Anti-TUBGCP4 Monoclonal Antibody, Clone HU923 (DCABH-7801) This Product Is for Research Use Only and Is Not Intended for Diagnostic Use

Total Page：16

File Type：pdf, Size：1020Kb

Anti-TUBGCP4 monoclonal antibody, clone HU923 (DCABH-7801) This product is for research use only and is not intended for diagnostic use. PRODUCT INFORMATION Product Overview Mouse monoclonal to GCP4 Antigen Description GCP4 is a component of the gamma-tubulin complex which is necessary for microtubule nucleation at the centrosome. GCP4 shows sequence identity with the C-terminal regions of human centrosomal proteins 103p (TUBGCP2) and 104p (TUBGCP3). Immunogen Recombinant fragment within Human GCP4 aa 1-178. The exact sequence is proprietary.Database link: Q9UGJ1 Isotype IgG2b Source/Host Mouse Species Reactivity Human Clone HU923 Purity Protein G purified Conjugate Unconjugated Applications WB, ICC/IF Positive Control HeLa cell lysate; HeLa cells. Format Liquid Size 100 μl Preservative None Storage Store at +4°C short term (1-2 weeks). Upon delivery aliquot. Store at -20°C long term. Avoid freeze / thaw cycle. Ship Shipped at 4°C. GENE INFORMATION 45-1 Ramsey Road, Shirley, NY 11967, USA Email: [email protected] Tel: 1-631-624-4882 Fax: 1-631-938-8221 1 © Creative Diagnostics All Rights Reserved Gene Name TUBGCP4 tubulin, gamma complex associated protein 4 [ Homo sapiens ] Official Symbol TUBGCP4 Synonyms TUBGCP4; tubulin, gamma complex associated protein 4; gamma-tubulin complex component 4; 76P; FLJ14797; gamma-ring complex protein 76 kDa; gamma tubulin ring complex protein (76p gene); GCP4; h76p; GCP-4; hGCP4; hGrip76; Entrez Gene ID 27229 Protein Refseq NP_055259 UniProt ID Q9UGJ1 Chromosome Location 15q15 Pathway Cell Cycle, organism-specific biosystem; Cell Cycle, Mitotic, organism-specific biosystem; Centrosome maturation, organism-specific biosystem; G2/M Transition, organism-specific biosystem; Mitotic G2-G2/M phases, organism-specific biosystem; Recruitment of NuMA to mitotic centrosomes, organism-specific biosystem; Recruitment of mitotic centrosome proteins and complexes, organism-specific biosystem. Function structural constituent of cytoskeleton; 45-1 Ramsey Road, Shirley, NY 11967, USA Email: [email protected] Tel: 1-631-624-4882 Fax: 1-631-938-8221 2 © Creative Diagnostics All Rights Reserved.

Copy Link

Recommended publications

Subcellular Localization and Mitotic Interactome Analyses Identify SIRT4 As a Centrosomally Localized and Microtubule Associated Protein
cells Article Subcellular Localization and Mitotic Interactome Analyses Identify SIRT4 as a Centrosomally Localized and Microtubule Associated Protein 1 1, 1 1 Laura Bergmann , Alexander Lang y , Christoph Bross , Simone Altinoluk-Hambüchen , Iris Fey 1, Nina Overbeck 2, Anja Stefanski 2, Constanze Wiek 3, Andreas Kefalas 1, Patrick Verhülsdonk 1, Christian Mielke 4, Dennis Sohn 5, Kai Stühler 2,6, Helmut Hanenberg 3,7, Reiner U. Jänicke 5, Jürgen Scheller 1, Andreas S. Reichert 8 , Mohammad Reza Ahmadian 1 and Roland P. Piekorz 1,* 1 Institute of Biochemistry and Molecular Biology II, Medical Faculty, Heinrich Heine University Düsseldorf, 40225 Düsseldorf, Germany; [email protected] (L.B.); [email protected] (A.L.); [email protected] (C.B.); [email protected] (S.A.-H.); [email protected] (I.F.); [email protected] (A.K.); [email protected] (P.V.); [email protected] (J.S.); [email protected] (M.R.A.) 2 Molecular Proteomics Laboratory, Heinrich Heine University Düsseldorf, 40225 Düsseldorf, Germany; [email protected] (N.O.); [email protected] (A.S.); [email protected] (K.S.) 3 Department of Otolaryngology and Head/Neck Surgery, Medical Faculty, Heinrich Heine University Düsseldorf, 40225 Düsseldorf, Germany; [email protected] (C.W.); [email protected] (H.H.) 4 Institute of Clinical Chemistry and Laboratory Diagnostics, Medical Faculty, Heinrich Heine University Düsseldorf, 40225 Düsseldorf, Germany; [email protected]
[Show full text]
Iii COMPUTATIONAL APPROACHES for ASSESSING KINOME
COMPUTATIONAL APPROACHES FOR ASSESSING KINOME FUNCTION AND DEREGULATION A Dissertation Presented to the Faculty of the Weill Cornell Graduate School of Medical Sciences in Partial Fulfillment of the Requirements for the Degree of Doctor of Philosophy by Charles Joseph Murphy August 2018 iii © 2018 Charles Joseph Murphy ALL RIGHTS RESERVED COMPUTATIONAL APPROACHES FOR ASSESSING KINOME FUNCTION AND DEREGULATION Charles Joseph Murphy, PhD Cornell University 2018 Protein kinases are a diverse family of about 500 proteins that all share the common ability to catalyze phosphorylation of the side chains of amino acids in proteins. Kinases play a vital role across diverse biological functions including proliferation, differentiation, cell migration, and cell-cycle control. Moreover, they are frequently altered across most cancers types and have been a focus for development of anti- cancer drugs, which has led to the development of 38 approved kinase inhibitors as of 2018. In this thesis, I developed two orthogonal computational approaches for investigating kinase function and deregulation. Starting with data from a large cohort of mouse triple negative breast cancer (TNBC) tumors, I use a combination of whole exome sequencing (WES) and RNA-seq to identify somatic alterations that drive individual tumors. I discovered that a large number of these alterations involve protein kinases and subsequent therapeutic targeting led to tumor regression. For my second approach, I utilized a large peptide library dataset from about 300 kinases. Which kinase phosphorylate which phosphorylation site is determined by both kinase- intrinsic and contextual factors. Peptide library approaches provide kinase-intrinsic amino acid specificity, which I used to predict novel kinase substrates and map out kinase phosphorylation networks.
[Show full text]
Sirt1 Is Regulated by Mir-135A and Involved in DNA Damage Repair During Mouse Cellular Reprogramming
www.aging-us.com AGING 2020, Vol. 12, No. 8 Research Paper Sirt1 is regulated by miR-135a and involved in DNA damage repair during mouse cellular reprogramming Andy Chun Hang Chen1,2,*, Qian Peng2,*, Sze Wan Fong1, William Shu Biu Yeung1,2, Yin Lau Lee1,2 1Department of Obstetrics and Gynaecology, The University of Hong Kong, Hong Kong SAR, China 2Shenzhen Key Laboratory of Fertility Regulation, The University of Hong Kong Shenzhen Hospital, Shenzhen, China *Co-first authors Correspondence to: Yin Lau Lee, William Shu Biu Yeung; email: [email protected], [email protected] Keywords: mouse induced pluripotent stem cells, cellular reprogramming, Sirt1, miR-135a, DNA damage repair Received: December 30, 2019 Accepted: March 30, 2020 Published: April 26, 2020 Copyright: Chen et al. This is an open-access article distributed under the terms of the Creative Commons Attribution License (CC BY 3.0), which permits unrestricted use, distribution, and reproduction in any medium, provided the original author and source are credited. ABSTRACT Sirt1 facilitates the reprogramming of mouse somatic cells into induced pluripotent stem cells (iPSCs). It is regulated by micro-RNA and reported to be a target of miR-135a. However, their relationship and roles on cellular reprogramming remain unknown. In this study, we found negative correlations between miR-135a and Sirt1 during mouse embryonic stem cells differentiation and mouse embryonic fibroblasts reprogramming. We further found that the reprogramming efficiency was reduced by the overexpression of miR-135a precursor but induced by the miR-135a inhibitor. Co-immunoprecipitation followed by mass spectrometry identified 21 SIRT1 interacting proteins including KU70 and WRN, which were highly enriched for DNA damage repair.
[Show full text]
Noelia Díaz Blanco
Effects of environmental factors on the gonadal transcriptome of European sea bass (Dicentrarchus labrax), juvenile growth and sex ratios Noelia Díaz Blanco Ph.D. thesis 2014 Submitted in partial fulfillment of the requirements for the Ph.D. degree from the Universitat Pompeu Fabra (UPF). This work has been carried out at the Group of Biology of Reproduction (GBR), at the Department of Renewable Marine Resources of the Institute of Marine Sciences (ICM-CSIC). Thesis supervisor: Dr. Francesc Piferrer Professor d’Investigació Institut de Ciències del Mar (ICM-CSIC) i ii A mis padres A Xavi iii iv Acknowledgements This thesis has been made possible by the support of many people who in one way or another, many times unknowingly, gave me the strength to overcome this "long and winding road". First of all, I would like to thank my supervisor, Dr. Francesc Piferrer, for his patience, guidance and wise advice throughout all this Ph.D. experience. But above all, for the trust he placed on me almost seven years ago when he offered me the opportunity to be part of his team. Thanks also for teaching me how to question always everything, for sharing with me your enthusiasm for science and for giving me the opportunity of learning from you by participating in many projects, collaborations and scientific meetings. I am also thankful to my colleagues (former and present Group of Biology of Reproduction members) for your support and encouragement throughout this journey. To the “exGBRs”, thanks for helping me with my first steps into this world. Working as an undergrad with you Dr.
[Show full text]
Cases. Genes Are Rank-Ordered According to Their P-Value
Table 1. Genes differentially expressed between adult T-ALL overexpressing ABL1 and the remaining T- ALL cases. Genes are rank-ordered according to their p-value. Probeset Gene symbol p-value FC GenBank Gene function Chromosome Expression in ID ID location “high” ABL1 cases 38847_at MELK <10-4 2.79 NM_014791 Protein amino acid phosphorylation 9p13.2 High 37999_at CPOX <10-4 2.86 NM_000097 Heme biosynthesis 3q12 High 38711_at CLASP2 <10-4 2.33 NM_015097 Cell division 3p23 High 40822_at NFATC3 0.00011 2.06 NM_004555 Regulation of transcription from 16q22.2 High RNA polymerase II promoter 41638_at PPWD1 0.00025 2.13 NM_015342 Protein folding 5q12.3 High 41278_at BAF53 0.00085 2.08 NM_004301 Regulation of transcription, 3q26.33 High DNA-dependent 39388_at CAMK2G 0.00088 2.32 NM_001222 Protein amino acid phosphorylation 10q22 High 32916_at PTPRE 0.0011 2.13 NM_006504 Protein amino acid dephosphorylation 10q26 High 36511_at SACM1L 0.0014 2.16 NM_014016 Unknown 3p21.3 High 38834_at TOPBP1 0.0015 2.55 NM_007027 DNA replication and 3q22.1 High chromosome cycle 33301_g_at CDC2L1 0.0017 2.16 NM_001787 Regulation of transcription, 1p36 High DNA-dependent 32767_at SIL 0.0025 2.23 NM_003035 Cell proliferation 1p32 High 40828_at ARHGEF7 0.0025 2.08 NM_003899 Signal transduction 13q34 High 38431_at MAPK9 0.0026 2.24 NM_002752 Protein amino acid phosphorylation 5q35 High 35663_at NPTX2 0.0028 3.68 NM_002523 Synaptic transmission 7q21.3-q22.1 High 38325_at MINPP1 0.003 2.58 NM_004897 Multiple inositol-polyphosphate 10q23 High phosphatase activity 35747_at
[Show full text]
Whole Exome Sequencing in Families at High Risk for Hodgkin Lymphoma: Identification of a Predisposing Mutation in the KDR Gene
Hodgkin Lymphoma SUPPLEMENTARY APPENDIX Whole exome sequencing in families at high risk for Hodgkin lymphoma: identification of a predisposing mutation in the KDR gene Melissa Rotunno, 1 Mary L. McMaster, 1 Joseph Boland, 2 Sara Bass, 2 Xijun Zhang, 2 Laurie Burdett, 2 Belynda Hicks, 2 Sarangan Ravichandran, 3 Brian T. Luke, 3 Meredith Yeager, 2 Laura Fontaine, 4 Paula L. Hyland, 1 Alisa M. Goldstein, 1 NCI DCEG Cancer Sequencing Working Group, NCI DCEG Cancer Genomics Research Laboratory, Stephen J. Chanock, 5 Neil E. Caporaso, 1 Margaret A. Tucker, 6 and Lynn R. Goldin 1 1Genetic Epidemiology Branch, Division of Cancer Epidemiology and Genetics, National Cancer Institute, NIH, Bethesda, MD; 2Cancer Genomics Research Laboratory, Division of Cancer Epidemiology and Genetics, National Cancer Institute, NIH, Bethesda, MD; 3Ad - vanced Biomedical Computing Center, Leidos Biomedical Research Inc.; Frederick National Laboratory for Cancer Research, Frederick, MD; 4Westat, Inc., Rockville MD; 5Division of Cancer Epidemiology and Genetics, National Cancer Institute, NIH, Bethesda, MD; and 6Human Genetics Program, Division of Cancer Epidemiology and Genetics, National Cancer Institute, NIH, Bethesda, MD, USA ©2016 Ferrata Storti Foundation. This is an open-access paper. doi:10.3324/haematol.2015.135475 Received: August 19, 2015. Accepted: January 7, 2016. Pre-published: June 13, 2016. Correspondence: [email protected] Supplemental Author Information: NCI DCEG Cancer Sequencing Working Group: Mark H. Greene, Allan Hildesheim, Nan Hu, Maria Theresa Landi, Jennifer Loud, Phuong Mai, Lisa Mirabello, Lindsay Morton, Dilys Parry, Anand Pathak, Douglas R. Stewart, Philip R. Taylor, Geoffrey S. Tobias, Xiaohong R. Yang, Guoqin Yu NCI DCEG Cancer Genomics Research Laboratory: Salma Chowdhury, Michael Cullen, Casey Dagnall, Herbert Higson, Amy A.
[Show full text]
A Transcriptional Signature of Postmitotic Maintenance in Neural Tissues
Neurobiology of Aging 74 (2019) 147e160 Contents lists available at ScienceDirect Neurobiology of Aging journal homepage: www.elsevier.com/locate/neuaging Postmitotic cell longevityeassociated genes: a transcriptional signature of postmitotic maintenance in neural tissues Atahualpa Castillo-Morales a,b, Jimena Monzón-Sandoval a,b, Araxi O. Urrutia b,c,*, Humberto Gutiérrez a,** a School of Life Sciences, University of Lincoln, Lincoln, UK b Milner Centre for Evolution, Department of Biology and Biochemistry, University of Bath, Bath, UK c Instituto de Ecología, Universidad Nacional Autónoma de México, Ciudad de México, Mexico article info abstract Article history: Different cell types have different postmitotic maintenance requirements. Nerve cells, however, are Received 11 April 2018 unique in this respect as they need to survive and preserve their functional complexity for the entire Received in revised form 3 October 2018 lifetime of the organism, and failure at any level of their supporting mechanisms leads to a wide range of Accepted 11 October 2018 neurodegenerative conditions. Whether these differences across tissues arise from the activation of Available online 19 October 2018 distinct cell typeespeciﬁc maintenance mechanisms or the differential activation of a common molecular repertoire is not known. To identify the transcriptional signature of postmitotic cellular longevity (PMCL), Keywords: we compared whole-genome transcriptome data from human tissues ranging in longevity from 120 days Neural maintenance Cell longevity to over 70 years and found a set of 81 genes whose expression levels are closely associated with Transcriptional signature increased cell longevity. Using expression data from 10 independent sources, we found that these genes Functional genomics are more highly coexpressed in longer-living tissues and are enriched in speciﬁc biological processes and transcription factor targets compared with randomly selected gene samples.
[Show full text]
Downloaded 10 April 2020)
Breeze et al. Genome Medicine (2021) 13:74 https://doi.org/10.1186/s13073-021-00877-z RESEARCH Open Access Epigenome-wide association study of kidney function identifies trans-ethnic and ethnic-specific loci Charles E. Breeze1,2,3* , Anna Batorsky4, Mi Kyeong Lee5, Mindy D. Szeto6, Xiaoguang Xu7, Daniel L. McCartney8, Rong Jiang9, Amit Patki10, Holly J. Kramer11,12, James M. Eales7, Laura Raffield13, Leslie Lange6, Ethan Lange6, Peter Durda14, Yongmei Liu15, Russ P. Tracy14,16, David Van Den Berg17, NHLBI Trans-Omics for Precision Medicine (TOPMed) Consortium, TOPMed MESA Multi-Omics Working Group, Kathryn L. Evans8, William E. Kraus15,18, Svati Shah15,18, Hermant K. Tiwari10, Lifang Hou19,20, Eric A. Whitsel21,22, Xiao Jiang7, Fadi J. Charchar23,24,25, Andrea A. Baccarelli26, Stephen S. Rich27, Andrew P. Morris28, Marguerite R. Irvin29, Donna K. Arnett30, Elizabeth R. Hauser15,31, Jerome I. Rotter32, Adolfo Correa33, Caroline Hayward34, Steve Horvath35,36, Riccardo E. Marioni8, Maciej Tomaszewski7,37, Stephan Beck2, Sonja I. Berndt1, Stephanie J. London5, Josyf C. Mychaleckyj27 and Nora Franceschini21* Abstract Background: DNA methylation (DNAm) is associated with gene regulation and estimated glomerular filtration rate (eGFR), a measure of kidney function. Decreased eGFR is more common among US Hispanics and African Americans. The causes for this are poorly understood. We aimed to identify trans-ethnic and ethnic-specific differentially methylated positions (DMPs) associated with eGFR using an agnostic, genome-wide approach. Methods: The study included up to 5428 participants from multi-ethnic studies for discovery and 8109 participants for replication. We tested the associations between whole blood DNAm and eGFR using beta values from Illumina 450K or EPIC arrays.
[Show full text]
UC San Diego UC San Diego Electronic Theses and Dissertations
UC San Diego UC San Diego Electronic Theses and Dissertations Title Regulation of gene expression programs by serum response factor and megakaryoblastic leukemia 1/2 in macrophages Permalink https://escholarship.org/uc/item/8cc7d0t0 Author Sullivan, Amy Lynn Publication Date 2009 Peer reviewed|Thesis/dissertation eScholarship.org Powered by the California Digital Library University of California UNIVERSITY OF CALIFORNIA, SAN DIEGO Regulation of Gene Expression Programs by Serum Response Factor and Megakaryoblastic Leukemia 1/2 in Macrophages A dissertation submitted in partial satisfaction of the requirements for the degree Doctor of Philosophy in Biomedical Sciences by Amy Lynn Sullivan Committee in charge: Professor Christopher K. Glass, Chair Professor Stephen M. Hedrick Professor Marc R. Montminy Professor Nicholas J. Webster Professor Joseph L. Witztum 2009 Copyright Amy Lynn Sullivan, 2009 All rights reserved. The Dissertation of Amy Lynn Sullivan is approved, and it is acceptable in quality and form for publication on microfilm and electronically: ______________________________________________________________ ______________________________________________________________ ______________________________________________________________ ______________________________________________________________ ______________________________________________________________ Chair University of California, San Diego 2009 iii DEDICATION To my husband, Shane, for putting up with me through all of the long hours, last minute late nights, and for not letting me quit no matter how many times my projects fell apart. To my son, Tyler, for always making me smile and for making every day an adventure. To my gifted colleagues, for all of the thought-provoking discussions, technical help and moral support through the roller- coaster ride that has been my graduate career. To my family and friends, for all of your love and support. I couldn’t have done it without you! iv EPIGRAPH If at first you don’t succeed, try, try, again.
[Show full text]
"The Genecards Suite: from Gene Data Mining to Disease Genome Sequence Analyses". In: Current Protocols in Bioinformat
The GeneCards Suite: From Gene Data UNIT 1.30 Mining to Disease Genome Sequence Analyses Gil Stelzer,1,5 Naomi Rosen,1,5 Inbar Plaschkes,1,2 Shahar Zimmerman,1 Michal Twik,1 Simon Fishilevich,1 Tsippi Iny Stein,1 Ron Nudel,1 Iris Lieder,2 Yaron Mazor,2 Sergey Kaplan,2 Dvir Dahary,2,4 David Warshawsky,3 Yaron Guan-Golan,3 Asher Kohn,3 Noa Rappaport,1 Marilyn Safran,1 and Doron Lancet1,6 1Department of Molecular Genetics, Weizmann Institute of Science, Rehovot, Israel 2LifeMap Sciences Ltd., Tel Aviv, Israel 3LifeMap Sciences Inc., Marshﬁeld, Massachusetts 4Toldot Genetics Ltd., Hod Hasharon, Israel 5These authors contributed equally to the paper 6Corresponding author GeneCards, the human gene compendium, enables researchers to effectively navigate and inter-relate the wide universe of human genes, diseases, variants, proteins, cells, and biological pathways. Our recently launched Version 4 has a revamped infrastructure facilitating faster data updates, better-targeted data queries, and friendlier user experience. It also provides a stronger foundation for the GeneCards suite of companion databases and analysis tools. Improved data uniﬁcation includes gene-disease links via MalaCards and merged biological pathways via PathCards, as well as drug information and proteome expression. VarElect, another suite member, is a phenotype prioritizer for next-generation sequencing, leveraging the GeneCards and MalaCards knowledgebase. It au- tomatically infers direct and indirect scored associations between hundreds or even thousands of variant-containing genes and disease phenotype terms. Var- Elect’s capabilities, either independently or within TGex, our comprehensive variant analysis pipeline, help prepare for the challenge of clinical projects that involve thousands of exome/genome NGS analyses.
[Show full text]
A Stable Sub-Complex Between GCP4, GCP5 and GCP6 Promotes The
© 2020. Published by The Company of Biologists Ltd | Journal of Cell Science (2020) 133, jcs244368. doi:10.1242/jcs.244368 RESEARCH ARTICLE A stable sub-complex between GCP4, GCP5 and GCP6 promotes the assembly of γ-tubulin ring complexes Laurence Haren, Dorian Farache*, Laurent Emorine and Andreas Merdes‡ ABSTRACT grip1 and grip2 motifs, corresponding to the N-terminal and γ-Tubulin is the main protein involved in the nucleation of C-terminal halves of GCP4, the smallest GCP (Gunawardane et al., microtubules in all eukaryotes. It forms two different complexes with 2000; Guillet et al., 2011). The crystallographic structure of GCP4 α proteins of the GCP family (γ-tubulin complex proteins): γ-tubulin shows that these domains correspond to bundles of -helices. The small complexes (γTuSCs) that contain γ-tubulin, and GCPs 2 and 3; other GCPs contain additional specific sequences, mainly at the and γ-tubulin ring complexes (γTuRCs) that contain multiple γTuSCs extreme N-terminus or in the region that links the grip1 and grip2 in addition to GCPs 4, 5 and 6. Whereas the structure and assembly motifs, as in GCPs 5 and 6 (Guillet et al., 2011; Farache et al., 2016). properties of γTuSCs have been intensively studied, little is known Depletion of GCP2 or GCP3 leads to severe spindle about the assembly of γTuRCs and the specific roles of GCPs 4, 5 abnormalities, and depleted cells are not viable. Depletion of and 6. Here, we demonstrate that two copies of GCP4 and one copy GCP4, 5 or 6 can be tolerated in fission yeast or in somatic cells of Drosophila each of GCP5 and GCP6 form a salt (KCl)-resistant sub-complex but not in vertebrates, where removal of either of these γ within the γTuRC that assembles independently of the presence of GCPs prevents the formation of the TuRC and provokes spindle γTuSCs.
[Show full text]
Suppl. Table 1
Suppl. Table 1. SiRNA library used for centriole overduplication screen. Entrez Gene Id NCBI gene symbol siRNA Target Sequence 1070 CETN3 TTGCGACGTGTTGCTAGAGAA 1070 CETN3 AAGCAATAGATTATCATGAAT 55722 CEP72 AGAGCTATGTATGATAATTAA 55722 CEP72 CTGGATGATTTGAGACAACAT 80071 CCDC15 ACCGAGTAAATCAACAAATTA 80071 CCDC15 CAGCAGAGTTCAGAAAGTAAA 9702 CEP57 TAGACTTATCTTTGAAGATAA 9702 CEP57 TAGAGAAACAATTGAATATAA 282809 WDR51B AAGGACTAATTTAAATTACTA 282809 WDR51B AAGATCCTGGATACAAATTAA 55142 CEP27 CAGCAGATCACAAATATTCAA 55142 CEP27 AAGCTGTTTATCACAGATATA 85378 TUBGCP6 ACGAGACTACTTCCTTAACAA 85378 TUBGCP6 CACCCACGGACACGTATCCAA 54930 C14orf94 CAGCGGCTGCTTGTAACTGAA 54930 C14orf94 AAGGGAGTGTGGAAATGCTTA 5048 PAFAH1B1 CCCGGTAATATCACTCGTTAA 5048 PAFAH1B1 CTCATAGATATTGAACAATAA 2802 GOLGA3 CTGGCCGATTACAGAACTGAA 2802 GOLGA3 CAGAGTTACTTCAGTGCATAA 9662 CEP135 AAGAATTTCATTCTCACTTAA 9662 CEP135 CAGCAGAAAGAGATAAACTAA 153241 CCDC100 ATGCAAGAAGATATATTTGAA 153241 CCDC100 CTGCGGTAATTTCCAGTTCTA 80184 CEP290 CCGGAAGAAATGAAGAATTAA 80184 CEP290 AAGGAAATCAATAAACTTGAA 22852 ANKRD26 CAGAAGTATGTTGATCCTTTA 22852 ANKRD26 ATGGATGATGTTGATGACTTA 10540 DCTN2 CACCAGCTATATGAAACTATA 10540 DCTN2 AACGAGATTGCCAAGCATAAA 25886 WDR51A AAGTGATGGTTTGGAAGAGTA 25886 WDR51A CCAGTGATGACAAGACTGTTA 55835 CENPJ CTCAAGTTAAACATAAGTCAA 55835 CENPJ CACAGTCAGATAAATCTGAAA 84902 CCDC123 AAGGATGGAGTGCTTAATAAA 84902 CCDC123 ACCCTGGTTGTTGGATATAAA 79598 LRRIQ2 CACAAGAGAATTCTAAATTAA 79598 LRRIQ2 AAGGATAATATCGTTTAACAA 51143 DYNC1LI1 TTGGATTTGTCTATACATATA 51143 DYNC1LI1 TAGACTTAGTATATAAATACA 2302 FOXJ1 CAGGACAGACAGACTAATGTA
[Show full text]