Supplemental Materials Table 1. Proteins Significantly Differentially
Total Page:16
File Type:pdf, Size:1020Kb
Load more
Recommended publications
-
Supplemental Information to Mammadova-Bach Et Al., “Laminin Α1 Orchestrates VEGFA Functions in the Ecosystem of Colorectal Carcinogenesis”
Supplemental information to Mammadova-Bach et al., “Laminin α1 orchestrates VEGFA functions in the ecosystem of colorectal carcinogenesis” Supplemental material and methods Cloning of the villin-LMα1 vector The plasmid pBS-villin-promoter containing the 3.5 Kb of the murine villin promoter, the first non coding exon, 5.5 kb of the first intron and 15 nucleotides of the second villin exon, was generated by S. Robine (Institut Curie, Paris, France). The EcoRI site in the multi cloning site was destroyed by fill in ligation with T4 polymerase according to the manufacturer`s instructions (New England Biolabs, Ozyme, Saint Quentin en Yvelines, France). Site directed mutagenesis (GeneEditor in vitro Site-Directed Mutagenesis system, Promega, Charbonnières-les-Bains, France) was then used to introduce a BsiWI site before the start codon of the villin coding sequence using the 5’ phosphorylated primer: 5’CCTTCTCCTCTAGGCTCGCGTACGATGACGTCGGACTTGCGG3’. A double strand annealed oligonucleotide, 5’GGCCGGACGCGTGAATTCGTCGACGC3’ and 5’GGCCGCGTCGACGAATTCACGC GTCC3’ containing restriction site for MluI, EcoRI and SalI were inserted in the NotI site (present in the multi cloning site), generating the plasmid pBS-villin-promoter-MES. The SV40 polyA region of the pEGFP plasmid (Clontech, Ozyme, Saint Quentin Yvelines, France) was amplified by PCR using primers 5’GGCGCCTCTAGATCATAATCAGCCATA3’ and 5’GGCGCCCTTAAGATACATTGATGAGTT3’ before subcloning into the pGEMTeasy vector (Promega, Charbonnières-les-Bains, France). After EcoRI digestion, the SV40 polyA fragment was purified with the NucleoSpin Extract II kit (Machery-Nagel, Hoerdt, France) and then subcloned into the EcoRI site of the plasmid pBS-villin-promoter-MES. Site directed mutagenesis was used to introduce a BsiWI site (5’ phosphorylated AGCGCAGGGAGCGGCGGCCGTACGATGCGCGGCAGCGGCACG3’) before the initiation codon and a MluI site (5’ phosphorylated 1 CCCGGGCCTGAGCCCTAAACGCGTGCCAGCCTCTGCCCTTGG3’) after the stop codon in the full length cDNA coding for the mouse LMα1 in the pCIS vector (kindly provided by P. -
Universidade Estadual De Campinas Instituto De Biologia
UNIVERSIDADE ESTADUAL DE CAMPINAS INSTITUTO DE BIOLOGIA VERÔNICA APARECIDA MONTEIRO SAIA CEREDA O PROTEOMA DO CORPO CALOSO DA ESQUIZOFRENIA THE PROTEOME OF THE CORPUS CALLOSUM IN SCHIZOPHRENIA CAMPINAS 2016 1 VERÔNICA APARECIDA MONTEIRO SAIA CEREDA O PROTEOMA DO CORPO CALOSO DA ESQUIZOFRENIA THE PROTEOME OF THE CORPUS CALLOSUM IN SCHIZOPHRENIA Dissertação apresentada ao Instituto de Biologia da Universidade Estadual de Campinas como parte dos requisitos exigidos para a obtenção do Título de Mestra em Biologia Funcional e Molecular na área de concentração de Bioquímica. Dissertation presented to the Institute of Biology of the University of Campinas in partial fulfillment of the requirements for the degree of Master in Functional and Molecular Biology, in the area of Biochemistry. ESTE ARQUIVO DIGITAL CORRESPONDE À VERSÃO FINAL DA DISSERTAÇÃO DEFENDIDA PELA ALUNA VERÔNICA APARECIDA MONTEIRO SAIA CEREDA E ORIENTADA PELO DANIEL MARTINS-DE-SOUZA. Orientador: Daniel Martins-de-Souza CAMPINAS 2016 2 Agência(s) de fomento e nº(s) de processo(s): CNPq, 151787/2F2014-0 Ficha catalográfica Universidade Estadual de Campinas Biblioteca do Instituto de Biologia Mara Janaina de Oliveira - CRB 8/6972 Saia-Cereda, Verônica Aparecida Monteiro, 1988- Sa21p O proteoma do corpo caloso da esquizofrenia / Verônica Aparecida Monteiro Saia Cereda. – Campinas, SP : [s.n.], 2016. Orientador: Daniel Martins de Souza. Dissertação (mestrado) – Universidade Estadual de Campinas, Instituto de Biologia. 1. Esquizofrenia. 2. Espectrometria de massas. 3. Corpo caloso. -
Class-I and Class-II Fumarases Are a Paradigm of the Recruitment Of
bioRxiv preprint doi: https://doi.org/10.1101/2020.08.04.232652; this version posted August 4, 2020. The copyright holder for this preprint (which was not certified by peer review) is the author/funder, who has granted bioRxiv a license to display the preprint in perpetuity. It is made available under aCC-BY-NC-ND 4.0 International license. 1 Class-I and Class-II fumarases are a paradigm of the recruitment of 2 metabolites and metabolic enzymes for signalling of the DNA Damage 3 Response during evolution. 4 5 Yardena Silas 1, 2, Esti Singer 1, Norbert Lehming 2 and Ophry Pines 1, 2* 6 1. Department of Microbiology and Molecular Genetics, IMRIC, Faculty of Medicine, 7 Hebrew University, Jerusalem, Israel 8 2. CREATE‑NUS‑HUJ Program and the Department of Microbiology and Immunology, 9 Yong Loo Lin School of Medicine, National University of Singapore, Singapore, 10 Singapore. 11 12 [email protected] 13 [email protected] 14 [email protected] 15 [email protected] 16 17 18 19 20 21 22 23 24 25 26 1 bioRxiv preprint doi: https://doi.org/10.1101/2020.08.04.232652; this version posted August 4, 2020. The copyright holder for this preprint (which was not certified by peer review) is the author/funder, who has granted bioRxiv a license to display the preprint in perpetuity. It is made available under aCC-BY-NC-ND 4.0 International license. 27 Abstract 28 Class-II fumarase (Fumarate Hydratase, FH) and its metabolic intermediates are essential 29 components in the DNA damage response (DDR) in eukaryotic cells (human and yeast) and 30 in the prokaryote Bacillus subtilis. -
Regulation of Pluripotency by RNA Binding Proteins
Cell Stem Cell Review Regulation of Pluripotency by RNA Binding Proteins Julia Ye1,2 and Robert Blelloch1,2,* 1The Eli and Edythe Broad Center of Regeneration Medicine and Stem Cell Research, Center for Reproductive Sciences, University of California, San Francisco, San Francisco, CA 94143, USA 2Department of Urology, University of California, San Francisco, San Francisco, CA 94143, USA *Correspondence: [email protected] http://dx.doi.org/10.1016/j.stem.2014.08.010 Establishment, maintenance, and exit from pluripotency require precise coordination of a cell’s molecular machinery. Substantial headway has been made in deciphering many aspects of this elaborate system, particularly with respect to epigenetics, transcription, and noncoding RNAs. Less attention has been paid to posttranscriptional regulatory processes such as alternative splicing, RNA processing and modification, nuclear export, regulation of transcript stability, and translation. Here, we introduce the RNA binding proteins that enable the posttranscriptional regulation of gene expression, summarizing current and ongoing research on their roles at different regulatory points and discussing how they help script the fate of pluripotent stem cells. Introduction RBPs are responsible for every event in the life of an RNA Embryonic stem cells (ESCs), which are derived from the inner molecule, including its capping, splicing, cleavage, nontem- cell mass of the mammalian blastocyst, are remarkable because plated nucleotide addition, nucleotide editing, nuclear export, they can propagate in vitro indefinitely while retaining both the cellular localization, stability, and translation (Keene, 2007). molecular identity and the pluripotent properties of the peri-im- Overall, little is known about RBPs: most are classified based plantation epiblast. -
A Computational Approach for Defining a Signature of Β-Cell Golgi Stress in Diabetes Mellitus
Page 1 of 781 Diabetes A Computational Approach for Defining a Signature of β-Cell Golgi Stress in Diabetes Mellitus Robert N. Bone1,6,7, Olufunmilola Oyebamiji2, Sayali Talware2, Sharmila Selvaraj2, Preethi Krishnan3,6, Farooq Syed1,6,7, Huanmei Wu2, Carmella Evans-Molina 1,3,4,5,6,7,8* Departments of 1Pediatrics, 3Medicine, 4Anatomy, Cell Biology & Physiology, 5Biochemistry & Molecular Biology, the 6Center for Diabetes & Metabolic Diseases, and the 7Herman B. Wells Center for Pediatric Research, Indiana University School of Medicine, Indianapolis, IN 46202; 2Department of BioHealth Informatics, Indiana University-Purdue University Indianapolis, Indianapolis, IN, 46202; 8Roudebush VA Medical Center, Indianapolis, IN 46202. *Corresponding Author(s): Carmella Evans-Molina, MD, PhD ([email protected]) Indiana University School of Medicine, 635 Barnhill Drive, MS 2031A, Indianapolis, IN 46202, Telephone: (317) 274-4145, Fax (317) 274-4107 Running Title: Golgi Stress Response in Diabetes Word Count: 4358 Number of Figures: 6 Keywords: Golgi apparatus stress, Islets, β cell, Type 1 diabetes, Type 2 diabetes 1 Diabetes Publish Ahead of Print, published online August 20, 2020 Diabetes Page 2 of 781 ABSTRACT The Golgi apparatus (GA) is an important site of insulin processing and granule maturation, but whether GA organelle dysfunction and GA stress are present in the diabetic β-cell has not been tested. We utilized an informatics-based approach to develop a transcriptional signature of β-cell GA stress using existing RNA sequencing and microarray datasets generated using human islets from donors with diabetes and islets where type 1(T1D) and type 2 diabetes (T2D) had been modeled ex vivo. To narrow our results to GA-specific genes, we applied a filter set of 1,030 genes accepted as GA associated. -
1 Metabolic Dysfunction Is Restricted to the Sciatic Nerve in Experimental
Page 1 of 255 Diabetes Metabolic dysfunction is restricted to the sciatic nerve in experimental diabetic neuropathy Oliver J. Freeman1,2, Richard D. Unwin2,3, Andrew W. Dowsey2,3, Paul Begley2,3, Sumia Ali1, Katherine A. Hollywood2,3, Nitin Rustogi2,3, Rasmus S. Petersen1, Warwick B. Dunn2,3†, Garth J.S. Cooper2,3,4,5* & Natalie J. Gardiner1* 1 Faculty of Life Sciences, University of Manchester, UK 2 Centre for Advanced Discovery and Experimental Therapeutics (CADET), Central Manchester University Hospitals NHS Foundation Trust, Manchester Academic Health Sciences Centre, Manchester, UK 3 Centre for Endocrinology and Diabetes, Institute of Human Development, Faculty of Medical and Human Sciences, University of Manchester, UK 4 School of Biological Sciences, University of Auckland, New Zealand 5 Department of Pharmacology, Medical Sciences Division, University of Oxford, UK † Present address: School of Biosciences, University of Birmingham, UK *Joint corresponding authors: Natalie J. Gardiner and Garth J.S. Cooper Email: [email protected]; [email protected] Address: University of Manchester, AV Hill Building, Oxford Road, Manchester, M13 9PT, United Kingdom Telephone: +44 161 275 5768; +44 161 701 0240 Word count: 4,490 Number of tables: 1, Number of figures: 6 Running title: Metabolic dysfunction in diabetic neuropathy 1 Diabetes Publish Ahead of Print, published online October 15, 2015 Diabetes Page 2 of 255 Abstract High glucose levels in the peripheral nervous system (PNS) have been implicated in the pathogenesis of diabetic neuropathy (DN). However our understanding of the molecular mechanisms which cause the marked distal pathology is incomplete. Here we performed a comprehensive, system-wide analysis of the PNS of a rodent model of DN. -
Investigation of Copy Number Variations on Chromosome 21 Detected by Comparative Genomic Hybridization
Li et al. Molecular Cytogenetics (2018) 11:42 https://doi.org/10.1186/s13039-018-0391-3 RESEARCH Open Access Investigation of copy number variations on chromosome 21 detected by comparative genomic hybridization (CGH) microarray in patients with congenital anomalies Wenfu Li, Xianfu Wang and Shibo Li* Abstract Background: The clinical features of Down syndrome vary among individuals, with those most common being congenital heart disease, intellectual disability, developmental abnormity and dysmorphic features. Complex combination of Down syndrome phenotype could be produced by partially copy number variations (CNVs) on chromosome 21 as well. By comparing individual with partial CNVs of chromosome 21 with other patients of known CNVs and clinical phenotypes, we hope to provide a better understanding of the genotype-phenotype correlation of chromosome 21. Methods: A total of 2768 pediatric patients sample collected at the Genetics Laboratory at Oklahoma University Health Science Center were screened using CGH Microarray for CNVs on chromosome 21. Results: We report comprehensive clinical and molecular descriptions of six patients with microduplication and seven patients with microdeletion on the long arm of chromosome 21. Patients with microduplication have varied clinical features including developmental delay, microcephaly, facial dysmorphic features, pulmonary stenosis, autism, preauricular skin tag, eye pterygium, speech delay and pain insensitivity. We found that patients with microdeletion presented with developmental delay, microcephaly, intrauterine fetal demise, epilepsia partialis continua, congenital coronary anomaly and seizures. Conclusion: Three patients from our study combine with four patients in public database suggests an association between 21q21.1 microduplication of CXADR gene and patients with developmental delay. One patient with 21q22.13 microdeletion of DYRK1A shows association with microcephaly and scoliosis. -
Yeast Genome Gazetteer P35-65
gazetteer Metabolism 35 tRNA modification mitochondrial transport amino-acid metabolism other tRNA-transcription activities vesicular transport (Golgi network, etc.) nitrogen and sulphur metabolism mRNA synthesis peroxisomal transport nucleotide metabolism mRNA processing (splicing) vacuolar transport phosphate metabolism mRNA processing (5’-end, 3’-end processing extracellular transport carbohydrate metabolism and mRNA degradation) cellular import lipid, fatty-acid and sterol metabolism other mRNA-transcription activities other intracellular-transport activities biosynthesis of vitamins, cofactors and RNA transport prosthetic groups other transcription activities Cellular organization and biogenesis 54 ionic homeostasis organization and biogenesis of cell wall and Protein synthesis 48 plasma membrane Energy 40 ribosomal proteins organization and biogenesis of glycolysis translation (initiation,elongation and cytoskeleton gluconeogenesis termination) organization and biogenesis of endoplasmic pentose-phosphate pathway translational control reticulum and Golgi tricarboxylic-acid pathway tRNA synthetases organization and biogenesis of chromosome respiration other protein-synthesis activities structure fermentation mitochondrial organization and biogenesis metabolism of energy reserves (glycogen Protein destination 49 peroxisomal organization and biogenesis and trehalose) protein folding and stabilization endosomal organization and biogenesis other energy-generation activities protein targeting, sorting and translocation vacuolar and lysosomal -
Serum Albumin OS=Homo Sapiens
Protein Name Cluster of Glial fibrillary acidic protein OS=Homo sapiens GN=GFAP PE=1 SV=1 (P14136) Serum albumin OS=Homo sapiens GN=ALB PE=1 SV=2 Cluster of Isoform 3 of Plectin OS=Homo sapiens GN=PLEC (Q15149-3) Cluster of Hemoglobin subunit beta OS=Homo sapiens GN=HBB PE=1 SV=2 (P68871) Vimentin OS=Homo sapiens GN=VIM PE=1 SV=4 Cluster of Tubulin beta-3 chain OS=Homo sapiens GN=TUBB3 PE=1 SV=2 (Q13509) Cluster of Actin, cytoplasmic 1 OS=Homo sapiens GN=ACTB PE=1 SV=1 (P60709) Cluster of Tubulin alpha-1B chain OS=Homo sapiens GN=TUBA1B PE=1 SV=1 (P68363) Cluster of Isoform 2 of Spectrin alpha chain, non-erythrocytic 1 OS=Homo sapiens GN=SPTAN1 (Q13813-2) Hemoglobin subunit alpha OS=Homo sapiens GN=HBA1 PE=1 SV=2 Cluster of Spectrin beta chain, non-erythrocytic 1 OS=Homo sapiens GN=SPTBN1 PE=1 SV=2 (Q01082) Cluster of Pyruvate kinase isozymes M1/M2 OS=Homo sapiens GN=PKM PE=1 SV=4 (P14618) Glyceraldehyde-3-phosphate dehydrogenase OS=Homo sapiens GN=GAPDH PE=1 SV=3 Clathrin heavy chain 1 OS=Homo sapiens GN=CLTC PE=1 SV=5 Filamin-A OS=Homo sapiens GN=FLNA PE=1 SV=4 Cytoplasmic dynein 1 heavy chain 1 OS=Homo sapiens GN=DYNC1H1 PE=1 SV=5 Cluster of ATPase, Na+/K+ transporting, alpha 2 (+) polypeptide OS=Homo sapiens GN=ATP1A2 PE=3 SV=1 (B1AKY9) Fibrinogen beta chain OS=Homo sapiens GN=FGB PE=1 SV=2 Fibrinogen alpha chain OS=Homo sapiens GN=FGA PE=1 SV=2 Dihydropyrimidinase-related protein 2 OS=Homo sapiens GN=DPYSL2 PE=1 SV=1 Cluster of Alpha-actinin-1 OS=Homo sapiens GN=ACTN1 PE=1 SV=2 (P12814) 60 kDa heat shock protein, mitochondrial OS=Homo -
S41467-020-18249-3.Pdf
ARTICLE https://doi.org/10.1038/s41467-020-18249-3 OPEN Pharmacologically reversible zonation-dependent endothelial cell transcriptomic changes with neurodegenerative disease associations in the aged brain Lei Zhao1,2,17, Zhongqi Li 1,2,17, Joaquim S. L. Vong2,3,17, Xinyi Chen1,2, Hei-Ming Lai1,2,4,5,6, Leo Y. C. Yan1,2, Junzhe Huang1,2, Samuel K. H. Sy1,2,7, Xiaoyu Tian 8, Yu Huang 8, Ho Yin Edwin Chan5,9, Hon-Cheong So6,8, ✉ ✉ Wai-Lung Ng 10, Yamei Tang11, Wei-Jye Lin12,13, Vincent C. T. Mok1,5,6,14,15 &HoKo 1,2,4,5,6,8,14,16 1234567890():,; The molecular signatures of cells in the brain have been revealed in unprecedented detail, yet the ageing-associated genome-wide expression changes that may contribute to neurovas- cular dysfunction in neurodegenerative diseases remain elusive. Here, we report zonation- dependent transcriptomic changes in aged mouse brain endothelial cells (ECs), which pro- minently implicate altered immune/cytokine signaling in ECs of all vascular segments, and functional changes impacting the blood–brain barrier (BBB) and glucose/energy metabolism especially in capillary ECs (capECs). An overrepresentation of Alzheimer disease (AD) GWAS genes is evident among the human orthologs of the differentially expressed genes of aged capECs, while comparative analysis revealed a subset of concordantly downregulated, functionally important genes in human AD brains. Treatment with exenatide, a glucagon-like peptide-1 receptor agonist, strongly reverses aged mouse brain EC transcriptomic changes and BBB leakage, with associated attenuation of microglial priming. We thus revealed tran- scriptomic alterations underlying brain EC ageing that are complex yet pharmacologically reversible. -
(3 ) End—Oligouridylation As a Step on the Path to Destruction
Downloaded from genesdev.cshlp.org on September 23, 2021 - Published by Cold Spring Harbor Laboratory Press PERSPECTIVE (New ways to meet your (3 end—oligouridylation as a step on the path to destruction Carol J. Wilusz2 and Jeffrey Wilusz1 Department of Microbiology, Immunology, and Pathology, Colorado State University, Fort Collins, Colorado 80523, USA Messenger RNA degradation is a vital contributor to the may accomplish the same endpoint (recruitment of deg- control of gene expression that generally involves re- radative enzymes), they may not be totally interchange- moval of a poly(A) tail in both prokaryotes and eukary- able as each can be regulated differently at the level of otes. In a thought-provoking study in this issue of Genes synthesis, recruit different regulatory poly(U)- or & Development, Mullen and Marzluff (2008) present poly(A)-binding factors, or attract different degradative data supporting a novel mechanism of mRNA decay. enzymes to the transcript. This strategy for initiating They discovered that histone mRNAs, which are unique decay via 3Ј unstructured extensions may have favored in that they are never polyadenylated in mammalian the evolution of the 3Ј end of RNAs to focus on tran- cells, degrade by a cell cycle-regulated mechanism that script function rather than on maintaining sequences/ involves addition of a short oligo(U) tail at the 3Ј end. structures that allow for eventual decay of the transcript. Interestingly, this oligo(U) tract is recognized by the It also creates a ready means for the cell to degrade any Lsm1–7 complex, which then appears to feed the tran- unwanted transcripts without regard to sequence or script into the standard mRNA decay pathways. -
Exploring the Non-Canonical Functions of Metabolic Enzymes Peiwei Huangyang1,2 and M
© 2018. Published by The Company of Biologists Ltd | Disease Models & Mechanisms (2018) 11, dmm033365. doi:10.1242/dmm.033365 REVIEW SPECIAL COLLECTION: CANCER METABOLISM Hidden features: exploring the non-canonical functions of metabolic enzymes Peiwei Huangyang1,2 and M. Celeste Simon1,3,* ABSTRACT A key finding from studies of metabolic enzymes is the existence The study of cellular metabolism has been rigorously revisited over the of mechanistic links between their nuclear localization and the past decade, especially in the field of cancer research, revealing new regulation of transcription. By modulating gene expression, insights that expand our understanding of malignancy. Among these metabolic enzymes themselves facilitate adaptation to rapidly insights isthe discovery that various metabolic enzymes have surprising changing environments. Furthermore, they can directly shape a ’ activities outside of their established metabolic roles, including in cell s epigenetic landscape (Kaelin and McKnight, 2013). the regulation of gene expression, DNA damage repair, cell cycle Strikingly, several metabolic enzymes exert completely distinct progression and apoptosis. Many of these newly identified functions are functions in different cellular compartments. Nuclear fructose activated in response to growth factor signaling, nutrient and oxygen bisphosphate aldolase, for example, directly interacts with RNA ́ availability, and external stress. As such, multifaceted enzymes directly polymerase III to control transcription (Ciesla et al., 2014),