DOCSLIB.ORG

(12) Patent Application Publication (10) Pub. No.: US 2006/0088532 A1 Alitalo Et Al

Total Page：16

File Type：pdf, Size：1020Kb

Download full-text PDF Read full-text
(12) Patent Application Publication (10) Pub. No.: US 2006/0088532 A1 Alitalo Et Al US 20060O88532A1 (19) United States (12) Patent Application Publication (10) Pub. No.: US 2006/0088532 A1 Alitalo et al. (43) Pub. Date: Apr. 27, 2006 (54) LYMPHATIC AND BLOOD ENDOTHELIAL Related U.S. Application Data CELL GENES (60) Provisional application No. 60/363,019, filed on Mar. (76) Inventors: Kari Alitalo, Helsinki (FI); Taija 7, 2002. Makinen, Helsinki (FI); Tatiana Petrova, Helsinki (FI); Pipsa Publication Classification Saharinen, Helsinki (FI); Juha Saharinen, Helsinki (FI) (51) Int. Cl. A6IR 48/00 (2006.01) Correspondence Address: A 6LX 39/395 (2006.01) MARSHALL, GERSTEIN & BORUN LLP A6II 38/18 (2006.01) 233 S. WACKER DRIVE, SUITE 6300 (52) U.S. Cl. .............................. 424/145.1: 514/2: 514/44 SEARS TOWER (57) ABSTRACT CHICAGO, IL 60606 (US) The invention provides polynucleotides and genes that are (21) Appl. No.: 10/505,928 differentially expressed in lymphatic versus blood vascular endothelial cells. These genes are useful for treating diseases (22) PCT Filed: Mar. 7, 2003 involving lymphatic vessels, such as lymphedema, various inflammatory diseases, and cancer metastasis via the lym (86). PCT No.: PCT/USO3FO6900 phatic system. Patent Application Publication Apr. 27, 2006 Sheet 1 of 2 US 2006/0088532 A1 integrin O9 integrin O1 KIAAO711 KAAO644 ApoD Fig. 1 Patent Application Publication Apr. 27, 2006 Sheet 2 of 2 US 2006/0088532 A1 CN g uueleo-gº US 2006/0O88532 A1 Apr. 27, 2006 LYMPHATIC AND BLOOD ENDOTHELLAL CELL lymphatic vessels, such as lymphangiomas or lymphang GENES iectasis. Witte, et al., Regulation of Angiogenesis (eds. Goldber, I. D. & Rosen, E. M.) 65-112 (Birkauser, Basel, BACKGROUND OF THE INVENTION Switzerland, 1997). The VEGFR-3 tyrosine kinase receptor 0001) 1. Field of the Invention is expressed in the normal lymphatic endothelium and is upregulated in many types of vascular tumors, including 0002 The invention relates to polynucleotides and pro Kaposi's sarcomas. Jussila, et al., Cancer Res 58, 1955-1604 teins specifically expressed in lymphatic endothelial cells. (1998); Partanen, et al., Cancer 86:2406-2412 (1999). 0003 2. Description of the Related Art Absence or dysfunction of lymphatic vessels which can result from an infection, Surgery, radiotherapy or from a 0004 Recent evidence on the association of lymphangio genetic defect, causes lymphedema, which is characterized genic growth factors with intralymphatic growth and by a chronic accumulation of protein-rich fluid in the tissues metastasis of cancers (Mandriota, et al., EMBO J. 20:672 that leads to swelling. The importance of VEGFR-3 signal 682 (2001); Skobe, et al., Nat. Med. 7:192-198 (2001): ing for lymphangiogenesis was revealed in the genetics of Stacker, et al., Nat. Med. 7: 186-191 (2001). Karpanen, et familial lymphedema, a disease characterized by a hypopla al., Cancer Res.61:1786-1790 (2001)) has raised hopes that sia of cutaneous lymphatic vessels, which leads to a disfig lymphatic vessels could be used as an additional target for uring and disabling Swelling of the extremities. Witte, et al., tumor therapy. Cancer cells spread within the body by direct Regulation of Angiogenesis (eds. Goldber, I. D. & Rosen, E. invasion to Surrounding tissues, spreading to body cavities, M.) 65-112 (Birkauser, Basel, Switzerland, 1997); Rockson, invasion into the blood vascular system (hematogenous S. G, Am. J. Med. 110, 288-295 (2001). Some members of metastasis), as well as spread via the lymphatic system families with lymphoedema are heterozygous for missense (lymphatic metastasis). Regional lymph node dissemination mutations of the VEGFR3 exons encoding the tyrosine is the first step in the metastasis of several common cancers and correlates highly with the prognosis of the disease. The kinase domain, which results in an inactive receptor protein. lymph nodes that are involved in draining tissue fluid from Karkkainen, et al., Nature Genet. 25:153-159 (2000); the tumor area are called sentinel nodes, and diagnostic Irrthum, et al., Am. J. Hum. Genet. 67:295-301 (2000). measures are in place to find these nodes and to remove them 0007. There is a need in the art for information on the in cases of Suspected metastasis. However, in spite of its transcriptional program which controls the diversity of clinical relevance, little is known about the mechanisms endothelial cells, and into the mechanisms of angiogenesis leading to metastasis via the bloodstream or via the lym and lymphangiogenesis. There is also a need in the art for phatics. new vascular markers, which may be used as valuable targets in the study of a number of diseases involving the 0005. Until recently, the lymphatic vessels have received lymphatic vessels, including tumor metastasis. much less attention than blood vessels, despite their impor tance in medicine. Lymphatic vessels collect protein-rich fluid and white blood cells from the interstitial space of most SUMMARY OF THE INVENTIONTO BE tissues and transport them as a whitish opaque fluid, the REVISED UPON FINALIZATION OF CLAIMS) lymph, into the blood circulation. Small lymphatic vessels 0008. The compositions of the present invention include coalesce into larger vessels, which drain the lymph through isolated polynucleotides, in particular, lymphatic endothelial the thoracic duct into large veins in the neck region. Lymph genes, polypeptides, isolated polypeptides encoded by these nodes serve as filtering stations along the lymphatic vessels polynucleotides, recombinant DNA molecules, cloned genes and lymph movement is propelled by the contraction of or degenerate variants thereof, especially naturally occurring Smooth muscles Surrounding collecting lymphatic vessels variants such as allelic variants, and antibodies that specifi and by bodily movements, the direction of flow being cally recognize one or more epitopes present on Such secured by valves as it is in veins. The lymphatic capillaries polypeptides. are lined by endothelial cells, which have distinct junctions with frequent large interendothelial gaps. The lymphatic 0009. The compositions of the present invention addi capillaries also lack a continuous basement membrane, and tionally include vectors, including expression vectors, con are devoid of pericytes. Anchoring filaments connect the taining the polynucleotides of the invention, cells geneti abluminal surfaces of lymphatic endothelial cells to the cally engineered to contain Such polynucleotides and cells perivascular extracellular matrix and pull to maintain vessel genetically engineered to express such polynucleotides. patency in the presence of tissue edema. The absence or 0010. In selected embodiments, such isolated polynucle obstruction of lymphatic vessels, which is usually the result otides of the invention represent a polynucleotide compris of an infection, Surgery, or radiotherapy and in rare cases, a ing a nucleotide sequence set forth in the sequence listing, genetic defect, causes accumulation of a protein-rich fluid in e.g., any of SEQ ID NOS:1-30. tissues, lymphedema. The lymphatic system is also critical 0011. The polynucleotides of the present invention also in fat absorption from the gut and in immune responses. include, but are not limited to, a polynucleotide that hybrid Bacteria, viruses, and other foreign materials are taken up by izes to the complement of the nucleotide sequence of SEQ the lymphatic vessels and transported to the lymph nodes, ID NOS:1-30 under highly stringent hybridization condi where the foreign material is presented to immune cells and tions; a polynucleotide that hybridizes to the complement of where dendritic cells traverse via the lymphatics. There has the nucleotide sequence of SEQ ID NOS:1-30 under mod been slow progress in the understanding of and ability to erately stringent hybridization conditions; a polynucleotide manipulate the lymphatic vessels. which is an allelic variant of any polynucleotide recited 0006 Abnormal development or function of the lym above; a polynucleotide which encodes a species homologue phatic ECs can result in tumors or malformations of the of any of the proteins recited above; of a polynucleotide that US 2006/0O88532 A1 Apr. 27, 2006 encodes a polypeptide comprising a specific domain or tiguous nucleotides of a sequence selected from the group truncation of the polypeptide encoded by any one of SEQID consisting of SEQID NOS:1-30, 45, 47,49, 51, 82,93, 111, NOS:1-30. Exemplary high stringency hybridization condi 188, 208, 212, 236, 242, 294, and 392, or a complement tions are hybridization at 42°C. for 20 hours in a solution thereof, under the following stringent hybridization condi containing 50% formamide, 5xSSPE, 5x Denhardt’s solu tions: (i) hybridization at 42°C. for 20 hours in a solution tion, 0.1% SDS and 0.1 mg/ml denatured salmon sperm containing 50% formamide, 5xSSPE, 5x Denhardt’s solu DNA, with a wash in 1xSSC, 0.1% SDS for 30 minutes at tion, 0.1% SDS and 0.1 mg/ml denatured salmon sperm 650 C. DNA, and (ii) washing for 30 minutes at 65° C. in 1xSSC, 0.1% SDS; and (b) detecting hybridization of the candidate 0012 Another aspect of the invention is drawn to LEC LEC nucleic acid and the polynucleotide, thereby identify and BEC polypeptides, including polypeptides encoded by ing a LEC nucleic acid. the polynucleotides described above. In some embodiments, the polypeptides are the mature forms of the polypeptides of 0016. The invention also provides a method of identify the invention. Expressly contemplated is a purified and ing a LEC protein comprising: (a) contacting a biological isolated polypeptide
Load more

Recommended publications
  • Wo 2010/075007 A2
    (12) INTERNATIONAL APPLICATION PUBLISHED UNDER THE PATENT COOPERATION TREATY (PCT) (19) World Intellectual Property Organization International Bureau (10) International Publication Number (43) International Publication Date 1 July 2010 (01.07.2010) WO 2010/075007 A2 (51) International Patent Classification: (81) Designated States (unless otherwise indicated, for every C12Q 1/68 (2006.01) G06F 19/00 (2006.01) kind of national protection available): AE, AG, AL, AM, C12N 15/12 (2006.01) AO, AT, AU, AZ, BA, BB, BG, BH, BR, BW, BY, BZ, CA, CH, CL, CN, CO, CR, CU, CZ, DE, DK, DM, DO, (21) International Application Number: DZ, EC, EE, EG, ES, FI, GB, GD, GE, GH, GM, GT, PCT/US2009/067757 HN, HR, HU, ID, IL, IN, IS, JP, KE, KG, KM, KN, KP, (22) International Filing Date: KR, KZ, LA, LC, LK, LR, LS, LT, LU, LY, MA, MD, 11 December 2009 ( 11.12.2009) ME, MG, MK, MN, MW, MX, MY, MZ, NA, NG, NI, NO, NZ, OM, PE, PG, PH, PL, PT, RO, RS, RU, SC, SD, (25) Filing Language: English SE, SG, SK, SL, SM, ST, SV, SY, TJ, TM, TN, TR, TT, (26) Publication Language: English TZ, UA, UG, US, UZ, VC, VN, ZA, ZM, ZW. (30) Priority Data: (84) Designated States (unless otherwise indicated, for every 12/3 16,877 16 December 2008 (16.12.2008) US kind of regional protection available): ARIPO (BW, GH, GM, KE, LS, MW, MZ, NA, SD, SL, SZ, TZ, UG, ZM, (71) Applicant (for all designated States except US): DODDS, ZW), Eurasian (AM, AZ, BY, KG, KZ, MD, RU, TJ, W., Jean [US/US]; 938 Stanford Street, Santa Monica, TM), European (AT, BE, BG, CH, CY, CZ, DE, DK, EE, CA 90403 (US).
    [Show full text]
  • Microgenomics of Ameloblastoma
    RESEARCH REPORTS Biological P. DeVilliers1, C. Suggs2, D. Simmons2, V. Murrah3, and J.T. Wright2* Microgenomics of 1Department of Pathology, University of Alabama at Ameloblastoma Birmingham; 2Department of Pediatric Dentistry, CB #7450, and 3Department of Oral Pathology, University of North Carolina at Chapel Hill, NC 27599, USA; *corresponding author, [email protected] J Dent Res 90(4):463-469, 2011 ABSTRACT INTRODUCTION Gene expression profiles of human ameloblastoma microdissected cells were characterized with the meloblastoma is an aggressive tumor of odontogenic epithelial origin, purpose of identifying genes and their protein Awith devastating morbidity if left untreated, due to its unlimited growth products that could be targeted as diagnostic and potential. It is characterized by a high rate of recurrence (up to 70%, depend- prognostic markers as well as for potential thera- ing on the treatment modality) and potential to undergo malignant transfor- peutic interventions. Five formalin-fixed, decalci- mation and to metastasize (up to 2% of cases). Malignant ameloblastoma is fied, paraffin-embedded samples of ameloblastoma defined as a histologically benign-appearing ameloblastoma with metastasis were subjected to laser capture microdissection, (Goldenberg et al., 2004; Cardoso et al., 2009). Surgical resection is the treat- linear mRNA amplification, and hybridization to ment of choice, which can cause further morbidity to the craniofacial com- oligonucleotide human 41,000 RNA arrays and plex, with loss of function and esthetics (Olasoji and Enwere, 2003). compared with universal human reference RNA, Gene expression profiling of tumor cell populations has advanced our to determine the gene expression signature. understanding of the pathogenesis of human tumors (Naderi et al., 2004).
    [Show full text]
  • 'Kinase-Controlled Phase Transition of Membraneless Organelles In
    Zurich Open Repository and Archive University of Zurich Main Library Strickhofstrasse 39 CH-8057 Zurich www.zora.uzh.ch Year: 2018 Kinase-controlled phase transition of membraneless organelles in mitosis Rai, Arpan Kumar ; Chen, Jia-Xuan ; Selbach, Matthias ; Pelkmans, Lucas Abstract: Liquid–liquid phase separation has been shown to underlie the formation and disassembly of membraneless organelles in cells, but the cellular mechanisms that control this phenomenon are poorly understood. A prominent example of regulated and reversible segregation of liquid phases may occur during mitosis, when membraneless organelles disappear upon nuclear-envelope breakdown and reappear as mitosis is completed. Here we show that the dual-specificity kinase DYRK3 acts as a central dissolvase of several types of membraneless organelle during mitosis. DYRK3 kinase activity is essential to prevent the unmixing of the mitotic cytoplasm into aberrant liquid-like hybrid organelles and the over-nucleation of spindle bodies. Our work supports a mechanism in which the dilution of phase-separating proteins during nuclear-envelope breakdown and the DYRK3-dependent degree of their solubility combine to allow cells to dissolve and condense several membraneless organelles during mitosis. DOI: https://doi.org/10.1038/s41586-018-0279-8 Posted at the Zurich Open Repository and Archive, University of Zurich ZORA URL: https://doi.org/10.5167/uzh-159872 Journal Article Accepted Version Originally published at: Rai, Arpan Kumar; Chen, Jia-Xuan; Selbach, Matthias; Pelkmans,
    [Show full text]
  • 22 Ultra-Conserved Elements in Vertebrate and Fly Genomes Mathias Drton Nicholas Eriksson Garmay Leung
    22 Ultra-Conserved Elements in Vertebrate and Fly Genomes Mathias Drton Nicholas Eriksson Garmay Leung Ultra-conserved elements in an alignment of multiple genomes are consecutive nucleotides that are in perfect agreement across all the genomes. For aligned vertebrate and fly genomes, we give descriptive statistics of ultra-conserved elements, explain their biological relevance, and show that the existence of ultra-conserved elements is highly improbable in neutrally evolving regions. 22.1 The data Our analyses of ultra-conserved elements are based on multiple sequence align- ments produced by MAVID [Bray and Pachter, 2004]. Prior to the alignment of multiple genomes, homology mappings (from Mercator [Dewey, 2005]) group into bins genomic regions that are anchored together by neighboring homolo- gous exons. A multiple sequence alignment is then produced for each of these alignment bins. MAVID is a global multiple alignment program, and therefore homologous regions with more than one homologous hit to another genome may not be found aligned together. Table 22.1 shows an example of Merca- tor’s output for a single region along with the beginning of the resulting MAVID multiple sequence alignment. Species Chrom. Start End Alignment Dog chrX 752057 864487 + A----AACCAAA--------- Chicken chr1 122119382 122708162 − TGCTGAGCTAAAGATCAGGCT Zebrafish chr9 19018916 19198136 + ------ATGCAACATGCTTCT Pufferfish chr2 7428614 7525502 + ---TAGATGGCAGACGATGCT Fugufish asm1287 21187 82482 + ---TCAAGGG----------- Table 22.1. Mercator output for a single bin, giving the position and orientation on the chromosome. Notice that the Fugu fish genome has not been fully assembled into chromosomes (cf. Section 4.2). The vertebrate dataset consists of 10,279 bins over 9 genomes (Table 22.2).
    [Show full text]
  • 1 Supporting Information for a Microrna Network Regulates
    Supporting Information for A microRNA Network Regulates Expression and Biosynthesis of CFTR and CFTR-ΔF508 Shyam Ramachandrana,b, Philip H. Karpc, Peng Jiangc, Lynda S. Ostedgaardc, Amy E. Walza, John T. Fishere, Shaf Keshavjeeh, Kim A. Lennoxi, Ashley M. Jacobii, Scott D. Rosei, Mark A. Behlkei, Michael J. Welshb,c,d,g, Yi Xingb,c,f, Paul B. McCray Jr.a,b,c Author Affiliations: Department of Pediatricsa, Interdisciplinary Program in Geneticsb, Departments of Internal Medicinec, Molecular Physiology and Biophysicsd, Anatomy and Cell Biologye, Biomedical Engineeringf, Howard Hughes Medical Instituteg, Carver College of Medicine, University of Iowa, Iowa City, IA-52242 Division of Thoracic Surgeryh, Toronto General Hospital, University Health Network, University of Toronto, Toronto, Canada-M5G 2C4 Integrated DNA Technologiesi, Coralville, IA-52241 To whom correspondence should be addressed: Email: [email protected] (M.J.W.); yi- [email protected] (Y.X.); Email: [email protected] (P.B.M.) This PDF file includes: Materials and Methods References Fig. S1. miR-138 regulates SIN3A in a dose-dependent and site-specific manner. Fig. S2. miR-138 regulates endogenous SIN3A protein expression. Fig. S3. miR-138 regulates endogenous CFTR protein expression in Calu-3 cells. Fig. S4. miR-138 regulates endogenous CFTR protein expression in primary human airway epithelia. Fig. S5. miR-138 regulates CFTR expression in HeLa cells. Fig. S6. miR-138 regulates CFTR expression in HEK293T cells. Fig. S7. HeLa cells exhibit CFTR channel activity. Fig. S8. miR-138 improves CFTR processing. Fig. S9. miR-138 improves CFTR-ΔF508 processing. Fig. S10. SIN3A inhibition yields partial rescue of Cl- transport in CF epithelia.
    [Show full text]
  • Ten Commandments for a Good Scientist
    Unravelling the mechanism of differential biological responses induced by food-borne xeno- and phyto-estrogenic compounds Ana María Sotoca Covaleda Wageningen 2010 Thesis committee Thesis supervisors Prof. dr. ir. Ivonne M.C.M. Rietjens Professor of Toxicology Wageningen University Prof. dr. Albertinka J. Murk Personal chair at the sub-department of Toxicology Wageningen University Thesis co-supervisor Dr. ir. Jacques J.M. Vervoort Associate professor at the Laboratory of Biochemistry Wageningen University Other members Prof. dr. Michael R. Muller, Wageningen University Prof. dr. ir. Huub F.J. Savelkoul, Wageningen University Prof. dr. Everardus J. van Zoelen, Radboud University Nijmegen Dr. ir. Toine F.H. Bovee, RIKILT, Wageningen This research was conducted under the auspices of the Graduate School VLAG Unravelling the mechanism of differential biological responses induced by food-borne xeno- and phyto-estrogenic compounds Ana María Sotoca Covaleda Thesis submitted in fulfillment of the requirements for the degree of doctor at Wageningen University by the authority of the Rector Magnificus Prof. dr. M.J. Kropff, in the presence of the Thesis Committee appointed by the Academic Board to be defended in public on Tuesday 14 September 2010 at 4 p.m. in the Aula Unravelling the mechanism of differential biological responses induced by food-borne xeno- and phyto-estrogenic compounds. Ana María Sotoca Covaleda Thesis Wageningen University, Wageningen, The Netherlands, 2010, With references, and with summary in Dutch. ISBN: 978-90-8585-707-5 “Caminante no hay camino, se hace camino al andar. Al andar se hace camino, y al volver la vista atrás se ve la senda que nunca se ha de volver a pisar” - Antonio Machado – A mi madre.
    [Show full text]
  • Endolysosomal Cation Channels and MITF in Melanocytes and Melanoma
    biomolecules Review Endolysosomal Cation Channels and MITF in Melanocytes and Melanoma Carla Abrahamian and Christian Grimm * Walther Straub Institute of Pharmacology and Toxicology, Faculty of Medicine, Ludwig-Maximilians-University, 80336 Munich, Germany; [email protected] * Correspondence: [email protected] Abstract: Microphthalmia-associated transcription factor (MITF) is the principal transcription fac- tor regulating pivotal processes in melanoma cell development, growth, survival, proliferation, differentiation and invasion. In recent years, convincing evidence has been provided attesting key roles of endolysosomal cation channels, specifically TPCs and TRPMLs, in cancer, including breast cancer, glioblastoma, bladder cancer, hepatocellular carcinoma and melanoma. In this review, we provide a gene expression profile of these channels in different types of cancers and decipher their roles, in particular the roles of two-pore channel 2 (TPC2) and TRPML1 in melanocytes and melanoma. We specifically discuss the signaling cascades regulating MITF and the relationship between endolysosomal cation channels, MAPK, canonical Wnt/GSK3 pathways and MITF. Keywords: TPC; two-pore; lysosome; TPC1; TPC2; TRPML; mucolipin; MCOLN; TRPML1; MITF; melanocytes; melanoma; mTOR; TFEB; calcium Citation: Abrahamian, C.; Grimm, C. 1. Introduction Endolysosomal Cation Channels and Melanocytes are neural-crest derived cells that produce melanin, the primary de- MITF in Melanocytes and Melanoma. terminant of skin color. Melanin is also found in hair, in the iris of the eye, and in the Biomolecules 2021, 11, 1021. https:// stria vascularis of the inner ear and, to a lesser degree, in a broad range of other tissues doi.org/10.3390/biom11071021 throughout the body [1]. There are two major types of melanin called eumelanin (dark, brown, black) and pheomelanin (yellow, red, light brown).
    [Show full text]
  • Association of Gene Ontology Categories with Decay Rate for Hepg2 Experiments These Tables Show Details for All Gene Ontology Categories
    Supplementary Table 1: Association of Gene Ontology Categories with Decay Rate for HepG2 Experiments These tables show details for all Gene Ontology categories. Inferences for manual classification scheme shown at the bottom. Those categories used in Figure 1A are highlighted in bold. Standard Deviations are shown in parentheses. P-values less than 1E-20 are indicated with a "0". Rate r (hour^-1) Half-life < 2hr. Decay % GO Number Category Name Probe Sets Group Non-Group Distribution p-value In-Group Non-Group Representation p-value GO:0006350 transcription 1523 0.221 (0.009) 0.127 (0.002) FASTER 0 13.1 (0.4) 4.5 (0.1) OVER 0 GO:0006351 transcription, DNA-dependent 1498 0.220 (0.009) 0.127 (0.002) FASTER 0 13.0 (0.4) 4.5 (0.1) OVER 0 GO:0006355 regulation of transcription, DNA-dependent 1163 0.230 (0.011) 0.128 (0.002) FASTER 5.00E-21 14.2 (0.5) 4.6 (0.1) OVER 0 GO:0006366 transcription from Pol II promoter 845 0.225 (0.012) 0.130 (0.002) FASTER 1.88E-14 13.0 (0.5) 4.8 (0.1) OVER 0 GO:0006139 nucleobase, nucleoside, nucleotide and nucleic acid metabolism3004 0.173 (0.006) 0.127 (0.002) FASTER 1.28E-12 8.4 (0.2) 4.5 (0.1) OVER 0 GO:0006357 regulation of transcription from Pol II promoter 487 0.231 (0.016) 0.132 (0.002) FASTER 6.05E-10 13.5 (0.6) 4.9 (0.1) OVER 0 GO:0008283 cell proliferation 625 0.189 (0.014) 0.132 (0.002) FASTER 1.95E-05 10.1 (0.6) 5.0 (0.1) OVER 1.50E-20 GO:0006513 monoubiquitination 36 0.305 (0.049) 0.134 (0.002) FASTER 2.69E-04 25.4 (4.4) 5.1 (0.1) OVER 2.04E-06 GO:0007050 cell cycle arrest 57 0.311 (0.054) 0.133 (0.002)
    [Show full text]
  • Analysis of Pax6 Contiguous Gene Deletions in the Mouse, Mus
    Genetics: Published Articles Ahead of Print, published on May 27, 2009 as 10.1534/genetics.109.104562 Analysis of Pax6 contiguous gene deletions in the mouse, Mus musculus, identifies regions distinct from Pax6 responsible for extreme small eye and belly spotting phenotypes Jack Favor*, Alan Bradley†, Nathalie Conte†, Dirk Janik‡, Walter Pretsch*, Peter Reitmeir§, Michael Rosemann**, Wolfgang Schmahl‡, Johannes Wienberg†† and Irmgard Zaus* Institute of Human Genetics*, Institute of Health Management§, Institute of Radiation Biology**, Helmholtz Zentrum München, German Research Center for Environmental Health, Neuherberg D- 85764, Germany † Wellcome Trust Sanger Institute, Hinxton, Cambridge CB10 1SA, UK ‡ Lehrstuhl für Allgemeine Pathologie und Neuropathologie, Tierärztliche Fakultät, Ludwig-Maximilians-Universität, München D-80539, Germany †† Chrombios GmbH, Raubling D-83064, Germany The mutant allele symbols Del(2)Pax611Neu/1Neu, Del(2)Pax612Neu/2Neu and Del(2)Pax613Neu/3Neu were submitted to and approved by the Mouse Genetic Nomenclature Committee, and assigned the MGI accession ID numbers 3698295, 3698296 and 3710946, respectively. 1 Running head: Mouse Pax6 contiguous gene deletions Key words: Mouse, Pax6, contiguous gene deletions, microphthalmia, belly spotting Corresponding author: Jack Favor Institute of Human Genetics Helmholtz Zentrum München German Research Center for Environmental Health Ingolstädter Lanstr. 1 D-85764 Neuherberg Germany Telephone No. +49-89-3187-2395 FAX No. +49-89-3187-3297 e-mail [email protected]
    [Show full text]
  • Mitf and Tfe3, Two Members of the Mitf-Tfe Family of Bhlh-Zip Transcription Factors, Have Important but Functionally Redundant Roles in Osteoclast Development
    Mitf and Tfe3, two members of the Mitf-Tfe family of bHLH-Zip transcription factors, have important but functionally redundant roles in osteoclast development Eiri´kur Steingri´msson*†, Lino Tessarollo‡, Bhavani Pathak§¶, Ling Houʈ**, Heinz Arnheiterʈ, Neal G. Copeland§, and Nancy A. Jenkins§ *Department of Biochemistry and Molecular Biology, Faculty of Medicine, University of Iceland, 101 Reykjavik, Iceland; ‡Neural Development Group and §Mouse Cancer Genetics Program, National Cancer Institute, Frederick, MD 21702-1201; and ʈLaboratory of Developmental Neurogenetics, National Institute of Neurological Disorders and Stroke, National Institutes of Health, Bethesda, MD 20892 Communicated by Liane B. Russell, Oak Ridge National Laboratory, Oak Ridge, TN, February 6, 2002 (received for review December 1, 2001) The Mitf-Tfe family of basic helix–loop–helix-leucine zipper (bHLH- neuroepithelial-derived retinal pigment epithelium of the eye, Zip) transcription factors encodes four family members: Mitf, Tfe3, ultimately resulting in microphthalmia, and some Mitf mutations Tfeb, and Tfec. In vitro, each protein in the family can bind DNA as result in a reduction in mast cell numbers. Thus, the Mitf a homo- or heterodimer with other family members. Mutational mutations are pleiotropic, affect many different cell types, and studies in mice have shown that Mitf is essential for melanocyte can be arranged in an allelic series (4). and eye development, whereas Tfeb is required for placental A mutation has been made in the Tfeb gene (TfebFcr) and vascularization. Here, we uncover a role for Tfe3 in osteoclast results in embryonic lethality because of defects in placental development, a role that is functionally redundant with Mitf.
    [Show full text]
  • Gene Expression Signatures and Biomarkers of Noninvasive And
    Oncogene (2006) 25, 2328–2338 & 2006 Nature Publishing Group All rights reserved 0950-9232/06 $30.00 www.nature.com/onc ORIGINAL ARTICLE Gene expression signatures and biomarkers of noninvasive and invasive breast cancer cells: comprehensive profiles by representational difference analysis, microarrays and proteomics GM Nagaraja1, M Othman2, BP Fox1, R Alsaber1, CM Pellegrino3, Y Zeng2, R Khanna2, P Tamburini3, A Swaroop2 and RP Kandpal1 1Department of Biological Sciences, Fordham University, Bronx, NY, USA; 2Department of Ophthalmology and Visual Sciences, University of Michigan, Ann Arbor, MI, USA and 3Bayer Corporation, West Haven, CT, USA We have characterized comprehensive transcript and Keywords: representational difference analysis; micro- proteomic profiles of cell lines corresponding to normal arrays; proteomics; breast carcinoma; biomarkers; breast (MCF10A), noninvasive breast cancer (MCF7) and copper homeostasis invasive breast cancer (MDA-MB-231). The transcript profiles were first analysed by a modified protocol for representational difference analysis (RDA) of cDNAs between MCF7 and MDA-MB-231 cells. The majority of genes identified by RDA showed nearly complete con- Introduction cordance withmicroarray results, and also led to the identification of some differentially expressed genes such The transformation of a normal cell into a cancer cell as lysyl oxidase, copper transporter ATP7A, EphB6, has been correlated to altered expression of a variety of RUNX2 and a variant of RUNX2. The altered transcripts genes (Perou et al., 2000; Becker et al., 2005). The identified by microarray analysis were involved in cell–cell expression of some of these genes is a direct result of or cell–matrix interaction, Rho signaling, calcium home- sequence mutation, whereas other changes occur due to ostasis and copper-binding/sensitive activities.
    [Show full text]
  • Rabbit Anti-Human TK1 Polyclonal Antibody (CABT-L2019) This Product Is for Research Use Only and Is Not Intended for Diagnostic Use
    Rabbit Anti-Human TK1 Polyclonal Antibody (CABT-L2019) This product is for research use only and is not intended for diagnostic use. PRODUCT INFORMATION Product Overview Polyclonal Antibody to Thymidine Kinase 1, Soluble (Knockout Validated) Specificity The antibody is a rabbit polyclonal antibody raised against TK1. It has been selected for its ability to recognize TK1 in immunohistochemical staining and western blotting. Target TK1 Immunogen Recombinant fragment corresponding to human TK1 (Ser2~Asn234) Isotype IgG Source/Host Rabbit Species Reactivity Human Purification Antigen-specific affinity chromatography followed by Protein A affinity chromatography Conjugate Unconjugated Applications WB Format Liquid Concentration Lot specific Size 200 μg Buffer Supplied as solution form in 0.01M PBS with 50% glycerol, pH7.4. Preservative 0.05% Proclin-300 Storage Avoid repeated freeze/thaw cycles. Store at 4°C for frequent use. Aliquot and store at -20°C for 12 months. Ship 4°C with ice bags Warnings For research use only. BACKGROUND 45-1 Ramsey Road, Shirley, NY 11967, USA Email: [email protected] Tel: 1-631-624-4882 Fax: 1-631-938-8221 1 © Creative Diagnostics All Rights Reserved Introduction TK1 Belongs to the thymidine kinase family. Keywords TK2;Thymidine kinase, cytosolic GENE INFORMATION Gene Name TK1 thymidine kinase 1, soluble [ Homo sapiens (human) ] Official Symbol TK1 Synonyms TK1; thymidine kinase 1, soluble; TK2; thymidine kinase, cytosolic; thymidine kinase-1; thymidine kinase 1 soluble isoform; Entrez Gene ID 7083
    [Show full text]