The Role of the Legionella Collagen-Like Protein in Legionella pneumophila Biofilm Formation, Environmental Dissemination and Pathogenicity
by
Mena Abdel-Nour
A thesis submitted in conformity with the requirements for the degree of Masters of Science
Department of Laboratory Medicine and Pathobiology University of Toronto
© Copyright Mena Abdel-Nour (2013)
The Role of the Legionella Collagen-Like Protein in Legionella pneumophila Biofilm Formation, Environmental Dissemination and Pathogenicity
Mena Abdel-Nour
Masters of Science
Department of Laboratory Medicine and Pathobiology University of Toronto 2013
Abstract
The Legionella collagen-like protein (Lcl) of Legionella pneumophila is an adhesin involved in multiple processes during the lifecycle of L. pneumophila. Among these processes is the sedimentation and auto-aggregation of L. pneumophila. Lcl potentiates the infection of amoeba species by facilitating contact and adhesion to its host, allowing the pathogen to replicate, disseminate and persist in the environment. Lcl dependent auto- aggregation requires divalent cations, suggesting it may occur in the natural habitat of L. pneumophila. In addition to its role in sedimentation, Lcl mediates biofilm production of L. pneumophila. The Lcl encoding gene, lpg2644 is polymorphic among clinical isolates, and the number of collagenous repeats is positively correlated to biofilm production and clinical prevalence. This study underscores the role of Lcl in human infection by contributing to environmental dissemination and persistence, thereby increasing the likelihood of encountering human hosts.
ii
Acknowledgments
I would like to acknowledge my supervisor, Dr. Cyril Guyard, for his continuous tutelage in both matters academic and non-academic, without his direction I would not be the scientist I am today.
I would also like to thank Dr. Mauricio Terebiznik, Dr. Alex Ensminger and Dr. Roberto Melano for their continuous support and guidance over the course of my scientific training. They have been instrumental to my learning process, and I am indebted to the help they have given me.
In addition, I would like to thank Carla Duncan and Dr. Mohammed Adil Khan for their valuable advice throughout my training.
iii
Table of Contents Abstract...... ii
Acknowledgments ...... iii
List of Figures ...... vi
List of Appendices...... viii
Chapter 1: Introduction ...... 1
1.1 Legionella pneumophila and legionellosis...... 1 1.2 Protozoa and L. pneumophila biofilm formation...... 4 1.3 Attachment and Physiochemical Determinants of L. pneumophila Biofilm Formation and Colonization...... 6 1.4 Regulation of L. pneumophila Biofilm Formation ...... 8 1.5 The Role of Non‐Protozoa Microbial Species in L. pneumophila Biofilm Colonization...... 11 1.6 The Resistance of L. pneumophila Containing Biofilms to Biocides...... 12 1.7 Auto‐aggregation and Biofilm Production...... 16 1.8 The Role of Lcl in L. pneumophila Adhesion and Virulence ...... 16 1.9 The study...... 18 Chapter 2: The role of Lcl in L. pneumophila auto‐aggregation and host‐phagocyte interactions ...... 19
2.1 Introduction ...... 19 2.2 Materials and Methods...... 20 2.3 Results...... 27 2.4 Discussion...... 55 Chapter 3: The Role of Lcl Collagenous Repeats in L. pneumophila Biofilm Production, Attachment and Adhesion...... 59
3.1 Introduction ...... 59 3.2 Materials and Methods...... 61 3.3 Results...... 69 3.4 Discussion...... 89 4 Conclusion...... 93
References ...... 94
iv
List of Tables
Table 1. L. pneumophila Strains used in Chapter 2.
Table 2. Table 2. Non-L. pneumophila strains used in Chapter 2.
Table 3. The PCR primers used in Chapter 2.
Table 4. L. pneumophila strains used in Chapter 3.
Table 5. PCR primers used in Chapter 3.
Table 6. Comparison of predicted amino acid sequences in Lcl isoforms.
v
List of Figures
Figure 1. Monospecies biofilm of the L. pneumophila lab strain Lp02 stained with the membrane permeable DNA dye Syto62.
Figure 2. Acanthamoeba castellanii infected with Lp02 expressing green fluorescent protein (GFP).
Figure 3. Schematic of the endogenous and environmental factors that influence L. pneumophila (Lp) biofilm production and colonization.
Figure 4. L. pneumophila sediments more efficiently than Legionella non- pneumophila strains.
Figure 5. Lcl is essential for L. pneumophila auto-aggregation.
Figure 6. Divalent cations are required for Lcl dependent auto-aggregation.
Figure 7. Surface exposed Lcl is required for L. pneumophila auto-aggregation.
Figure 8. Lcl alone is sufficient to induce auto-aggregation and biofilm production
Figure 9. Production of Lcl alters E. coli sediment ultrastructure.
Figure 10. Lcl mediates the attachment of L. pneumophila to Acanthamoeba castellanii.
Figure 11. Lcl dependent auto-aggregation potentiates the internalization of L. pneumophila in A. castellanii.
Figure 12. Fucoidan inhibits L. pneumophila sedimentation in a dose dependent manner.
Figure 13. Lcl dependent auto-aggregation increases the number of L. pneumophila per infected A. castellanii
Figure 14. Polymorphisms in the number of lpg2644 collagenous repeats are positively correlated to biofilm production in clinical isolates.
Figure 15. Clinical isolates LU1536, LR1063 and LR0347 contain size polymorphisms in their predicted Lcl sequences.
Figure 16. Schematic representation of the different Lcl isoforms in this study.
Figure 17. The number of Lcl collagenous repeats are correlated with L. pneumophila biofilm production in an isogenic background.
Figure 18. Lcl collagenous repeats impact L. pneumophila-abiotic surface interactions.
vi
Figure 19. Lcl collagenous repeats influence L. pneumophila cell-cell interactions and sedimentation.
Figure 20. Lcl collagenous repeats mediate L. pneumophila biofilm structure.
Figure 21. The number of Lcl collagenous repeats influences fucoidan binding of L. pneumophila and recombinant Lcl.
Figure 22. Lcl collagenous repeats influence L. pneumophila clinical prevalence.
Figure 23. Lcl influences L. pneumophila surface hydrophobicity.
vii
List of Appendices Abbreviations
PFA (Paraformaldehyde)
Mip (Macrophage infectivity potentiator)
Hsp60 (Heat shock protein 60)
GFP (Green Fluorescent protein)
Lp (Legionella pneumophila)
PBS (Phospate Buffered Saline)
c-di-GMP (Cyclic Di-Guanosine Monophosphate)
Lcl (Legionella collagen-like protein)
IPTG (Isopropyl β-D-1-thiogalactopyranoside)
CFU (Colony Forming Units)
CLSM (Confocal Laser Scanning Microscopy)
GAG (Glycosaminoglycan)
BYE (Buffered Yeast Extract)
BCYE (Buffered Charcoal Yeast Extract)
ELISA (Enzyme Linked Immunosorbant Assay)
OD (Optical Density)
SDS-PAGE (Sodium Dodecyl Sulfate Polyacrylimade Gel Electrophoresis)
BSA (Bovine Serum Albumen)
WT (Wild-type)
KO (Knock-out)
PCR (Polymerase Chain Reaction)
qPCR (Quantitative PCR)
viii
ECM (Extracellular Matrix)
MOI (Multiplicity of Infection)
TCA (Trichloroacetic Acid)
LB (Luria Bertani)
SAATs (Self Associating Auto-Transporters)
VBNC (Viable But Non-Culturable)
AHLs (Acylhomoserine Lactones)
AHK (α-Hydroxy Ketones)
Lf (Legionella feeleii)
ix
Chapter 1: Introduction
1.1 Legionella pneumophila and legionellosis.
On July 1976 an outbreak of a severe respiratory ailment of unknown origin occurred at the 58th annual convention of the American Legion in Philadelphia (1). The causative agent was later identified and named Legionella pneumophila, and the associated disease was termed legionellosis (2-4). Legionellosis has two different clinical manifestations based on the symptoms that are elicited. The mild form is known as Pontiac fever and the more severe condition is called Legionnaires’ disease with a case fatality ranging from 5-80% (5). Although other species of Legionella have been linked to disease, Legionella pneumophila is responsible for approximately 91.5% of legionellosis cases and is a significant contributor of community acquired and hospital acquired pneumonia (5, 6). Furthermore, in the United States and Canada, the number of reported cases has substantially increased in recent years (7). Most diagnoses of legionellosis are established with the use of a urine antigen test, however the sensitivity of these tests has recently been called into question (8, 9).
L. pneumophila is an aquatic pathogen that is ubiquitously found in nature, in both anthropogenic structures and in environmental waters (10-14). In addition, L. pneumophila is able to produce monospecies biofilms in vitro (Fig. 1.) that contain a visible extracellular matrix (15, 16).
Widespread persistence of L. pneumophila in the environment is due to the ability of this organism to occupy a number of different ecological habitats. One of these habitats is
1
multispecies biofilm which L. pneumophila is able to colonize. In naturally occurring
multispecies biofilms, the colonization with L. pneumophila can be influenced by several other species of microorganisms (17, 18). Of these microorganisms, protozoa are arguably one of the most important in determining L. pneumophila persistence, as the pathogen uses protozoa to replicate intracellularly (19). Co-evolution with multiple species of protozoa is believed to result in the development of mechanisms that allow L. pneumophila to occupy a very broad host range, and to infect human cells (20-22). Growth of Legionella in biofilms may lead to enhanced virulence. L. pneumophila isolates from serogroups 1, 10 and 12 that were collected from biofilms were shown to be more cytotoxic towards amoeba than reference outbreak and worldwide epidemic strains (23). Moreover, initial data suggests that biofilm-derived Legionella pneumophila evades the innate immune response in macrophages (24). Importantly, legionellosis is not transmitted from person to person, therefore insights into the ecology of L. pneumophila may yield information that can be used to prevent infections, by hindering L. pneumophila maintenance in biofilms.
2
Figure 1. L. pneumophila can produce monospecies biofilms. A three day old monospecies biofilm produced by the L. pneumophila lab strain Lp02 grown on a glass chambered coverslip and stained with the membrane permeable DNA dye Syto62. Scale bar represents 100μm.
3
1.2 Protozoa and L. pneumophila biofilm formation.
Protozoa play a crucial role in the lifecycle of Legionella species as they are the natural
environmental hosts of the bacteria (19, 25-28) .In biofilm communities, amoeba species have been found associated with L. pneumophila (29). To feed, protozoan species often graze on bacteria present in multispecies biofilms, a phenomenon that L. pneumophila exploits in order to replicate intracellularly (Fig. 2.) (30, 31). As a consequence, the presence of protozoa in anthropogenic water sources has been deemed a risk factor for L. pneumophila outbreaks (30). In fact the amount of L. pneumophila in biofilms has been shown to be directly correlated with the biomass of protozoa (32). This is in accordance with in vitro models showing that the presence of amoeba species promotes the biofilm formation of L. pneumophila on pins of “inverse” microtiter plates (33). L. pneumophila is also capable of growing off the debris from dead amoebae, thus amoeba may also encourage the replication of L. pneumophila indirectly (34).
Floating biofilms also contain protozoa in association with L. pneumophila suggesting that L.
pneumophila – protozoa interactions may promote colonization in the absence of available
abiotic surfaces (35, 36). In addition to the role of protozoa as a means of replication, the
intracellular stage of L. pneumophila provides protection from environmental stressors (37, 38)
including biocides used to disinfect water systems (39, 40). Indeed, biofilms produced with L.
pneumophila in the presence of thermotolerant amoebae allow L. pneumophila to persist after
heat treatment (41), demonstrating that amoebae can provide a protective niche for L.
pneumophila (37).
4
Figure 2. L.pneumophila uses protozoa to replicate. Acanthamoeba castellanii infected with Lp02 expressing green fluorescent protein (GFP). Infections were performed with an MOI (multiplicity of infection) of 50. A. castellanii were fixed 2 hours post-inoculation for imaging. Scale bar represents 10μm.
5
1.3 Attachment and Physiochemical Determinants of L. pneumophila Biofilm Formation and Colonization.
When producing surface associated biofilms, attachment serves as an initial crucial step, whether
it is on biotic or abiotic surfaces. Although L. pneumophila can often be found attached to
various surfaces in the environment, colonization of existing biofilms in addition to attachment
to abiotic substrates is determined by a wide variety of parameters (Fig. 3.) (42). One important
factor that governs the adherence of L. pneumophila in anthropogenic water systems is the
composition of the surface material to which the bacteria are adhering (43). L. pneumophila can
adhere well to several different plastics that are commonly used in plumbing, whereas copper
inhibits the attachment of the bacteria (43-45). It remains unclear, however whether this is due to
differences in surface - L. pneumophila interactions or if it is because different plumbing materials select for different pioneering species. These pioneering microbial species may establish initial biofilms that L. pneumophila colonizes afterwards, which may have different properties, subsequently influencing the colonization of L. pneumophila.
Cations have been implicated in the attachment of bacteria to different substrata, and can contribute to biofouling (46). Similarly, both calcium and magnesium have been demonstrated to facilitate the attachment of L. pneumophila to abiotic surfaces (47). Elevated zinc, magnesium and manganese levels are correlated with increased L. pneumophila contamination and zinc increases the ability of L. pneumophila to bind to human lung epithelial cells (48-50).
Interestingly as it pertains to the cation dependent attachment of L. pneumophila, an orthologue of the Pseudomonas fluorescens calcium-dependent cyclic di-GMP (c-di-GMP) regulated protease LapG was identified in L. pneumophila. LapG regulates biofilm formation of
6
Pseudomonas fluorescens by cleaving the surface adhesin LapA required for biofilm formation
(51, 52) .
In addition to the presence of cations, the availability of carbon has also been shown to
influence the colonization of biofilms with L. pneumophila, with increasing concentrations
favouring L. pneumophila colonization, presumably because it provides nutrients for the bacteria
to replicate (53). Notably, the increase in biofilm production due to carbon has only been
reported at 20°C, suggesting that carbon may only influence biofilm production at certain
temperatures (54). Temperature is also an important determinant for L. pneumophila biofilm
colonization. Studies have shown that heating water above 55°C can reduce the detectable
amount of L. pneumophila in water systems even in the presence of organic carbon sources,
however this may be due to a decrease in other biofilm species which may serve as a platform for
L. pneumophila colonization (55, 56).
Static and flow conditions of water have been demonstrated to be crucial determinants of
biofilm formation and biofilm colonization with L. pneumophila in water systems. Stagnation of
water in distribution systems seems to favour colonization with L. pneumophila (57). Moreover,
Legionnaires’ disease cases have been linked to stagnant water in hospital settings (58). In
accordance with these data, a constant flow in anthropogenic water can decrease the presence of
L. pneumophila through the use of Venturi systems, presumably by preventing the initial
attachment of the bacteria to surfaces (59). But even under turbulent flow conditions, biofilms in
aquatic environments can persist (60,,61) and maintain a population of L. pneumophila (62). To
explain the persistence of L. pneumophila under turbulent flow, it was proposed that the bacteria
can localize to the sediment where it is less affected by turbulence (63, 64), and interestingly
sedimentation has recently been linked to quorum sensing (65, 66).
7
Although there have been exhaustive research efforts in determining the physiochemical
parameters that allow L. pneumophila to colonize and form biofilms, little is known regarding
the L. pneumophila molecular factors that contribute directly to this process. The Legionella
collagen-like protein (Lcl) was initially identified as an adhesin required for infection of
protozoa and macrophages (67). Subsequently Lcl was found to be an important mediator of L.
pneumophila biofilm formation (68). Lcl facilitates biofilm production by promoting attachment
to abiotic substrates as well as cell-cell/cell-matrix interactions (69). In addition to Lcl, type IV
pili was initially implicated in L. pneumophila biofilm colonization based in its role in adherence
to protozoan cells (70). Yet, a site directed type IV pili mutant was shown to colonize biofilms as
well as wild-type bacteria (71). In addition to surface exposed adhesins, the twin arginine
transport (Tat) secretion system has also been implicated in biofilm formation. Deletion of the tatB and tatC genes resulted in a significant reduction in biofilm formation, however the specific role that this secretion system plays is unknown (72).
1.4 Regulation of L. pneumophila Biofilm Formation
For L. pneumophila, as well as for other microorganisms, biofilm formation is an environmental
response that can promote survival. To determine if biofilm production is an appropriate
response, there are several environmental cues which can greatly influence biofilm formation.
One important environmental prompt is iron, which has important roles in the growth of many
organisms, and can influence L. pneumophila replication (73). The addition of lactoferrin, an
iron chelator, can directly kill L. pneumophil demonstrating the importance of iron in L.
pneumophila viability (74). Furthermore, bacterial ferrous iron transport promotes the
intracellular replication of L. pneumophila in protozoa which may influence multispecies biofilm
8
formation and colonization, as adherence factors are often regulated by cell density (75). Iron is also required for the production of melanin and it is believed that deletion of the lbtA and lbtB genes which encode iron siderophores prevent growth within aquatic biofilms (73). Interestingly, although iron is essential for biofilm formation, high iron concentrations can inhibit biofilm formation, yet to date the reasons for this are unknown (15).
The ability of bacteria to monitor and respond to cell density is known as quorum sensing and it is a crucial process during biofilm production. Among quorum sensing molecules, α-hydroxy ketones (AHKs) have been identified in L. pneumophila, and are similar to the AHKs produced by Vibrio cholera (76, 77). These molecules regulate a wide variety of traits including virulence, extracellular filament production and sedimentation through the lqs gene cluster which encodes for the AHK synthase LqsA, the AHK sensor LqsS and the response regulator LqsR (65, 78, 79).
In addition to the products of this gene cluster, an orphan sensor kinase named LqsT regulates competence, a process that is elevated in biofilm formation (66).
The second-messenger molecule cyclic di-GMP (c-di-GMP) is also an important signalling factor that allows bacteria to respond to environmental changes (80). L. pneumophila has 22 predicted genes related to c-di-GMP production, degradation and/or recognition (81). One of these genes, lpg1057, was found to encode an enzyme responsible for the production of cyclic di-GMP which promotes biofilm formation, and is the only c-di-GMP related gene to date found to directly influence monospecies biofilm production of L. pneumophila (82). In response to amino acid starvation, the alarmone guanosine tetraphosphate (ppGpp) can also regulate L.
pneumophila gene expression (83). Although the ppGpp system has only been linked to the
regulation of virulence related traits, this system may indirectly effect environmental biofilm
production by influencing L. pneumophila -amoeba interactions. In addition, sensitivity to ppGpp
9
signalling requires the sigma factor RpoS (84). RpoS in turn influences LqsR expression, suggesting that virulence related traits regulated by AHKs require multiple environmental signals
(85). In parallel with the ppGpp-RpoS regulation of virulence, downstream is the two component system Let A/Let S (86). The Let A/Let S system relieves the repression of virulence related genes by the RNA binding protein CsrA (87). Despite the initially suspected roles of these transcriptional regulators in surface attachment and biofilm formation, none of the mutants lacking rpoS, letA or csrA were affected in biofilm formation (33). Of the known L. pneumophila sigma factors, to date only the flagellar sigma factor FliA has been implicated in the regulation of biofilm production and deletion of fliA results in a decrease in biofilm formation, however it is unclear what downstream or upstream factors are involved in this process (33).
Temperature was mentioned above as being an important determinant for biofilm formation (55,
56). In addition, temperature can regulate the properties of the biofilms produced by L. pneumophila (88). Monospecies biofilms produced in vitro at 37-42°C are composed of cells that are filamentous and biofilms are mycelial mat-like whereas biofilms produced at 25°C are thinner and made up of rod shaped cells (88). These findings coincide with other studies demonstrating that the filamentation of L. pneumophila is regulated by temperature (89).
Filamentous growth occurs in other bacterial species to increase fitness against adverse environmental conditions (90). In turn, intracellular filamentatous L. pneumophila can produce progeny more efficiently than short rod forms (91). Furthermore the length of L. pneumophila cells has been linked to ppGpp signalling (87). In vitro, biofilms produced at 37°C are more robust than at 25°C (33), and interestingly these biofilms produced at 25°C are more adherent(88). In addition, the production of the L. pneumophila type II secretion system, and
10
type IV pili are temperature regulated, and may influence attachment at different temperatures
(92).
1.5 The Role of Non-Protozoa Microbial Species in L. pneumophila Biofilm Colonization
Environmental biofilms that are colonized by L. pneumophila often contain several different
bacterial species (93). These bacterial species may promote the persistence of L. pneumophila in biofilms, while other species inhibit L. pneumophila’s colonization (Fig. 3.). For example,
Flavobacterum breve and cyanobacterial species can promote L. pneumophila growth and colonization of biofilms by providing a source of nutrients (94, 95). In vitro, the growth of L.
pneumophila is necrotrophic when heat killed Pseudomonas putida bacteria are given as a nutrient source, suggesting that in its natural environment L. pneumophila is capable of
replicating without the presence of protozoan species (34). Interestingly, summer seasons which
coincide with legionellosis outbreaks favour the proliferation of L. pneumophila in cooling tower
microbial populations while other Legionella species decrease in number (96). Therefore it is
tempting to speculate that L. pneumophila may influence the growth of other Legionella species.
In fact, L. pneumophila produces a surfactant secreted by the protein TolC which is toxic to other
Legionella species, but has no effect on Pseudomonas aeruginosa, Klebsiella pneumoniae and
Listeria monocytogenes and may play a role in the reduction of growth of other Legionella
species in biofilm communities when L. pneumophila populations increase in number (97).
One of the most studied bacteria that can influence L. pneumophila’s biofilm colonization
ability is P. aeruginosa. Although there is a body of evidence suggesting that L. pneumophila
can coexist in biofilms with P. aeruginosa, these studies were performed with inoculums from
11
natural environmental sources which may contain several different bacterial species (18, 45). In
contrast to these studies, “pure culture” monospecies biofilms with P. aeruginosa were shown to
prevent L. pneumophila colonization (33, 98) .This phenomenon may be mediated by
acylhomoserine lactones (AHLs) produced by P. aeruginosa as these AHLs not only inhibit the
growth of L. pneumophila but also its biofilm production (99). Furthermore, specific AHLs
produced by P. aeruginosa can downregulate Lcl production which is essential for biofilm
formation in L. pneumophila (69). Interestingly, the in vitro inhibition of L. pneumophila
colonization by P. aeruginosa is alleviated if K. pneumoniae is present in the biofilm produced
(98). In fact complex multispecies biofilms that contain both P. aeruginosa and K. pneumoniae
are permissive for L. pneumophila colonization (35). The presence of amoeba seems to also
affect whether P. aeruginosa is antagonistic to L. pneumophila colonization, as biofilms which contain both Acanthamoeba castellanii and P. aeruginosa increase the uptake of L. pneumophila
within A. castellanii, and the colonization of L. pneumophila in biofilms (100).
1.6 The Resistance of L. pneumophila Containing Biofilms to Biocides
There is a great interest in determining methods for disinfecting L. pneumophila containing
biofilms because of the ongoing threat to human health posed by these organisms in
anthropogenic water sources. Due to the intracellular lifestyle of L. pneumophila within protozoa
however, it is difficult to tease out whether the resistance of L. pneumophila in environmental
biofilms is due to the biofilm structure, its association with amoeba or both. It is evident however that environmental L. pneumophila found in biofilms are extremely resilient to treatment with
biocides (101). L. pneumophila exposed to environmental stresses such as biocides and/or found
within biofilms can enter a viable but non-culturable (VBNC) state (102). This property makes
12
the accurate assessment of the contamination levels with L. pneumophila cumbersome since it
requires the co-cultering of L. pneumophila with amoeba to lift the VBNC state (103).
Recently, nanoparticles have been suggested to be powerful tools to prevent L. pneumophila
biofilm formation, as nanoparticles such as silver are able to disrupt L. pneumophila -amoebae
interactions and biofilm structure (104, 105). Nanoparticles can also effectively clear L. pneumophila from mixed species biofilms and appear to be an attractive treatment option for disinfecting anthropogenic water sources (106, 107). The most common biocides used to control water-borne pathogens are chlorine derivatives, and chlorine derivatives are more efficacious than UV for disinfecting L. pneumophila (108, 109). Yet chloramine, one of the most potent
chlorine derivative biocides, does not completely eradicate L. pneumophila from aquatic biofilms
(110, 111).
The location of the biofilm can also play a role in resistance to disinfection strategies. This is particularly the case for biofilms formed in sediments which provide protection to
L.pneumophila from UV radiation (112). Furthermore, L. pneumophila grown on a solid surface is more resistant to killing by iodine than bacteria grown in broth, suggesting that there are metabolic differences between surface associated and planktonic phase bacteria (113). This is consistent with data suggesting that sessile and planktonic L. pneumophila in biofilms have different gene expression profiles (15).
13
14
Figure 3. Factors that influence L. pneumophila biofilm formation and colonization. L. pneumophila (denoted by Lp and shown in orange) can invade and replicate within environmental protozoa in the environment, which can be promoted by other microbial species such as P. aeruginosa (top left) and by alterations in gene expression due to environmental cues such as quorum sensing (top right). In addition environmental cues can also influence changes in L. pneumophila cell metabolism that favour biofilm production and colonization, which may occur following replication within protozoa or independently of protozoa infection (middle). Other microbial species such as P. aeruginosa can inhibit L. pneumophila colonization by altering their gene expression (bottom left). This inhibition of L. pneumophila biofilm colonization in turn, can also be influenced by the presence of other microorganisms such as K. pneumoniae which alleviates the inhibition by P. aeruginosa and allows L. pneumophila to be incorperated within biofilms. Physio-chemical parameters such as divalent cations can favour L. pneumophila biofilm colonization while other factors such as the presence of nanoparticles and copper can hinder L. pneumophila colonization.
15
1.7 Auto-aggregation and Biofilm Production.
During biofilm production, cell-cell interactions are crucial in determining biofilm architecture
(114, 115). These interactions are often mediated by adhesins located on the surface of the
bacteria (116, 117). Cell-cell interactions allow the bacteria to form aggregates, in a process known as auto-aggregation (118). To analyze auto-aggregation, the sedimentation of bacterial suspensions can be measured, as bacterial aggregates tend to settle. One family of surface adhesins that mediate auto-aggregation is the Self Associating Auto-Transporters (SAATs), which facilitate auto-aggregation through polymerization (119, 120). Auto-aggregation has
phenotypic properties similar to biofilm formation, and frequently the degree of auto-aggregation
is correlated with the degree of biofilm production (121, 122). In fact, there has been no strain
constructed, or identified to date that is deficient in biofilm production but is capable of auto-
aggregation, or vice versa and currently, it is believed that auto-aggregation is an indicator of the
biofilm capabilities of bacterial strains (116, 123).
1.8 The Role of Lcl in L. pneumophila Adhesion and Virulence
In addition to surviving and disseminating in their natural habitats, environmental pathogenic
bacteria need to adhere and colonize host cells in order to establish infection (124). The ability of
bacteria to anchor themselves to host receptors or matrices is mediated by surface exposed
adhesion proteins. In addition to their roles in adherence to host cells, these proteins often also mediate biofilm formation. L. pneumophila is able to bind to lung epithelial cells, alveolar
macrophages and extracellular matrices in mammalian cells during infection (125-127). In vitro, the addition of exogenous heparin inhibits the binding of L. pneumophila to lung epithelial cells
16
(48, 128). In a mouse infection model, pre-incubation of L. pneumophila with heparin decreased the mortality rate, protected the alveolar–capillary barrier, prevented systemic bacterial dissemination and stimulated Th1 cytokine production (219). Together, these results show that L. pneumophila produces GAG-binding adhesins that are essential to the pathogenesis of
Legionella infections.To date there have been several adherence factors identified in L. pneumophila, including type IV pilus, rtxA, Hsp60, LaiA and mip (129-137). While rtxA, Hsp60 and mip mediate attachment to both macrophages and lung epithelial cells (129-135), LaiA and type IV pilus are involved in the attachment of L. pneumophila to protoza and macrophages
(136, 137). Yet among the identified L. pneumophila adhesins only Lcl has been demonstrated to bind to host GAGs (68).
The Legionella collagen like protein or Lcl, was recently identified by heparin affinity chromatography, demonstrating that L. pneumophila Lcl is a GAG binding protein (67, 68). Lcl is located on the outer membrane of L. pneumophila, and is exposed to the extracellular milieu
(67, 69). In addition, Lcl also mediates biofilm production and attachment to abiotic surfaces (68,
69). Lcl contains 3 domains, an N-terminal region, a central domain containing tandem collagenous repeats and a C-terminal domain with no identified function. Both the collagenous repeat domain and the C-terminal domain were found to be essential for biofilm production, although their precise roles in this process are unknown (68, 69). Lcl’s collagenous repeat domain is polymorphic among clinical isolates and initial data suggests that these polymorphisms confer differences in attachment to host cells (67, 68, 138).
17
1.9 The study
Purpose: The purpose of this study was to investigate the role of Lcl in L. pneumophila ecology and pathogenicity, and to characterize the role of the Lcl’s collagenous repeats.
Hypothesis: Based on previous studies, it can be hypothesized that Lcl plays an important role in the environmental survival and persistence of L. pneumophila. This may be achieved by
promoting L. pneumophila-host cell interactions and by promoting multicellular behaviour such
as biofilm production and auto-aggregation. In addition Lcl collagenous repeats may influence
processes mediated by Lcl, as past studies have indicated that the distribution of Lcl collagenous
repeats is not uniform among clinical isolates.
There are 3 goals of this study:
A. Characterize the role of Lcl in L. pneumophila sedimentation and auto-aggregation.
Discussed in Chapter 2.
B. Investigate the role of Lcl in L. pneumophila –amoeba interactions.
Discussed in Chapter 2.
C. Explore the impact of variations in Lcl collagenous repeats on Lcl mediated processes.
Discussed in Chapter 3.
18
Chapter 2: The role of Lcl in L. pneumophila auto-aggregation and host- phagocyte interactions
2.1 Introduction
The ability of bacterial cells to come into contact and form aggregates, or auto-aggregation has
been implicated in environmental and host dissemination, and is relatively common among
Gram-negative pathogens such as Haemophilus influenza (139), Pseudomonas aeruginosa (140)
, Haemophilus cryptic genospecies(141) and enterohaemorrhagic Escherichia coli or EHEC
(142). Auto-aggregation also plays a major role in virulence (143, 144) and this phenomenon has phenotypic properties similar to biofilms (145, 146). Furthermore, the ability to auto-aggregates
is frequently correlated with the strength of biofilm production (122, 147, 148). Auto-
aggregation may involve surface exposed proteins such as the self associating auto-transporter
(SAAT) family of adhesins (116). SAATs are a versatile group of proteins which are involved in
biofilm production and adherence to human cells in addition to auto-aggregation (117, 119, 149).
Despite the role that auto-aggregation has in pathogenesis, the molecular determinants of inter-
bacterial interactions remain only partially understood.
The Gram-negative pathogen Legionella pneumophila is a major cause of community acquired
pneumonia (5, 6) and has been shown to auto-aggregate (66, 150). Legionellosis is acquired by
inhaling contaminated aerosols (11) and to date there have been no reported cases of human to
human transmission. In the environment, L. pneumophila is localized in the sediments of hot-
water tanks and water distribution systems, which are believed to be sources of the pathogen
19
during outbreaks (14, 64). In natural and in man-made water systems, L. pneumophila can be
isolated from different protozoa (19, 20, 151). This intracellular stage plays a crucial role in L.
pneumophila’s life cyle, since the bacteria utilize protozoan hosts as a mean to replicate and disseminate in the environment (63). Despite the association that auto-aggregation has with pathogenesis, there are only few studies to date exploring the molecular determinants, the nature and the roles of this process in L. pneumophila. The Legionella collagen-like protein (Lcl) is
involved in both biofilm production and adherence to human cells (67-69), two processes which
are characteristic of proteins implicated in auto-aggregation (116, 139). Based on these initial
findings, we hypothesized that the Lcl adhesin may play a role in auto-aggregation. We show
that surface exposed Lcl is essential and sufficient for auto-aggregation and that this process
requires divalent cations. Using amoeba infection models, we reveal that Lcl dependent auto-
aggregation and attachment may represent a key determinant of L. pneumophila’s life cycle and
virulence by promoting contact and adhesion between the pathogen and its natural hosts.
2.2 Materials and Methods
Chemicals, bacterial strains and growth conditions.
Unless otherwise indicated, all chemicals were purchased from Sigma. All Legionella
pneumophila (Table 1) and other Legionella isolates from other species (Table 2) were cultured
in buffered charcoal-yeast extract (BCYE) agar at 37 °C and 5% CO2 and or with buffered yeast
extract (BYE) broth at 37°C with shaking at 100 rpm (152). Cultures of Lp02 were
supplemented with thymidine when required (153). Escherichia coli strains (Table 2) were
cultured on Luria Bertani (LB) agar at 37°C and 5% CO2 and or with LB broth at 37°C with
shaking at 225rpm.
20
General DNA techniques.
Genomic DNA and plasmid DNA was purified using a QIAamp DNA minikit and a QIA prep
spin miniprep kit (Qiagen) respectively. To quantify DNA, spectrophotometry was used. For
PCR, 10ng was used as a template and PCR reactions were performed with Taq DNA
polymerase as recommended by the manufacturer (Invitrogen). The PCR primers used are found
in Table 3. PCR amplifications for cloning were performed with Platinum Taq DNA polymerase
high fidelity as per the manufacturer (Invitrogen). All clones were verified by sequencing.
Sequencing reactions were performed using a BigDye terminator cycle sequencing kit, version
3.1 and purified with a BigDye X terminator purification kit and run on a 3130xl genetic
analyzer (Applied Biosystems). To generate an E. coli strain expressing lpg2644, primers 3 and 4
were used to PCR amplify lpg2644 from the PCR2.1-lpg2644 vector. The resulting PCR product
was cloned into the PCR2.1 vector and digested with Bsph1 and EcoR1. The digested fragment
was then ligated into an NcoI and EcoR1 digested pTrc plasmid under the regulation of the
leaky-IPTG inducible promoter, trc.
Bacterial sedimentation assays.
Sedimentation assays were performed as previously described with a few modifications (66,
150). L. pneumophila strains were grown for three days and colonies were suspended to an
OD600nm of 1 in deionised water with 10% BYE or deionised water with the addition of the indicated salts. For sedimentation assays with mixed populations, bacterial suspensions were adjusted to an OD600nm of 1 and an equal volume of each suspension was added to test tubes and
allowed to settle. To visualize sedimentation in E. coli strains, overnight plate cultures were
21
suspended in deionised water with10% LB to an OD600 of 1 with or without the addition of 1mM isopropyl β-D-1-thiogalactopyranoside (IPTG). Images were taken immediately after the indicated time period with all incubations being performed at room temperature. To measure sedimentation kinetics, sedimentation assays were performed as described above, and the
OD600nm was measured every hour with a spectrophotometer, where a decrease in OD600nm
indicates an increase in sedimentation.
SDS-PAGE and immunoblot analysis.
SDS-PAGE was performed as previously described (154). Immunoblotting was performed
according to the methods of Towbin (155). To detect the presence of specific proteins, cell
lysates were prepared with broth cultures adjusted to an OD600nm of 4.5, centrifuged at 5000 rpm
for 10 minutes, washed twice with PBS and an equal volume of 2X Laemmli loading buffer with
10% 2-mercaptoethanol was added. E. coli cultures were induced with 5 mM IPTG during
exponential phase and after 3 hours cells were centrifuged, washed twice with PBS and mixed
with an equal volume of 2X Laemmli loading buffer with 10% 2-mercaptoethanol. All samples
were then boiled for 15 minutes before running on gel. Bound antibodies (1:20,000 for anti-Lcl
and 1:50, 000 for anti-icdh) were detected with peroxidase-linked anti-rabbit IgG (1:20,000). To
determine if Lcl is secreted during sedimentation, sedimentation assays were performed as
described above, and after 5 hours the suspension was pipetted vigorously to resuspend the
sediment cells. Afterwards 1 ml of suspension was centrifuged for 5 minutes at 13,000rpm and
the cell pellet was resuspended in 100 µl of PBS. The supernatant was then precipitated by
adding 100% Trichloroacetic acid (TCA) to a final concentration of 13% and incubated at -20°C
22
overnight. Samples were then centrifuged for 15 minutes at 4°C and resuspended with an equal volume of PBS as the cell pellet.
Immunofluorescence assays.
To detect Lcl on the surface of E. coli strains bacteria from plate cultures were washed twice and resuspended in PBS. The inner membrane impermeable dye FM 4-64 (Molecular probes) was used to label the cells and afterwards bacteria were incubated with anti-Lcl antibodies (1:50) and anti-rabbit alexa-flour (Molecular probes) antibodies (1:500), as previously described (Mallegol et al., 2012).
Biofilm quantification.
All biofilm assays were performed using polystyrene 96-well plates (Costar). E. coli strains were grown for 16 hours in LB broth and adjusted to a final OD of 0.2 in fresh LB with or without the addition of 5mM IPTG. 96-well plates were incubated at 37 °C and 5% CO2 for 1 day. Biofilms were stained with 40 µl of 0.25% crystal violet per well for 15 minutes and washed three times with 200 µl of sterile deionised water. The crystal violet stain was then solubilised in 95% ethanol and after 15 minutes, absorbance was read at 600nm. The results of three independent experiments were pooled with 8 replicates each.
Scanning electron microscopy.
23
E. coli strains were left to sediment in 90% deionised water with 10% LB onto 12mm glass
coverslips (Warner instruments). Afterwards, coverslips were heat fixed, fixed with 4%
paraformaldehyde (PFA) for 30 minutes and scanning electron microscopy was performed as
previously described (91).
Acanthamoeba castellanii infection assays.
Acanthamoeba castellanii was grown in peptone yeast extract glucose (PYG) medium at room
temperature and one day before infection 24-well tissue culture plates were seeded with 1 ml of
A. castellanii suspension adjusted to a cell density of 5x105 cells / ml (156). L. pneumophila strains grown to stationary phase were added to A. castellanii at an MOI (multiplicity of infection) of 50 in deionised water and deionised water with 500 µM MgCl2 and allowed 2 hours
to infect. To determine if differences in infection between conditions were due to sedimentation
or initial binding, infections were also performed with centrifugation at 880 Xg for 10 minutes
before allowing 2 hours for infection. Afterwards L. pneumophila internalization was measured
by flow cytometery similar to as previously described (66, 150) with the addition of a 1 hour 100
µg/ml gentamicin treatment to kill extracellular bacteria. All L. pneumophila strains used
contained a plasmid expressing GFP (green fluorescent protein) under a constitutive promoter
and internalization was defined as the acquisition of fluorescence by A. castellanii compared to
the uninfected control. To measure the infection of A. castellanii by microscopy, A. castellanii
were seeded onto 12 mm glass coverslips inside 24-well tissue culture plates and the same
procedure as described above was performed and afterwards cells were fixed with 4% PFA. One
hundred A. castellanii were counted per replicate and infection was presented as percent of total
24
A. castellanii infected. Experiments were performed in triplicate. To determine the effect of aggregation on infection in the Lp02∆lpg2644 strain, infection assays were performed as described above in deionised water with or without the addition of anti-L.pneumophila serogroup
1 agglutinating antibodies (1:1000) (91).
Table 1. L. pneumophila Strains used in this study
MR code Species Designation Plasmid Source or reference
23 L. pneumophila Lp02 (153)
52 L. pneumophila Lp02Δlpg2644 (68)
73 L. pneumophila Lp02 pBH6119 pBH6119 (68)
69 L. pneumophila Lp02Δlpg2644 pBH6119 (68) pBH6119
76 L. pneumophila Lp02 plpg2644 pBH6119 lpg2644 (68)
77 L. pneumophila Lp02Δlpg2644 pBH6119 lpg2644 (68)
plpg2644
133 L. pneumophila Lp02 pRFP pKB288 (pBH6119 This study mCherry)
134 L. pneumophila Lp02Δlpg2644 pRFP pKB288 (pBH6119 This study mCherry)
36 L. pneumophila Lp02 pGFP pBH6119 GFP (69)
70 L. pneumophila Lp02 Δlpg2644 pGFP pBH6119 GFP (69)
124 L. pneumophila Lp02Δlpg2644 pBH6119 GFP (69) clpg2644 pGFP (chromosomal insertion of lpg2644)
L. pneumophila L. pneumophila sg1-9* (68)
L. pneumophila L. pneumophila sg2 (68)
25
L. pneumophila L. pneumophila sg3 (68)
L. pneumophila L. pneumophila sg4 (68)
L. pneumophila L. pneumophila sg5 (68)
L. pneumophila L. pneumophila sg6 (68)
L. pneumophila L. pneumophila sg8 (68)
L. pneumophila L. pneumophila sg10 (68)
L. pneumophila L. pneumophila sg12 (68)
* cross reactive with serogroups 1-9
Table 2. Legionella isolates from species other than pneumophila and E. coli strains used in this study
MR code Species Designation Plasmid Source or reference
40 E. coli (TOP10) E. coli pTrc pTrc This study
79 E. coli (TOP10) E. coli plcl plcl This study
L. erythra LR1359 (68)
L. feeleii LR0568 (68)
L. feeleii Lf pBH6119 This study
L. feeleii Lf plpg2644 This study
L. erythra LR1317 (68)
L. rubrilucens LR1406 (68)
L. maceachernii LR0193 (68)
L. anisa LR0398 (68)
L. bozemanii sg1 LR0651 (68)
L. bozemanii sg2 LR0405 (68)
Table 3. Primers used in this study
Code Primer Amplification Sequence 5’ to 3’ target
26
1 lpg2644 F lpg2644 GAAATAAAGAATGATACATCGA
2 lpg2644 R GCAAAGCGAATTTATGAACA
3 lpg2644 TGCGTATCATGATACATCGAAATAAAGTC Bsph1 F
4 lpg2644 GTTACGAATTCTTAAAAGGCTCTTACAGCAC
EcoR1 R
2.3 Results Legionella pneumophila auto-aggregates more than a selected panel of non-pneumophila
Legionella species.
Taking in account that auto-aggregation is associated with increased virulence and biofilm formation in other bacterial species (117, 120), we first sought to determine whether Legionella
species differ in their abilities to form auto-aggregates. The conventional experimental strategy
to evaluate bacterial auto-aggregation is to perform sedimentation assays with bacterial
suspensions (118, 119, 144). To this end, we compared the sedimentation of L. pneumophila
with Legionella isolates from other species using a sedimentation assay adapted from a
previously described method (66, 150). L. pneumophila isolates of serogroups 1 (Lp02), 1-9 (that
cross reacts with serogroups 1-9) and eight Legionella isolates from other species were
suspended in deionised water with 10% BYE (buffered yeast extract) and allowed to settle
(Table1 and 2). After an overnight incubation, the L. pneumophila isolates sedimented while L.
erythra, L. feeleii, L. rubrilucens, L. maceachernii, L. anisa and L. bozemanii strains showed
27
poor sedimentation (Fig. 4A).Considering that these non-pneumophila species are poor biofilm producers and are rarely diagnosed in legionellosis patients, these data raise potential
correlations between the ability to produce auto-aggregates and the environmental
colonization/persistence of Legionella bacteria (67-69). We next compared the sedimentation of
L. pneumophila isolates from serogroups 1 (Lp02), 1-9, 2, 3, 4, 5, 6, 8, 10, and 12 which were
previously shown to produce Lcl (67-69). All the tested isolates with the exception of L.
pneumophila sg 3 and L. pneumophila sg8 were capable of sedimentation (Fig. 4B). Although
most serogroup are able to auto-aggregate, this suggests that differences in O-antigen decoration
may have an impact of the aggregation of L. pneumophila serogroups with low clinical
prevalence such as sg3 and sg8 compared to sg1 or sg6 (147, 157).
28
Figure 4. L. pneumophila sediments more efficiently than Legionella non- pneumophila strains. (A) Sedimentation assays with Lp02, an L. pneumophila isolate that cross reacts with serogroups 1-9 (L. pneumophila sg1-9), eight isolates from other Legionella species and with (B) L. pneumophila isolates from serogroups 1(Lp02), 1-9, 2, 3, 4, 5, 6, 8, 10 and 12 after overnight static incubation at room temperature in deionised water with 10% BYE. One representative experiment is shown. Experiments were performed in triplicate.
29
Lcl mediates Legionella pneumophila auto-aggregation.
BLAST searches of genomic data from Legionella species available in databases revealed that
genes encoding for homologues of Lcl are present in all sequenced L. pneumophila serogroup 1
strains and in L. pneumophila serogroup 12 strain 570-CO-H (amino-acid sequence identity
between 65% to 85%) while it is absent from L. longbeachae (str. NSW150 and D-4968) and L. drancourtii genomes (data not shown, Duncan et al., 2011). We also previously reported that homologues of the L. pneumophila biofilm mediator, Lcl, cannot be detected in species which are poor biofilm producers such as L. erythra , L. feeleii, L. rubrilucens, L. maceachernii, L. anisa and L. bozemanii (67-69). On the basis of studies correlating biofilm formation and auto- aggregation, we next sought to test the hypothesis that the auto-aggregation phenotype observed with L. pneumophila is mediated by Lcl (encoded by lpg2644). While Lp02 was able to form auto-aggregates, this was not the case for Lp02Δlpg2644 (Fig. 5A). Complementation of
Lp02Δlpg2644 by transformation with a plasmid expressing lpg2644 (plpg2644) resulted in
recovery of its auto-aggregation properties. Taken together, this result suggests that Lcl is
essential for L. pneumophila auto-aggregation. When to colony forming units (CFU) were
measured before and after sedimentation assays (with vigourous vortexing to break up
aggregates), a similar number of cells were measured suggesting that the sedimentation
phenotype was not due to cell death (data not shown). Importantly the empty vector controls
(Lp02 pBH6119 and Lp02 Δlpg2644 pBH6119) did not have differences in sedimentation
compared to their respective untransformed strains. We next tested whether the kinetics and
degree of L. pneumophila auto-aggregation are influenced by the level of expression of Lcl. The
complemented mutant, Lp02Δlpg2644 plpg2644 and the wild type strain transformed with
30
plpg2644 (Lp02 plpg2644) produced more Lcl than Lp02 and Lp02 pBH6119 as estimated by anti-Lcl immunoblotting (Fig. 5B). Taking this data in account, we next compared the sedimentation kinetics of these L. pneumophila strains in relation to their Lcl synthesis. After one
hour, Lp02Δlpg2644 plpg2644 and Lp02 plpg2644, which express higher levels of Lcl had sedimented more rapidly than Lp02 (Fig. 5C). There were no significant differences in
sedimentation rate or degree between Lp02 plpg2644 and Lp02∆lpg2644 plpg2644, which is
consistent with similar levels of Lcl production. This suggests that the rate and degree of
sedimentation are influenced by the amount of Lcl produced. When we compared the kinetics of
sedimendation of Lp02 grown to stationary phase in BYE broth and stationary phase Lp02
grown on BCYE agar plates, similar sedimentation kinetics were observed (Fig. 5D).
Previously, we reported that Lcl is capable of binding to several glycosaminoglycans (GAGs)
including fucoidan, chondroitin sulfate-A, dextran sulfate and heparin sulphate, whose presence
was shown to inhibit the biofilm formation of L. pneumophila (68). To determine whether the
GAG binding properties of Lcl are required for the auto-aggregation of L. pneumophila,
sedimentation assays were performed with Lp02 in the presence of 0.25 mg/ml of these GAGs.
Fucoidan, chondroitin sulfate-A, dextran sulfate and heparin sulfate all inhibited Lp02
sedimentation. In contrast, the negative controls, mannose (0.25 mg/ml) and BSA (0.25 mg/ml)
did not alter Lp02 auto-aggregation (Fig. 5E). Thus the addition of Lcl ligands are able to
prevent the auto-aggregation of Lp02.
31
Figure 5. Lcl is essential for L. pneumophila auto-aggregation. Sedimentation assays with wild type (Lp02), an lpg2644 knockout (Lp02Δlpg2644), Lp02 and Lp02Δlpg2644 transformed with an empty vector (Lp02 pBH6119 and Lp02Δlpg2644 pBH6119 respectively), the Lp02 over-expressing Lcl (Lp02 plpg2644) and the complemented knockout (Lp02Δlpg2644 plpg2644) measured (A) macroscopically in test tubes and (C) with sedimentation kinetics. (B) Anti-Lcl immunoblot demonstrating different expression levels of Lcl in Lp02, Lp02∆lpg2644, Lp02 pBH6119, Lp02∆lpg2644 pBH6119, Lp02 plpg2644 and Lp02∆lpg2644 plpg2644.(D)Sedimentation assays with Lp02 from plate cultures and stationary broth. (E) Sedimentation assays with Lp02 in the presence of 0.25 mg/ml GAGs. Mannose (0.25 mg/ml) and BSA (0.25 mg/ml) were used as negative controls.
32
Divalent cations are required for Lcl induced auto-aggregation.
Divalent cations are involved in cell-cell interactions of both prokaryotes and eukaryotes (158-
160) . Therefore, we hypothesized that divalent cations may also play a role in Lcl dependent L. pneumophila auto-aggregation. To test this hypothesis, we assessed the sedimentation of Lp02,
Lp02Δlpg2644 and Lp02Δlpg2644 plpg2644 in deionised water or in 500 µM solutions of either
CaCl2, MgCl2, ZnCl2 or KCl in deionised water. While sedimentation did not occur in deionised
water alone, Lp02 sedimented in assays supplemented with 500 µM CaCl2, MgCl2 and ZnCl2
(Fig. 6A). In contrast, Lp02 did not sediment with the addition of 500 µM KCl indicating that potassium and chloride ions have no effect on the auto-aggregation of L. pneumophila (Fig. 6A).
Importantly, Lp02Δlpg2644 did not sediment in any conditions (Fig. 6B). The deficiency in sedimentation of Lp02Δlpg2644 was restored upon complementation with plpg2644 (Fig. 6C).
These data suggest that divalent cations induce L. pneumophila auto-aggregation in an Lcl dependent manner. Consistent with results obtained with Lp02, sedimentation of Lp02Δlpg2644 plpg2644 did not occur with the addition of 500 µM KCl (Fig. 6C). In addition, Lp02 and
Lp02Δlpg2644 plpg2644 also sedimented in the presence of 500 µM MgSO4, confirming that
divalent cations and not chloride anions are required for the auto-aggregation of L. pneumophila
(data not shown). We next determined whether the concentrations of specific cations have an
impact on the sedimentation kinetics of L. pneumophila. Lp02 colonies were suspended in
deionised water with 500 µM, 100 µM and 50 µM of CaCl2, ZnCl2 or MgCl2 and the OD600nm of the bacterial suspensions were monitored hourly for eight hours. Lp02 sedimentation appeared to be dose dependent with the addition of CaCl2, ZnCl2 and MgCl2 (Fig. 6D-F). The addition of up
to 500 µM KCl however did not rescue Lp02 sedimentation suggesting that the lack of
sedimentation in the previous assays was not due to a lower chloride or potassium ion
33
concentration (data not shown). In addition, no significant difference was observed in the degree
and rate of sedimentation between the different cations (Fig. 6D-F). Furthermore, sedimentation
of Lp02 supplemented with CaCl2 and ZnCl2 was inhibited by the addition of a sub lethal concentration of the metal chelator diethylenetriaminepentaacetic acid (DTPA) (Fig. 6G and H),
confirming that the aggregation of L. pneumophila is dependent on divalent cations. Auto-
aggregation in the presence of MgCl2 however could not be inhibited by the addition of DTPA
(data not shown). This is consistent with the reported low affinity of DTPA to magnesium
compared to Ca2+ and Zn2+ (161).
34
Figure 6. Divalent cations are required for Lcl dependent auto-aggregation. Sedimentation assays with (A) Lp02, (B) Lp02∆lpg2644 and (C) Lp02∆lpg2644 plpg2644 in deionised water (control) and deionised water supplemented with 500 μM CaCl2, ZnCl2 ,MgCl2 and KCl. Sedimentation kinetics of Lp02 with 500 μM, 100 μM and 50 μM (D) CaCl2, (E) ZnCl2 and (F) MgCl2. Sedimentation assays in the presence of (G) 100 μM CaCl2 and (H) 100 μM ZnCl2 with and without 50 μM DPTA, or with 50 μM DPTA only in deionised water.
35
Lcl secreted in the extracellular milieu is not sufficient to induce the aggregation of L. pneumophila Lp02Δlpg2644.
Based on evidences that Lcl is both surface exposed and secreted into the extracellular milieu
using the type II secretion system (67, 69, 162), we next tested whether Lcl is secreted into the
extracellular milieu during sedimentation assays. Anti-Lcl immunoblot assays detected Lcl in the
supernatant fractions (SN) of sedimentation assays with Lp02 and with a mixed suspensions of
Lp02 and Lp02Δlpg2644, while Lcl could not be detected in assays with Lp02Δlpg2644 alone
(Fig. 7A). We next investigated if Lcl secreted by wild type bacteria could be sufficient to
sediment Lp02Δlpg2644 in a mixed population of Lp02Δlpg2644 expressing red fluorescent
protein (Lp02Δlpg2644 pRFP) and Lp02 expressing green fluorescent protein (Lp02 pGFP).
When sedimented cells were visualized by fluorescence microscopy, the vast majority of the
bacteria that were observed were Lp02 expressing GFP with few Lp02Δlpg2644 pRFP,
indicating that Lp02 primarily had sedimented (Fig. 7B). Plasmids were next swapped to ensure
that the observed phenotype was not indirectly linked to the heterologous expression of
respective fluorescent proteins. Sedimentation assays were performed with RFP expressing Lp02
(Lp02 pRFP) and GFP expressing Lp02Δlpg2644 (Lp02Δlpg2644 pGFP). Most of the bacteria
found at the bottom of the test tube were Lp02 pRFP (Fig. 7C), suggesting that the lack of cell-
cell interactions observed between Lp02 and Lp02Δlpg2644 is not an indirect consequence of the
heterologous expression of RFP and GFP. These results were further confirmed by measuring the proportion of each labelled bacterial cell after sedimentation using fluorescence microscopy.
Among 5 representative microscopy fields, Lp02 accounted for 91-93% of the visualized cells
(Fig. 7D and 7E). In control assays the expression of RFP or GFP did not alter the individual sedimentation rates of any of the strains used, indicating that neither the expression of GFP nor
RFP effects sedimentation (data not shown). Taken together, these results show that
36
Lp02Δlpg2644 bacteria are not able to aggregate with wild type and suggest that the Lcl secreted in the extracellular milieu is not sufficient for the incorporation of L. pneumophila into auto- aggregates.
37
Figure 7. Surface exposed Lcl is required for L. pneumophila auto-aggregation. (A) Anti-Lcl immublots of the supernant (SN) and cell fraction (CF) from sedimentation assays with Lp02 ,Lp02∆lpg2644 and mixed suspensions. Fluorescence microscopy analysis of labelled auto- aggregates after 5 hour static incubations with (B) Lp02 pGFP and Lp02∆ lpg2644 pRFP, and C) Lp02 pRFP and Lp02∆lpg2644 pGFP mixed suspensions in deionised water with 500 μM MgCl2. (D) And (E) represent the respective and relative quantifications of Lp02 and Lp02∆lpg2644 in mixed sedimentation assays from B and C. Scale bar represents 10μm. * indicates statistically significant differences with P<0.001 by two-tailed Student’s t-test.
38
Lcl is sufficient to induce auto-aggregation and to increase biofilm production in E. coli
and L. feeleii.
To determine whether Lcl is sufficient to induce auto-aggregation, we next measured the impact
of heterologous expression of Lcl on the sedimentation of E. coli. The Lcl gene (lpg2644) was cloned into the plasmid pTrc under the control of the leaky trc -IPTG (isopropyl β-D-1- thiogalactopyranoside) inducible promoter. This plasmid was then transformed into E. coli TOP
10 to create E. coli plcl (Table 2). As a negative control, the E. coli TOP10 strain was transformed with the empty pTrc vector to obtain E. coli pTrc (Table 2). In immunoblot assays, anti-Lcl antibodies reacted with a 50-kDa protein in E. coli plcl lysates and an increased expression level was observed in the presence of IPTG (Fig. 8A). The cellular localization of Lcl was examined by live imaging using spinning disk confocal microscopy and live cell anti-Lcl immuno-fluorescence assays with E. coli plcl. Confocal analysis revealed that Lcl is expressed at the surface of E. coli plcl cells (antibodies are not outer membrane permeable), albeit not uniformly distributed (Fig. 8B). This heterogeneous cluster distribution of recombinant Lcl in
E.coli is consistent with its previously reported distribution in L. pneumophila (69).No fluorescence signal was detected with E. coli pTrc and anti-Lcl antiserum (Fig. 8B). The cellular distribution of Lcl was further analysed using deconvolved confocal xy planes. Inner membranes were labelled with the dye FM4-64(163) (Fig. 8B). The scanning of Lcl fluorescence intensities along cross section of the bacteria and the comparison with the fluorescence intensities for FM 4-
64 confirmed that heterologous Lcl is expressed at the cell surface of E. coli (Fig. 8B).
To determine if surface exposed Lcl is sufficient to mediate bacterial cell-cell interactions, the
auto-aggregation of E. coli plcl and E. coli pTrc colonies were compared in sedimentation assays. After 5 hour incubation, control strain E. coli pTrc remained in suspension whereas E.
39
coli plcl showed a marked ability to auto-aggregate (Fig. 8C). By differential interference
contrast microscopy (DIC), cells from settled E. coli pTrc appeared to be distributed evenly and
homogenously (Fig. 8D). In contrast, settled E. coli plcl cells were found to cluster (where a
cluster was defined as an area that contains more than 1 cell in close proximity) into large
aggregates, suggesting that heterologous expression of Lcl is sufficient to induce auto-
aggregation and results in sedimentation (Fig. 8D). This finding was further confirmed by
sedimentation kinetic assays where E. coli plcl, started to settle after an hour of incubation while
E. coli pTrc remained in suspension for the 5 hour time course (Fig. 8E). In contrast to the data
obtained with L. pneumophila, increased synthesis of Lcl through IPTG induction did not
significantly affect the sedimentation kinetics or degree of E. coli plcl (Fig. 8C and E).
Importantly, differences in sedimentation between these strains were not due to differences in
cell viability as demonstrated by comparing CFUs of cell suspensions collected pre and post-
sedimentation assays (data not shown).
We know from our previous reports that surface exposed Lcl is essential for the biofilm
production of L. pneumophila (68, 69). Based on the ability of Lcl to induce the auto-aggregation
of E. coli, we next sought to determine whether heterologous expression of lpg2644 could also
be sufficient to influence E. coli biofilm production. In comparison with E. coli pTrc, E. coli plcl
produced significantly more biofilm (Fig. 8F). Moreover, in the presence of IPTG, increased
synthesis of Lcl was correlated with a significantly higher amount of biofilm production of the E.
coli plcl strain (Fig. 8F). The addition of IPTG to E. coli pTrc slightly decreased the biofilm
production of E. coli pTrc, while it also slightly decreased the growth of both E. coli pTrc and E.
coli plcl as measured by absorbance of bacterial suspensions at 600nm, most likely due to the toxicity of IPTG on growth(164, 165). This decrease in growth however did not
40
significantlyimpact the adherent biomass as detected by crystal violet staining. We then evaluated whether heterologous expression of lpg2644 could also be sufficient to influence auto- aggregation in other Legionella species. L. feeleii (Lf) was transformed with plpg2644 to obtain
Lf plpg2644 (Table 2). The synthesis of recombinant Lcl in Lf plpg2644 was confirmed by anti-
Lcl immunoblot analysis (Figure 8G). Similarly to E. coli plcl, L. feelii plpg2644 showed a marked ability to auto-aggregate in sedimentation assays while Legionella feelii transformed with the empty plasmid (Lf pBH6119) remained in suspension (Fig. 8G).
41
42
Figure 8. Lcl is sufficient to induce auto-aggregation and biofilm production in E. coli and L. feeleii. (A) Anti-Lcl immunoblot of E. coli containing the empty plasmid (E. coli pTrc) and E. coli transformed with a plasmid containing lpg2644 under the control of a leaky IPTG inducible promoter (E. coli plcl). (B) Anti-Lcl immunofluorescence and FM 4-64 staining of live E. coli pTrc and E. coli plcl (top). The localization of Lcl (green line) was determined by comparing its fluorescence intensity along the white lines with the inner membrane marker FM 4-64 (red line). Sedimentation of E. coli pTrc and E. coli plcl measured by (C) test tube sedimentation assays, (D) DIC of sediment and (E) sedimentation kinetics. (F) Biofilm production of E. coli pTrc and E. coli plcl as measured by crystal violet staining. * indicates statistically significant differences between the indicated conditions and E. coli plcl - IPTG and ** indicates statistically significant differences with E. coli plcl + IPTG (P<0.05) by two-tailed Student’s t-test. (G) Anti-Lcl immunoblot and sedimentation assays with L. feeleii transformed with the empty vector (Lf pBH6119) and with the plpg2644 plasmid (Lf plpg2644). IPTG was added to a final concentration of 1mM when indicated for sedimentation experiments and immunoblotting. For biofilm assays IPTG was added to a final concentration of 5 mM. Scale bars represent 0.6 μm and 10 μm for panels B and D respectively.
43
We next investigated if lpg2644 expression is sufficient to influence the ultrastructure of
bacterial auto-aggregates. To test this hypothesis, E. coli pTrc and E. coli plcl sediments, with
and without IPTG were analysed by scanning electronic microscopy. In the absence of IPTG, E.
coli pTrc showed few cells which appeared to be loosely associated (Fig. 9A) while assays performed with settled E. coli plcl cells formed large structured clusters (Fig. 9B). Addition of
IPTG to E. coli pTrc resulted in a decrease in the number of sedimented cells (Fig. 9C), which is consistent with the reported bacteriostatic toxicity of IPTG on E. coli (164, 165). In contrast E. coli plcl supplemented with IPTG formed thicker and denser aggregates possibly covered by an extracellular substance (Fig. 9D). While the heterologous over-expression of Lcl does not increase the sedimentation of E. coli, this structural impact is in agreement with the increased biofilm formation observed with E. coli plcl upon IPTG induction.
44
Figure 9. Production of Lcl alters E. coli sediment ultrastructure. Electron micrographs of E. coli pTrc and E. coli plcl sediment after overnight static incubation at room temperature without (A and C respectively) and with 1 mM IPTG induction (B and D respectively). One representative electron micrograph is shown,which is representative from 15 different fields.Scale bars represent 5µm.
45
Lcl mediates the attachment of L. pneumophila to Acanthamoeba castellanii.
Once an intracellular pathogen is in contact with a host cell, it next adheres intimately to host
surfaces using adhesins. Lcl is an adhesin that mediates the attachment of L. pneumophila to
human lung epithelial cells (68). We thus hypothesised that it may also mediate the attachment of
Lp02 to A. castellanii. To test this hypothesis independently of the aggregation/sedimentation
phenotype, we performed A. castellanii infection experiments where cell contacts were promoted
by initiating the assay with a mild centrifugation. The infection of A. castellanii with Lp02
pGFP, Lp02Δlpg2644 pGFP and a chromosomally complemented lpg2644 deletion mutant
labelled with GFP (Lp02Δlpg2644clpg2644 pGFP) were measured by flow cytometry as
previously described (66, 150). In these experimental conditions, Lp02 pGFP was found to infect
76-83 % of A. castellanii cells regardless of the presence of MgCl2 (Fig. 10A). This suggests that magnesium does not influence the infection of L. pneumophila with amoebae once they are in contact. In contrast, only 5 to 13 % of the A. castellanii cells were infected in assays with
Lp02Δlpg2644 pGFP. Considering the short term incubation of our assays (2 hours), these results presumably reflect a reduced adhesion of Lp02Δlpg2644 and is consistent with the reported decreased L. pneumophila infection of A. castellanii in the presence of blocking anti-Lcl antibodies (67). The infection of A. castellanii with the complemented mutant was significantly higher than with Lp02∆lpg2644 (P<0.01) and followed the same trend as the wild type strain in all experimental conditions (Fig. 10A). To confirm that the acquisition of fluorescence by A. castellanii was in fact due to the internalization of fluorescent L. pneumophila, the number of infected A. castellanii was next monitored by confocal laser scanning microscopy (CLSM) using the same experimental strategy. This approach revealed the same trend as our infection assays
46
measured by flow cytometry, suggesting that the Lcl adhesin mediates the attachment of L. pneumophila to A. castellanii (Fig. 10B). Surprisingly, when centrifuged infection assays were
performed in the presence of fucoidan, the infection of A. castellanii with Lp02 pGFP,
Lp02Δlpg26444 pGFP and Lp02Δlpg2644clpg2644 pGFP remained unchanged (Fig. 10C and D).
These results suggest that fucoidan can specifically inhibit L. pneumophila aggregation while it does not inhibit the attachment to A. castellanii.
47
Figure 10. Lcl mediates the attachment of L. pneumophila to Acanthamoeba castellanii. Infection of A. castellanii by Lp02 pGFP, Lp02∆lpg2644 pGFP and Lp02∆lpg2644 clpg2644 (chromosomal insertion of gene lpg2644) pGFP after centrifugation in deionized water in the absence or presence of 500µM MgCl2 measured by (A) flow cytometry and (B) fluorescence microscopy. Infection of A. castellanii measured by flow cytometry in the presence of 2.5X10-3 to 2.5X10-5 mg /ml fucoidan in (C) centrifuged conditions in deionized water, (D) centrifuged conditions with the addition of 500µM MgCl2 with Lp02 pGFP (white squares), Lp02∆lpg2644 pGFP (grey circles) and Lp02∆lpg2644 clpg2644 pGFP (black triangles). * indicates statistically significant differences with Lp02∆lpg2644 clpg2644 – MgCl2 by two- tailed Student’s t-test (p<0.01).
48
Lcl dependent auto-aggregation potentiates the infection of Acanthamoeba castellanii by L.
pneumophila.
Amoeba species, such as the L. pneumophila host A. castellanii, are preferentially found attached
to surfaces in aquatic environments where they feed more effectively on their prey (166, 167).
Given that Lcl is a mediator of sedimentation, we hypothesized that this process may also assist
the bacteria in more efficiently encountering and thus invading amoebae. To test this hypothesis,
Lp02 pGFP, Lp02Δlpg2644 pGFP and Lp02Δlpg2644clpg2644 pGFP were left to settle during 2
hours on A. castellanii without initial centrifugation. To evaluate the role of Lcl dependent auto-
aggregation on A. castellanii infection, assays were performed in deionised water and in
deionised water with 500µM MgCl2 which are respectively non-permissive and permissive for
Lcl dependent auto-aggregation. Lp02 pGFP infected significantly 108% (P<0.01) more amoebae in the presence of 500 µM MgCl2 than in deionised water alone (Fig. 11A). This result
suggests that Lcl dependent auto-aggregation of wild type Lp02 increases the ability of L. pneumophila to come in contact with A. castellanii. Lp02Δlpg2644 pGFP showed a marked and significant decrease in internalization in both the absence and presence of magnesium, in
comparison to Lp02 pGFP. Infection assays of A. castellanii with Lp02Δlpg2644clpg2644 pGFP
followed the same trend as with wild type Lp02 (Fig. 11A). This finding was further confirmed
by CLSM analyses suggesting that the Lcl-dependent auto-aggregation potentiates the infection
of A. castellanii by wild type L. pneumophila (Fig. 11B). Taking in account that Lcl also
mediates the attachment of Lp02 to A. castellanii, the reduced infectivity of Lp02Δlpg2644 in
these experiments may reflect a sum of deficiencies in aggregation dependent contact as well as
attachment. To experimentally separate these two processes, we took advantage of the dose
dependent inhibitory effect of soluble GAGs on the Lcl mediated auto-aggregation which does
49
not affect the attachment of Lp02 (Fig. 12). When Lp02 pGFP and Lp02Δlpg2644clpg2644 pGFP were left to auto-aggregate and settle during 2 hours without centrifugation, a dose dependent inhibition of A. castellanii infection was observed in the presence of fucoidan concentrations that inhibit the auto-aggregation of Lp02 (Fig. 11C). Consistent with the results observed in centrifuged infection assays (Fig. 10C and D), fucoidan had no effect on the infection of A. castellanii in conditions which do not promote auto-aggregation (Fig. 11D). The infection of A. castellanii with Lp02Δlpg26444 pGFP remained unchanged despite of the presence of fucoidan (Fig. 11C and D). Bearing in mind that the concentrations of fucoidan used do not inhibit the attachment of Lp02 to A. castellanii, these data suggest that Lcl dependent auto-aggregation potentiates the infection of these host cells.
We next asked if aggregation alone could potentiate the host internalization of the adhesion deficient Lp02Δlpg2644 strain. A. castellanii was challenged with aggregates of Lp02Δlpg2644 pGFP formed in presence of agglutinating anti-L. pneumophila polyclonal antibodies (Fig. 11E).
Compared to a suspension of planktonic bacteria, the infection of A. castellanii with
Lp02Δlpg26444 pGFP aggregates was 8 times greater (Fig. 11F). In control assays, agglutination of wild type Lp02 did not alter the infection of A. castellanii (data not shown) confirming previously studies showing that L. pneumophila opsonization does not increase the infection of
A. castellanii (168). Taken together this data suggest that the aggregation of L. pneumophila potentiates the infection of A. castellanii independently of attachment.
50
Figure 11. Lcl dependent auto-aggregation potentiates the internalization of L. pneumophila in A. castellanii. Infection of A. castellanii by Lp02 pGFP, Lp02∆lpg2644 pGFP and Lp02∆lpg2644 clpg2644 pGFP in non-centrifuged conditions in the absence or presence of 500µM MgCl2 measured by (A) flow cytometry and (B) fluorescence microscopy. Infection of A. castellanii measured by flow cytometry in the presence of 2.5X10-3 to 2.5X10-5 mg /ml fucoidan in (C) non-centrifuged conditions with the addition of 500µM MgCl2 and D) non- centrifuged conditions in deionized water with Lp02 pGFP (white squares), Lp02∆lpg2644 pGFP (grey circles) and Lp02∆lpg2644 clpg2644 pGFP (black triangles). (E) Fluorescence microscopy of Lp02∆lpg2644 pGFP in the absence or presence of anti-Legionella pneumophila serogroup1 (anti-Lp1) agglutinating antibodies (1:1000). (F) Infection of A. castellanii with isolated planktonic Lp02∆lpg2644 pGFP and artificially aggregated Lp02∆lpg2644 pGFP (- and + anti-Lp1 antibodies respectively). Scale bar represents 10μm. * and ** indicates statistically significant differences between the indicated strains (A and B) and compared to assays with 0 mg/ml fucoidan (C)respectively by two-tailed Student’s t-test (p<0.01).
51
Figure 12. Fucoidan inhibits L. pneumophila sedimentation in a dose dependent manner. -5 -4 Sedimentation kinetics of Lp02 in 500µM MgCl2 with the addition of 0, 2.5X10 , 2.5X10 and 2.5X10-3 mg /ml fucoidan.
52
Lcl dependent auto-aggregation increases the number of L. pneumophila per infected A.
castellanii.
In initial CLSM analyses, A. castellanii in non-centrifuged infections with Lp02 pGFP and
Lp02Δlpg2644clpg2644 pGFP appeared to contain higher numbers of intracellular L.
pneumophila when infected with aggregates rather than isolated bacteria (Fig. 13A). Meanwhile,
only individual bacteria were internalized in A. castellanii infected with Lp02Δlpg2644 (Fig.
13A). These initial results led us to speculate that the Lcl-dependent auto-aggregation may also
have an impact on the number of internalized L. pneumophila per infected A. castellanii by
potentiating the contact of host cells with multi-cellular Lp02 aggregates rather than isolated
bacteria. To investigate this, the numbers of internalized L. pneumophila were counted per
infected A. castellanii according to our previously described non-centrifuged experimental
conditions with CLSM. Infection assays performed with Lp02 pGFP and complemented mutant
Lp02 Δlpg2644 clpg2644 showed a greater number of internalized L. pneumophila per A.
castellanii in conditions allowing Lcl dependent auto-aggregation (deionised water with MgCl2) than in the absence of Lcl dependent auto-aggregation (deionised water alone) (Fig. 13B). In contrast, in infection assays performed with Lp02Δlpg2644 pGFP, most infected A. castellanii amoebae contained only individual bacterium regardless of the absence or presence of magnesium. This is consistent with the inability of this strain to auto-aggregate.
53
Figure 13. Lcl dependent auto-aggregation increases the number of L. pneumophila per infected A. castellanii. A) Visualization of A. castellanii infection by Lp02 pGFP, Lp02∆lpg2644 pGFP and Lp02∆lpg2644 clpg2644 pGFP in non-centrifuged conditions by fluorescence microscopy and B) quantification of the number of bacteria per infected amoeba in non-centrifuged assays. Scale bar represents 10μm.
54
2.4 Discussion
Bacterial biofilms are important determinants in host colonization for several pathogens (118,
169). Although bacterial auto-aggregation is commonly linked to biofilm production (141, 147,
148, 170), a recent study suggests that these two processes may have phenotypic differences
(145). Here, we demonstrate that among nine Legionella species, L. pneumophila is exclusively
capable of auto-aggregation. The other Legionella species used in this study were previously
shown to neither produce a homologue of Lcl nor to contain a detectable lpg2644 gene (68).
Thus the rare occurrence of these Legionella species in legionellosis patients may be explained
by their deficiency in Lcl dependent aggregation, which may lead to a reduced capacity for
contamination of anthropogenic water systems and therefore reduced contact with humans. To
test the role of Lcl in L. pneumophila auto-aggregation we used an lpg2644 isogenic mutant of
Lp02, which revealed that Lcl is essential for auto-aggregation. This is consistent with the
reported role of auto-aggregation in the formation of L. pneumophila biofilms (33).
Amoebae, the natural hosts of L. pneumophila, often reside on surfaces, in stagnant
environmental water where they are also frequently recovered from biofilms with L.
pneumophila (166, 167). Upon phagocytosis, L. pneumophila bacteria are able to replicate in the
environment within the protozoa host (20, 171). The early time points of infection by amoebae
include the following sequence of events: initial contact of the pathogen with the phagocyte, intimate adherence followed by ingestion (172). Upon initial contact, the intimate adherence of
55
L. pneumophila to the surface of its natural hosts may involve carbohydrate receptors (173). In a previous study, Lcl was shown to bind to fucoidan, a polymer of fucose (68). Interestingly, amoeba expresses fucosylated surface proteins (174, 175). Thus Lcl may also serve as an adhesin for the attachment of L. pneumophila to its environmental hosts. Consistent with this hypothesis, we show that the deletion of lpg2644 in L. pneumophila greatly reduces the ability of Lp02 to infect A. castellanii. In addition to the initial binding of A. castellanii, Lcl dependent auto- aggregation of L. pneumophila also appeared to promote the infection of A. castellanii by facilitating contact between the pathogen and its host. In fact, the aggregation of Chlamydia trachomatis and Chlamydia pneumoniae cells mediated by host collagenous lectins was previously shown to enhance bacterial uptake per phagocyte (176). Interestingly, many cases of legionellosis are linked to the presence of L. pneumophila in stagnant water (57, 58). Thus the
Lcl adhesin may play a dual-role in the life-cycle of L. pneumophila by promoting conditions where the bacteria can both settle and also infect amoebae, increasing the ability of L. pneumophila to replicate and disseminate in the environment. In this study, we show that heterologous expression of lpg2644 in E. coli leads to auto-aggregation and increased biofilm production. Microscopy analysis of E. coli plcl auto-aggregates revealed large clusters with divisions in between. Although these partitions may be due to partial desiccation during imaging experiments, this phenotype was solely observed with E. coli plcl which suggest that it is directly correlated with Lcl synthesis. When Lcl was over-expressed, E. coli formed thick aggregates covered by an extracellular matrix which resembles the typical extracellular polymeric substance reported in other bacterial biofilms (177, 178). Here, we demonstrate that heterologous expression of lpg2644 is sufficient to promote cell-cell interactions, and that surface expression of Lcl is required for L. pneumophila auto-aggregation as suggested by sedimentation assays
56
with a mixed suspension of Lp02 and Lp02Δlpg2644. Taken together, these data suggest that
cell-cell interactions may result from homophilic interactions between surface exposed Lcl
proteins of neighbouring cells. Alternatively, it is possible that Lcl requires unidentified bridging factors that are conserved among E. coli and L. pneumophila species as in the instance of
Aerobacter aerogenes auto-aggregation (179). The phenomenon of heterologous expression of proteins inducing auto-aggregation, is similar to what was observed with the Staphylococcus
aureus adhesin, Protein A, where production of Protein A in Lactococcus lactis was sufficient to
induce both auto-aggregation and biofilm production (180).
We observed that auto-aggregation mediated by Lcl requires the presence of divalent cations.
This finding is correlated with the reported ability of calcium and magnesium to increase the
attachment of L. pneumophila to abiotic surfaces (47). It is thus possible that the role of divalent
cations in initial attachment may be directly related to the ability of L. pneumophila to form auto-
aggregates. Divalent cations have previously been shown to affect the auto-aggregation and the
biofilm production of several bacterial species, by acting as a structural element (160, 181-183)
and also by acting as a signalling molecule (177, 184). Interestingly in all the aforementioned
examples there is specificity in the divalent cation which elicits the response. This is not the case
here, since calcium, zinc and magnesium were equally efficient in inducing Lcl dependent L.
pneumophila auto-aggregation. The halophile, Halobacterium salinarum has also been shown to aggregate in the presence of several different divalent cations (185, 186). Interestingly, both L. pneumophila and H. salinarum are aquatic organisms, and it is possible that the selective pressure for the reliance on several different cations, could arise from differences in the environments where their respective biofilms are being produced. Organisms which produce biofilms in aquatic environments may have acquired the ability to use several different cations
57
because of the scarcity of these ions in their natural environment. During mammalian infections
however, microorganisms that produce biofilms are in environments where there is an abundance
of different divalent cations. For L. pneumophila, although the production of biofilms or
aggregates in the human host remains unexplored, the presence of zinc is associated with
contamination of water sources with L. pneumophila (187) . Moreover, zinc potentiates L.
pneumophila attachment to human alveolar epithelial cells (48). Altogether, the requirement of
divalent cations for Lcl dependent auto-aggregation, the reported roles of Lcl in attachment to
epithelial cells and GAGs and the role of cations in L. pneumophila adhesion suggest that these
correlated Lcl dependent mechanisms may both contribute to the environmental dissemination
and the host colonization of L. pneumophila.
58
Chapter 3: The Role of Lcl Collagenous Repeats in L. pneumophila Biofilm Production, Attachment and Adhesion.
3.1 Introduction The majority of bacterial pathogens are able to produce multicellular structures known as
biofilms (188). Biofilms have been recognized as a serious concern for human health as they
allow pathogens to persist in living hosts or in their natural environment where they may serve as
a source of infection (169, 189). Furthermore the ability to form biofilms also contributes to
environmental dissemination (118, 190). Bacteria within biofilms possess several advantages that
planktonic bacteria do not, such as increased horizontal gene transfer and increased resistance to
antibiotics or environmental stresses (191, 192). These properties make the eradication of these structures extremely difficult once established, and can perpetuate spread of pathogens.
The Gram-negative pathogen Legionella pneumophila is a major cause of hospital and
community acquired pneumonia and the major causative agent of legionellosis (5, 6). During
outbreaks, L. pneumophila is often found in water distribution systems and hot-water tanks (14,
58, 64) where it can be a member of multispecies biofilms (44, 96). L. pneumophila is
ubiquitously found in environmental freshwater (63) where it often coexists and replicates within
various protozoa (19). To date, there have been no reported cases of person to person
transmission of the pathogen Infections by L. pneumophila are believed to be due to the
inhalation of aerosolised particles from contaminated environmental sources (11). Despite the
frequent association of L. pneumophila containing biofilms with suspected source of infections,
only few molecular determinants of L. pneumophila biofilm formation have been identified to
date (33, 72, 82). Elucidation of the mechanisms that L. pneumophila uses to promote the
59
colonisation of water systems and possibly host interactions may provide valuable information
for the prevention of legionellosis.
During the process of biofilm production, surface exposed adhesins often mediate the initial
attachment to abiotic surfaces and host cells (193, 194). Additionally, adhesins may also promote
cell-cell interactions, and subsequent development of bacterial biofilms (114, 195). In few cases,
the same adhesin may facilitate both initial adhesion to surfaces as well as inter-bacterial
physical interactions (119, 120). The Legionella collagen-like protein (Lcl) of L. pneumophila,
was recently reported to be an adhesin with such dual functions and is encoded by the gene
lpg2644 (68, 69). Although L. pneumophila produces several different adhesins, to date Lcl
remains the only adhesin indentified to be involved in biofilm formation of this bacteria. The Lcl
protein contains three different structural regions, an N-terminal region with a predicted signal sequence, a central region containing tandem collagen-like repeats and a C terminal region with no significant homologies to known proteins. The collagenous repeat domain of Lcl is polymorphic in clinical isolates and immunogenic in infected patients (68, 138). Lcl also plays a key role in attachment to lung epithelial cells and A. castellanii (67, 68). Deletion of the
collagen-like domain of recombinant Lcl reduces its ability to bind to host glycosaminoglycans
(GAGs) (68). The biofilm formation of an lpg2644 site directed mutant cannot be restored by
trans-complementation assays in the absence of this domain (69). Initial data also showed that
the over-expression of recombinant polymorphic Lcl proteins in a wild type reference L.
pneumophila strain can influence its adhesion to and invasion within host cells (67). Despite data
indicating that Lcl’s collagenous domain is necessary for biofilm formation and influences the
attachment of L. pneumophila to GAGs, the precise role of Lcl’s collagen like repeats in these
processes remains unknown.
60
In this work, we demonstrate that Lcl’s collagenous repeats are a critical determinant for L.
pneumophila biofilm formation and that the numbers of repeats are positively correlated with the amount of biofilm produced in clinical isolates, as well as under an isogenic background. These differences in the degree of biofilm production are due to differences in both initial attachment and cell-cell interactions, and can influence the structure of the biofilm. Finally, we show that polymorphisms in Lcl’s collagen-like repeats modulate the binding of L. pneumophila to a polymer of sulfated fucose suggesting that it may also play a role in host-pathogen interactions in addition to biofilm formation.
3.2 Materials and Methods Chemicals, bacterial strains and growth conditions.
Unless otherwise indicated, all chemicals were purchased from Sigma. All Legionella
pneumophila isolates (Table 4) were cultured in buffered charcoal-yeast extract (BCYE) agar at
37 °C and 5% CO2 and or with buffered yeast extract (BYE) broth at 37°C with shaking at 100
rpm (152). Cultures of Lp02 were supplemented with thymidine when required (153).
General DNA techniques.
Genomic DNA and plasmid DNA was purified using a QIAamp DNA minikit and a QIA prep
spin miniprep kit (Qiagen) respectively. To quantify DNA, spectrophotometry was used. For
PCR, 10 ng was used as a template and PCR reactions were performed with Taq DNA
polymerase as recommended by the manufacturer (Invitrogen). The PCR primers used are
61
pooled in Table 5. PCR reactions for cloning were performed with Platinum Taq DNA
polymerase high fidelity as per the manufacturer (Invitrogen). All clones were verified by
sequencing. Sequencing reactions were performed using a BigDye terminator cycle sequencing kit, version 3.1 and purified with a BigDye X terminator purification kit and run on a 3130xl genetic analyzer (Applied Biosystems). To measure the approximate size of lpg2644 in clinical isolates primers 1 and 2 were used, and the PCR product was compared to a 2log ladder
(Fermentas). To estimate the number of repeats in lpg2644 from clinical isolates, chromosomal
DNA was amplified with Taq DNA polymerase (Invitrogen) using primers 8 and 9. The PCR product was then compared against a 100 base pair DNA ladder (Fermentas).
Biofilm quantification.
All biofilm assays were performed using polystyrene 96-well plates (Costar). L. pneumophila biofilm assays were performed as previously described (68). Strains were grown for 30hrs in
BYE and diluted to an OD of 0.2 in fresh broth and incubated for 2 days. Biofilms were stained with 40 μl of 0.25% crystal violet per well for 15 minutes and washed three times with 200 μl of sterile deionised water. The crystal violet stain was then solubilised in 95% ethanol and after 15 minutes absorbance was read at 600nm.
Generation of plpg2644 variants with different repeats.
To determine the role that Lcl collagenous repeats have in various biological processes, lpg2644 was PCR amplified using genomic DNA from clinical isolates using primers 1 and 2 (Table 5).
62
PCR products from clinical isolates LU1536, LR1063 and LR0347 (Table 4) were used to create lpg2644 inserts containing 18, 13 and 11 repeats respectively. The resulting PCR products and the vector pBH6119 were then digested with XbaI and SphI to generate compatible ends. The
PCR products were then ligated into the XbaI and SphI digested pBH6119 vector and transformed into E.coli TOP10 strain (Invitrogen). Transformants were selected by carbenicillin resistance on LB agar. Single colonies were then picked, cultured in LB broth with 50μg/ ml carbenicillin for plasmid extraction. After verification the plasmid was then transformed into
Lp02 and Lp02Δlpg2644 (Table 4).
SDS-PAGE and Immunoblot analysis.
SDS-PAGE was performed as previously described (154). Immunoblotting was performed according to the methods of Towbin (155).To detect the presence of specific Legionella proteins, cell lysates were prepared with plate cultures adjusted to an OD600nm of 8, centrifuged at 5000 rpm for 10 minutes and washed twice with PBS. Lysates were then mixed with an equal volume of 2X Laemmli loading buffer with 10% 2-mercaptoethanol, samples were then boiled for 15 minutes before running on gel. Bound anti-Lcl antibodies (1:20,000) were detected with peroxidase-linked anti-rabbit IgG (1:20,000). Recombinant proteins were detected with anti-His mouse antibody (1:5000) (Invitrogen) and anti-mouse peroxidase linked IgG (1:2000).
Quantification of Legionella adherence using quantitative PCR.
63
Quantitative PCR was performed as previously described (68).To measure the binding abilities
of L. pneumophila strains to abiotic surfaces, 100 μl of Legionella suspension adjusted to an
OD600nm of 2 in PBS was incubated for 1h at 37°C and 5% CO2 in polystyrene 96-well plates
(Costar). After three washes with PBS, DNA was purified directly from the wells using a
DNeasy 96 blood and tissue kit according to the manufacturer’s instructions (Qiagen). To measure the percent of attached bacteria, DNA was purified from the initial innoculum that was not washed, and percent attached was calculated as the amount of DNA purified from the washed/unwashed wells. Quantitative PCR (qPCR) was performed using primers and a probe to gyrA (Table 2 codes 5-7). Quantitative PCR was performed with Universal PCR master mix
(Applied Biosystems) using 400nM of each primer and 200nM probe. Amplification and detection was performed with an ABI Prism 7900 detection system. To quantify adherence of bacterial strains to fucoidan the same protocol was followed with 96-well heparin binding plates
(BD Biosciences) coated with 5 μgs of fuocidan as per the manufacturer’s recommendations.
Production and purification of His-Tag fusion proteins.
The lpg2644 gene was amplified from LU1536, LR1063 and LR0347genomic DNA using
primers 3 and 4 (Table5). To obtain an lpg2644 gene with 2 repeats, a gene was designed with
two repeats from sequences that were conserved amongst all the isolates used. This sequence
was then synthesized (Genscript) and put into the pUC57 vector flanked with EcoR1 and Xho1
restriction sites and PCR amplified using primers 3 and 4. The PCR products were cloned into
the pBAD-HisB (Invitrogen) vector according to the instructions of the manufacturer and cloned
into the E. coli LMG194 strain. E. coli LMG194 clones were tested for the expression of
64
recombinant proteins after induction with 0.002% to 0.2% L-arabinose at 37°C for 4 h and the
optimal arabinose concentration for maximum expression was obtained and used for purification.
His-tagged fusion proteins were purified under native conditions with a nickel-Sepharose high-
performance chromatography column (HisTrap HP column) according to the instructions of the
manufacturer (GE Healthcare). A recombinant Lcl (rLcl) protein lacking the collagen-like
tandem repeats (Lcl Δrepeats) was obtained from our previous work (68). All purified fusion
proteins were dialyzed in PBS before use.
ELISAs.
To examine the binding of rLcls to fucoidan, Immunlon 2-HB 96-well plates (VWR) were
coated with 5 mg/ml fucoidan as previously described (196). Wells were then blocked for 1h with 1%BSA-PBS. Recombinant Lcls were diluted in 1% BSA–PBS to a final concentration of
250 nM and diluted 1:10 in 1% BSA–PBS. Afterwards 100 ul was added to each well and incubated at room temperature for 1 h. Wells were washed with PBS–0.5% Tween 20 and probed with rabbit anti-His-rLcl diluted 1:5,000 in 1% BSA–PBS, followed by anti-rabbit antibody conjugated to horseradish peroxidase diluted 1:2,000 in 1% BSA–PBS. Pierce TMB
(3,3′,5,5′-tetramethyl benzidine) ELISA substrate (Fisher Scientific) was used as the substrate for
HRP (horseradish peroxidase), the reactions were stopped after 30 min at room temperature with
2 M sulfuric acid, and the absorbance was determined at 450 nm using a BioTek Powerwave XS
plate reader. All samples were tested in triplicate. To measure the binding of rLcls to abiotic
surfaces, the same protocol as above was performed with uncoated wells and after 1 hour to
allow rLcls to bind, wells were blocked for 1 h with 1%BSA-PBS.
65
Bacterial sedimentation assays.
Sedimentation assays were performed as previously described with a few modifications (150).
To visualize sedimentation, L. pneumophila strains were grown for three days and colonies were
suspended to an OD600nm of 1 in deionised water with 10% BYE. Images were taken immediately after the indicated time period with all incubations being performed at room temperature. To measure sedimentation kinetics, sedimentation assays were performed as described above, and the OD600nm was measured every hour with a spectrophotometer, where a decrease in OD600nm indicates an increase in sedimentation.
Confocal laser scanning microscopy.
For confocal laser scanning microscopic examination (CLSM) of biofilms, bacterial cultures
(800 µl) were prepared in Lab-TekII chamber slides (Labtek II, VWR, Rochester, USA)
according to the procedure described above. After 3 days of incubation at 37°C and 5% CO2,
400 μl of supernatant was removed and bacteria were labelled with the nucleic acid stain SYTO
62 (Molecular probes) diluted 1:25 for 1 hour at RT. Afterwards 400 μl of supernatant was
removed and 8% PFA was added for 20 min followed by two washes with sterile deionised
water. The plastic wells were removed from the slide and fluoromount (DAKO north America
INC, Carpinteria, USA) was added before placing a coverslip on the gasket and observed by
CLSM using a Nikon Eclipse TE2000EZ inverted microscope, 100 X Plan APO oil immersion
DIC N2 objective. Image acquisition and post-acquisition processing were performed using EZ-
66
C1 Software Ver. 3.50 and the NIS-elements BR Software Ver. 3.0 for Nikon C1 Confocal
Microscopy.
Quantification of Hydrophobicity
The hexadecane method was used as previously described (197). Briefly 5ml of logarithmic
phase culture was pelleted, washed and resuspended in 5 ml of PBS One ml of hexadecane was
added vortexed for 1 min and incubated for 10 min at 30°C. Mixtures were then vortexed for an
additional 1 min and allowed to stand for 2 min for phase separation at room temperature. The absorbance of the lower aqueous phase was read at OD600nm and compared against the PBS
control. The Hydrophobicity index was calculated as = [1-(A/A0)] x100, where A is the OD600nm
after hexadecane treatment and A0 is the OD600nm before treatment.
Table 4. Legionella pneumophila strains used in this study
Species Designation Plasmid PredictedSource Lcl size(s)
L. pneumophila Lp02 untransformed 50kDa (153) L. pneumophila Lp02Δlpg2644 untransformed - (68) L. pneumophila Lp02 p pBH6119 50kDa (68) L. pneumophila Lp02Δlpg2644 p pBH6119 - (68) L. pneumophila Lp02Δlpg2644 plpg2644 plpg2644 18rpts 50kDa This study 18rpts L. pneumophila Lp02 plpg2644 18rpts plpg2644 18rpts 50kDa This study L. pneumophila Lp02Δlpg2644 plpg2644 plpg2644 13rpts 42kDa This study 13rpts
67
L. pneumophila Lp02 plpg2644 13rpts plpg2644 13rpts 50,42kDa This study L. pneumophila Lp02Δlpg2644 plpg2644 plpg2644 11rpts 39kDa This study 11rpts L. pneumophila Lp02 plpg2644 11rpts plpg2644 11rpts 50, 39kDa This study L. pneumophila Lp02Δlpg2644 plpg2644 plpg2644 Δrpts 25kDa (69) Δrpts L. pneumophila Lp02 plpg2644 Δrpts plpg2644 Δrpts 50, 25kDa (69) L. pneumophila LU1536 50kDa (68) L. pneumophila LR1063 42kDa (68) L. pneumophila LR0347 39kDa (68)
68
Table 5. Primers and probes used in this study code Primer/ Amplification Sequence 5’ to 3’ probe target
1 lpg2644 lpg2644 GGTCATCTAGAGAAATAAAGAATGATACATCGA Xba1 F 2 lpg2644 GTGAGCGCATGCGCAAAGCGAATTTATGAACA Sph1 R 3 lpg2644 AGCTCGAGCAATCCGGCCTCGCAAGCC Xho1 F 4 lpg2644 CGGAATTCCGGGTTGCGAGAGTTGGCTA EcoR1 R 5 gyrA F gyrA GGCGGGCAAGGTGTTATTT 6 gyrA R GCAAGGAGCGGACCACTTT 7 gyrA VIC-CATTTCGTTCGTAACCTG-MGBNFQ probe 8 Lpms31 L lpg2644 repeats GCAATCCGGCCTCGCAAGCC 9 Lpms31 R CAGGCACACCTTGGCCGTCA
3.3 Results Polymorphisms in the number of lpg2644 collagenous repeats are positively correlated to biofilm production in clinical isolates.
Biofilm formation of clinical strains LU1536, LR1063 and LR0347 were compared. After two days, LU1536 produced 90% fold more biofilm than LR1063 (Fig. 14A). The strain LR1063 in turn, produced approximately twice as much biofilm as the LR0347 strain. In these assays, there was no significant difference in growth between strains, indicating that differences in biofilm production were not due to differences in cell proliferation (data not shown). Based on previous
69
studies indicating that Lcl collagenous repeats are polymorphic among clinical isolates (67, 138), and are essential for the production of L. pneumophila biofilm (69), we next hypothesised that the differences in biofilm production observed with LU1536, LR1063 and LR0347 could be due to polymorphisms in the Lcl collagen-like domain. PCR amplification of lpg2644 from clinical isolates LU1536, LR1063 and LR0347 using flanking primers led to amplicons that were approximately 1.5kb, 1.3kb and 1.25kb respectively (Fig. 14B). These PCR amplicons were next
Sanger sequenced and their predicted amino-acid sequences were then compared by alignment
(Fig.15). In accordance with previously reported nomenclature by Pourcel et al, a single repeat was denoted as 5 Gly-Xaa-Yaa tripeptides (15 amino acids total) within the central tandem collagenous repeat domain (138). Using this designation, the predicted amino acid sequences of
Lcl isoforms from LU1536, LR1063 and LR0347 contained 18, 13 and 11 repeats respectively
(Fig. 16). When the predicted Lcl sequences of LU1536, LR1063 and LR0347 were compared there was 94.9%, 95% and 99.5% amino acid homology between LU1536 and LR1063 strains,
LU1536 and LR0347 strains and LR1063 and LR0347 strains respectively (Table 6). The predicted amino acid sequence of Lcl from the L. pneumophila Philadelphia reference strain,
Lp02, was 100% identical to LU1536. Taken together, these results indicate that the sequence polymorphisms in lpg2644 homologues from clinical isolates LU1536, LR1063 and LR0347 are mainly due to the number of repeats coding for collagenous amino acid sequences.
70
Figure 14. Polymorphisms in the number of lpg2644 collagenous repeats are positively correlated to biofilm production in clinical isolates. (A) Biofilm production after two days quantified by crystal violet staining and (B) PCR amplification of lpg2644 from clinical strains LU1536, LR1063 and LR0347. * indicates statistically significant differences with p>0.05 by the students
71
Figure 15. Clinical isolates LU1536, LR1063 and LR0347 contain size polymorphisms in their predicted Lcl sequences. Alignment of the predicted Lcl amino acid sequences from LU1536 which contains 18 repeats (first row), LR1063 which contains 13 repeats (second row) and LR0347 (third row).
72
Figure 16. Schematic representation of the different Lcl isoforms in this study. The light grey boxes represent the N-terminal signal peptide, dark grey boxes represent 15 amino acid repeats containing collagenous sequences and the black boxes represent the C-terminal domain.
Table 6. Comparison of predicted amino acid sequences in Lcl isoforms
Sequences being compared Origin of sequence Shared identity
Lcl 18repeats - Lcl 13repeats LU1536-LR1063 95% Lcl 18repeats - Lcl 11repeats LU1536- LR0347 94.9% Lcl 13repeats – Lcl 11repeats LR1063-LR0347 99.5%
73
The number of Lcl collagenous repeats are correlated with L. pneumophila biofilm
production in an isogenic background.
To evaluate if the polymorphisms observed in the lpg2644 homologues are sufficient to explain
the differences in L. pneumophila biofilm production of LU1536, LR1063 and LR0347, we
investigated the expression of these lpg2644 homologues in an isogenic background. To test this,
lpg2644 from LU1536 containing 18 repeats, LR1063 containing 13 repeats and LR0347
containing 11 repeats were PCR amplified and cloned into the Legionella expression vector
pBH6119 under the control of the icmR promoter (Table 4, primers 1 and 2). These plasmids
were named plpg2644 18rpts, plpg2644 13rpts and plpg2644 11rpts respectively. These
constructs were then transformed into the lpg2644 knock out strain, Lp02∆lpg2644 (KO), and
the Lp02 wild type (WT) strain (Table1). In addition the KO and WT strains transformed with
the pBH6119 expression vector containing lpg2644 with the repeats deleted (Lp02Δlpg2644
plpg2644 ∆rpts and Lp02 plpg2644 ∆rpts respectively) were taken from a previous study (69).
Lcl expression was assessed using anti-Lcl immunoblotting with cell lysates from transformed
WT and KO strains. In the KO and KO transformed with the empty vector, no proteins reacted with anti-Lcl antibodies with the exception of a nonspecific band at approximately 42kDa (Fig.
17A and B). The remaining strains produced proteins that reacted with anti-Lcl antibodies that
ranged from 50-25kDa (Fig. 17A and B). These observed bands are consistent with the predicted
sizes of the Lcl variants produced by these strains (Table 4). In some cases, other bands were
observed with different molecular masses than expected, these bands presumably reflect the
degradation or the maturation of Lcl proteins, as they were absent from the lpg2644 knockout
strain.
74
When biofilm production was quantified with the transformed Lp02Δlpg2644 strains, there was a
positive correlation between biofilm production and the number of lpg2644 repeats (r2 =0.9110 /
r=0.9544) when comparing Lp02 Δlpg2644 transformed with plpg2644 18, 13, 11 and ∆rpts
(Fig. 17C). As previously reported, transformation of Lp02Δlpg2644 with plpg2644 ∆rpts did not restore biofilm production (69). This suggests that the number of lpg2644 repeats positively influences L. pneumophila biofilm formation. WT strains over-expressing the various Lcl isoforms had a positive correlation between the number of lpg2644 repeats in the transformed
plasmid and the amount of biofilm produced (r2 =0.8499 / r=0.9219), albeit to a slightly lesser
degree than observed with the transformed knockout strains (Fig. 17D). Wild type Lp02
transformed with plpg2644 ∆rpts showed a marked decrease in biofilm production as previously
reported (69) (Fig. 17D). Taken together, these data suggest that lpg2644 isoforms exert a
dominant negative effect on biofilm formation when expressed in a wild type background.
Importantly, the empty vector controls (Lp02Δlpg2644 pBH6119 and Lp02 pBH6119) did not
show significant differences in biofilm formation in comparison to their respective
untransformed strains. Additionally, there were no significant differences in growth between the
strains used, demonstrating that differences in biofilm production were not due to variations in
growth (data not shown).
75
Figure 17. The number of Lcl collagenous repeats are correlated with L. pneumophila biofilm production in an isogenic background. Anti-Lcl immunoblot with cell lysate from (A) Lp02Δlpg2644 (KO) transformed strains and (B) Lp02 (WT) transformed strains. Adherent biomass of two day old biofilms quantified by crystal violet staining with (C) Lp02Δlpg2644 transformed strains and (D) Lp02 transformed strains.*,** and *** indicates statistically significant differences with Lp02Δlpg2644 plpg2644 11rpts, Lp02 plpg2644 11rpts and the indicated strains respectively with p<0.05by the students t-test.
76
Lcl collagenous repeats impact L. pneumophila-abiotic surface interactions.
Previously, we demonstrated that deletion of lpg2644 in Lp02 resulted in a significant decrease
in attachment to abiotic surfaces, which is a crucial step during biofilm formation (69). Based on
this finding, we assessed if differences in biofilm production correlated to polymorphisms in Lcl could be explained by variations in initial attachment. Attachment to polystyrene of
Lp02Δlpg2644 and Lp02 strains expressing polymorphic Lcls was measured by qPCR as previously described (69). In accordance with past reports, the attachment of Lp02 Δlpg2644 to polystyrene was reduced by 56% compared to the wild type Lp02 strains (P≤0.01, Fig. 18A). In contrast, Lp02Δlpg2644 strains expressing different Lcl variants had a positive correlation
between the number of repeats in the Lcl polymorphism expressed, and attachment to
polystyrene (r2 =0.9851 / r=0.9925). Lp02Δlpg2644 plpg2644 Δrpts, had a similar low attachment to polystyrene as the lpg2644 knockout strain (Fig. 18A). This suggests that that the collagenous repeat domain of Lcl is important for attachment to abiotic surfaces. Lp02Δlpg2644 plpg2644 11rpts and Lp02Δlpg2644 plpg2644 13rpts demonstrated significantly less attachment to polystyrene than WT (Fig. 18A). This suggests that the number of Lcl repeats positively influences the attachment of L. pneumophila to abiotic surfaces. WT strains over-expressing
polymorphic Lcls showed no significant differences in attachment to polystyrene compared to
Lp02, and had a significantly greater attachment to polystyrene than KO (Fig. 18B). This is in
striking contrast to the results obtained with biofilm production, where a dominant negative
effect was observed when Lcl isoforms were expressed in Lp02 (Fig. 17D). This suggests that
there is no dominant negative effect on attachment of L. pneumophila to abiotic surfaces when
Lcl isoforms containing less repeats are overexpressed in Lp02.
77
Figure 18. Lcl collagenous repeats impact L. pneumophila-abiotic surface interactions. Attachment of Lp02Δlpg2644 transformed strains (A) and Lp02 transformed strains (B) to polystyrene measured by qPCR. (C) Coomassie stained gel and anti-His immunoblot of purified recombinant Lcl (rLcl) proteins with 18, 13, 11, 2 and Δrepeats. (D) Binding of purified rLcl proteins to polystyrene estimated by ELISA. * and ** denotes statistically significant differences with the untransformed WT strain and the indicated strains respectively with P<0.01 by the students t-test.
78
We next sought to test if differences in initial attachment of the various complemented
Lp02Δlpg2644 strains could be explained by differences in Lcl-polystyrene binding. Purified
recombinant His tagged –Lcl (rLcl) isoforms containing 18, 13,11,2 and Δ repeats were
incubated in the wells of a 96-well plate. Following incubation, binding of rLcl protein to the
wells was estimated by ELISA using anti-His antibodies. To ensure that equal amounts of
protein were used in binding assays, recombinant proteins were analysed by coomassie staining and anti-His immunoblotting (Fig. 18C). Interestingly, there were no significant differences in binding to polystyrene between any of the rLcl variants tested (Fig. 18D). This suggests that although Lcl collagenous repeats influence initial attachment, this may be due to other mechanisms than direct interactions between Lcl and abiotic surfaces.
Lcl collagenous repeats influence L. pneumophila cell-cell interactions and sedimentation.
We previously reported that Lcl promotes cell-cell interactions during biofilm formation and
mediates auto-aggregation of L. pneumophila in sedimentation assays (69). Thus, we
hypothesised that the collagenous repeats of Lcl could be essential in these processes and that
polymorphisms in this domain could also influence the degree of cell-cell interactions between L.
pneumophila bacteria. These interactions were assessed by performing sedimentation assays with
bacterial suspensions (118-120). As expected, deletion of lpg2644 prevented the sedimentation
of Lp02Δlpg2644 (Fig. 19A). Complementation assays of Lp02Δlpg2644 with plpg2644
containing 18, 13 and 11 repeats could restore its sedimentation while transformation with
plpg2644 ∆rpts could not (Fig. 19A). This suggests that the repeat domain of Lcl is essential for
the cell-cell interactions mediated by Lcl. All wild type strains expressing recombinant Lcl
79
isoforms with the exception of Lp02 plpg2644 Δrpts were able to sediment (Fig. 19B). Lp02
plpg2644 Δrpts in contrast appeared to have a small subset of cells which sedimented with the
majority of the bacteria remaining in suspension. This dominant negative effect may be similar to the dominant negative effect observed while measuring the biofilm production of this strain.
Quantification of the rate and degree of sedimentation revealed no significant differences
between the transformed KO strains (Fig. 19C), with the exception of Lp02Δlpg2644 plpg2644
∆rpts which did not sediment, confirming that the repeat domain of Lcl is essential for
sedimentation. Similarly, the Lp02 strains over-expressing Lcl isoforms showed no differences
in degree or rate of sedimentation with the exception of Lp02 plpg2644 Δrpts (Fig. 19D).
Surprisingly, Lp02 plpg2644 Δrpts had no significant decrease in OD600nm throughout the time
course of kinetic analyses while a cluster of sedimented cells could be observed Figure 19B. The
discrepancy between these 2 different assays may be explained the incubation time (overnight vs
5 hours). All strains over-expressing a recombinant Lcl variant with collagenous repeats,
sedimented faster and to a greater degree than the wild type regardless of the number of
collagen-like repeats. This is in agreement with past studies demonstrating that over-expression of Lcl increases the sedimentation of L. pneumophila.
80
Figure 19. Lcl collagenous repeats influence L. pneumophila cell-cell interactions and sedimentation. Auto-aggregation of Lp02∆lpg2644 transformed strains and Lp02 transformed strains visualized by tube sedimentation assays after overnight incubation at room temperature (A and B respectively) and sedimentation kinetics (C and D respectively).
81
Lcl collagenous repeats are crucial for L. pneumophila biofilm structure.
Based upon data suggesting that the Lcl collagen-like domain is involved in cell-cell interactions and initial attachment, and the importance of these processes in biofilm production and architecture (114, 115, 198), we next investigated the influence of the number of Lcl repeats on biofilm structure. To visualize biofilms, bacteria were labelled with the membrane permeable nucleic acid stain SYTO 62 and analyzed by CLSM. Biofilms produced by Lp02 were confluent and approximately 75µm thick (Fig. 20A). In contrast, assays with Lp02Δlpg2644 showed small
sparsely appearing clusters of cells, consistent with the lack of biofilm produced by this strain.
Complementation of Lp02Δlpg2644 with plasmids coding for lpg2644 with 18 and 13 repeats
resulted in biofilms that were between 70-80µm thick (Fig. 20B). Lp02Δlpg2644 plpg2644
11rpts in comparison, produced significantly (P<0.05) thinner biofilms of approximately 55µm
in thickness. This suggests that the number of Lcl collagenous repeats can influence the
thickness and possibly the robustness of L. pneumophila biofilms. The morphology and thickness
of Lp02Δlpg2644 plpg2644 ∆rpts was not significantly different from the KO, confirming that
the repeat domain of Lcl is essential for biofilm production (Fig. 20B).
82
Figure 20. Lcl collagenous are crucial for L. pneumophila biofilm structure. (A) 3-D reconstruction of 0.45 μm Z-stacks of biofilms and (B) quantification of biofilm thickness of 3 day old biofilms formed on glass chambered coverslips produced by Lp02 and Lp02∆lpg2644 transformed strains stained with Syto 62. * and ** indicates statistically significant differences between the indicated strains and untransformed Lp02 respectively. Images were aquired with a 100X objective.Scale bars represent 100μm.
83
Polymorphisms in Lcl collagenous repeats influence the binding of recombinant Lcl to
fucoidan and the attachment of L. pneumophila to fucoidan.
Binding to fucosylated surface receptors is necessary for efficient infection of the respiratory pathogen Pseudomonas aeruginosa (199, 200). Notably, Lcl has been shown to bind to fucoidan, a polymer of fucose, and is involved in the binding of L. pneumophila to lung epithelial cells and
Acanthamoeba castellanii (67, 68). We next investigated the impact of Lcl collagenous repeats on the attachment of L. pneumophila to fucoidan. Deletion of lpg2644 resulted in an 80% decrease in fucoidan binding, consistent with previously reported data (Fig. 21A) (69). Although there were no significant differences in attachment between the Lp02 wildtype strain and the KO complemented with lpg2644 containing 18, and 13 repeats (Fig. 21A), there was a correlation between the number of Lcl repeats and fucoidan attachment of the transformed KO strains (r2
=0.9096 / r=0.9573). Lp02∆lpg2644 plpg2644 11rpts was able to attach to fucoidan greater than
KO, however this strain had significantly less attachment than Lp02 (18 repeats). Furthermore
Lp02Δlpg2644 plpg2644 ∆rpts, showed a similar low attachment to fucoidan as the KO strain, indicating that the repeat domain of Lcl is important for fucoidan binding. Over-expression of the different lpg2644 variants in a WT genetic background led to a correlation between the number of lpg2644 repeats in the transformed plasmid and attachment to fucoidan(r2 =0.7604 /
r=0.8720) with Lp02 plpg2644 11rpts attaching significantly less than WT but greater than KO
(Fig. 21B). This suggests that the number of Lcl collagenous repeats exerts a dominant negative
effect on fucoidan binding.
84
Using ELISAs, we next measured the effect of the number of Lcl collagenous repeats on the
binding of rLcl protein to fucoidan. Lcl variants harbouring 18 and 13 repeats, had 3-5fold
greater affinity (P<0.05) to fucoidan than the Lcl variant containing 11, 2 and Δrepeats (Fig.
21C). Furthermore Lcl variants with 11, 2 and zero repeats had no significant differences in fucoidan binding between each other. Interestingly, rLcl containing 13 repeats had approximately 33% greater affinity to fucoidan than rLcl 18repeats (Fig. 21C). This is in contrast with the affinity of L. pneumophila strains expressing these variants, where there were no observable differences in fucoidan binding.
85
Figure 21. The number of Lcl collagenous repeats influences fucoidan binding of L. pneumophila and recombinant Lcl. Fucoidan binding of (A) the lpg2644 knockout (KO) transformed strains and (B) wild type (WT) transformed strains measured by qPCR. C) Binding of rLcl variants to fucoidan coated wells measured by ELISA. The ELISA results are shown with the OD450nm from the antibody alone control subtracted from each condition. * and ** indicates statistically significant differences between the untransformed wild-type and the indicated strains respectively with p<0.05 by the students t-test.
86
Lcl collagenous repeats influence L. pneumophila clinical prevalence.
Being able to produce greater amounts of biofilm may allow L. pneumophila to persist in anthropogenic structures where they can infect humans. Furthermore, increased affinity to host cell receptors containing fucose may increase the virulence of L. pneumophila by increasing the ability to attach and thus invade host cells. Based on the potential role of Lcl collagenous repeats in these processes, we next examined the prevalence of clinical strains containing an lpg2644 gene with 18, 13 and 11 repeats. After PCR amplifying 282 L. pneumophila clinical isolates, isolates with 18, 13 and 11 lpg2644 repeats comprised 6.8% (19 isolates), 2.1% (6 isolates) and
1.8% (5 isolates) of the total strains respectively. This suggests that the number of lpg2644 repeats may influence the clinical prevalence of L. pneumophila (Fig. 22).
87
Figure 22. Lcl collagenous repeats influence L. pneumophila clinical prevalence. Clinical prevalence of French L. pneumophila clinical isolates containing lpg2644 genes with 18,13 and 11 repeats
88
3.4 Discussion Prokaryotic collagen-like proteins are a versatile group of microbial factors that are produced by several pathogenic bacteria (201-204). These proteins participate in a wide variety of processes during host infection (205-209), and recently have been implicated in biofilm production (197).
Here, we demonstrate that, in L. pneumophila, polymorphisms in Lcl’s collagenous repeat domain are directly correlated with the degree and thickness of biofilms produced. In the environment, the production of biofilm provides a protective niche to L. pneumophila against stresses (37, 38). Thus L. pneumophila strains that have evolved to produce more biofilms are likely to persist and colonize their environment more efficiently which may increase the likelihood of the bacterium to come into contact with human hosts. Consistent with this notion, in this study we show that clinical strains synthesizing Lcl with 11 and 13 repeats produce less biofilm and are less clinically prevalent than isolates containing lpg2644 genes with 18 repeats.
Based on these data it is possible that Lcl’s collagenous repeats may be used as a biomarker for strains that are prevalent in the environment, and therefore giving an indicator of the potential risk that these isolates pose towards humans.
For pathogenic bacteria, the successful establishment of an infection depends on an arsenal of molecules that facilitates tissue colonization and adherence to host cells and extracellular matrix
(ECM) components (126). Bacterial adhesion is essential to escape mechanical clearance and to establish the focal point of an infection from which dissemination will occur (211). The ability of bacteria to bind to matrices or specific host receptors is mediated by surface adhesin proteins.
Polymorphisms in the tandem repeats of these adhesins can both positively or negatively alter host cell adhesion (141, 210). In the present study, L. pneumophila isolates synthezing Lcl
89
variants that poorly bind fucoidan (lpg2644 11 repeats) are not commonly isolated from humans.
Interestingly, the estimated affinity of rLcl proteins for fucoidan was non-linear with respect to the number of repeats. This suggests that polymorphisms in the collagenous repeat domain interfere with the GAG binding site(s) of Lcl. In other adhesins, the number of repeats was implicated in cell surface positioning and presentation of ligand binding domains (211, 212). It can also influence the functional specificity of adhesins (213). In previous work, the over- expression of Lcl proteins with 19 repeats in a wild type strain was shown to specifically increase the binding of L. pneumophila to macrophages while over-expression of a Lcl protein with 14 repeats only increased the binding to epithelial cells (67), suggesting that Lcl may bind multiple host receptors. As there is no human to human spread of L. pneumophila and the natural environment constitutes the main selective pressure for these intracellular bacteria, we speculate that the polymorphisms in Lcl may also mediate the attachment of L. pneumophila to different natural host receptors.
During biofilm formation, the initial attachment of L. pneumophila to abiotic surfaces is mediated by Lcl (69). Here we determined that polymorphisms in Lcl’s collagenous repeats can influence the degree of attachment of L. pneumophila to abiotic surfaces. This finding may explain the correlation between the number of Lcl repeats and biofilm production when variants are expressed in an Lp02Δ lpg2644 isogenic background. In fact binding to abiotic surfaces is correlated with the biofilm formation abilities of other drinking water-isolated bacteria (214).
These differences in L. pneumophila however are not due to direct Lcl-abiotic surface interactions as binding of purified rLcl isoforms to polystyrene was low regardless of the number of collagenous repeats. Interestingly, during biofilm production, binding to components of the extracellular matrix is believed to facilitate stronger attachment to abiotic surfaces (215-217)
90
Therefore it is possible that Lcl acts as an intermediate during abiotic surface binding, by
interacting with other factors that facilitate adhesion. Alternatively, Lcl may alter the surface properties of L. pneumophila therefore potentiating the attachment of the bacteria to surfaces. In fact, surface hydrophobicity is known to be crucial during biofilm formation, as this can increase the strength of bacteria-surface interactions (214, 217). Yet paradoxically, deletion of lpg2644 results in an increase in surface hydrophobicity (Fig. 23), suggesting that Lcl may have the opposite effect.
In this study we show that over-expression of Lcl isoforms containing different numbers of repeats in the wild type Lp02 strain results in dominant negative effects in biofilm production and fucoidan binding, while sedimentation and abiotic attachment are unchanged. Although the decrease in biofilm production of the Lp02 plpg2644Δrpts strain may be explained by a decrease in cell-cell interactions, based on the poor sedimentation of this strain, the cause of the dominant negative effect observed with wild-type strains over-expressing Lcl with 11 and 13 repeats remains unclear. It suggests that recombinant Lcl variants interact with the endogenous Lcl using their conserved C-terminal or N-terninal domains. Similarly, the Group A Streptococcus adhesion and biofilm mediator Scl-1 has a “lollipop-like” structure where the collagen-like domain comprises the stalks that are capable of interacting with one another, while other peptides make up the head region that is capable of binding (209, 218). Although the structure of
Lcl is unknown, it is possible that Lcl may have a similar shape, therefore allowing Lcl’s collagenous repeats to influence other domains.
91
Figure 23. Lcl influences L. pneumophila surface hydrophobicity. Surface hydrophobicity of Lp02 and Lp02Δ lpg2644 measured by the hexadecane binding method.
92
4 Conclusion
In this study, we demonstrate that the surface exposed adhesin, Lcl, can contribute to the
virulence of L. pneumophila in several ways. Lcl is capable of mediating multicellular behaviour to induce formation of auto-aggregates. Lcl also is a key player in the initial attachment of L. pneumophila to natural host cells such as A. castellanii. Furthermore the ability to form auto- aggregates increases the infectivity of protozoa by promoting contacts between the bacteria and host cells. The collagenous domain of Lcl is highly polymorphic among clinical isolates and these polymorphisms can influence biofilm formation. Lcl repeat polymorphisms also influences the attachment to fucoidan, suggesting that this region may also mediate the attachment of L. pneumophila to host cells. The Lcl variants which allow the production of more robust biofilms and have higher affinity for fucoidan is also more common among prevalent clinical isolates.
Taken together this demonstrates that Lcl is a crucial factor involved in both the lifecycle and the virulence of this pathogen.
These findings may help us to improve our understanding of the environmental factors governing the ecology of L. pneumophila. In the long term, these findings may lead to the design of alternative disinfection strategies that could more efficiently prevent colonization of man-made water systems by L. pneumophila.
93
References
1. Sanford, J. P. 1979. Legionnaires' disease: one person's perspective. Ann. Intern. Med. 90:699-703.
2. Fraser, D. W., T. R. Tsai, W. Orenstein, W. E. Parkin, H. J. Beecham, R. G. Sharrar, J. Harris, G. F. Mallison, S. M. Martin, J. E. McDade, C. C. Shepard, and P. S. Brachman. 1977. Legionnaires' disease: description of an epidemic of pneumonia. N. Engl. J. Med. 297:1189-1197. doi: 10.1056/NEJM197712012972201.
3. McDade, J. E., C. C. Shepard, D. W. Fraser, T. R. Tsai, M. A. Redus, and W. R. Dowdle. 1977. Legionnaires' disease: isolation of a bacterium and demonstration of its role in other respiratory disease. N. Engl. J. Med. 297:1197-1203. doi: 10.1056/NEJM197712012972202.
4. Chandler, F. W., M. D. Hicklin, and J. A. Blackmon. 1977. Demonstration of the agent of Legionnaires' disease in tissue. N. Engl. J. Med. 297:1218-1220. doi: 10.1056/NEJM197712012972206.
5. Yu, V. L., J. F. Plouffe, M. C. Pastoris, J. E. Stout, M. Schousboe, A. Widmer, J. Summersgill, T. File, C. M. Heath, D. L. Paterson, and A. Chereshsky. 2002. Distribution of Legionella Species and Serogroups Isolated by Culture in Patients with Sporadic Community- Acquired Legionellosis: An International Collaborative Survey. J. Infect. Dis. 186:127-128.
6. Carratalà, J., N. Fernández-Sabé, L. Ortega, X. Castellsagué, B. Rosón, J. Dorca, A. Fernández-Agüera, R. Verdaguer, J. Martínez, F. Manresa, and F. Gudiol. 2005. Outpatient care compared with hospitalization for community-acquired pneumonia: a randomized trial in low-risk patients. Ann. Intern. Med. 142:165.
7. Neil, K., and R. Berkelman. 2008. Increasing incidence of legionellosis in the United States, 1990-2005: changing epidemiologic trends. Clin. Infect. Dis. 47:591-599. doi: 10.1086/590557; 10.1086/590557.
8. Svarrer, C. W., C. Luck, P. L. Elverdal, and S. A. Uldum. 2012. Immunochromatic kits Xpect Legionella and BinaxNOW Legionella for detection of Legionella pneumophila urinary antigen have low sensitivities for the diagnosis of Legionnaires' disease. J. Med. Microbiol. 61:213-217. doi: 10.1099/jmm.0.035014-0; 10.1099/jmm.0.035014-0.
9. Berdal, B. P., C. E. Farshy, and J. C. Feeley. 1979. Detection of Legionella pneumonophila antigen in urine by enzyme-linked immunospecific assay. J. Clin. Microbiol. 9:575-578.
10. Bentham, R. H., and C. R. Broadbent. 1993. A model for autumn outbreaks of Legionnaires' disease associated with cooling towers, linked to system operation and size. Epidemiol. Infect. 111:287-295.
94
11. Fields, B. S., R. F. Benson, and R. E. Besser. 2002. Legionella and Legionnaires' Disease: 25 Years of Investigation. Clin. Microbiol. Rev. 15:506-526.
12. Feazel, L. M., L. K. Baumgartner, K. L. Peterson, D. N. Frank, J. Kirk Harris, and N. R. Pace. 2009. Opportunistic pathogens enriched in showerhead biofilms. Proc. Natl. Acad. Sci. U. S. A. 106:16393-16398.
13. McEvoy, M., N. Batchelor, G. Hamilton, A. MacDonald, M. Faiers, A. Sills, J. Lee, and T. Harrison. 2000. A cluster of cases of legionnaires' disease associated with exposure to a spa pool on display. Commun. Dis. Public Health. 3:43.
14. Wadowsky, R. M., R. B. Yee, L. Mezmar, E. J. Wing, and J. N. Dowling. 1982. Hot water systems as sources of Legionella pneumophila in hospital and nonhospital plumbing fixtures. Appl. Environ. Microbiol. 43:1104-1110.
15. Hindre, T., H. Bruggemann, C. Buchrieser, and Y. Hechard. 2008. Transcriptional profiling of Legionella pneumophila biofilm cells and the influence of iron on biofilm formation. Microbiology. 154:30-41.
16. Pécastaings, S., M. Bergé, K. M. Dubourg, and C. Roques. 2010. Sessile Legionella pneumophila is able to grow on surfaces and generate structured monospecies biofilms. Biofouling. 26:809.
17. Kwon, S., E. Moon, T. Kim, S. Hong, and H. Park. 2009. Pyrosequencing Demonstrated Complex Microbial Communities in a Membrane Filtration System for a Drinking Water Treatment Plant. Microbes and Environments. 26:1103150283-155.
18. Murga, R., T. S. Forster, E. Brown, J. M. Pruckler, B. S. Fields, and R. M. Donlan. 2001. Role of biofilms in the survival of Legionella pneumophila in a model potable-water system. Microbiology. 147:3121.
19. Rowbotham, T. J. 1981. Pontiac Fever, Amoebae and Legionellae. The Lancet. 317:40-41.
20. Molmeret, M., M. Horn, M. Wagner, M. Santic, and Y. Abu Kwaik. 2005. Amoebae as training grounds for intracellular bacterial pathogens. Appl. Environ. Microbiol. 71:20-28.
21. Steinert, M., U. Hentschel, and J. Hacker. 2002. Legionella pneumophila: an aquatic microbe goes astray. FEMS Microbiol. Rev. 26:149-162.
22. Yan, L., R. L. Cerny, and J. D. Cirillo. 2004. Evidence that hsp90 is involved in the altered interactions of Acanthamoeba castellanii variants with bacteria. Eukaryotic Cell. 3:567-578.
23. Chaabna, Z., Françoise Forey, M. Reyrolle, S. Jarraud, Danièle Atlan, D. Fontvieille, and C. Gilbert. 2013. Molecular diversity and high virulence of Legionella pneumophila strains isolated from biofilms developed within a warm spring of a thermal spa. BMC Microbiology. 13:17-17.
95
24. Abu Khweek, A., N. S. Fernandez Davila, K. Caution, A. Akhter, B. A. Abdulrahman, M. Tazi, H. Hassan, L. A. Novotny, L. O. Bakaletz, and A. O. Amer. 2013. Biofilm-derived Legionella pneumophila evades the innate immune response in macrophages. Front. Cell. Infect. Microbiol. 3:18. doi: 10.3389/fcimb.2013.00018; 10.3389/fcimb.2013.00018.
25. Barker, J., P. A. Lambert, and M. R. Brown. 1993. Influence of intra-amoebic and other growth conditions on the surface properties of Legionella pneumophila. Infect. Immun. 61:3503- 3510.
26. Newsome, A. L., M. B. Farone, S. G. Berk, and J. H. Gunderson. 2001. Free living amoebae as opportunistic hosts for intracellular bacterial parasites. J. Eukaryot. Microbiol. Suppl:13S-14s.
27. Rowbotham, T. J. 1983. Isolation of Legionella pneumophila from clinical specimens via amoebae, and the interaction of those and other isolates with amoebae. J. Clin. Pathol. 36:978- 986.
28. Skinner, A. R., C. M. Anand, A. Malic, and J. B. Kurtz. 1983. Acanthamoebae and environmental spread of Legionella pneumophila. Lancet. 2:289-290.
29. Taylor, M., K. Ross, and R. Bentham. 2009. Legionella, Protozoa, and Biofilms: Interactions within Complex Microbial Systems. Microb. Ecol. 58:538-547.
30. Valster, R. M., B. A. Wullings, and d. K. van. 2010. Detection of protozoan hosts for Legionella pneumophila in engineered water systems by using a biofilm batch test. Appl. Environ. Microbiol. 76:7144-7153.
31. Valster, R. M., B. A. Wullings, d. B. van, and d. K. van. 2011. Relationships between free- living protozoa, cultivable Legionella spp., and water quality characteristics in three drinking water supplies in the Caribbean. Appl. Environ. Microbiol. 77:7321.
32. Liu, R., Z. Yu, H. Guo, M. Liu, H. Zhang, and M. Yang. 2012. Pyrosequencing analysis of eukaryotic and bacterial communities in faucet biofilms. Sci. Total Environ. 435-436:124- 131.
33. Mampel, J., T. Spirig, S. S. Weber, J. A. J. Haagensen, S. Molin, and H. Hilbi. 2006. Planktonic Replication Is Essential for Biofilm Formation by Legionella pneumophila in a Complex Medium under Static and Dynamic Flow Conditions. Appl. Environ. Microbiol. 72:2885-2895.
34. Temmerman, R., H. Vervaeren, B. Noseda, N. Boon, and W. Verstraete. 2006. Necrotrophic growth of Legionella pneumophila. Appl. Environ. Microbiol. 72:4323-4328.
35. Declerck, P., J. Behets, V. van Hoef, and F. Ollevier. 2007. Replication of Legionella pneumophila in floating biofilms. Curr. Microbiol. 55:435-440.
96
36. Hsu, B., C. Huang, J. Chen, N. Chen, and J. Huang. 2011. Comparison of potentially pathogenic free-living amoeba hosts by Legionella spp. in substrate-associated biofilms and floating biofilms from spring environments. Water Res. 45:5171-5183.
37. Atlas, R. M. 1999. Legionella: from environmental habitats to disease pathology, detection and control. Environ. Microbiol. 1:283.
38. Hoffman, P. S. 1997. Invasion of eukaryotic cells by Legionella pneumophila: A common strategy for all hosts? The Canadian Journal of Infectious Diseases. 8:139.
39. Donlan, R. M., T. Forster, R. Murga, E. Brown, C. Lucas, J. Carpenter, and B. Fields. 2005. Legionella pneumophila associated with the protozoan Hartmannella vermiformis in a model multi-species biofilm has reduced susceptibility to disinfectants. Biofouling. 21:1-7.
40. Thomas, V., T. Bouchez, V. Nicolas, S. Robert, J. F. Loret, and Y. Lévi. 2004. Amoebae in domestic water systems: resistance to disinfection treatments and implication in Legionella persistence. J. Appl. Microbiol. 97:950-963.
41. Storey, M. V., J. Winiecka-Krusnell, N. J. Ashbolt, and T. Stenström. 2004. The efficacy of heat and chlorine treatment against thermotolerant Acanthamoebae and Legionellae. Scand. J. Infect. Dis. 36:656-656.
42. Wright, J. B., I. Ruseska, M. A. Athar, S. Corbett, and J. W. Costerton. 1989. Legionella pneumophila Grows Adherent to Surfaces in vitro and in Situ. Infection Control and Hospital Epidemiology. 10:408-415.
43. Rogers, J., A. B. Dowsett, P. J. Dennis, J. V. Lee, and C. W. Keevil. 1994. Influence of Plumbing Materials on Biofilm Formation and Growth of Legionella pneumophila in Potable Water Systems. Appl. Environ. Microbiol. 60:1842-1851.
44. Rogers, J., A. B. Dowsett, P. J. Dennis, J. V. Lee, and C. W. Keevil. 1994. Influence of temperature and plumbing material selection on biofilm formation and growth of Legionella pneumophila in a model potable water system containing complex microbial flora. Appl. Environ. Microbiol. 60:1585-1592.
45. Moritz, M. M., H. Flemming, and J. Wingender. 2010. Integration of Pseudomonas aeruginosa and Legionella pneumophila in drinking water biofilms grown on domestic plumbing materials. Int. J. Hyg. Environ. Health. 213:190-197.
46. Geesey, G. G., B. Wigglesworth-Cooksey, and K. E. Cooksey. 2000. Influence of calcium and other cations on surface adhesion of bacteria and diatoms: A review. Biofouling. 15:195- 205.
47. Koubar, M., M. H. Rodier, and J. Frere. 2013. Involvement of Minerals in Adherence of Legionella pneumophila to Surfaces. Curr. Microbiol. . doi: 10.1007/s00284-012-0295-0.
97
48. Yaradou, D. F., D. Raze, C. Ginevra, F. Ader, A. Doléans-Jordheim, F. Vandenesch, F. D. Menozzi, J. Etienne, and S. Jarraud. 2007. Zinc-dependent cytoadherence of Legionella pneumophila to human alveolar epithelial cells in vitro. Microb. Pathog. 43:234-242.
49. Bargellini, A., I. Marchesi, E. Righi, A. Ferrari, S. Cencetti, P. Borella, and S. Rovesti. 2011. Parameters predictive of Legionella contamination in hot water systems: Association with trace elements and heterotrophic plate counts. Water Res. 45:2315-2321.
50. Borella, P., M. T. Montagna, V. Romano-Spica, S. Stampi, G. Stancanelli, M. Triassi, I. Marchesi, A. Bargellini, R. Neglia, N. Paglionico, G. Spilotros, U. Moscato, G. Casati, P. P. Legnani, R. Sacchetti, C. Ossi, M. Moro, and G. Ribera. 2003. Relationship between mineral content of domestic hot water and microbial contamination. Journal of Trace Elements in Medicine and Biology : Organ of the Society for Minerals and Trace Elements (GMS). 17 Suppl 1:37.
51. Boyd, C. D., D. Chatterjee, H. Sondermann, and G. O'Toole A. 2012. LapG, required for modulating biofilm formation by Pseudomonas fluorescens Pf0-1, is a calcium-dependent protease. J. Bacteriol. 194:4406.
52. Chatterjee, D., C. D. Boyd, G. O'Toole A., and H. Sondermann. 2012. Structural characterization of a conserved, calcium-dependent periplasmic protease from Legionella pneumophila. J. Bacteriol. 194:4415.
53. Gião, ,M.S., S. A. Wilks, N. F. Azevedo, M. J. Vieira, and C. W. Keevil. 2009. Comparison between standard culture and peptide nucleic acid 16S rRNA hybridization quantification to study the influence of physico-chemical parameters on Legionella pneumophila survival in drinking water biofilms. Biofouling. 25:343.
54. Pang, C. M., and W. Liu. 2006. Biological filtration limits carbon availability and affects downstream biofilm formation and community structure. Appl. Environ. Microbiol. 72:5702- 5712.
55. van, d. K., H. R. Veenendaal, and W. J. H. Scheffer. 2005. Biofilm formation and multiplication of Legionella in a model warm water system with pipes of copper, stainless steel and cross-linked polyethylene. Water Res. 39:2789-2798.
56. Martinelli, F., A. Caruso, L. Moschini, A. Turano, C. Scarcella, and F. Speziani. 2000. A comparison of Legionella pneumophila occurrence in hot water tanks and instantaneous devices in domestic, nosocomial, and community environments. Curr. Microbiol. 41:374-376.
57. Ciesielski, C. A., M. J. Blaser, and W. L. Wang. 1984. Role of stagnation and obstruction of water flow in isolation of Legionella pneumophila from hospital plumbing. Appl. Environ. Microbiol. 48:984-987.
98
58. Fisher-Hoch, S., C. L. Bartlett, J. O. Tobin, M. B. Gillett, A. M. Nelson, J. E. Pritchard, M. G. Smith, R. A. Swann, J. M. Talbot, and J. A. Thomas. 1981. Investigation and control of an outbreaks of legionnaires' disease in a district general hospital. Lancet. 1:932.
59. Makin, T., and M. Pride. 2010. Venturi system could be major breakthrough. Health Estate. 64:27-33.
60. Storey, M. V., J. Långmark, N. J. Ashbolt, and Stenström T.A. 2004. The fate of legionellae within distribution pipe biofilms: measurement of their persistence, inactivation and detachment. Water Science and Technology : A Journal of the International Association on Water Pollution Research. 49:269.
61. Lehtola, M. J., E. Torvinen, J. Kusnetsov, T. Pitkanen, L. Maunula, C. von Bonsdorff, P. J. Martikainen, S. A. Wilks, C. W. Keevil, and I. T. Miettinen. 2007. Survival of Mycobacterium avium, Legionella pneumophila, Escherichia coli, and Caliciviruses in Drinking Water-Associated Biofilms Grown under High-Shear Turbulent Flow. Appl. Environ. Microbiol. 73:2854-2859.
62. Liu, Z., Y. E. Lin, J. E. Stout, C. C. Hwang, R. D. Vidic, and V. L. Yu. 2006. Effect of flow regimes on the presence of Legionella within the biofilm of a model plumbing system. J. Appl. Microbiol. 101:437-442.
63. Fliermans, C. B., W. B. Cherry, L. H. Orrison, S. J. Smith, D. L. Tison, and D. H. Pope. 1981. Ecological distribution of Legionella pneumophila. Appl. Environ. Microbiol. 41:9-16.
64. Stout, J. E., V. L. Yu, and M. G. Best. 1985. Ecology of Legionella pneumophila within water distribution systems. Appl. Environ. Microbiol. 49:221-228.
65. Tiaden, A., T. Spirig, T. Sahr, M. A. Walti, K. Boucke, C. Buchrieser, and H. Hilbi. 2010. The autoinducer synthase LqsA and putative sensor kinase LqsS regulate phagocyte interactions, extracellular filaments and a genomic island of Legionella pneumophila. Environ. Microbiol. 12:1243.
66.Kessler, A., U. Schell, T. Sahr, A. Tiaden, C. Harrison, C. Buchrieser, and H. Hilbi. 2013. The Legionella pneumophila orphan sensor kinase LqsT regulates competence and pathogen-host interactions as a component of the LAI-1 circuit. Environ. Microbiol. 15:646-662.
67. Vandersmissen, L., E. De Buck, V. Saels, D. A. Coil, and J. Anné. 2010. A Legionella pneumophila collagen-like protein encoded by a gene with a variable number of tandem repeats is involved in the adherence and invasion of host cells. FEMS Microbiol. Lett. 306:168.
68. Duncan, C., A. Prashar, J. So, P. Tang, D. E. Low, M. Terebiznik, and C. Guyard. 2011. Lcl of Legionella pneumophila is an immunogenic GAG binding adhesin that promotes interactions with lung epithelial cells and plays a crucial role in biofilm formation. Infect. Immun. 6:2168-2181.
99
69. Mallegol, J., C. Duncan, A. Prashar, J. So, D. E. Low, M. Terebeznik, and C. Guyard. 2012. Essential Roles and Regulation of the Legionella pneumophila Collagen-Like Adhesin during Biofilm Formation. PloS One. 7:46462.
70. Stone, B. J., and Y. A. Kwaik. 1998. Expression of Multiple Pili by Legionella pneumophila: Identification and Characterization of a Type IV Pilin Gene and Its Role in Adherence to Mammalian and Protozoan Cells. Infect. Immun. 66:1768-1775.
71. Lucas, C. E., E. Brown, and B. S. Fields. 2006. Type IV pili and type II secretion play a limited role in Legionella pneumophila biofilm colonization and retention. Microbiology. 152:3569-3573.
72. De Buck, E., L. Maes, E. Meyen, L. Van Mellaert, N. Geukens, J. Anné, and E. Lammertyn. 2005. Legionella pneumophila Philadelphia-1 tatB and tatC affect intracellular replication and biofilm formation. Biochem. Biophys. Res. Commun. 331:1413-1420.
73. Cianciotto, N. P. 2007. Iron Acquisition by Legionella pneumophila. Biometals. 20:323- 331.
74. Orsi, N. 2004. The antimicrobial activity of lactoferrin: Current status and perspectives. Biometals. 17:189-196.
75. Robey, M., and N. P. Cianciotto. 2002. Legionella pneumophila feoAB Promotes Ferrous Iron Uptake and Intracellular Infection. Infect. Immun. 70:5659-5669.
76. Tiaden, A., and H. Hilbi. 2012. α-Hydroxyketone synthesis and sensing by Legionella and Vibrio. Sensors (Basel, Switzerland). 12:2899-2919.
77. Spirig, T., A. Tiaden, P. Kiefer, C. Buchrieser, J. A. Vorholt, and H. Hilbi. 2008. The Legionella autoinducer synthase LqsA produces an alpha-hydroxyketone signaling molecule. The Journal of Biological Chemistry. 283:18113.
78. Tiaden, A., T. Spirig, and H. Hilbi. 2010. Bacterial gene regulation by alpha- hydroxyketone signaling. Trends Microbiol. 18:288.
79. Tiaden, A., T. Spirig, P. Carranza, H. Brüggemann, K. Riedel, L. Eberl, C. Buchrieser, and H. Hilbi. 2008. Synergistic contribution of the Legionella pneumophila lqs genes to pathogen-host interactions. J. Bacteriol. 190:7532-7547.
80. McDonough, K. A., and A. Rodriguez. 2011. The myriad roles of cyclic AMP in microbial pathogens: from signal to sword. Nat. Rev. Microbiol. 10:27-38. doi: 10.1038/nrmicro2688; 10.1038/nrmicro2688.
81. Levi, A., M. Folcher, U. Jenal, and H. A. Shuman. 2011. Cyclic diguanylate signaling proteins control intracellular growth of Legionella pneumophila. MBio. 2:e00316-e00316-10.
100
82. Carlson, H. K., R. E. Vance, and M. A. Marletta. 2010. H-NOX regulation of c-di-GMP metabolism and biofilm formation in Legionella pneumophila. Mol. Microbiol. 77:930.
83. Hammer, B.K., and M. S. Swanson. 1999. Co-ordination of Legionella pneumophila virulence with entry into stationary phase by ppGpp. Mol. Microbiol. 33: 721-731.
84. Bachman, M. A., and M. S. Swanson. 2001. RpoS co-operates with other factors to induce Legionella pneumophila virulence in the stationary phase. Mol. Microbiol. 40:1201-1214.
85. Tiaden, A., T. Spirig, S. S. Weber, H. Brüggemann, R. Bosshard, C. Buchrieser, and H. Hilbi. 2007. The Legionella pneumophila response regulator LqsR promotes host cell interactions as an element of the virulence regulatory network controlled by RpoS and LetA. Cell. Microbiol. 9:2903-2903.
86. Hammer, B. K., E. S. Tateda, and M. S. Swanson. 2002. A two-component regulator induces the transmission phenotype of stationary-phase Legionella pneumophila Mol. Microbiol. 44:107-118.
87. Molofsky, A. B., and M. S. Swanson. 2003. Legionella pneumophila CsrA is a pivotal repressor of transmission traits and activator of replication. Mol. Microbiol. 50:445-461.
88. Piao, Z., C. C. Sze, O. Barysheva, K. Iida, and S. Yoshida. 2006. Temperature-Regulated Formation of Mycelial Mat-Like Biofilms by Legionella pneumophila. Appl. Environ. Microbiol. 72:1613-1622.
89. Konishi, T., T. Yamashiro, M. Koide, and A. Nishizono. 2006. Influence of Temperature on Growth of Legionella pneumophila Biofilm Determined by Precise Temperature Gradient Incubator. Journal of Bioscience and Bioengineering. 101:478-484.
90. Justice, S. S., D. A. Hunstad, L. Cegelski, and S. J. Hultgren. 2008. Morphological plasticity as a bacterial survival strategy. Nature Reviews.Microbiology. 6:162-168.
91. Prashar, A., S. Bhatia, Z. Tabatabaeiyazdi, C. Duncan, R. Garduño A., P. Tang, D. E. Low, C. Guyard, and M. R. Terebiznik. 2012. Mechanism of invasion of lung epithelial cells by filamentous Legionella pneumophila. Cell. Microbiol. 14:1632-1655.
92. Liles, M. R., V. K. Viswanathan, and N. P. Cianciotto. 1998. Identification and Temperature Regulation of Legionella pneumophila Genes Involved in Type IV Pilus Biogenesis and Type II Protein Secretion. Infect. Immun. 66:1776-1782.
93. Messi, P., I. Anacarso, A. Bargellini, M. Bondi, I. Marchesi, S. de Niederhäusern, and P. Borella. 2011. Ecological behaviour of three serogroups of Legionella pneumophila within a model plumbing system. Biofouling. 27:165.
101
94. Tison, D. L., D. H. Pope, W. B. Cherry, and C. B. Fliermans. 1980. Growth of Legionella pneumophila in association with blue-green algae (cyanobacteria). Appl. Environ. Microbiol. 39:456-459.
95. Wadowsky, R. M., and R. B. Yee. 1983. Satellite growth of Legionella pneumophila with an environmental isolate of Flavobacterium breve. Appl. Environ. Microbiol. 46:1447-1449.
96. Wéry, N., V. Bru-Adan, C. Minervini, J. Delgénes, L. Garrelly, and J. Godon. 2008. Dynamics of Legionella spp. and bacterial populations during the proliferation of L. pneumophila in a cooling tower facility. Appl. Environ. Microbiol. 74:3030-3037.
97. Stewart, C. R., D. M. Burnside, and N. P. Cianciotto. 2011. The surfactant of Legionella pneumophila Is secreted in a TolC-dependent manner and is antagonistic toward other Legionella species. J. Bacteriol. 193:5971.
98. Stewart, C. R., V. Muthye, and N. P. Cianciotto. 2012. Legionella pneumophila persists within biofilms formed by Klebsiella pneumoniae, Flavobacterium sp., and Pseudomonas fluorescens under dynamic flow conditions. PloS One. 7:e50560.
99. Kimura, S., K. Tateda, Y. Ishii, M. Horikawa, S. Miyairi, N. Gotoh, M. Ishiguro, and K. Yamaguchi. 2009. Pseudomonas aeruginosa Las quorum sensing autoinducer suppresses growth and biofilm production in Legionella species. Microbiology. 155:1934.
100. Declerck, P., J. Behets, Y. Delaedt, A. Margineanu, E. Lammertyn, and F. Ollevier. 2005. Impact of Non-Legionella Bacteria on the Uptake and Intracellular Replication of Legionella pneumophila in Acanthamoeba castellanii and Naegleria lovaniensis. Microb. Ecol. 50:536-549.
101. Emtiazi, F., T. Schwartz, S. M. Marten, P. Krolla-Sidenstein, and U. Obst. 2004. Investigation of natural biofilms formed during the production of drinking water from surface water embankment filtration. Water Res. 38:1197-1206.
102. Gião, ,M.S., S. Wilks, N. F. Azevedo, M. J. Vieira, and C. W. Keevil. 2009. Incorporation of natural uncultivable Legionella pneumophila into potable water biofilms provides a protective niche against chlorination stress. Biofouling. 25:345.
103. Alleron, L., N. Merlet, C. Lacombe, and J. Frère. 2008. Long-term survival of Legionella pneumophila in the viable but nonculturable state after monochloramine treatment. Curr. Microbiol. 57:497-502.
104. Raftery, T. D., H. Lindler, and T. L. McNealy. 2013. Altered Host Cell–Bacteria Interaction due to Nanoparticle Interaction with a Bacterial Biofilm. Microb. Ecol. 65:496-503.
105. Stojak, A. R., T. Raftery, S. J. Klaine, and T. L. McNealy. 2011. Morphological responses of Legionella pneumophila biofilm to nanoparticle exposure. Nanotoxicology. 5:730.
102
106. Rogers, J., A. B. Dowsett, and C. W. Keevil. 1995. A paint incorporating silver to control mixed biofilms containing Legionella pneumophila. J. Ind. Microbiol. 15:377.
107. Liu, Z., J. E. Stout, M. Boldin, J. Rugh, W. F. Diven, and V. L. Yu. 1998. Intermittent Use of Copper-Silver Ionization for Legionella Control in Water Distribution Systems: A Potential Option in Buildings Housing Individuals at Low Risk of Infection. Clinical Infectious Diseases. 26:138-140.
108. Schwartz, T., S. Hoffmann, and U. Obst. 2003. Formation of natural biofilms during chlorine dioxide and u.v. disinfection in a public drinking water distribution system. J. Appl. Microbiol. 95:591-601.
109. Walker, J. T., C. W. Mackerness, D. Mallon, T. Makin, T. Williets, and C. W. Keevil. 1995. Control of Legionella pneumophila in a hospital water system by chlorine dioxide. J. Ind. Microbiol. 15:384.
110. Pryor, M., S. Springthorpe, S. Riffard, T. Brooks, Y. Huo, G. Davis, and S. A. Sattar. 2004. Investigation of opportunistic pathogens in municipal drinking water under different supply and treatment regimes. Water Science and Technology : A Journal of the International Association on Water Pollution Research. 50:83.
111. Williams, M. M., and E. Braun-Howland. 2003. Growth of Escherichia coli in model distribution system biofilms exposed to hypochlorous acid or monochloramine. Appl. Environ. Microbiol. 69:5463-5471.
112. Kusnetsov, J. M., P. J. Keskitalo, H. E. Ahonen, A. I. Tulkki, I. T. Miettinen, and P. J. Martikainen. 1994. Growth of Legionella and other heterotrophic bacteria in a circulating cooling water system exposed to ultraviolet irradiation. J. Appl. Microbiol. 77:461-466.
113. Cargill, K. L., B. H. Pyle, R. L. Sauer, and G. A. McFeters. 1992. Effects of culture conditions and biofilm formation on the iodine susceptibility of Legionella pneumophila. Can. J. Microbiol. 38:423.
114. Martinez-Gil, M., F. Yousef-Coronado, and M. Espinosa-Urgel. 2010. LapF, the second largest Pseudomonas putida protein, contributes to plant root colonization and determines biofilm architecture. Mol. Microbiol. 77:549-561. doi: 10.1111/j.1365-2958.2010.07249.x; 10.1111/j.1365-2958.2010.07249.x.
115. Danese, P. N., L. A. Pratt, S. L. Dove, and R. Kolter. 2000. The outer membrane protein, antigen 43, mediates cell-to-cell interactions within Escherichia coli biofilms. Mol. Microbiol. 37:424-432.
116. Klemm, P., R. M. Vejborg, and O. Sherlock. 2006. Self-associating autotransporters, SAATs: Functional and structural similarities. International Journal of Medical Microbiology. 296:187-195.
103
117. Klemm, P., L. Hjerrild, M. Gjermansen, and M. A. Schembri. 2004. Structure-function analysis of the self-recognizing Antigen 43 autotransporter protein from Escherichia coli. Mol Microbiol. 51: 283-296
118. Travier, L., S. Guadagnini, E. Gouin, A. Dufour, V. Chenal-Francisque, P. Cossart, J. C. Olivo-Marin, J. M. Ghigo, O. Disson, and M. Lecuit. 2013. ActA Promotes Listeria monocytogenes Aggregation, Intestinal Colonization and Carriage. PLoS Pathog. 9:e1003131. doi: 10.1371/journal.ppat.1003131; 10.1371/journal.ppat.1003131.
119. Côté, J., and M. Mourez. 2011. Structure-function analysis of the TibA self-associating autotransporter reveals a modular organization. Infect. Immun. 79:1826-1832.
120. Charbonneau, M., and M. Mourez. 2007. Functional organization of the autotransporter adhesin involved in diffuse adherence. J. Bacteriol. 189:9020-9029.
121. Alhede, M., K. N. Kragh, K. Qvortrup, M. Allesen-Holm, M. van Gennip, L. D. Christensen, P. Ø. Jensen, A. K. Nielsen, M. Parsek, D. Wozniak, S. Molin, T. Tolker- Nielsen, N. Høiby, M. Givskov, and T. Bjarnsholt. 2011. Phenotypes of non-attached Pseudomonas aeruginosa aggregates resemble surface attached biofilm. PloS One. 6:e27943.
122. Sorroche, F. G., M. B. Spesia, A. Zorreguieta, and W. Giordano. 2012. A positive correlation between bacterial autoaggregation and biofilm formation in native Sinorhizobium meliloti isolates from Argentina. Appl. Environ. Microbiol. 78:4092.
123. Spahich, N., R. Kenjale, and G. Waksman. 2011. Crystal structure of the Haemophilus influenzae Hap adhesin reveals an intercellular oligomerization mechanism for bacterial aggregation. EMBO J. 30:3864-3874.
124. Pizarro-Cerda, J., and P. Cossart. 2006. Bacterial adhesion and entry into host cells. Cell. 124:715-727. doi: 10.1016/j.cell.2006.02.012.
125. Cianciotto, N. P., J. K. Stamos, and D. W. Kamp. 1995. Infectivity of Legionella pneumophila mip mutant for alveolar epithelial cells. Curr. Microbiol. 30:247-250.
126. Payne, N. R., and M. A. Horwitz. 1987. Phagocytosis of Legionella pneumophila is mediated by human monocyte complement receptors. J. Exp. Med. 166:1377-1389.
127. Wagner, C., A. S. Khan, T. Kamphausen, B. Schmausser, C. Unal, U. Lorenz, G. Fischer, J. Hacker, and M. Steinert. 2007. Collagen binding protein Mip enables Legionella pneumophila to transmigrate through a barrier of NCI-H292 lung epithelial cells and extracellular matrix. Cell. Microbiol. 9:450-462. doi: 10.1111/j.1462-5822.2006.00802.x.
128. Thomas, R., and T. Brooks. 2004. Common oligosaccharide moieties inhibit the adherence of typical and atypical respiratory pathogens. J. Med. Microbiol. 53:833-840.
104
129. Cirillo, S. L., L. E. Bermudez, S. H. El-Etr, G. E. Duhamel, and J. D. Cirillo. 2001. Legionella pneumophila entry gene rtxA is involved in virulence. Infect. Immun. 69:508-517. doi: 10.1128/IAI.69.1.508-517.2001.
130. Cirillo, S. L., J. Lum, and J. D. Cirillo. 2000. Identification of novel loci involved in entry by Legionella pneumophila. Microbiology. 146 ( Pt 6):1345-1359.
131. Cirillo, S. L., L. Yan, M. Littman, M. M. Samrakandi, and J. D. Cirillo. 2002. Role of the Legionella pneumophila rtxA gene in amoebae. Microbiology. 148:1667-1677.
132. Garduno, R. A., E. Garduno, and P. S. Hoffman. 1998. Surface-associated hsp60 chaperonin of Legionella pneumophila mediates invasion in a HeLa cell model. Infect. Immun. 66:4602-4610.
133. Fernandez, R. C., S. M. Logan, S. H. Lee, and P. S. Hoffman. 1996. Elevated levels of Legionella pneumophila stress protein Hsp60 early in infection of human monocytes and L929 cells correlate with virulence. Infect. Immun. 64:1968-1976.
134. Helbig, J. H., B. Konig, H. Knospe, B. Bubert, C. Yu, C. P. Luck, A. Riboldi- Tunnicliffe, R. Hilgenfeld, E. Jacobs, J. Hacker, and G. Fischer. 2003. The PPIase active site of Legionella pneumophila Mip protein is involved in the infection of eukaryotic host cells. Biol. Chem. 384:125-137. doi: 10.1515/BC.2003.013.
135. Wagner, C., A. S. Khan, T. Kamphausen, B. Schmausser, C. Unal, U. Lorenz, G. Fischer, J. Hacker, and M. Steinert. 2007. Collagen binding protein Mip enables Legionella pneumophila to transmigrate through a barrier of NCI-H292 lung epithelial cells and extracellular matrix. Cell. Microbiol. 9:450-462. doi: 10.1111/j.1462-5822.2006.00802.x.
136. Stone, B. J., and Y. Abu Kwaik. 1998. Expression of multiple pili by Legionella pneumophila: identification and characterization of a type IV pilin gene and its role in adherence to mammalian and protozoan cells. Infect. Immun. 66:1768-1775.
137. Chang, B., F. Kura, J. Amemura-Maekawa, N. Koizumi, and H. Watanabe. 2005. Identification of a novel adhesion molecule involved in the virulence of Legionella pneumophila. Infect. Immun. 73:4272-4280. doi: 10.1128/IAI.73.7.4272-4280.2005.
138. Pourcel, C., P. Visca, B. Afshar, S. D'Arezzo, G. Vergnaud, and N. K. Fry. 2007. Identification of variable-number tandem-repeat (VNTR) sequences in Legionella pneumophila and development of an optimized multiple-locus VNTR analysis typing scheme. J. Clin. Microbiol. 45:1190-1199.
139. Hendrixson, D. R., and J. St. Geme W. 1998. The Haemophilus influenzae Hap Serine Protease Promotes Adherence and Microcolony Formation, Potentiated by a Soluble Host Protein. Mol. Cell. 2:841-850.
105
140. Borlee, B. R., A. D. Goldman, K. Murakami, R. Samudrala, D. J. Wozniak, and M. R. Parsek. 2010. Pseudomonas aeruginosa uses a cyclic-di-GMP-regulated adhesin to reinforce the biofilm extracellular matrix. Mol. Microbiol. 75:827-842.
141. Sheets, A. J., and St Geme, 3rd, Joseph,W. 2011. Adhesive activity of the haemophilus cryptic genospecies cha autotransporter is modulated by variation in tandem Peptide repeats. J. Bacteriol. 193:329-339.
142. Torres, A. G., N. T. Perna, V. Burland, A. Ruknudin, F. R. Blattner, and J. B. Kaper. 2002. Characterization of Cah, a calcium-binding and heat-extractable autotransporter protein of enterohaemorrhagic Escherichia coli. Mol. Microbiol. 45:951-966.
143. Mikaty, G., M. Soyer, E. Mairey, N. Henry, D. Dyer, K. T. Forest, P. Morand, S. Guadagnini, M. C. Prévost, X. Nassif, and G. Duménil. 2009. Extracellular bacterial pathogen induces host cell surface reorganization to resist shear stress. PLoS Pathogens. 5:e1000314.
144. Hélaine, S., E. Carbonnelle, L. Prouvensier, J. Beretti, X. Nassif, and V. Pelicic. 2005. PilX, a pilus-associated protein essential for bacterial aggregation, is a key to pilus-facilitated attachment of Neisseria meningitidis to human cells. Mol. Microbiol. 55:65-77.
145. Alhede, M., K. N. Kragh, K. Qvortrup, M. Allesen-Holm, M. van Gennip, L. D. Christensen, P. O. Jensen, A. K. Nielsen, M. Parsek, D. Wozniak, S. Molin, T. Tolker- Nielsen, N. Hoiby, M. Givskov, and T. Bjarnsholt. 2011. Phenotypes of non-attached Pseudomonas aeruginosa aggregates resemble surface attached biofilm. PLoS One. 6:e27943. doi: 10.1371/journal.pone.0027943; 10.1371/journal.pone.0027943.
146. Kaplan, J. B., E. A. Izano, P. Gopal, M. T. Karwacki, S. Kim, J. L. Bose, K. W. Bayles, and A. R. Horswill. 2012. Low levels of β-lactam antibiotics induce extracellular DNA release and biofilm formation in Staphylococcus aureus. MBio. 3:e00198.
147. Nakao, R., M. Ramstedt, S. N. Wai, and B. E. Uhlin. 2012. Enhanced Biofilm Formation by Escherichia coli LPS Mutants Defective in Hep Biosynthesis. PloS One. 7:e51241.
148. Yamaguchi, M., K. Sato, H. Yukitake, Y. Noiri, S. Ebisu, and K. Nakayama. 2010. A Porphyromonas gingivalis mutant defective in a putative glycosyltransferase exhibits defective biosynthesis of the polysaccharide portions of lipopolysaccharide, decreased gingipain activities, strong autoaggregation, and increased biofilm formation. Infect. Immun. 78:3801-3812.
149. Sherlock, O., R. M. Vejborg, and P. Klemm. 2005. The TibA adhesin/invasin from enterotoxigenic Escherichia coli is self recognizing and induces bacterial aggregation and biofilm formation. Infect. Immun. 73:1954-1963. doi: 10.1128/IAI.73.4.1954-1963.2005.
150. Tiaden, A., T. Spirig, T. Sahr, M. Wälti A., K. Boucke, C. Buchrieser, and H. Hilbi. 2010. The autoinducer synthase LqsA and putative sensor kinase LqsS regulate phagocyte interactions, extracellular filaments and a genomic island of Legionella pneumophila. Environ. Microbiol. 12:1243.
106
151. Berk, S. G., G. Faulkner, E. Garduno, M. C. Joy, M. Ortiz-Jimenez, and R. A. Garduno. 2008. Packaging of Live Legionella pneumophila into Pellets Expelled by Tetrahymena spp. Does Not Require Bacterial Replication and Depends on a Dot/Icm-Mediated Survival Mechanism. Appl. Environ. Microbiol. 74:2187-2199.
152. Feeley, J. C., R. J. Gibson, G. W. Gorman, N. C. Langford, J. K. Rasheed, D. C. Mackel, and W. B. Baine. 1979. Charcoal-yeast extract agar: primary isolation medium for Legionella pneumophila. J. Clin. Microbiol. 10:437-441.
153. Berger, K. H., and R. R. Isberg. 1993. Two distinct defects in intracellular growth complemented by a single genetic locus in Legionella pneumophila. Mol. Microbiol. 7:7-19.
154. Laemmli, U. K. 1970. Cleavage of structural proteins during the assembly of the head of bacteriophage T4. Nature. 227:680-685.
155. Towbin, H., T. Staehelin, and J. Gordon. 1979. Electrophoretic transfer of proteins from polyacrylamide gels to nitrocellulose sheets: procedure and some applications. Proc. Natl. Acad. Sci. U. S. A. 76:4350-4354.
156. Lebeau, I., E. Lammertyn, E. De Buck, L. Maes, N. Geukens, L. Van Mellaert, and J. Anné. 2004. Novel transcriptional regulators of Legionella pneumophila that affect replication in Acanthamoeba castellanii. Arch. Microbiol. 181:362-370.
157. Khan, M. A., N. Knox, A. Prashar, D. Alexander, M. Abdel-Nour, C. Duncan, P. Tang, H. Amatullah, C. C. Dos Santos, N. Tijet, D. E. Low, C. Pourcel, G. Van Domselaar, M. Terebiznik, A. W. Ensminger, and C. Guyard. 2013. Comparative Genomics Reveal That Host-Innate Immune Responses Influence the Clinical Prevalence of Serogroups. PLoS One. 8:e67298. doi: 10.1371/journal.pone.0067298.
158. Duan, Y., E. Fisher, D. Malamud, E. Golub, and D. R. Demuth. 1994. Calcium-binding properties of SSP-5, the Streptococcus gordonii M5 receptor for salivary agglutinin. Infect. Immun. 62:5220-5226.
159. Sigurdson, S. L., and J. Lwebuga-Mukasa. 1994. Divalent cation-dependent regulation of rat alveolar epithelial cell adhesion and spreading. Exp. Cell Res. 213:71-79.
160. Conrady, D. G., C. C. Brescia, K. Horii, A. A. Weiss, J. Hassett, and A. B. Herr. 2008. A Zinc-Dependent Adhesion Module Is Responsible for Intercellular Adhesion in Staphylococcal Biofilms. Proc. Natl. Acad. Sci. U. S. A. 105:19456-19461.
161. Anderegg, G., F. Arnaud-Neu, R. Delgado, J. Felcman, and K. Popov. 2006. Critical Evaluation of Stability Constants of Metal Complexes of Complexones for Biomedical and Environmental Applications. ChemInform. 37:.
162. DebRoy, S., J. Dao, M. Soderberg, O. Rossier, and N. P. Cianciotto. 2006. Legionella pneumophila type II secretome reveals unique exoproteins and a chitinase that promotes bacterial
107
persistence in the lung. Proc. Natl. Acad. Sci. U. S. A. 103:19146-19151. doi: 10.1073/pnas.0608279103.
163. Fishov, I., and C. L. Woldringh. 1999. Visualization of membrane domains in Escherichia coli. Mol. Microbiol. 32:1166-1172.
164. Chen, G., C. L. Patten, and H. E. Schellhorn. 2003. Controlled expression of an rpoS antisense RNA can inhibit RpoS function in Escherichia coli. Antimicrob. Agents Chemother. 47:3485-3493.
165. Huang, C. T., S. W. Peretti, and J. D. Bryers. 1993. Plasmid retention and gene expression in suspended and biofilm cultures of recombinant Escherichia coli DH5alpha(pMJR1750). Biotechnol. Bioeng. 41:211-220. doi: 10.1002/bit.260410207.
166. Init, I., Y. L. Lau, A. Arin Fadzlun, A. I. Foead, R. S. Neilson, and V. Nissapatorn. 2010. Detection of free living amoebae, Acanthamoeba and Naegleria, in swimming pools, Malaysia. Tropical Biomedicine. 27:566.
167. Pickup, Z. L., R. Pickup, and J. D. Parry. 2007. A comparison of the growth and starvation responses of Acanthamoeba castellanii and Hartmannella vermiformis in the presence of suspended and attached Escherichia coli K12. FEMS Microbiol. Ecol. 59:556-563.
168. Bracha, R., D. Kobiler, and D. Mirelman. 1982. Attachment and ingestion of bacteria by trophozoites of Entamoeba histolytica. Infect. Immun. 36:396-406.
169. Costerton, J. W., P. S. Stewart, and E. P. Greenberg. 1999. Bacterial Biofilms: A Common Cause of Persistent Infections. Science. 284:1318-1322.
170. Haaber, J., M. T. Cohn, D. Frees, T. J. Andersen, and H. Ingmer. 2012. Planktonic aggregates of Staphylococcus aureus protect against common antibiotics. PLoS One. 7:e41075. doi: 10.1371/journal.pone.0041075; 10.1371/journal.pone.0041075.
171. Abu Kwaik, Y., L. Y. Gao, B. J. Stone, C. Venkataraman, and O. S. Harb. 1998. Invasion of protozoa by Legionella pneumophila and its role in bacterial ecology and pathogenesis. Appl. Environ. Microbiol. 64:3127-3133.
172. Molofsky, A. B., L. M. Shetron-Rama, and M. S. Swanson. 2005. Components of the Legionella pneumophila flagellar regulon contribute to multiple virulence traits, including lysosome avoidance and macrophage death. Infect. Immun. 73:5720-5734. doi: 10.1128/IAI.73.9.5720-5734.2005.
173. Declerck, P., J. Behets, B. De Keersmaecker, and F. Ollevier. 2007. Receptor-mediated uptake of Legionella pneumophila by Acanthamoeba castellanii and Naegleria lovaniensis. J. Appl. Microbiol. 103:2697-2703. doi: 10.1111/j.1365-2672.2007.03530.x.
108
174. Feasley, C. L., J. M. Johnson, C. M. West, and C. P. Chia. 2010. Glycopeptidome of a heavily N-glycosylated cell surface glycoprotein of Dictyostelium implicated in cell adhesion. Journal of Proteome Research. 9:3495.
175. Schiller, B., A. Hykollari, J. Voglmeir, G. Pöltl, K. Hummel, E. Razzazi-Fazeli, R. Geyer, and I. B. H. Wilson. 2009. Development of Dictyostelium discoideum is associated with alteration of fucosylated N-glycan structures. Biochem. J. 423:41.
176. Oberley, R. E., K. A. Ault, T. L. Neff, K. R. Khubchandani, E. C. Crouch, and J. M. Snyder. 2004. Surfactant proteins A and D enhance the phagocytosis of Chlamydia into THP-1 cells. AJP - Lung Cellular and Molecular Physiology. 287:L296-L306.
177. Mulcahy, H., and S. Lewenza. 2011. Magnesium limitation is an environmental trigger of the Pseudomonas aeruginosa biofilm lifestyle. PloS One. 6:e23307.
178. Das, T., P. K. Sharma, H. J. Busscher, H. van der Mei C., and B. P. Krom. 2010. Role of extracellular DNA in initial bacterial adhesion and surface aggregation. Appl. Environ. Microbiol. 76:3405-3408.
179. Harris, R. H., and R. Mitchell. 1973. The Role of Polymers in Microbial Aggregation. Annual Reviews in Microbiology. 27:27-50.
180. Merino, N., A. Toledo-Arana, M. Vergara-Irigaray, J. Valle, C. Solano, E. Calvo, J. A. Lopez, T. J. Foster, J. R. Penades, and I. Lasa. 2009. Protein A-Mediated Multicellular Behavior in Staphylococcus aureus. The Journal of Bacteriology. 191:832-843.
181. Kierek, K., and P. I. Watnick. 2003. The Vibrio cholerae O139 O-antigen polysaccharide is essential for Ca2+-dependent biofilm development in sea water. Proc. Natl. Acad. Sci. U. S. A. 100:14357-14362.
182. Kierek, K., and P. I. Watnick. 2003. Environmental Determinants of Vibrio cholerae Biofilm Development. Appl. Environ. Microbiol. 69:5079-5088.
183. Martínez-Gil, M., D. Romero, R. Kolter, and M. Espinosa-Urgel. 2012. Calcium Causes Multimerization of the Large Adhesin LapF and Modulates Biofilm Formation by Pseudomonas putida. J. Bacteriol. 194:6782-6789.
184. McLean, J. S., G. E. Pinchuk, O. V. Geydebrekht, C. L. Bilskis, B. A. Zakrajsek, E. A. Hill, D. A. Saffarini, M. F. Romine, Y. A. Gorby, J. K. Fredrickson, and A. S. Beliaev. 2008. Oxygen-dependent autoaggregation in Shewanella oneidensis MR-1. Environ. Microbiol. 10:1861-1876.
185. Kawakami, Y., N. Hayashi, M. Ema, and M. Nakayama. 2007. Effects of divalent cations on Halobacterium salinarum cell aggregation. J. Biosci. Bioeng. 104:42-46. doi: 10.1263/jbb.104.42.
109
186. Kawakami, Y., T. Ito, M. Kamekura, and M. Nakayama. 2005. Ca(2+)-dependent cell aggregation of halophilic archaeon, Halobacterium salinarum. J. Biosci. Bioeng. 100:681-684. doi: 10.1263/jbb.100.681.
187. Serrano-Suárez, A., J. Dellundé, H. Salvadó, S. Cervero-Aragó, J. Méndez, O. Canals, S. Blanco, A. Arcas, and R. Araujo. 2013. Microbial and physicochemical parameters associated with Legionella contamination in hot water recirculation systems. Environmental Science and Pollution Research. 1-11. doi: 10.1007/s11356-013-1557-5.
188. Hall-Stoodley, L., J. W. Costerton, and P. Stoodley. 2004. Bacterial biofilms: from the natural environment to infectious diseases. Nat. Rev. Microbiol. 2:95-108. doi: 10.1038/nrmicro821.
189. Hall-Stoodley, L., and P. Stoodley. 2005. Biofilm formation and dispersal and the transmission of human pathogens. Trends Microbiol. 13:7-10. doi: 10.1016/j.tim.2004.11.004.
190. Colvin, K. M., V. D. Gordon, K. Murakami, B. R. Borlee, D. J. Wozniak, G. C. L. Wong, and M. R. Parsek. 2011. The Pel Polysaccharide Can Serve a Structural and Protective Role in the Biofilm Matrix of Pseudomonas aeruginosa. PLoS Pathogens. 7:e1001264.
191. Nguyen, K. T., K. Piastro, T. A. Gray, and K. M. Derbyshire. 2010. Mycobacterial biofilms facilitate horizontal DNA transfer between strains of Mycobacterium smegmatis. J. Bacteriol. 192:5134-5142. doi: 10.1128/JB.00650-10; 10.1128/JB.00650-10.
192. Drenkard, E., and F. M. Ausubel. 2002. Pseudomonas biofilm formation and antibiotic resistance are linked to phenotypic variation. Nature. 416:740-743. doi: 10.1038/416740a.
193. Giltner, C. L., E. J. van Schaik, G. F. Audette, D. Kao, R. S. Hodges, D. J. Hassett, and R. T. Irvin. 2006. The Pseudomonas aeruginosa type IV pilin receptor binding domain functions as an adhesin for both biotic and abiotic surfaces. Mol. Microbiol. 59:1083-1096. doi: 10.1111/j.1365-2958.2005.05002.x.
194. Heilmann, C., O. Schweitzer, C. Gerke, N. Vanittanakom, D. Mack, and F. Gotz. 1996. Molecular basis of intercellular adhesion in the biofilm-forming Staphylococcus epidermidis. Mol. Microbiol. 20:1083-1091.
195. Wigglesworth-Cooksey, B., and K. E. Cooksey. 2005. Use of fluorophore-conjugated lectins to study cell-cell interactions in model marine biofilms. Appl. Environ. Microbiol. 71:428-435. doi: 10.1128/AEM.71.1.428-435.2005.
196. Parveen, N., and J. M. Leong. 2000. Identification of a candidate glycosaminoglycan- binding adhesin of the Lyme disease spirochete Borrelia burgdorferi. Mol. Microbiol. 35:1220- 1234.
197. Oliver-Kozup, H., M. Elliott, B. A. Bachert, K. H. Martin, S. D. Reid, D. Schwegler- Berry, B. J. Green, and S. Lukomski. 2011. The streptococcal collagen-like protein-1 (Scl1) is
110
a significant determinant for biofilm formation by group A Streptococcus. BMC Microbiology. 11:262-262.
198. Thormann, K. M., R. M. Saville, S. Shukla, D. A. Pelletier, and A. M. Spormann. 2004. Initial Phases of biofilm formation in Shewanella oneidensis MR-1. J. Bacteriol. 186:8096-8104. doi: 10.1128/JB.186.23.8096-8104.2004.
199. Adam, E. C., B. S. Mitchell, D. U. Schumacher, G. Grant, and U. Schumacher. 1997. Pseudomonas aeruginosa II lectin stops human ciliary beating: therapeutic implications of fucose. American Journal of Respiratory and Critical Care Medicine. 155:2102.
200. Bucior, I., J. F. Pielage, and J. N. Engel. 2012. Pseudomonas aeruginosa pili and flagella mediate distinct binding and signaling events at the apical and basolateral surface of airway epithelium. PLoS Pathogens. 8:e1002616.
201. Ghosh, N., T. J. McKillop, T. A. Jowitt, M. Howard, H. Davies, D. F. Holmes, I. S. Roberts, and J. Bella. 2012. Collagen-like proteins in pathogenic E. coli strains. PloS One. 7:e37872.
202. Mouton, L., E. Traunecker, K. McElroy, L. Du Pasquier, and D. Ebert. 2009. Identification of a polymorphic collagen-like protein in the crustacean bacteria Pasteuria ramosa. Res. Microbiol. 160:792-799.
203. Rasmussen, M., A. Edén, L. Björck, I. Division II, o. M. Faculty, C. S. Department of, I. Sektion II, Avdelningen för infektionsmedicin (BMC), L. universitet, Medicin, I. M. Division of, L. University, and k. v. Institutionen för. 2000. SclA, a novel collagen-like surface protein of Streptococcus pyogenes. Infect. Immun. 68:6370-6377.
204. Sylvestre, P., E. Couture-Tosi, and M. Mock. 2002. A collagen-like surface glycoprotein is a structural component of the Bacillus anthracis exosporium. Mol. Microbiol. 45:169-178.
205. Chen, S., Y. Tsai, C. Wu, S. Liao, L. Wu, C. Chang, Y. Liu, and P. Tsai. 2010. Streptococcal collagen-like surface protein 1 promotes adhesion to the respiratory epithelial cell. BMC Microbiology. 10:320-320.
206. Humtsoe, J. O., J. K. Kim, Y. Xu, D. R. Keene, M. Höök, S. Lukomski, and K. K. Wary. 2005. A streptococcal collagen-like protein interacts with the alpha2beta1 integrin and induces intracellular signaling. The Journal of Biological Chemistry. 280:13848.
207. Caswell, C. C., M. Barczyk, D. R. Keene, E. Lukomska, D. E. Gullberg, and S. Lukomski. 2008. Identification of the first prokaryotic collagen sequence motif that mediates binding to human collagen receptors, integrins alpha2beta1 and alpha11beta1. The Journal of Biological Chemistry. 283:36168.
208. Reuter, M., C. C. Caswell, S. Lukomski, and P. F. Zipfel. 2010. Binding of the human complement regulators CFHR1 and factor H by streptococcal collagen-like protein 1 (Scl1) via
111
their conserved C termini allows control of the complement cascade at multiple levels. The Journal of Biological Chemistry. 285:38473-38485.
209. Reuter, M., S. Hälbich, C. C. Caswell, S. Lukomski, and P. F. Zipfel. 2009. The streptococcal-collagen-like protein (Scl) of S. pyogenes M6 and M55, binds Factor H and CFHR- 1 via the C-terminus. Mol. Immunol. 46:2862-2863.
210. Levdansky, E., O. Kashi, H. Sharon, Y. Shadkchan, and N. Osherov. 2010. The Aspergillus fumigatus cspA gene encoding a repeat-rich cell wall protein is important for normal conidial cell wall architecture and interaction with host cells. Eukaryotic Cell. 9:1403-1415.
211. Sylvestre, P., E. Couture-Tosi, and M. Mock. 2003. Polymorphism in the Collagen-Like Region of the Bacillus anthracis BclA Protein Leads to Variation in Exosporium Filament Length. The Journal of Bacteriology. 185:1555-1563.
212. Hartford, O., P. Francois, P. Vaudaux, and T. J. Foster. 1997. The dipeptide repeat region of the fibrinogen-binding protein (clumping factor) is required for functional expression of the fibrinogen-binding domain on the Staphylococcus aureus cell surface. Mol. Microbiol. 25:1065-1076.
213. Oh, S., G. Cheng, J. A. Nuessen, R. Jajko, K. M. Yeater, X. Zhao, C. Pujol, D. R. Soll, and L. L. Hoyer. 2005. Functional specificity of Candida albicans Als3p proteins and clade specificity of ALS3 alleles discriminated by the number of copies of the tandem repeat sequence in the central domain. Microbiology. 151:673-681.
214. Simoes, L. C., M. Simoes, and M. J. Vieira. 2010. Adhesion and biofilm formation on polystyrene by drinking water-isolated bacteria. Antonie Van Leeuwenhoek. 98:317-329. doi: 10.1007/s10482-010-9444-2; 10.1007/s10482-010-9444-2.
215. Rogers, J. D., R. J. Palmer Jr, P. E. Kolenbrander, and F. A. Scannapieco. 2001. Role of Streptococcus gordonii amylase-binding protein A in adhesion to hydroxyapatite, starch metabolism, and biofilm formation. Infect. Immun. 69:7046-7056. doi: 10.1128/IAI.69.11.7046- 7056.2001.
216. Das, T., P. K. Sharma, H. J. Busscher, H. C. van der Mei, and B. P. Krom. 2010. Role of extracellular DNA in initial bacterial adhesion and surface aggregation. Appl. Environ. Microbiol. 76:3405-3408. doi: 10.1128/AEM.03119-09; 10.1128/AEM.03119-09.
217. Donlan, R. M. 2002. Biofilms: microbial life on surfaces. Emerg. Infect. Dis. 8:881-890. doi: 10.3201/eid0809.020063.
218. Xu, Y., D. R. Keene, J. M. Bujnicki, M. Höök, and S. Lukomski. 2002. Streptococcal Scl1 and Scl2 proteins form collagen-like triple helices. The Journal of Biological Chemistry. 277:27312-27318.
112
219. Ader, F., R. Le Berre, R. Fackeure, D. Raze, F. D. Menozzi, N. Viget, K. Faure, E. Kipnis, B. Guery, S. Jarraud, J. Etienne, and C. Chidiac. 2008. In vivo effect of adhesion inhibitor heparin on Legionella pneumophila pathogenesis in a murine pneumonia model. Intensive Care Med. 34:1511-1519. doi: 10.1007/s00134-008-1063-2; 10.1007/s00134-008- 1063-2.
113