DOCSLIB.ORG

Identi Cation of Potential Biomarkers and Pathways

Total Page：16

File Type：pdf, Size：1020Kb

Download full-text PDF Read full-text
Identi Cation of Potential Biomarkers and Pathways Identication of Potential Biomarkers and Pathways in Neonatal Hypoxic-Ischemic Brain Injury: Based on Bioinformatics Technology Shangbin Li The First Hospital of Hebei Medical University Shuangshuang Li Chengdu University of Traditional Chinese Medicine Qian Zhao The First Hospital of Hebei Medical University Jiayu Huang The First Hospital of Hebei Medical University Jinfeng Meng The First Hospital of Hebei Medical University Weichen Yan The First Hospital of Hebei Medical University Jie Wang The First Hospital of Hebei Medical University Changjun Ren ( [email protected] ) The First Hospital of Hebei Medical University Ling Hao The First Hospital of Hebei Medical University Research Article Keywords: neonatal hypoxic-ischemic brain injury, inammatory response, immune response, differentially expressed genes, bioinformatics analysis Posted Date: August 5th, 2021 DOI: https://doi.org/10.21203/rs.3.rs-777916/v1 License: This work is licensed under a Creative Commons Attribution 4.0 International License. Read Full License Page 1/22 Abstract Background Neonatal hypoxic-ischemic brain damage (HIBD) is one of the most common serious diseases in newborns, with a high mortality and disability rate. This study aims to use the bioinformatics analysis to identify potential hematologic/immune systems tissue-specic genes and related signaling pathways neonatal HIBD. Methods Microarray datasets in HIBD were downloaded from the Gene Expression Omnibus database, and DEGs were identied by R software.Enrichment analyses were performed and protein–protein interaction networks were constructed to understand the functions and enriched pathways of DEGs and to identify central genes and key modules. Results In the cerebral cortex tissue with HIBD, 2598 DEGs were identied, including 2362 up-regulated and 236 down-regulated DEGs. In the blood with HIBD, 1442 DEGs were identied, including 540 up-regulated and 902 down-regulated DEGs. The results of biological processes and KEGG enrichment were very similar in DEGs of the two kinds of tissues, and both involved inammation, immunity and apoptosis. The common DEGs of the two kinds of tissues also showed similar results in biological processes and KEGG enrichment.and four hematologic/immune system tissues specically expressed potential biomarker genes were conrmed through a variety of methods, which were veried by GEO datasets and published experimental research. Conclusion The DEGs of HIBD including the potential peripheral biomarkers TYROBP, ITGAM, EGR1 and HMOX1, which may play a role in the pathogenesis of HIBD through inammation and immune-mediated signaling pathways. 1. Introduction Hypoxic ischemic brain injury (HIBD), also known as hypoxic-ischemic encephalopathy (HIE), is one of the most common serious diseases in newborns. In developed countries, HIBD occurs in 1–8 cases per 1,000 live births, and 10–26 cases per 1,000 in low and middle income countries[1–2]. In the long term, HIBD can cause cerebral palsy, epilepsy, visual impairment and motor cognitive impairment[3]. At present, neonatal HIBD is mainly based on the clinical manifestations of the nervous system, imaging and electrophysiological examinations to diagnose and predict prognosis[4]. These methods of diagnosis and prognostic judgment require a long time and cause delay in diagnosis. So that delay in diagnosis oftentimes leads to that many HIBD babies miss the optimal treatment time, which may cause different Page 2/22 levels of neurological sequelae.With the rapid development of biomedicine, there have been many reports on biomarkers related to neonatal HIBD[5]. However, there is no blood-based marker that is stable enough to diagnose HIBD or predict prognosis[6]. Currently, there is still a lack of effective drugs to treat HIBD, and prevention is the key to this disease. In recent years, mild hypothermia neuroprotective therapy has become the standard for clinical treatment of HIBD, and other adjuvant therapies such as erythropoietin and neuroprotective agents are rapidly transitioning from basic science to clinical application[7–8]. However, pharmacological treatments were solely focused on neurons. Gradually, glial cells started to be considered as alternative targets for neuroprotection[9–10]. More and more evidences show that hypoxia-ischemia can induce inammation in the brain parenchyma and peripheral immune system, which plays a vital role in mediating secondary neuronal death[11– 12].The brain is considered a place of immune privilege because the blood-brain barrier restricts blood- borne cells and proteins from entering the central nervous system (CNS)[13].In the central nervous system, microglia, astrocytes, and oligodendrocytes play the roles of inammatory cells and immune cells. There are currently studies that the sequelae of the nervous system are related to the activation of astrocytes[14].The inammatory response of the brain can lead to the activation of astrocytes and the activation and aggregation of microglia to provide immune defense for nerve cells, which can lead to rapid changes in their gene expression[15].The research team of Dr. Ting Qi and Professor Jian Yang found that the blood has genetic targets that can be used to identify brain-related properties (such as IQ) and diseases (such as schizophrenia)[16].This discovery provides a new research idea for brain disease research. Therefore, this study aims to apply the public gene expression comprehensive database (GEO) for bioinformatics analysis to determine the differentially expressed genes (DEGs) in neonatal cerebral cortex tissue and blood.Our research study focused on nding the potential hematologic/immune system tissue specicity gene and related signal pathways that are closely related to HIBD and revealing the underlying molecular mechanisms. 2. Materials And Methods 2.1. Microarray Data The expression prole datasets of HIBD were searched from the publicly available Gene Expression Omnibus (GEO) database (http://www.ncbi.nlm.nih.gov/geo). The microarray datasets generated from the cerebral cortical in rats with HIBD and from the whole blood in human with HIBD and controls were used in the study. Four gene expression proles include GSE37777, GSE18356, GSE121178 and GSE112137 were obtained.The details of the datasets are shown in Table 1. 2.2 Identication of differentially expressed genesDEGs We analyzed the DEGs of healthy and HIBD samples in the cerebral cortex tissue and blood by using the limma software package, especially the raw data of datasets GSE121178 and GSE37777 were extracted Page 3/22 with the affy package and individually normalized with the robust multi-array average (RMA) package, and batch effects were eliminated between experiments by applying the ComBat function in the SVA package. The DEGs cut-off thresholds of both are set as follows: (1) p<0.05; (2) log 2 (FoldChange, FC)> 0.585 or log 2 (FoldChange, FC) <-0.585. 2.3 GO Enrichment and KEGG Pathway Analysis Gene ontology (GO) includes three types of data, namely, cellular components (CC), molecular functions (MF), and biological processes (BP)[17]. GO is often used to annotate genes according to a dened set of structured words. The Kyoto Encyclopedia of Genes and Genomes (KEGG) is used to match the information of gene pathways[18]. We used the DAVID 6.8 (https://david.ncifcrf.gov) online tool[19] to perform GO biological process (GO-BP) analysis on DEGs in HIBD, and use KOBAS 3.0 (http://kobas.cbi.pku.edu.cn/) online tool for KEGG pathway analysis[20]. P<0.05 was selected as the threshold to identify the signicant enrichment of GEGs in GO terms and signal pathways. 2.4 PPI network construction, central genes and key module Analysis The tool for searching gene/protein interactions (STRING: http://string-db.org/) is an online biological database designed to evaluate the protein–protein interaction(PPI) network. Intersecting the DEGs of cerebral cortex tissue and whole blood to obtain a common DEGs. According to the information in the STRING database (PPI score> 0.4), we selected the protein related to the common DEGs (species: Homo), and used the Cytoscape software (http://cytoscape.org/ ) build a PPI network. Then we used ve methods(degree, Maximum Neighborhood Component (MNC), Radiality centrality, Stress centrality, Closeness centrality) to sequence and evaluate central genes . In addition, we used the MCODE algorithm to obtain key modules. 2.5 Validation of central genes and determination of tissue-specic biomarker genes We identied the central genes by using the Genecards database[21]and further determine the genes potentially related to the disease. The central genes was located for further determine the central genes expressed in the hematologic/immune system by using the Biogps database[22].The results obtained from the two databases were integrated to obtain HIBD hematologic/immune system tissue specic biomarker genes. We applied the GSE121137 data set for external verication of tissue-specic genes.Box-plot analysis and receiver operating characteristic(ROC) curve were performed to display tissue-specic genes for external verication of the diagnostic potential of HIBD by using GraphPad Prism8.0 soft. 2.6 Prediction of transcription factors and miRNAs of key central genes The CHEA3 database[23] are used to predict the relationship between key central genes and transcription factors (TF); The mirDIP database[24] was identied to predict the relationship between key central genes Page 4/22 and miRNA.Network analysis was performed by running Cytoscape application,and
Load more

Recommended publications
  • 22 Ultra-Conserved Elements in Vertebrate and Fly Genomes Mathias Drton Nicholas Eriksson Garmay Leung
    22 Ultra-Conserved Elements in Vertebrate and Fly Genomes Mathias Drton Nicholas Eriksson Garmay Leung Ultra-conserved elements in an alignment of multiple genomes are consecutive nucleotides that are in perfect agreement across all the genomes. For aligned vertebrate and fly genomes, we give descriptive statistics of ultra-conserved elements, explain their biological relevance, and show that the existence of ultra-conserved elements is highly improbable in neutrally evolving regions. 22.1 The data Our analyses of ultra-conserved elements are based on multiple sequence align- ments produced by MAVID [Bray and Pachter, 2004]. Prior to the alignment of multiple genomes, homology mappings (from Mercator [Dewey, 2005]) group into bins genomic regions that are anchored together by neighboring homolo- gous exons. A multiple sequence alignment is then produced for each of these alignment bins. MAVID is a global multiple alignment program, and therefore homologous regions with more than one homologous hit to another genome may not be found aligned together. Table 22.1 shows an example of Merca- tor’s output for a single region along with the beginning of the resulting MAVID multiple sequence alignment. Species Chrom. Start End Alignment Dog chrX 752057 864487 + A----AACCAAA--------- Chicken chr1 122119382 122708162 − TGCTGAGCTAAAGATCAGGCT Zebrafish chr9 19018916 19198136 + ------ATGCAACATGCTTCT Pufferfish chr2 7428614 7525502 + ---TAGATGGCAGACGATGCT Fugufish asm1287 21187 82482 + ---TCAAGGG----------- Table 22.1. Mercator output for a single bin, giving the position and orientation on the chromosome. Notice that the Fugu fish genome has not been fully assembled into chromosomes (cf. Section 4.2). The vertebrate dataset consists of 10,279 bins over 9 genomes (Table 22.2).
    [Show full text]
  • Endolysosomal Cation Channels and MITF in Melanocytes and Melanoma
    biomolecules Review Endolysosomal Cation Channels and MITF in Melanocytes and Melanoma Carla Abrahamian and Christian Grimm * Walther Straub Institute of Pharmacology and Toxicology, Faculty of Medicine, Ludwig-Maximilians-University, 80336 Munich, Germany; [email protected] * Correspondence: [email protected] Abstract: Microphthalmia-associated transcription factor (MITF) is the principal transcription fac- tor regulating pivotal processes in melanoma cell development, growth, survival, proliferation, differentiation and invasion. In recent years, convincing evidence has been provided attesting key roles of endolysosomal cation channels, specifically TPCs and TRPMLs, in cancer, including breast cancer, glioblastoma, bladder cancer, hepatocellular carcinoma and melanoma. In this review, we provide a gene expression profile of these channels in different types of cancers and decipher their roles, in particular the roles of two-pore channel 2 (TPC2) and TRPML1 in melanocytes and melanoma. We specifically discuss the signaling cascades regulating MITF and the relationship between endolysosomal cation channels, MAPK, canonical Wnt/GSK3 pathways and MITF. Keywords: TPC; two-pore; lysosome; TPC1; TPC2; TRPML; mucolipin; MCOLN; TRPML1; MITF; melanocytes; melanoma; mTOR; TFEB; calcium Citation: Abrahamian, C.; Grimm, C. 1. Introduction Endolysosomal Cation Channels and Melanocytes are neural-crest derived cells that produce melanin, the primary de- MITF in Melanocytes and Melanoma. terminant of skin color. Melanin is also found in hair, in the iris of the eye, and in the Biomolecules 2021, 11, 1021. https:// stria vascularis of the inner ear and, to a lesser degree, in a broad range of other tissues doi.org/10.3390/biom11071021 throughout the body [1]. There are two major types of melanin called eumelanin (dark, brown, black) and pheomelanin (yellow, red, light brown).
    [Show full text]
  • Association of Gene Ontology Categories with Decay Rate for Hepg2 Experiments These Tables Show Details for All Gene Ontology Categories
    Supplementary Table 1: Association of Gene Ontology Categories with Decay Rate for HepG2 Experiments These tables show details for all Gene Ontology categories. Inferences for manual classification scheme shown at the bottom. Those categories used in Figure 1A are highlighted in bold. Standard Deviations are shown in parentheses. P-values less than 1E-20 are indicated with a "0". Rate r (hour^-1) Half-life < 2hr. Decay % GO Number Category Name Probe Sets Group Non-Group Distribution p-value In-Group Non-Group Representation p-value GO:0006350 transcription 1523 0.221 (0.009) 0.127 (0.002) FASTER 0 13.1 (0.4) 4.5 (0.1) OVER 0 GO:0006351 transcription, DNA-dependent 1498 0.220 (0.009) 0.127 (0.002) FASTER 0 13.0 (0.4) 4.5 (0.1) OVER 0 GO:0006355 regulation of transcription, DNA-dependent 1163 0.230 (0.011) 0.128 (0.002) FASTER 5.00E-21 14.2 (0.5) 4.6 (0.1) OVER 0 GO:0006366 transcription from Pol II promoter 845 0.225 (0.012) 0.130 (0.002) FASTER 1.88E-14 13.0 (0.5) 4.8 (0.1) OVER 0 GO:0006139 nucleobase, nucleoside, nucleotide and nucleic acid metabolism3004 0.173 (0.006) 0.127 (0.002) FASTER 1.28E-12 8.4 (0.2) 4.5 (0.1) OVER 0 GO:0006357 regulation of transcription from Pol II promoter 487 0.231 (0.016) 0.132 (0.002) FASTER 6.05E-10 13.5 (0.6) 4.9 (0.1) OVER 0 GO:0008283 cell proliferation 625 0.189 (0.014) 0.132 (0.002) FASTER 1.95E-05 10.1 (0.6) 5.0 (0.1) OVER 1.50E-20 GO:0006513 monoubiquitination 36 0.305 (0.049) 0.134 (0.002) FASTER 2.69E-04 25.4 (4.4) 5.1 (0.1) OVER 2.04E-06 GO:0007050 cell cycle arrest 57 0.311 (0.054) 0.133 (0.002)
    [Show full text]
  • Role of RUNX1 in Aberrant Retinal Angiogenesis Jonathan D
    Page 1 of 25 Diabetes Identification of RUNX1 as a mediator of aberrant retinal angiogenesis Short Title: Role of RUNX1 in aberrant retinal angiogenesis Jonathan D. Lam,†1 Daniel J. Oh,†1 Lindsay L. Wong,1 Dhanesh Amarnani,1 Cindy Park- Windhol,1 Angie V. Sanchez,1 Jonathan Cardona-Velez,1,2 Declan McGuone,3 Anat O. Stemmer- Rachamimov,3 Dean Eliott,4 Diane R. Bielenberg,5 Tave van Zyl,4 Lishuang Shen,1 Xiaowu Gai,6 Patricia A. D’Amore*,1,7 Leo A. Kim*,1,4 Joseph F. Arboleda-Velasquez*1 Author affiliations: 1Schepens Eye Research Institute/Massachusetts Eye and Ear, Department of Ophthalmology, Harvard Medical School, 20 Staniford St., Boston, MA 02114 2Universidad Pontificia Bolivariana, Medellin, Colombia, #68- a, Cq. 1 #68305, Medellín, Antioquia, Colombia 3C.S. Kubik Laboratory for Neuropathology, Massachusetts General Hospital, 55 Fruit St., Boston, MA 02114 4Retina Service, Massachusetts Eye and Ear Infirmary, Department of Ophthalmology, Harvard Medical School, 243 Charles St., Boston, MA 02114 5Vascular Biology Program, Boston Children’s Hospital, Department of Surgery, Harvard Medical School, 300 Longwood Ave., Boston, MA 02115 6Center for Personalized Medicine, Children’s Hospital Los Angeles, Los Angeles, 4650 Sunset Blvd, Los Angeles, CA 90027, USA 7Department of Pathology, Harvard Medical School, 25 Shattuck St., Boston, MA 02115 Corresponding authors: Joseph F. Arboleda-Velasquez: [email protected] Ph: (617) 912-2517 Leo Kim: [email protected] Ph: (617) 912-2562 Patricia D’Amore: [email protected] Ph: (617) 912-2559 Fax: (617) 912-0128 20 Staniford St. Boston MA, 02114 † These authors contributed equally to this manuscript Word Count: 1905 Tables and Figures: 4 Diabetes Publish Ahead of Print, published online April 11, 2017 Diabetes Page 2 of 25 Abstract Proliferative diabetic retinopathy (PDR) is a common cause of blindness in the developed world’s working adult population, and affects those with type 1 and type 2 diabetes mellitus.
    [Show full text]
  • (12) Patent Application Publication (10) Pub. No.: US 2006/0088532 A1 Alitalo Et Al
    US 20060O88532A1 (19) United States (12) Patent Application Publication (10) Pub. No.: US 2006/0088532 A1 Alitalo et al. (43) Pub. Date: Apr. 27, 2006 (54) LYMPHATIC AND BLOOD ENDOTHELIAL Related U.S. Application Data CELL GENES (60) Provisional application No. 60/363,019, filed on Mar. (76) Inventors: Kari Alitalo, Helsinki (FI); Taija 7, 2002. Makinen, Helsinki (FI); Tatiana Petrova, Helsinki (FI); Pipsa Publication Classification Saharinen, Helsinki (FI); Juha Saharinen, Helsinki (FI) (51) Int. Cl. A6IR 48/00 (2006.01) Correspondence Address: A 6LX 39/395 (2006.01) MARSHALL, GERSTEIN & BORUN LLP A6II 38/18 (2006.01) 233 S. WACKER DRIVE, SUITE 6300 (52) U.S. Cl. .............................. 424/145.1: 514/2: 514/44 SEARS TOWER (57) ABSTRACT CHICAGO, IL 60606 (US) The invention provides polynucleotides and genes that are (21) Appl. No.: 10/505,928 differentially expressed in lymphatic versus blood vascular endothelial cells. These genes are useful for treating diseases (22) PCT Filed: Mar. 7, 2003 involving lymphatic vessels, such as lymphedema, various inflammatory diseases, and cancer metastasis via the lym (86). PCT No.: PCT/USO3FO6900 phatic system. Patent Application Publication Apr. 27, 2006 Sheet 1 of 2 US 2006/0088532 A1 integrin O9 integrin O1 KIAAO711 KAAO644 ApoD Fig. 1 Patent Application Publication Apr. 27, 2006 Sheet 2 of 2 US 2006/0088532 A1 CN g uueleo-gº US 2006/0O88532 A1 Apr. 27, 2006 LYMPHATIC AND BLOOD ENDOTHELLAL CELL lymphatic vessels, such as lymphangiomas or lymphang GENES iectasis. Witte, et al., Regulation of Angiogenesis (eds. Goldber, I. D. & Rosen, E. M.) 65-112 (Birkauser, Basel, BACKGROUND OF THE INVENTION Switzerland, 1997).
    [Show full text]
  • Functional Receptor Molecules Cd300lf and Cd300ld Within the CD300 Family Enable Murine Noroviruses to Infect Cells
    Functional receptor molecules CD300lf and CD300ld within the CD300 family enable murine noroviruses to infect cells Kei Hagaa,1, Akira Fujimotoa,1, Reiko Takai-Todakaa, Motohiro Mikia,b, Yen Hai Doana, Kosuke Murakamia, Masaru Yokoyamac, Kazuyoshi Muratad, Akira Nakanishie,2, and Kazuhiko Katayamaa,2 aDepartment of Virology II, National Institute of Infectious Diseases, Tokyo 208-0011, Japan; bNew Business Planning Division, Innovative Diagnostics Research Center, Denka Innovation Center, Denka Company Limited, Tokyo 194-8560, Japan; cPathogen Genomics Center, National Institute of Infectious Diseases, Tokyo 208-0011, Japan; dNational Institute for Physiological Sciences, Aichi 444-8585, Japan; and eSection of Gene Therapy, Department of Aging Intervention, National Center for Geriatrics and Gerontology, Aichi 474-8511, Japan Edited by Mary K. Estes, Baylor College of Medicine, Houston, Texas, and approved August 11, 2016 (received for review April 9, 2016) Norovirus is the leading cause of acute gastroenteritis worldwide. mice that were deficient in STAT1 and RAG2 (11). MNV repli- Since the discovery of human norovirus (HuNoV), an efficient and cates within the murine macrophage cell line RAW264.7 cells. reproducible norovirus replication system has not been established in MNV strains MNV-1, WU11, and S99 bind macrophages ex vivo cultured cells. Although limited amounts of virus particles can be through a terminal sialic acid on the ganglioside GD1a, which produced when the HuNoV genome is directly transfected into cells, has been suggested as a binding receptor (12). Another MNV the HuNoV cycle of infection has not been successfully reproduced in strain, CR3, binds a different glycan, and the difference in glycan any currently available cell-culture system.
    [Show full text]
  • Functional Receptor Molecules Cd300lf and Cd300ld Within the CD300 Family Enable Murine Noroviruses to Infect Cells
    Functional receptor molecules CD300lf and CD300ld within the CD300 family enable murine noroviruses to infect cells Kei Hagaa,1, Akira Fujimotoa,1, Reiko Takai-Todakaa, Motohiro Mikia,b, Yen Hai Doana, Kosuke Murakamia, Masaru Yokoyamac, Kazuyoshi Muratad, Akira Nakanishie,2, and Kazuhiko Katayamaa,2 aDepartment of Virology II, National Institute of Infectious Diseases, Tokyo 208-0011, Japan; bNew Business Planning Division, Innovative Diagnostics Research Center, Denka Innovation Center, Denka Company Limited, Tokyo 194-8560, Japan; cPathogen Genomics Center, National Institute of Infectious Diseases, Tokyo 208-0011, Japan; dNational Institute for Physiological Sciences, Aichi 444-8585, Japan; and eSection of Gene Therapy, Department of Aging Intervention, National Center for Geriatrics and Gerontology, Aichi 474-8511, Japan Edited by Mary K. Estes, Baylor College of Medicine, Houston, Texas, and approved August 11, 2016 (received for review April 9, 2016) Norovirus is the leading cause of acute gastroenteritis worldwide. mice that were deficient in STAT1 and RAG2 (11). MNV repli- Since the discovery of human norovirus (HuNoV), an efficient and cates within the murine macrophage cell line RAW264.7 cells. reproducible norovirus replication system has not been established in MNV strains MNV-1, WU11, and S99 bind macrophages ex vivo cultured cells. Although limited amounts of virus particles can be through a terminal sialic acid on the ganglioside GD1a, which produced when the HuNoV genome is directly transfected into cells, has been suggested as a binding receptor (12). Another MNV the HuNoV cycle of infection has not been successfully reproduced in strain, CR3, binds a different glycan, and the difference in glycan any currently available cell-culture system.
    [Show full text]
  • Supplementary Figures and Tables
    SUPPLEMENTARY DATA Supplementary Figure 1. Isolation and culture of endothelial cells from surgical specimens of FVM. (A) Representative pre-surgical fundus photograph of a right eye exhibiting a FVM encroaching on the optic nerve (dashed line) causing tractional retinal detachment with blot hemorrhages throughout retina (arrow heads). (B) Magnetic beads (arrows) allow for separation and culturing of enriched cell populations from surgical specimens (scale bar = 100 μm). (C) Cultures of isolated cells stained positively for CD31 representing a successfully isolated enriched population (scale bar = 40 μm). ©2017 American Diabetes Association. Published online at http://diabetes.diabetesjournals.org/lookup/suppl/doi:10.2337/db16-1035/-/DC1 SUPPLEMENTARY DATA Supplementary Figure 2. Efficient siRNA knockdown of RUNX1 expression and function demonstrated by qRT-PCR, Western Blot, and scratch assay. (A) RUNX1 siRNA induced a 60% reduction of RUNX1 expression measured by qRT-PCR 48 hrs post-transfection whereas expression of RUNX2 and RUNX3, the two other mammalian RUNX orthologues, showed no significant changes, indicating specificity of our siRNA. Functional inhibition of Runx1 signaling was demonstrated by a 330% increase in insulin-like growth factor binding protein-3 (IGFBP3) RNA expression level, a known target of RUNX1 inhibition. Western blot demonstrated similar reduction in protein levels. (B) siRNA- 2’s effect on RUNX1 was validated by qRT-PCR and western blot, demonstrating a similar reduction in both RNA and protein. Scratch assay demonstrates functional inhibition of RUNX1 by siRNA-2. ns: not significant, * p < 0.05, *** p < 0.001 ©2017 American Diabetes Association. Published online at http://diabetes.diabetesjournals.org/lookup/suppl/doi:10.2337/db16-1035/-/DC1 SUPPLEMENTARY DATA Supplementary Table 1.
    [Show full text]
  • Brain Region-Dependent Gene Networks Associated with Selective Breeding for Increased Voluntary Wheel-Running Behavior
    UC Riverside UC Riverside Previously Published Works Title Brain region-dependent gene networks associated with selective breeding for increased voluntary wheel-running behavior. Permalink https://escholarship.org/uc/item/8c49g8fd Journal PloS one, 13(8) ISSN 1932-6203 Authors Zhang, Pan Rhodes, Justin S Garland, Theodore et al. Publication Date 2018 DOI 10.1371/journal.pone.0201773 Peer reviewed eScholarship.org Powered by the California Digital Library University of California RESEARCH ARTICLE Brain region-dependent gene networks associated with selective breeding for increased voluntary wheel-running behavior Pan Zhang1,2, Justin S. Rhodes3,4, Theodore Garland, Jr.5, Sam D. Perez3, Bruce R. Southey2, Sandra L. Rodriguez-Zas2,6,7* 1 Illinois Informatics Institute, University of Illinois at Urbana-Champaign, Urbana, IL, United States of America, 2 Department of Animal Sciences, University of Illinois at Urbana-Champaign, Urbana, IL, United a1111111111 States of America, 3 Beckman Institute for Advanced Science and Technology, Urbana, IL, United States of a1111111111 America, 4 Center for Nutrition, Learning and Memory, University of Illinois at Urbana-Champaign, Urbana, a1111111111 IL, United States of America, 5 Department of Evolution, Ecology, and Organismal Biology, University of a1111111111 California, Riverside, CA, United States of America, 6 Department of Statistics, University of Illinois at Urbana-Champaign, Urbana, IL, United States of America, 7 Carle Woese Institute for Genomic Biology, a1111111111 University of Illinois at Urbana-Champaign, Urbana, IL, United States of America * [email protected] OPEN ACCESS Abstract Citation: Zhang P, Rhodes JS, Garland T, Jr., Perez SD, Southey BR, Rodriguez-Zas SL (2018) Brain Mouse lines selectively bred for high voluntary wheel-running behavior are helpful models region-dependent gene networks associated with for uncovering gene networks associated with increased motivation for physical activity and selective breeding for increased voluntary wheel- other reward-dependent behaviors.
    [Show full text]
  • Mitf and Tfe3, Two Members of the Mitf-Tfe Family of Bhlh-Zip Transcription Factors, Have Important but Functionally Redundant Roles in Osteoclast Development
    Mitf and Tfe3, two members of the Mitf-Tfe family of bHLH-Zip transcription factors, have important but functionally redundant roles in osteoclast development Eiri´kur Steingri´msson*†, Lino Tessarollo‡, Bhavani Pathak§¶, Ling Houʈ**, Heinz Arnheiterʈ, Neal G. Copeland§, and Nancy A. Jenkins§ *Department of Biochemistry and Molecular Biology, Faculty of Medicine, University of Iceland, 101 Reykjavik, Iceland; ‡Neural Development Group and §Mouse Cancer Genetics Program, National Cancer Institute, Frederick, MD 21702-1201; and ʈLaboratory of Developmental Neurogenetics, National Institute of Neurological Disorders and Stroke, National Institutes of Health, Bethesda, MD 20892 Communicated by Liane B. Russell, Oak Ridge National Laboratory, Oak Ridge, TN, February 6, 2002 (received for review December 1, 2001) The Mitf-Tfe family of basic helix–loop–helix-leucine zipper (bHLH- neuroepithelial-derived retinal pigment epithelium of the eye, Zip) transcription factors encodes four family members: Mitf, Tfe3, ultimately resulting in microphthalmia, and some Mitf mutations Tfeb, and Tfec. In vitro, each protein in the family can bind DNA as result in a reduction in mast cell numbers. Thus, the Mitf a homo- or heterodimer with other family members. Mutational mutations are pleiotropic, affect many different cell types, and studies in mice have shown that Mitf is essential for melanocyte can be arranged in an allelic series (4). and eye development, whereas Tfeb is required for placental A mutation has been made in the Tfeb gene (TfebFcr) and vascularization. Here, we uncover a role for Tfe3 in osteoclast results in embryonic lethality because of defects in placental development, a role that is functionally redundant with Mitf.
    [Show full text]
  • A Non-Synonymous SNP Within Membrane Metalloendopeptidase-Like 1 (MMEL1) Is Associated with Multiple Sclerosis
    Genes and Immunity (2010) 11, 660–664 & 2010 Macmillan Publishers Limited All rights reserved 1466-4879/10 www.nature.com/gene ORIGINAL ARTICLE A non-synonymous SNP within membrane metalloendopeptidase-like 1 (MMEL1) is associated with multiple sclerosis M Ban1,15, JL McCauley2,15, R Zuvich3,15, A Baker1, L Bergamaschi4, M Cox5, A Kemppinen1, S D’Alfonso4, FR Guerini6, J Lechner-Scott5, F Dudbridge7, J Wason7, NP Robertson8, PL De Jager9,10, DA Hafler11, LF Barcellos12, AJ Ivinson13, D Sexton3, JR Oksenberg14, SL Hauser14, MA Pericak-Vance2, J Haines3, A Compston1 and S Sawcer1 1Department of Clinical Neuroscience, University of Cambridge, Addenbrooke’s Hospital, Cambridge, UK; 2Miami Institute for Human Genomics, University of Miami Miller School of Medicine, Miami, FL, USA; 3Center for Human Genetics Research, Vanderbilt University Medical Center, Nashville, TN, USA; 4Department of Medical Sciences and Interdisciplinary Research Center of Autoimmune Diseases, University of Eastern Piedmont, Novara, Italy; 5University of Newcastle, John Hunter Hospital, Newcastle, New South Wales, Australia; 6Laboratory of Molecular Medicine and Biotechnology, Don C Gnocchi Foundation IRCCS, S Maria Nascente, Milan, Italy; 7MRC Biostatistics Unit, Cambridge, UK; 8Department of Neurology, University Hospital of Wales, Heath Park, Cardiff, UK; 9Program in Translational NeuroPsychiatric Genomics, Center for Neurologic Diseases, Brigham and Women’s Hospital, Harvard Medical School, Boston, MA, USA; 10Broad Institute, Cambridge, MA, USA; 11Department of Neurology, Yale University School of Medicine, New Haven, CT, USA; 12Division of Epidemiology, School of Public Health, University of California at Berkeley, Berkeley, CA, USA; 13Harvard NeuroDiscovery Center, Harvard Medical School, Boston, MA, USA and 14Department of Neurology, University of California San Francisco, San Francisco, CA, USA Several single-nucleotide polymorphism (SNP) genome-wide association studies (GWASs) have been completed in multiple sclerosis (MS).
    [Show full text]
  • Nº Ref Uniprot Proteína Péptidos Identificados Por MS/MS 1 P01024
    Document downloaded from http://www.elsevier.es, day 26/09/2021. This copy is for personal use. Any transmission of this document by any media or format is strictly prohibited. Nº Ref Uniprot Proteína Péptidos identificados 1 P01024 CO3_HUMAN Complement C3 OS=Homo sapiens GN=C3 PE=1 SV=2 por 162MS/MS 2 P02751 FINC_HUMAN Fibronectin OS=Homo sapiens GN=FN1 PE=1 SV=4 131 3 P01023 A2MG_HUMAN Alpha-2-macroglobulin OS=Homo sapiens GN=A2M PE=1 SV=3 128 4 P0C0L4 CO4A_HUMAN Complement C4-A OS=Homo sapiens GN=C4A PE=1 SV=1 95 5 P04275 VWF_HUMAN von Willebrand factor OS=Homo sapiens GN=VWF PE=1 SV=4 81 6 P02675 FIBB_HUMAN Fibrinogen beta chain OS=Homo sapiens GN=FGB PE=1 SV=2 78 7 P01031 CO5_HUMAN Complement C5 OS=Homo sapiens GN=C5 PE=1 SV=4 66 8 P02768 ALBU_HUMAN Serum albumin OS=Homo sapiens GN=ALB PE=1 SV=2 66 9 P00450 CERU_HUMAN Ceruloplasmin OS=Homo sapiens GN=CP PE=1 SV=1 64 10 P02671 FIBA_HUMAN Fibrinogen alpha chain OS=Homo sapiens GN=FGA PE=1 SV=2 58 11 P08603 CFAH_HUMAN Complement factor H OS=Homo sapiens GN=CFH PE=1 SV=4 56 12 P02787 TRFE_HUMAN Serotransferrin OS=Homo sapiens GN=TF PE=1 SV=3 54 13 P00747 PLMN_HUMAN Plasminogen OS=Homo sapiens GN=PLG PE=1 SV=2 48 14 P02679 FIBG_HUMAN Fibrinogen gamma chain OS=Homo sapiens GN=FGG PE=1 SV=3 47 15 P01871 IGHM_HUMAN Ig mu chain C region OS=Homo sapiens GN=IGHM PE=1 SV=3 41 16 P04003 C4BPA_HUMAN C4b-binding protein alpha chain OS=Homo sapiens GN=C4BPA PE=1 SV=2 37 17 Q9Y6R7 FCGBP_HUMAN IgGFc-binding protein OS=Homo sapiens GN=FCGBP PE=1 SV=3 30 18 O43866 CD5L_HUMAN CD5 antigen-like OS=Homo
    [Show full text]