:UniProtKB/TrEMBL;Acc:D0P351] 0.978659777 -0.641990011 PITG_21187 Myoferlin-like protein [Source:UniProtKB/TrEMBL;Acc:D0P399] 0.978659777 -0.641990011 PITG_21540 Resistance-Nodulation-Cell Division (RND) Superfamily [Source:UniProtKB/TrEMBL;Acc:D0P4C6] 0.978659777 -0.641990011 PITG_21846 Putative uncharacterized protein [Source:UniProtKB/TrEMBL;Acc:D0P4N4] 0.978659777 -0.641990011 EPrPING00000001103 tRNA-Lys for anticodon CUU 0.975937984 -0.598950998 EPrPING00000002058 tRNA-Lys for anticodon CUU 0.975937984 -0.598950998 EPrPING00000002909 28s_rRNA 0.975937984 -0.598950998 PITG_02022 Clathrin heavy chain [Source:UniProtKB/TrEMBL;Acc:D0MUN7] 0.975937984 -0.598950998 PITG_10863 60S ribosomal protein L32-1 [Source:UniProtKB/TrEMBL;Acc:D0NH95] 0.955749918 -0.49262554 PITG_16760 Elongation of very long chain fatty acids protein, putative [Source:UniProtKB/TrEMBL;Acc:D0NUU7] 0.955749918 -0.49262554 EPrPING00000007245 Small nucleolar RNA U3 [Source:RFAM;Acc:RF00012] 0.958185094 -0.464905321 930

931

76 932

933 934 Supplementary Table 4. Significant differentially expressed (DE) small ncRNAs found for isolate IMK-1 (clonal lineage US-

935 22).

ID Name prob log2FC EPrPING00000005787 Small nucleolar RNA snR56æ 0.991128877 -2.679917456 EPrPING00000003667 tRNA-Ser for anticodon GCU 0.968662078 -1.745220911 EPrPING00000001572 28s_rRNA 0.968662078 -1.745220911 PITG_08197 Mitochondrial intermediate peptidase, putative 0.968662078 -1.745220911 PITG_11099 60S ribosomal protein L18-2 0.959417743 -1.101449387 EPrPING00000003401 U5 spliceosomal RNA 0.966449158 -1.072671818 EPrPING00000001103 tRNA-Lys for anticodon CUU 0.966449158 -1.072671818 PITG_02053 40S ribosomal protein S8 0.966449158 -1.072671818 PITG_06428 Callose synthase, putative 0.966449158 -1.072671818 PITG_07056 Isocitrate dehydrogenase [NADP] 0.966449158 -1.072671818 PITG_18187 Sulfite reductase [NADPH] subunit beta, putative 0.973798769 -1.025828325 PITG_09020 Putative uncharacterized protein [Source:UniProtKB/TrEMBL;Acc:D0NDR0] 0.973798769 -1.025828325 PITG_13677 Phosphatidylinositol-4-phosphate-5-kinase (PIPK-D7/GPCR-PIPK) [Source:UniProtKB/TrEMBL;Acc:D0NMJ1] 0.987584944 -0.979185884 EPrPING00000005097 Small nucleolar RNA U3 [Source:RFAM;Acc:RF00012] 0.987584944 -0.979185884 EPrPING00000006967 28s_rRNA [Source:RNAMMER;Acc:28s_rRNA] 0.987584944 -0.979185884 EPrPING00000007245 Small nucleolar RNA U3 [Source:RFAM;Acc:RF00012] 0.987584944 -0.979185884 PITG_08809 60S ribosomal protein L12, putative [Source:UniProtKB/TrEMBL;Acc:D0ND91] 0.989799777 -0.914125369 PITG_06722 Elongation factor 1-alpha [Source:UniProtKB/TrEMBL;Acc:D0N1P5] 0.993997463 -0.913935445 EPrPING00000000785 28s_rRNA [Source:RNAMMER;Acc:28s_rRNA] 0.993997463 -0.913935445 EPrPING00000002161 Small nucleolar RNA U3 [Source:RFAM;Acc:RF00012] 0.993997463 -0.913935445 EPrPING00000002851 Eukaryotic type signal recognition particle RNA [Source:RFAM;Acc:RF00017] 0.993997463 -0.913935445 EPrPING00000004708 tRNA-Ser for anticodon GCU [Source:TRNASCAN_SE;Acc:tRNA-Ser] 0.993997463 -0.913935445

77 EPrPING00000006598 Small nucleolar RNA U3 [Source:RFAM;Acc:RF00012] 0.993997463 -0.913935445 PITG_00339 Putative uncharacterized protein [Source:UniProtKB/TrEMBL;Acc:D0MQJ7] 0.993997463 -0.913935445 PITG_00524 Putative uncharacterized protein [Source:UniProtKB/TrEMBL;Acc:D0MR10] 0.993997463 -0.913935445 PITG_00980 Nuclear cap-binding protein subunit, putative [Source:UniProtKB/TrEMBL;Acc:D0MS56] 0.993997463 -0.913935445 PITG_01368 Transmembrane protein, putative [Source:UniProtKB/TrEMBL;Acc:D0MVC5] 0.993997463 -0.913935445 PITG_01650 Putative uncharacterized protein [Source:UniProtKB/TrEMBL;Acc:D0MTR3] 0.993997463 -0.913935445 PITG_03225 Putative uncharacterized protein [Source:UniProtKB/TrEMBL;Acc:D0MZP3] 0.993997463 -0.913935445 PITG_03712 Elongation factor 3, putative [Source:UniProtKB/TrEMBL;Acc:D0MYB4] 0.993997463 -0.913935445 PITG_04668 Polysaccharide lyase, putative [Source:UniProtKB/TrEMBL;Acc:D0N1R9] 0.993997463 -0.913935445 PITG_05171 60S ribosomal protein L44 [Source:UniProtKB/TrEMBL;Acc:D0N3Q1] 0.993997463 -0.913935445 PITG_05615 Pyrophosphate-energized vacuolar membrane proton pump, putative [Source:UniProtKB/TrEMBL;Acc:D0N394] 0.993997463 -0.913935445 PITG_05658 Putative uncharacterized protein [Source:UniProtKB/TrEMBL;Acc:D0N3D2] 0.993997463 -0.913935445 PITG_06237 60S ribosomal protein L8, putative [Source:UniProtKB/TrEMBL;Acc:D0N4E3] 0.993997463 -0.913935445 PITG_06799 Ribosomal protein L27 [Source:UniProtKB/TrEMBL;Acc:D0N851] 0.993997463 -0.913935445 PITG_06995 60S ribosomal protein L4 [Source:UniProtKB/TrEMBL;Acc:D0N700] 0.993997463 -0.913935445 PITG_09430 Trafficking protein particle complex subunit 2, putative [Source:UniProtKB/TrEMBL;Acc:D0NBZ3] 0.993997463 -0.913935445 PITG_10218 Glucan 1,3-beta-glucosidase, putative [Source:UniProtKB/TrEMBL;Acc:D0NEL9] 0.993997463 -0.913935445 PITG_10883 26S proteasome non-ATPase regulatory subunit, putative [Source:UniProtKB/TrEMBL;Acc:D0NHB2] 0.993997463 -0.913935445 PITG_10929 Proteasome subunit alpha type [Source:UniProtKB/TrEMBL;Acc:D0NFS0] 0.993997463 -0.913935445 PITG_10979 Elongation factor 1-gamma, putative [Source:UniProtKB/TrEMBL;Acc:D0NFW0] 0.993997463 -0.913935445 PITG_11249 Heat shock 70 kDa protein [Source:UniProtKB/TrEMBL;Acc:D0NGJ7] 0.993997463 -0.913935445 PITG_14172 Putative uncharacterized protein [Source:UniProtKB/TrEMBL;Acc:D0NNS9] 0.993997463 -0.913935445 PITG_15195 Putative uncharacterized protein [Source:UniProtKB/TrEMBL;Acc:D0NQ54] 0.993997463 -0.913935445 PITG_17516 S-adenosylmethionine synthase [Source:UniProtKB/TrEMBL;Acc:D0NWG8] 0.993997463 -0.913935445 PITG_19871 Cell division control protein 48 [Source:UniProtKB/TrEMBL;Acc:D0P0N7] 0.993997463 -0.913935445 PITG_19999 40S ribosomal protein S14 [Source:UniProtKB/TrEMBL;Acc:D0P1W1] 0.993997463 -0.913935445 PITG_20152 Putative uncharacterized protein [Source:UniProtKB/TrEMBL;Acc:D0P192] 0.993997463 -0.913935445 PITG_20189 60S ribosomal protein L14, putative [Source:UniProtKB/TrEMBL;Acc:D0NSE9] 0.993997463 -0.913935445 PITG_20487 Putative uncharacterized protein [Source:UniProtKB/TrEMBL;Acc:D0P296] 0.993997463 -0.913935445

78 PITG_20970 Triosephosphate isomerase/glyceraldehyde-3-phosphate dehydrogenase, putative [Source:UniProtKB/TrEMBL;Acc:D0P2W7] 0.993880421 -0.896682026 EPrPING00000001280 U5 spliceosomal RNA [Source:RFAM;Acc:RF00020] 0.993880421 -0.896682026 EPrPING00000002266 28s_rRNA [Source:RNAMMER;Acc:28s_rRNA] 0.993880421 -0.896682026 EPrPING00000003074 tRNA-Ser for anticodon GCU [Source:TRNASCAN_SE;Acc:tRNA-Ser] 0.993880421 -0.896682026 EPrPING00000003235 tRNA-Gly for anticodon CCC [Source:TRNASCAN_SE;Acc:tRNA-Gly] 0.993880421 -0.896682026 EPrPING00000003935 U1 spliceosomal RNA [Source:RFAM;Acc:RF00003] 0.993880421 -0.896682026 EPrPING00000004304 Small nucleolar RNA U3 [Source:RFAM;Acc:RF00012] 0.993880421 -0.896682026 EPrPING00000004722 8s_rRNA [Source:RNAMMER;Acc:8s_rRNA] 0.993880421 -0.896682026 EPrPING00000005924 28s_rRNA [Source:RNAMMER;Acc:28s_rRNA] 0.993880421 -0.896682026 EPrPING00000006909 tRNA-Gly for anticodon CCC [Source:TRNASCAN_SE;Acc:tRNA-Gly] 0.993880421 -0.896682026 PITG_00133 Phosphoserine aminotransferase, putative [Source:UniProtKB/TrEMBL;Acc:D0MSZ0] 0.993880421 -0.896682026 PITG_00585 Peroxiredoxin-like protein [Source:UniProtKB/TrEMBL;Acc:D0MR68] 0.993880421 -0.896682026 PITG_00921 Phospholipase D, Pi-PLD-like-1 [Source:UniProtKB/TrEMBL;Acc:D0MS08] 0.993880421 -0.896682026 PITG_01279 Putative uncharacterized protein [Source:UniProtKB/TrEMBL;Acc:D0MV39] 0.993880421 -0.896682026 PITG_01768 DAHP synthase [Source:UniProtKB/TrEMBL;Acc:D0MU15] 0.993880421 -0.896682026 PITG_02532 Ca2 :Cation Antiporter (CaCA) Family [Source:UniProtKB/TrEMBL;Acc:D0MWK2] 0.993880421 -0.896682026 PITG_02729 Chromodomain protein, putative [Source:UniProtKB/TrEMBL;Acc:D0MX27] 0.993880421 -0.896682026 PITG_03454 Putative uncharacterized protein [Source:UniProtKB/TrEMBL;Acc:D0N0B0] 0.993880421 -0.896682026 PITG_03856 Peptidyl-prolyl cis-trans isomerase, putative [Source:UniProtKB/TrEMBL;Acc:D0MYP9] 0.993880421 -0.896682026 PITG_03881 Histone H2A [Source:UniProtKB/TrEMBL;Acc:D0MYS3] 0.993880421 -0.896682026 PITG_04918 Alanyl-tRNA synthetase, putative [Source:UniProtKB/TrEMBL;Acc:D0N2D2] 0.993880421 -0.896682026 PITG_06009 Putative uncharacterized protein [Source:UniProtKB/TrEMBL;Acc:D0N676] 0.993880421 -0.896682026 PITG_06256 Putative uncharacterized protein [Source:UniProtKB/TrEMBL;Acc:D0N4F8] 0.993880421 -0.896682026 PITG_07201 UDP-glucose:glycoprotein glucosyltransferase, putative [Source:UniProtKB/TrEMBL;Acc:D0N7I0] 0.993880421 -0.896682026 PITG_07917 PLAC8 family protein [Source:UniProtKB/TrEMBL;Acc:D0NA52] 0.993880421 -0.896682026 PITG_09034 Putative uncharacterized protein [Source:UniProtKB/TrEMBL;Acc:D0NDS0] 0.993880421 -0.896682026 PITG_09613 Putative uncharacterized protein [Source:UniProtKB/TrEMBL;Acc:D0NCE6] 0.993880421 -0.896682026 PITG_10370 Putative uncharacterized protein [Source:UniProtKB/TrEMBL;Acc:D0NF57] 0.993880421 -0.896682026 PITG_11766 40S ribosomal protein S3a [Source:UniProtKB/TrEMBL;Acc:D0NIH7] 0.993880421 -0.896682026

79 PITG_12084 Crinkler (CRN) family protein, pseudogene [Source:BROAD_P_infestans;Acc:PITG_12084] 0.993880421 -0.896682026 PITG_12122 Proteasome subunit alpha type [Source:UniProtKB/TrEMBL;Acc:D0NJ35] 0.993880421 -0.896682026 PITG_12158 Annexin (Annexin) Family [Source:UniProtKB/TrEMBL;Acc:D0NJ67] 0.993880421 -0.896682026 PITG_12985 Putative uncharacterized protein [Source:UniProtKB/TrEMBL;Acc:D0NK06] 0.993880421 -0.896682026 PITG_14133 Programmed cell death protein, putative [Source:UniProtKB/TrEMBL;Acc:D0NNQ0] 0.993880421 -0.896682026 PITG_15250 Putative uncharacterized protein [Source:UniProtKB/TrEMBL;Acc:D0NQ91] 0.993880421 -0.896682026 PITG_15449 Branched-chain-amino-acid aminotransferase [Source:UniProtKB/TrEMBL;Acc:D0NRA1] 0.993880421 -0.896682026 PITG_15955 Epoxide hydrolase, putative [Source:UniProtKB/TrEMBL;Acc:D0NS42] 0.993880421 -0.896682026 PITG_16669 Transcription factor IIIB, putative [Source:UniProtKB/TrEMBL;Acc:D0NVC1] 0.993880421 -0.896682026 PITG_18170 12-oxophytodienoate reductase, putative [Source:UniProtKB/TrEMBL;Acc:D0NX66] 0.993880421 -0.896682026 PITG_18233 Putative uncharacterized protein [Source:UniProtKB/TrEMBL;Acc:D0NXN6] 0.993880421 -0.896682026 PITG_18414 Phosphoglucomutase [Source:UniProtKB/TrEMBL;Acc:D0NWZ2] 0.993880421 -0.896682026 PITG_18774 Mitochondrial Carrier (MC) FamilyPhosphate carrier protein, putative [Source:UniProtKB/TrEMBL;Acc:D0NVB4] 0.993880421 -0.896682026 PITG_19419 Putative uncharacterized protein [Source:UniProtKB/TrEMBL;Acc:D0P096] 0.993880421 -0.896682026 PITG_20188 60S ribosomal protein L5 [Source:UniProtKB/TrEMBL;Acc:D0P1Y9] 0.993880421 -0.896682026 PITG_23089 Crinkler (CRN) family protein, pseudogene [Source:BROAD_P_infestans;Acc:PITG_23089] 0.993880421 -0.896682026 PITG_23156 Small cysteine rich protein SCR58 [Source:UniProtKB/TrEMBL;Acc:D0P0J3] 0.993880421 -0.896682026 PITG_23351 NA 0.991390619 -0.802232489 EPrPING00000000099 28s_rRNA [Source:RNAMMER;Acc:28s_rRNA] 0.991390619 -0.802232489 EPrPING00000002348 28s_rRNA [Source:RNAMMER;Acc:28s_rRNA] 0.991390619 -0.802232489 PITG_09563 40S ribosomal protein S9-1 [Source:UniProtKB/TrEMBL;Acc:D0NCA2] 0.991390619 -0.802232489 PITG_13500 40S ribosomal protein S4 [Source:UniProtKB/TrEMBL;Acc:D0NM53] 0.993447974 -0.789354986 EPrPING00000005666 U5 spliceosomal RNA [Source:RFAM;Acc:RF00020] 0.970574808 -0.788823362 EPrPING00000006113 tRNA-Lys for anticodon CUU [Source:TRNASCAN_SE;Acc:tRNA-Lys] 0.989908587 -0.78497907 PITG_10941 Elongation factor 2 [Source:UniProtKB/TrEMBL;Acc:D0NFT2] 0.989908587 -0.78497907 PITG_16074 Heat shock protein 101 [Source:UniProtKB/TrEMBL;Acc:D0NST7] 0.987392329 -0.715794847 EPrPING00000000217 tRNA-Gly for anticodon CCC [Source:TRNASCAN_SE;Acc:tRNA-Gly] 0.987392329 -0.715794847 EPrPING00000000452 28s_rRNA [Source:RNAMMER;Acc:28s_rRNA] 0.987392329 -0.715794847 EPrPING00000001881 tRNA-Ser for anticodon GCU [Source:TRNASCAN_SE;Acc:tRNA-Ser] 0.987392329 -0.715794847

80 EPrPING00000005439 tRNA-Gly for anticodon CCC [Source:TRNASCAN_SE;Acc:tRNA-Gly] 0.987392329 -0.715794847 EPrPING00000005574 28s_rRNA [Source:RNAMMER;Acc:28s_rRNA] 0.987392329 -0.715794847 EPrPING00000006839 8s_rRNA [Source:RNAMMER;Acc:8s_rRNA] 0.987392329 -0.715794847 EPrPING00000007210 tRNA-Gly for anticodon CCC [Source:TRNASCAN_SE;Acc:tRNA-Gly] 0.987392329 -0.715794847 PITG_00156 Beta-tubulin [Source:UniProtKB/TrEMBL;Acc:D0MT13] 0.987392329 -0.715794847 PITG_00268 Putative uncharacterized protein [Source:UniProtKB/TrEMBL;Acc:D0MQD4] 0.987392329 -0.715794847 PITG_00804 T-complex protein 1 subunit delta [Source:UniProtKB/TrEMBL;Acc:D0MRQ9] 0.987392329 -0.715794847 PITG_01588 Putative uncharacterized protein [Source:UniProtKB/TrEMBL;Acc:D0MTL1] 0.987392329 -0.715794847 PITG_03419 Flagellar protein, putative [Source:UniProtKB/TrEMBL;Acc:D0N077] 0.987392329 -0.715794847 PITG_03695 Putative uncharacterized protein [Source:UniProtKB/TrEMBL;Acc:D0MYA0] 0.987392329 -0.715794847 PITG_03822 Putative uncharacterized protein [Source:UniProtKB/TrEMBL;Acc:D0MYL7] 0.987392329 -0.715794847 PITG_03967 Putative uncharacterized protein [Source:UniProtKB/TrEMBL;Acc:D0MZ00] 0.987392329 -0.715794847 PITG_04572 Putative uncharacterized protein [Source:UniProtKB/TrEMBL;Acc:D0N1J4] 0.987392329 -0.715794847 PITG_04640 Elongation factor 1-alpha [Source:UniProtKB/TrEMBL;Acc:D0N1P5] 0.987392329 -0.715794847 PITG_04831 Regulator of chromosome condensation (RCC1)-like protein [Source:UniProtKB/TrEMBL;Acc:D0N246] 0.987392329 -0.715794847 PITG_05249 Putative uncharacterized protein [Source:UniProtKB/TrEMBL;Acc:D0N3W7] 0.987392329 -0.715794847 PITG_06415 Heat shock protein 90 [Source:UniProtKB/TrEMBL;Acc:D0N4T6] 0.987392329 -0.715794847 PITG_06639 Protein kinase [Source:UniProtKB/TrEMBL;Acc:D0N5B4] 0.987392329 -0.715794847 PITG_07865 Autophagy-related protein, putative [Source:UniProtKB/TrEMBL;Acc:D0NA05] 0.987392329 -0.715794847 PITG_08744 Long-chain-fatty-acid-CoA ligase [Source:UniProtKB/TrEMBL;Acc:D0ND38] 0.987392329 -0.715794847 PITG_09064 Putative uncharacterized protein [Source:UniProtKB/TrEMBL;Acc:D0NBL8] 0.987392329 -0.715794847 PITG_11047 T-complex protein 1 subunit eta [Source:UniProtKB/TrEMBL;Acc:D0NG21] 0.987392329 -0.715794847 PITG_11110 Eukaryotic translation initiation factor 2 subunit 3 [Source:UniProtKB/TrEMBL;Acc:D0NG72] 0.987392329 -0.715794847 PITG_11143 AP-1 complex subunit gamma-1 [Source:UniProtKB/TrEMBL;Acc:D0NGA4] 0.987392329 -0.715794847 PITG_11329 Annexin (Annexin) Family [Source:UniProtKB/TrEMBL;Acc:D0NIJ7] 0.987392329 -0.715794847 PITG_11457 Phosphoribosylformylglycinamidine synthase [Source:UniProtKB/TrEMBL;Acc:D0NIT8] 0.987392329 -0.715794847 PITG_11755 Putative uncharacterized protein [Source:UniProtKB/TrEMBL;Acc:D0NIG7] 0.987392329 -0.715794847 PITG_12266 Inositol-3,4-bisphosphate 4-phosphatase, putative [Source:UniProtKB/TrEMBL;Acc:D0NJF9] 0.987392329 -0.715794847 PITG_12745 40S ribosomal protein S17, putative [Source:UniProtKB/TrEMBL;Acc:D0NL21] 0.987392329 -0.715794847

81 PITG_12882 Electron transfer flavoprotein subunit alpha, mitochondrial [Source:UniProtKB/TrEMBL;Acc:D0NLD7] 0.987392329 -0.715794847 PITG_14223 Putative uncharacterized protein [Source:UniProtKB/TrEMBL;Acc:D0NNW9] 0.987392329 -0.715794847 PITG_16058 Putative uncharacterized protein [Source:UniProtKB/TrEMBL;Acc:D0NSS1] 0.987392329 -0.715794847 PITG_16069 Heat shock protein 101 [Source:UniProtKB/TrEMBL;Acc:D0NST2] 0.987392329 -0.715794847 PITG_17292 Protein kinase [Source:UniProtKB/TrEMBL;Acc:D0NVQ5] 0.987392329 -0.715794847 PITG_17925 Pentafunctional AROM polypeptide, putative [Source:UniProtKB/TrEMBL;Acc:D0NXA2] 0.987392329 -0.715794847 PITG_17985 Putative uncharacterized protein [Source:UniProtKB/TrEMBL;Acc:D0NXF4] 0.987392329 -0.715794847 PITG_18052 60S ribosomal protein L3 [Source:UniProtKB/TrEMBL;Acc:D0NY29] 0.987392329 -0.715794847 PITG_19017 14-3-3 protein epsilon [Source:UniProtKB/TrEMBL;Acc:D0NYS2] 0.987392329 -0.715794847 PITG_19178 13 kDa ribonucleoprotein-associated protein [Source:UniProtKB/TrEMBL;Acc:D0NZI7] 0.987392329 -0.715794847 PITG_19669 Ubiquitin-like protein/ribosomal protein [Source:UniProtKB/TrEMBL;Acc:D0P0F3] 0.987392329 -0.715794847 PITG_19712 Putative uncharacterized protein [Source:UniProtKB/TrEMBL;Acc:D0P0X9] 0.987392329 -0.715794847 PITG_21010 Eukaryotic translation initiation factor 3 subunit, putative [Source:UniProtKB/TrEMBL;Acc:D0P366] 0.986509401 -0.648151287 EPrPING00000005627 Small nucleolar RNA U3 [Source:RFAM;Acc:RF00012] 0.984901299 -0.630897868 PITG_11116 NAD-specific glutamate dehydrogenase, putative [Source:UniProtKB/TrEMBL;Acc:D0NG78] 0.981166682 -0.584587624 PITG_12887 Putative uncharacterized protein [Source:UniProtKB/TrEMBL;Acc:D0NLE2] 0.972371463 -0.561713645 EPrPING00000002058 tRNA-Lys for anticodon CUU [Source:TRNASCAN_SE;Acc:tRNA-Lys] 0.972371463 -0.561713645 EPrPING00000003651 Small nucleolar RNA U3 [Source:RFAM;Acc:RF00012] 0.972371463 -0.561713645 EPrPING00000004201 28s_rRNA [Source:RNAMMER;Acc:28s_rRNA] 0.972371463 -0.561713645 EPrPING00000004429 tRNA-Leu for anticodon CAG [Source:TRNASCAN_SE;Acc:tRNA-Leu] 0.972371463 -0.561713645 EPrPING00000006271 Small nucleolar RNA U3 [Source:RFAM;Acc:RF00012] 0.972371463 -0.561713645 PITG_00527 Luminal-binding protein 3 [Source:UniProtKB/TrEMBL;Acc:D0MR13] 0.972371463 -0.561713645 PITG_01862 Glucose-6-phosphate isomerase [Source:UniProtKB/TrEMBL;Acc:D0MU98] 0.972371463 -0.561713645 PITG_02371 Putative uncharacterized protein [Source:UniProtKB/TrEMBL;Acc:D0MW63] 0.972371463 -0.561713645 PITG_02857 L-allo-threonine aldolase [Source:UniProtKB/TrEMBL;Acc:D0MXE1] 0.972371463 -0.561713645 PITG_06860 ATP-binding Cassette (ABC) Superfamily [Source:UniProtKB/TrEMBL;Acc:D0N6M4] 0.972371463 -0.561713645 PITG_07088 Major Facilitator Superfamily (MFS) [Source:UniProtKB/TrEMBL;Acc:D0N786] 0.972371463 -0.561713645 PITG_07193 Putative uncharacterized protein [Source:UniProtKB/TrEMBL;Acc:D0N7H4] 0.972371463 -0.561713645 PITG_09241 Putative uncharacterized protein [Source:UniProtKB/TrEMBL;Acc:D0NB78] 0.972371463 -0.561713645

82 PITG_10729 Putative uncharacterized protein [Source:UniProtKB/TrEMBL;Acc:D0NGY4] 0.972371463 -0.561713645 PITG_12912 Phosphatidylinositol transfer protein beta isoform [Source:UniProtKB/TrEMBL;Acc:D0NJU7] 0.972371463 -0.561713645 PITG_13301 H-or Na-translocating F-type, V-type and A-type ATPase (F-ATPase) Superfamily [Source:UniProtKB/TrEMBL;Acc:D0NLM9] 0.972371463 -0.561713645 PITG_15117 Actin-1 [Source:UniProtKB/Swiss-Prot;Acc:P22131] 0.989550395 -0.553135404 PITG_15069 Putative uncharacterized protein [Source:UniProtKB/TrEMBL;Acc:D0NRK6] 0.963744896 -0.515403401 EPrPING00000002096 tRNA-Leu for anticodon CAG [Source:TRNASCAN_SE;Acc:tRNA-Leu] 0.963744896 -0.515403401 PITG_15722 60S ribosomal protein L5 [Source:UniProtKB/TrEMBL;Acc:D0NSE8] 0.963744896 -0.515403401 PITG_19042 Putative uncharacterized protein [Source:UniProtKB/TrEMBL;Acc:D0NZU5] 0.963744896 -0.515403401 PITG_19127 Putative uncharacterized protein [Source:UniProtKB/TrEMBL;Acc:D0NYW7] 0.987820864 -0.483938534 EPrPING00000001536 tRNA-Ser for anticodon GCU [Source:TRNASCAN_SE;Acc:tRNA-Ser] 0.95944711 -0.394400586 936

937

83 938

939 A.

84 940 B.

941

942 Supplementary Figure 1. Expression levels of 12 genes assessed by qPCR in isolate US140120 (clonal lineage US-23). A.

943 Expression level of 11 of the 12 tested genes. ABC: ATP-binding cassette (ABC) Superfamily (PITG_11969), RxLR: Avr2 family

944 secreted RxLR effector peptide protein (PITG_20025), PD: Phospholipase D, Pi-PLD-like-3 (PITG_00923), Zinc: CHP annotated as

945 RING Zinc finger (PITG_02748), TonB: CHP annotated as a TonB receptor (PITG_05795), AAT_I: CHP annotated as part of the

946 AAT_I superfamily (PITG_16256), ATS1-RCC1: CHP annotated as ATS1 alfa tubulin suppresor / RCC1 multidomain

947 (PITG_16013), PCNA: Proliferating Cell Nuclear Antigen (PITG_14397), Myb: Myb-like DNA Binding protein (PITG_19361), HA:

85 948 Histone Arginine demethylase (PITG_19607), Ago: Argonaute 3 (PITG_01400) B. Expression level of gene Gypsy: Gypsy-like

949 retrotransposon GypsyPi-3a (AY830104.1).

950

86 951

952 A.

87 953 B.

954 Supplementary Figure 2. Expression levels of 12 genes assessed by qPCR in isolate IMK-1 (clonal lineage US-22). A.

955 Expression level of 11 of the 12 tested genes. ABC: ATP-binding cassette (ABC) Superfamily (PITG_11969), RxLR: Avr2 family

956 secreted RxLR effector peptide protein (PITG_20025), PD: Phospholipase D, Pi-PLD-like-3 (PITG_00923), Zinc: CHP annotated as

957 RING Zinc finger (PITG_02748), TonB: CHP annotated as a TonB receptor (PITG_05795), AAT_I: CHP annotated as part of the

958 AAT_I superfamily (PITG_16256), ATS1-RCC1: CHP annotated as ATS1 alfa tubulin suppresor / RCC1 multidomain

959 (PITG_16013), PCNA: Proliferating Cell Nuclear Antigen (PITG_14397), Myb: Myb-like DNA Binding protein (PITG_19361), HA:

960 Histone Arginine demethylase (PITG_19607), Ago: Argonaute 3 (PITG_01400) B. Expression level of gene Gypsy: Gypsy-like

961 retrotransposon GypsyPi-3a (AY830104.1).

88 962

963 A.

89 964 B.

965 Supplementary Figure 3. Expression levels of 12 genes assessed by qPCR in isolate RC1#10 (clonal lineage EC-1). A.

966 Expression level of 11 of the 12 tested genes. ABC: ATP-binding cassette (ABC) Superfamily (PITG_11969), RxLR: Avr2 family

967 secreted RxLR effector peptide protein (PITG_20025), PD: Phospholipase D, Pi-PLD-like-3 (PITG_00923), Zinc: CHP annotated as

968 RING Zinc finger (PITG_02748), TonB: CHP annotated as a TonB receptor (PITG_05795), AAT_I: CHP annotated as part of the

969 AAT_I superfamily (PITG_16256), ATS1-RCC1: CHP annotated as ATS1 alfa tubulin suppresor / RCC1 multidomain

970 (PITG_16013), PCNA: Proliferating Cell Nuclear Antigen (PITG_14397), Myb: Myb-like DNA Binding protein (PITG_19361), HA:

90 971 Histone Arginine demethylase (PITG_19607), Ago: Argonaute 3 (PITG_01400) B. Expression level of gene Gypsy: Gypsy-like

972 retrotransposon GypsyPi-3a (AY830104.1).

973

91