DOCSLIB.ORG

Liens De Parenté Entre Cépages

Total Page：16

File Type：pdf, Size：1020Kb

Download full-text PDF Read full-text
Liens De Parenté Entre Cépages Thierry LACOMBE INRA – UMR AGAP – Montpellier Equipe Diversité & Adaptation de la Vigne Liens de parenté entre cépages De nouveaux enseignements sur l’encépagement du Sud-Ouest Les 1ères assises des vins du Sud-Ouest les 10 & 11 décembre 2013 à Toulouse LesLes 1ères « familles assises » des de vins cépages du Sud -Ouest • Une idée ancienne : Roxas-Clemente (1807), Odart (1840), Marès (1890), Andrasovsky (1927), Negrul (1940), Pirovano (1948), Galet (1988) • Sud-Ouest : Levadoux (1948, 1956), Bisson (1999), Lavignac (2001) Carmenets Clarets Cots Courbus Folles Gouais Gras Mansiens 2 Levadoux 1948, 1956 ; Bisson 1999 LesLes 1ères microsatellites assises des vins (ou du SSR) Sud -Ouest • Outils d’investigation génétique • Principe – Sur l’ADN, répétition de motifs constitués d’1, 2, 3 ou 4 bases ex. (A)n, (TC)n, (TAT)n, (GATA)n AGTTCGAGAAACGCCTCCAGAAGACCC • Propriétés TCCATTTTGGTCCGATTGGGAAACCCT – Locus donné TTGGGTTTAAGCAACAGTGAGAGTTGC GGAGAACAGGATCGTTGGCGCACACGC – Polymorphes ACGGCCGCTTCGCCATTGTATGGAGCC – co-dominants TCAAGCAGCGTATTCCATAGCGAGTGG AGGAGAGAGAGAGAGAGAGAGAGAGAG – nombreux dans génome AGTGAGCGCCAAAGAGAGAGGGAGGAG • Utilisations GGGGAGAGTGGTGGCTTTATAGCGAGA AGGATCGAGTTGTACGGACAATATATT – Identification des cépages GGGATGACACCTGTGTAGCACGTGGAG – Etudes de diversité ATCAAGCGTGTGAAGGTTCGCCGGCAG TTCTTTCACTGAA – Sélection assistée par marqueur Exemple du locus VVMD7 – Recherche de parentés 3 LesLes 1ères microsatellites assises des vins (ou du SSR) Sud -Ouest • Utilisation pour valider ou découvrir la parenté des cépages Parents Descendants directs Parents Ex. VVMD5 Bowers et al. 1999 4 LesLes 1ères microsatellites assises des vins (ou du SSR) Sud -Ouest • Exemples de parentés publiées Di Vecchi-Staraz et al. 2007 Boursiquot et al. 2009 Myles et al. 2011 EtudeLes 1ères généalogique assises des vins à grande du Sud -échelleOuest • Collection de Vassal – 2344 cépages analysés • Laboratoire INRA-SupAgro de Montpellier • Publication automne 2012 • Méthodologie : Données historiques likely parent-pairs 2344 20 Logiciel Validation Résultats cépages nSSR FAMOZ Collection likely parents INRA Laucou et al. 2011 Gerber et al. 2003 Données Di Vecchi et al. 2007 phénotypiques Vassal LesGénéalogie 1ères assises des des cépages vins du Sud-Ouest • Aperçu des résultats 2344 Cépages 276 153 1087 828 Non-apparentés Relations indirectes Relations directes Parentés établies (12%) (7%) (46%) (35%) LesGénéalogie 1ères assises des des cépages vins du Sud-Ouest ? • Cépages non-apparentés : 276 cv. ? ? Arbane Asprinio ? Bobal Bogaskere Brustiano Corbeau 26 6 14 Dolcetto 9 Grassen Mancin 27 70 32 Plant d’Arrat 34 Red Globe 20 19 San Antoni 14 Tsolikouri LesGénéalogie 1ères assises des des cépages vins du Sud-Ouest • Relations directes : 1087 cv. Aspiran Cinsaut Aubun Counoise Manseng noir Tannat Muscardin Calitor Poulsard Rèze Robin noir Servanin Savagnin Petit Manseng Vermentino Rossola bianca Marsanne Roussanne LesGénéalogie 1ères assises des des cépages vins du Sud-Ouest • Parentés établies : 828 cv. Parentés : 255 confirmées Données d’hybrideur 126 828 non confirmées Parentés établies 100 publiées confirmées 32 publiées infirmées Cépages traditionnels 315 découvertes LesCaractéristiques 1ères assises des générales vins du Sud -Ouest parentés de 828 cépages • Nombre générations limité • Chevauchements générations LesCaractéristiques 1ères assises des générales vins du Sud -Ouest parentés de 828 cépages • Nombre générations limité • Chevauchements générations • Autofécondations rares 2% LesCaractéristiques 1ères assises des générales vins du Sud -Ouest parentés de 828 cépages • Nombre générations limité TOP 10 Nb. desc. • Chevauchements générations Gouais blanc 63 Muscat d’Alexandrie 60 • Autofécondations rares Chasselas 50 • Principaux géniteurs Pinot 49 Frankenthal 39 Sultanine 35 Muscat de Hambourg 28 Gibi 28 Riesling 27 Ugni blanc 25 LesCabernets, 1ères assises Magdeleine des vins du & Sud Gouais-Ouest + 104 autres cépages européens Morenoa ; Abouriou Bernadou ; Cep rouge ; Tressot ; Txakoli Fer Tarrabassié Plant de Plant de Chalosse noire ; Mérille ; Pedebernade 6 Dubosc 2 Saint-Côme ; Raffiat de Négret pounjut ; Moncade ; Muscadelle ; Négrette ; Plant Jurançon blanc ; Mouyssaguès de Fronton Graisse ; Colombard Gros Cabernet Magdeleine Gouais Négret Sauvignon Crouchen noire des Penouille Prunelard Cabernet franc Charentes blanc du Tarn Cabernet- Cabernet Folle Guignard Carmenère Merlot Milgranet Mourtès Cot Sauvignon goudable blanche de Saintour Camaraou noir Colombaud Castets Merlot Jurançon Bouillet ? Gibert Valdiguié blanc noir 14 LesMansengs 1ères assises & Fer des vins du Sud-Ouest Petit Gros Cabernet Savagnin Manseng Manseng franc Plant de Plant de Bouysselet Cauzette Dubosc 1 Manseng Gros Manseng vert de Lucq Manseng Prunelard Cahours Fer Verjus noir Noual Négret de Négral Malpé Banhars Guillemot Gouais Baral ? Berdomenel Aouillat blanc Cep rouge Bouchalès Gros Crouchen Claverie ; Saint-Macaire 15 Mansois Mauzac noir du Plant de Dubosc 2 Lot-et-Garonne Plant de Facca Raffiat de Tannat Moncade LesCamaralets 1ères assises, Camaraous des vins du & Sud Courbus-Ouest Camaralet Plant de Cabernet Manseng Camaralet Courbu Aouillat femelle Dubosc 2 franc noir Lercat Camaraou Camaraou Camaralet Gros Courbu blanc femelle faux de semis Courbu Camaraou Abouriou Savagnin Arrufiac noir noir Magdeleine noire des Charentes Gros Petit Verdot faux Cabernet Plant de Pedebernade 7 Crouchen Petit Ondenc Castets Lauzet Courbu LesSavagnin, 1ères assises Tressot des &vins Verdots du Sud -Ouest Béquignol Plant de Prunelard Tressot Savagnin Berdomenel Cauzette Blanc Cardon Camaraou noir Petit Manseng Sauvignon Tannat Bouysselet Duras Verdanel + 47 autres cépages d’Autriche, France, Portugal, Espagne Ardonnet Gros Verdot Manseng noir Petit Verdot Plant de Dubosc 2 Gros Manseng Plant de Dubosc 1 Ahumat + 9 autres cépages Petit Verdot de l’Est de la France faux LesConclusions 1ères assises des vins du Sud-Ouest • Géniteurs insoupçonnés • Influences extra-régionales : Gouais, Savagnin & Tressot • Cépages patrimoniaux aujourd’hui disparus du vignoble • Intérêt de la conservation des ressources génétiques Magdeleine noire Tressot des Charentes Manseng noir Courbu 18 Les 1ères assises des vins du Sud-Ouest Remerciements à INRA & Montpellier SupAgro : J-M. BOURSIQUOT, V. LAUCOU, M. DI VECCHI-STARAZ, J-P. PEROS, P. THIS et à IFV Sud-Ouest – V’innopôle : O. YOBREGAT 19 .
Load more

Recommended publications
  • Tannat: Home Away from Home
    feature / vinifera / Tannat TANNAT: HOME AWAY FROM HOME From Tannat’s contested South American debut, back to its origins in southwest France, and forward to its latest outposts in New Zealand, Julia Harding MW charts the rise of this climate-sensitive and terroir- transparent grape variety, now producing a thrilling range of wines orget the tango and dulce de leche, the competitive debate now simmering concerns Tannat’s first home in South America. Those waving the Argentine flag claim that the variety was brought to their country toward the end of the 19th century byF the Basque farmer Juan Jáuregui (born in Irouleguy in 1812), who traveled from Bordeaux to Montevideo in 1835, moving north to Salto before crossing the River Uruguay and settling in Concordia in the province of Entre Ríos in southern Argentina, immediately opposite the Uruguayan town of Salto. According to Alberto Moroy, a specialist in Argentinian and Uruguayan history, writing in Uruguay’s national newspaper El Pais in March 2016, Jáuregui planted the first Tannat cuttings in Concepción in 1861, brought over from France by his nephew Pedro Jáuregui. They apparently came via his paternal grandfather from the estate of Louis XVI. (Moroy’s account is based on a book by Frenchman Alexis Pierre Louis Edouard Peiret, A visit to the Colonies of the Argentine Republic, published in Buenos Airesin 1889.) Jáuregui was also the first to make wine in Concordia. The story continues with another Basque, Don Pascual Harriague (1819–94), who emigrated from Lapurdi (Labourd) to Uruguay in 1838 and settled in Montevideo. In 1840 he moved north to Salto, which is where he became interested in farming and eventually in grape-growing.
    [Show full text]
  • Determining the Classification of Vine Varieties Has Become Difficult to Understand Because of the Large Whereas Article 31
    31 . 12 . 81 Official Journal of the European Communities No L 381 / 1 I (Acts whose publication is obligatory) COMMISSION REGULATION ( EEC) No 3800/81 of 16 December 1981 determining the classification of vine varieties THE COMMISSION OF THE EUROPEAN COMMUNITIES, Whereas Commission Regulation ( EEC) No 2005/ 70 ( 4), as last amended by Regulation ( EEC) No 591 /80 ( 5), sets out the classification of vine varieties ; Having regard to the Treaty establishing the European Economic Community, Whereas the classification of vine varieties should be substantially altered for a large number of administrative units, on the basis of experience and of studies concerning suitability for cultivation; . Having regard to Council Regulation ( EEC) No 337/79 of 5 February 1979 on the common organization of the Whereas the provisions of Regulation ( EEC) market in wine C1), as last amended by Regulation No 2005/70 have been amended several times since its ( EEC) No 3577/81 ( 2), and in particular Article 31 ( 4) thereof, adoption ; whereas the wording of the said Regulation has become difficult to understand because of the large number of amendments ; whereas account must be taken of the consolidation of Regulations ( EEC) No Whereas Article 31 of Regulation ( EEC) No 337/79 816/70 ( 6) and ( EEC) No 1388/70 ( 7) in Regulations provides for the classification of vine varieties approved ( EEC) No 337/79 and ( EEC) No 347/79 ; whereas, in for cultivation in the Community ; whereas those vine view of this situation, Regulation ( EEC) No 2005/70 varieties
    [Show full text]
  • Fps Grape Program Newsletter
    FPS GRAPE PROGRAM NEWSLETTER fps.ucdavis.edu OCT O BER 2012 From the Director: A Fruitful Year of Expansion by Deborah Golino On May 4, 2012, Foundation An ongoing major initiative for Plant Services supporters the FPS grapevine program is celebrated the dedication of the new Foundation Vineyard the Trinchero Family Estates at Russell Ranch. On page Building. We greatly enjoyed 14, Mike Cunningham details having so many stakeholders the vineyard preparations, join us for this special event. vine training and impressive Dean Neal Van Alfen welcomed numbers of qualified grapevines our guests; among them were added in 2012. Such progress Bob and Roger Trinchero In Progress: Trinchero Family Estates Building at FPS attests to the close cooperation representing the Trinchero Photo by Justin Jacobs of each person at FPS across family, donor Francis Mahoney, every function. Funding for this and the family of Pete Christensen, late Viticulture Foundation Vineyard was provided by the National Clean Specialist in the Department of Viticulture and Enology. Plant Network, a major new USDA program that benefits Having this event timed between the National Clean Plant clean plant centers for specialty crops at public institutions. Network Tier II Grapes annual meeting and Rose Day This is the final year of NCPN funding from the current allowed many distant guests to attend, including State farm bill. We hope that this program will continue to back and Federal regulatory officials, scientists from around us up as we fulfill our role as the foundation of registered the country, and many of our client nurseries. Photos of grapevine plants for growers and nurseries.
    [Show full text]
  • Vitis Vinifera L.)
    Theor Appl Genet (2013) 126:401–414 DOI 10.1007/s00122-012-1988-2 ORIGINAL PAPER Large-scale parentage analysis in an extended set of grapevine cultivars (Vitis vinifera L.) Thierry Lacombe • Jean-Michel Boursiquot • Vale´rie Laucou • Manuel Di Vecchi-Staraz • Jean-Pierre Pe´ros • Patrice This Received: 19 June 2012 / Accepted: 15 September 2012 / Published online: 27 September 2012 Ó Springer-Verlag Berlin Heidelberg 2012 Abstract Inheritance of nuclear microsatellite markers cultivars, (2) 100 full parentages confirming results estab- (nSSR) has been proved to be a powerful tool to verify or lished with molecular markers in prior papers and 32 full uncover the parentage of grapevine cultivars. The aim of the parentages that invalidated prior results, (3) 255 full paren- present study was to undertake an extended parentage analysis tages confirming pedigrees as disclosed by the breeders and using a large sample of Vitis vinifera cultivars held in the (4) 126 full parentages that invalidated breeders’ data. Second, INRA ‘‘Domaine de Vassal’’ Grape Germplasm Repository incomplete parentages were determined in 1,087 cultivars due (France). A dataset of 2,344 unique genotypes (i.e. cultivars to the absence of complementary parents in our cultivar without synonyms, clones or mutants) identified using 20 sample. Last, a group of 276 genotypes showed no direct nSSR was analysed with FAMOZ software. Parentages relationship with any other cultivar in the collection. Com- showing a logarithm of odds score higher than 18 were vali- piling these results from the largest set of parentage data dated in relation to the historical data available. The analysis published so far both enlarges and clarifies our knowledge of first revealed the full parentage of 828 cultivars resulting in: the genetic constitution of cultivated V.
    [Show full text]
  • European Commission
    29.9.2020 EN Offi cial Jour nal of the European Union C 321/47 OTHER ACTS EUROPEAN COMMISSION Publication of a communication of approval of a standard amendment to the product specification for a name in the wine sector referred to in Article 17(2) and (3) of Commission Delegated Regulation (EU) 2019/33 (2020/C 321/09) This notice is published in accordance with Article 17(5) of Commission Delegated Regulation (EU) 2019/33 (1). COMMUNICATION OF A STANDARD AMENDMENT TO THE SINGLE DOCUMENT ‘VAUCLUSE’ PGI-FR-A1209-AM01 Submitted on: 2.7.2020 DESCRIPTION OF AND REASONS FOR THE APPROVED AMENDMENT 1. Description of the wine(s) Additional information on the colour of wines has been inserted in point 3.3 ‘Evaluation of the products' organoleptic characteristics’ in order to add detail to the description of the various products. The details in question have also been added to the Single Document under the heading ‘Description of the wine(s)’. 2. Geographical area Point 4.1 of Chapter I of the specification has been updated with a formal amendment to the description of the geographical area. It now specifies the year of the Geographic Code (the national reference stating municipalities per department) in listing the municipalities included in each additional geographical designation. The relevant Geographic Code is the one published in 2019. The names of some municipalities have been corrected but there has been no change to the composition of the geographical area. This amendment does not affect the Single Document. 3. Vine varieties In Chapter I(5) of the specification, the following 16 varieties have been added to those listed for the production of wines eligible for the ‘Vaucluse’ PGI: ‘Artaban N, Assyrtiko B, Cabernet Blanc B, Cabernet Cortis N, Floreal B, Monarch N, Muscaris B, Nebbiolo N, Pinotage N, Prior N, Soreli B, Souvignier Gris G, Verdejo B, Vidoc N, Voltis B and Xinomavro N.’ (1) OJ L 9, 11.1.2019, p.
    [Show full text]
  • 377 Final 2003/0140
    COMMISSION OF THE EUROPEAN COMMUNITIES Brussels, 24.6.2003 COM (2003) 377 final 2003/0140 (ACC) Proposal for a COUNCIL DECISION on the conclusion of an agreement between the European Community and Canada on trade in wines and spirit drinks (presented by the Commission) EXPLANATORY MEMORANDUM 1. This agreement between Canada and the European Community is the result of bilateral negotiations which took place from 7 November 2001 to 24 April 2003 on the basis of a negotiating mandate adopted by the Council on 1 August 2001 (Doc. 11170/01). The agreement comprises arrangements for the reciprocal trade in wines and spirit drinks with a view to creating favourable conditions for its harmonious development. 2. The agreement specifies oenological practices which may be used by producers of wine exported to the other Party, as well as a procedure for accepting new oenological practices. The Community's simplified system of certification will be applied to imported wines originating in Canada. Canada will not introduce import certification for Community wines and will simplify the extent of such testing requirements as are currently applied by provinces, within a year of entry into force. Production standards are agreed for wine made from grapes frozen on the vine. Concerning production standards for spirit drinks, the agreement provides that Canada will adhere to Community standards for its exports of whisky to the Community. 3. Procedures whereby geographical indications relating to wines and spirit drinks of either Party may be protected in the territory of the other Party are agreed. The current "generic" status in Canada of 21 wine names will be ended by the following dates: 31 December 2013 for Chablis, Champagne, Port and Porto, and Sherry; 31 December 2008 for Bourgogne and Burgundy, Rhin and Rhine, and Sauterne and Sauternes; the date of entry into force of the agreement for Bordeaux, Chianti, Claret, Madeira, Malaga, Marsala, Medoc and Médoc, and Mosel and Moselle.
    [Show full text]
  • Présentation Normalisée Pour La Mise En Œuvre Des Décisions Du
    DECISION DU DIRECTEUR GENERAL DE RANCE GRI ER F A M DIRECTION DES INTERVENTIONS SERVICE GESTION DU POTENTIEL ET AMELIORATION DES STRUCTURES VITIVINICOLES 12, RUE ROL-TANGUY INTV-GPASV-2018-32 TSA 20002 93555 MONTREUIL CEDEX Du 18 septembre 2018 DOSSIER SUIVI PAR : SOPHIE PENET COURRIEL : [email protected] PLAN DE DIFFUSION : MISE EN APPLICATION : IMMEDIATE Pour exécution : FranceAgriMer Pour information : DGPE – BUREAU DU VIN ET AUTRES BOISSONS DRAAF CONTROLE GENERAL ECONOMIQUE ET FINANCIER ASSOCIATION DES REGIONS DE FRANCE COLLECTIVITE DE CORSE ORGANISATIONS MEMBRES DU CONSEIL SPECIALISE POUR LA FILIERE VITICOLE Objet : Décision relative aux agréments du plan collectif de restructuration du vignoble du bassin viticole Sud-Ouest et de son porteur de projet et aux critères d’admissibilité pour ce plan déposé en application du programme d’aide national de l’OCM vitivinicole 2019-2023 pour les campagnes 2018-2019 à 2020-2021. Mots-clés : aide, OCM vitivinicole, restructuration, vignes, plantation, plan collectif, bassin viticole, Sud-Ouest. Résumé : La décision du directeur général de FranceAgriMer INTV-GPASV-2018-22 définit le cadre général pour la mise en œuvre des plans collectifs de restructuration du vignoble 2018- 2019 à 2020-2021. Ces plans collectifs font l’objet d’une décision spécifique par bassin viticole qui précise tous les critères autres que ceux figurant dans la décision générale ou dans les décisions de campagne. La présente décision concerne l’agrément de la structure porteuse du projet du plan, l’agrément
    [Show full text]
  • Supplemental Table 2 Results of Seven SSR from 294 Varieties
    Supplemental Data for: Marsal G, Mateo-Sanz JM, Canals JM, Zamora F and Fort F. 2016. SSR analysis of 338 accessions planted in Penedès (Spain) reveals 28 unreported molecular profiles ofVitis vinifera L. Am J Enol Vitic 67:466-470. doi: 10.5344/ajev.2016.16013. Supplemental Table 2 Results of seven SSR from 294 varieties. Prime namea vvs2 vvmd5 vvmd7 vvmd27 vvmd28 zag62 ssrZAG79 Abouriou 130 149 232 232 246 246 179 183 233 243 192 202 251 258 Afus Ali 130 132 224 230 238 248 183 183 234 258 184 186 242 250 Agiorgitiko 140 142 228 236 242 248 174 184 257 257 198 200 247 247 Aglianico 149 154 228 242 238 238 182 187 227 257 186 186 242 244 Ahmeur Bou Ahmeur 132 145 228 234 238 248 181 192 247 253 190 202 246 256 Airen 140 142 224 232 242 252 178 191 233 243 186 198 246 258 Alarije 140 142 230 232 238 238 183 192 234 257 184 186 250 256 Albana 130 140 222 228 246 248 178 186 234 236 192 198 251 251 Aleatico 129 131 222 224 238 248 178 192 236 246 184 194 249 255 Alfrocheiro 140 149 222 234 252 256 177 187 235 247 186 198 251 251 Alicante henri bouschet 130 142 222 234 238 242 177 192 243 259 186 186 243 256 Alvarelhao 129 149 221 225 238 238 182 185 234 258 186 192 250 258 Alvarinho 132 149 218 228 238 238 187 187 233 235 184 202 247 250 Ancellotta 129 153 230 230 238 261 182 186 234 244 190 192 242 245 Angelo Pirovano 132 140 230 232 246 246 183 183 217 243 190 202 239 250 Ansonica 132 140 222 236 238 246 178 182 227 257 186 200 247 250 Aramon noir 130 140 230 230 238 242 180 192 227 259 186 194 243 256 Assyrtiko 130 132 236 236 242 248
    [Show full text]
  • Vitis International Variety Catalogue \(VIVC\)
    BIO Web of Conferences 5, 01009 (2015) DOI: 10.1051/bioconf/20150501009 © Owned by the authors, published by EDP Sciences, 2015 Vitis International Variety Catalogue (VIVC): A cultivar database referenced by genetic profiles and morphology Erika Maul and Reinhard Töpfer Julius Kühn Institut, Institut für Rebenzüchtung Geilweilerhof, 76833 Siebeldingen, Germany Abstract. The establishment of the Vitis International Variety Catalogue (VIVC) dates back to 1984. The idea was to virtually assemble all accessions maintained in the worldwide existing collections to face genetic erosion. In many cases synonymy, homonymy and misnaming hampered the clear assignment of cultivars/accessions to prime names. In the past 15 years nuclear microsatellites, in particular the nine SSR-markers VVS2, VVMD5, VVMD7, VVMD25, VVMD27, VVMD28, VVMD32, VrZAG62 and VrZAG79 were extensively applied for cultivar recognition in combination with ampelography. Genetic fin- gerprints of more than 15,000 cultivars/accessions were collected. They were taken from more than 300 articles and from microsatellite databases on the web. Allele sizes were adapted according to own internal reference varieties. Comparison of profiles revealed new identities like: “Corbeau” = “Sevilhao”, “Gragnelut” = “Fer”, “Beretinjak” = “Bianco d’Alessano”. The activities aim to equip the prime names of VIVC with reliable genetic profiles combined with the validation of their identity by ampelography. Fingerprints from 1,500 cultivars were already uploaded in VIVC. Two distinct search modules were imple- mented: “Microsatellites by varieties” and “Microsatellites by profiles”. The implementation assists the management of grape- vine genetic resources, e.g. trueness to type assessment in grapevine collections and serves research and breeding. Due to the large anthropogenic spread of grapevines it is 1.
    [Show full text]
  • Cépages Principaux, Secondaires, Oubliés… Etat Des Lieux De La Biodiversité Régionale
    Olivier Yobrégat IFV Sud-Ouest Cépages principaux, secondaires, oubliés… Etat des lieux de la biodiversité régionale Les 1ères assises des vins du Sud-Ouest les 10 & 11 décembre 2013 à Toulouse Les 1ères assises des vins du Sud-Ouest Préalables • Cépage autochtone : notion hasardeuse et non fixée Définition : « originaire du pays qu’il habite » A quand faire remonter l’origine (= semis ?) Pour une région donnée, variété née ? / sélectionnée ? / implantée ? / répandue ? / anciennement documentée ? / présente sans interruption de longue date ?... Quid de l’origine (présumée) des parents, lorsqu’ils ont connus ? (ex. Duras = Tressot X Savagnin, cas des descendants du Gouais B…) • Un choix raisonnable : considérer plutôt l’appartenance d’une variété à un patrimoine, une tradition, sur la base d’informations complémentaires : bibliographie, anciens vignobles, échantillons végétaux, recensements, étude des parentés… • Néanmoins, nombreux écueils (antériorité, avancées scientifiques, fiabilité des références anciennes…) 2 La région considérée Les: le Bassin1ères de assises production des vinsSud-Ouest du Sud -Ouest 3 Les 1ères assises des vins du Sud-Ouest Panorama rapide de Vitis vinifera • +/- 6 000 cépages de Vitis vinifera dans le monde • +/- 550 en France – Collections internationales : INRA et IFV – 160 conservatoires dans les régions viticoles • 349 variétés autorisées (Catalogue officiel) – 257 variétés de raisins de cuve (dont 20 HPD, par exemple Baco blanc) – 61 variétés de raisins de table et double fin – 31 porte-greffes • 1
    [Show full text]
  • Sparkling Wine
    “As food and drink lovers we take joy in soaking up new food and drink experiences when we travel. It keeps us excited and feeds us with fresh ideas. In our search for great suppliers, we tend to work with small food and wine producers and craftsmen whose work results in a purity of produce that is fundamental to the creation of a delicious meal. Our wine list at has been carefully chosen by ourselves. When selecting wine we think that “life is too short” so let’s experiment! We prioritise boutique growers that work organically with huge care and little interference, in bio-diverse environments. That enables them to develop delicious natural and rare wines with complex flavours, without the taint of additives or gadgetry. These rare wines, with their unique flavours, aromas and characteristics, enhance and compliment many of Justin’s dishes. It gives us much pleasure to be able to introduce you to a diverse, eclectic range of “natural” vineyards to sit alongside our more regular style wines. We do like to change our wine list by the glass as frequently as our food menu so that you (and we…) can get to know new and interesting wine” - Enjoy Justin & Jurga Sharp We are really loving skin contact whites at the moment. These are white wines that are made like red wines, with the skins present during the fermentation, rather than pressing the juice off before fermentation begins. Skin contact whites are niche, operating outside the fine wine mind-set. We think this could be about to change: these wines are frequently compelling and we don’t know why they don’t enjoy greater support.
    [Show full text]
  • The High Polyphenol Content of Grapevine Cultivar Tannat Berries Is Conferred Primarily by Genes That Are Not Shared with the Reference Genome W
    The Plant Cell, Vol. 25: 4777–4788, December 2013, www.plantcell.org ã 2013 American Society of Plant Biologists. All rights reserved. LARGE-SCALE BIOLOGY ARTICLE The High Polyphenol Content of Grapevine Cultivar Tannat Berries Is Conferred Primarily by Genes That Are Not Shared with the Reference Genome W Cecilia Da Silva,a,1 Gianpiero Zamperin,b,1 Alberto Ferrarini,b Andrea Minio,b Alessandra Dal Molin,b Luca Venturini,b Genny Buson,b Paola Tononi,b Carla Avanzato,b Elisa Zago,b,2 Eduardo Boido,c Eduardo Dellacassa,c Carina Gaggero,a Mario Pezzotti,b Francisco Carrau,c and Massimo Delledonneb,3 a Departamento de Biología Molecular, Instituto de Investigaciones Biológicas Clemente Estable, 11600 Montevideo, Uruguay b Centro di Genomica Funzionale, Dipartimento di Biotecnologie, Universitá degli Studi di Verona, 37134 Verona, Italy c Sección Enología, Facultad de Química, Universidad de la República,11800 Montevideo, Uruguay ORCID IDs: 0000-0002-7100-4581 (M.D.); 0000-0002-8452-3380 (A.F.); 0000-0003-0600-5163 (G.Z.). The grapevine (Vitis vinifera) cultivar Tannat is cultivated mainly in Uruguay for the production of high-quality red wines. Tannat berries have unusually high levels of polyphenolic compounds, producing wines with an intense purple color and remarkable antioxidant properties. We investigated the genetic basis of these important characteristics by sequencing the genome of the Uruguayan Tannat clone UY11 using Illumina technology, followed by a mixture of de novo assembly and iterative mapping onto the PN40024 reference genome. RNA sequencing data for genome reannotation were processed using a combination of reference-guided annotation and de novo transcript assembly, allowing 5901 previously unannotated or unassembled genes to be defined and resulting in the discovery of 1873 genes that were not shared with PN40024.
    [Show full text]