DOCSLIB.ORG

Investigation of Copy Number Variations on Chromosome 21 Detected by Comparative Genomic Hybridization

Total Page：16

File Type：pdf, Size：1020Kb

Download full-text PDF Read full-text
Investigation of Copy Number Variations on Chromosome 21 Detected by Comparative Genomic Hybridization Li et al. Molecular Cytogenetics (2018) 11:42 https://doi.org/10.1186/s13039-018-0391-3 RESEARCH Open Access Investigation of copy number variations on chromosome 21 detected by comparative genomic hybridization (CGH) microarray in patients with congenital anomalies Wenfu Li, Xianfu Wang and Shibo Li* Abstract Background: The clinical features of Down syndrome vary among individuals, with those most common being congenital heart disease, intellectual disability, developmental abnormity and dysmorphic features. Complex combination of Down syndrome phenotype could be produced by partially copy number variations (CNVs) on chromosome 21 as well. By comparing individual with partial CNVs of chromosome 21 with other patients of known CNVs and clinical phenotypes, we hope to provide a better understanding of the genotype-phenotype correlation of chromosome 21. Methods: A total of 2768 pediatric patients sample collected at the Genetics Laboratory at Oklahoma University Health Science Center were screened using CGH Microarray for CNVs on chromosome 21. Results: We report comprehensive clinical and molecular descriptions of six patients with microduplication and seven patients with microdeletion on the long arm of chromosome 21. Patients with microduplication have varied clinical features including developmental delay, microcephaly, facial dysmorphic features, pulmonary stenosis, autism, preauricular skin tag, eye pterygium, speech delay and pain insensitivity. We found that patients with microdeletion presented with developmental delay, microcephaly, intrauterine fetal demise, epilepsia partialis continua, congenital coronary anomaly and seizures. Conclusion: Three patients from our study combine with four patients in public database suggests an association between 21q21.1 microduplication of CXADR gene and patients with developmental delay. One patient with 21q22.13 microdeletion of DYRK1A shows association with microcephaly and scoliosis. Our findings helped pinpoint critical genes in the genotype-phenotype association with a high resolution of 0.1 Mb and expanded the clinical features observed in patients with CNVs on the long arm of chromosome 21. Keywords: Chromosome 21, Microarray, CNV, Genotype-phenotype association, CXADR, DYRK1A Background Despite the fact that DS is mainly caused by trisomy 21, Down Syndrome (DS) is the most prevalent genetic dis- the genotype-phenotype association of typical DS fea- order resulting in intellectual disability, which is usually tures is yet to be determined. caused by an extra copy of chromosome 21. It is esti- Down Syndrome Critical Region (DSCR) hypothesis mated that 1 in 700 newborn babies in United States are failed to provide solid evidence on the proposed theory diagnosed with DS [1]. The phenotypes of DS frequently of minimum gene responsible for all major DS pheno- include congenital heart disease, intellectual disability, types caused by a gene dosage effect [3–6]. Meanwhile, developmental abnormity and dysmorphic features [2]. under limited circumstances partial monosomy 21 and partial trisomy 21 have been found to provide better * Correspondence: [email protected] understanding on the genotype-phenotype association of Genetics Laboratory, University of Oklahoma Health Sciences Center, 1122 NE chromosome 21 [7–10]. Phenotypes with partial 13th Street, Suite 1400, Oklahoma City, OK 73104, USA © The Author(s). 2018 Open Access This article is distributed under the terms of the Creative Commons Attribution 4.0 International License (http://creativecommons.org/licenses/by/4.0/), which permits unrestricted use, distribution, and reproduction in any medium, provided you give appropriate credit to the original author(s) and the source, provide a link to the Creative Commons license, and indicate if changes were made. The Creative Commons Public Domain Dedication waiver (http://creativecommons.org/publicdomain/zero/1.0/) applies to the data made available in this article, unless otherwise stated. Li et al. Molecular Cytogenetics (2018) 11:42 Page 2 of 8 duplication or deletion of chromosome 21q are found to CGH microarray be highly variable among patients For instance, a child Fresh blood samples were collected for this study and with Intellectual disability and dysmorphologic features genomic DNA was extracted from peripheral white of DS but without congenital heart disease was found to blood cells according to our standard operating using have a 2.78-Mb duplication on chromosome 21q22.11 Nucleic Acid Isolation System (QuickGene-610 L, FUJI- [11]. Partial deletion of 21q21.1 are found to be associ- FILM Corporation, Tokyo, Japan). Patient D1’s CGH ated with intellectual disability while deletion of microarray was performed on a 385-K oligonucleotide 21q22.11 are considered associated with neurobehavioral chip and all other samples were performed on a CGH disorder [8]. Despite the efforts to link DS clinical fea- 720 K Whole-Genome Tiling v3.0 array (Roche Nimble- tures with genes and regions, the association map reso- Gen, Inc., Madison, WI) according to the manufacturer’s lution is low and details still remain incomplete. protocol with minor modifications. As an internal Instead of trying to find a DSCR, our study focused on hybridization control for each experiment, an opposite finding specific genotype-phenotype associations by in- sex DNA came from normal population individuals vestigating rare patients which involved a partial CNV pooled use as reference DNA (Promega Corporation, on chromosome 21. Advancements in technology in Madison, WI). Both the patients’ DNA and reference comparative genomic hybridization (CGH) microarray DNA were labeled with either Cyanine 3 (Cy-3) or enable laboratory to identify copy number variations Cyanine 5 (Cy-5) by random priming (Trilink Biotech- (CNVs) on chromosome 21 as small as 10 k base pairs. nologies, San Diego, CA) and then hybridized to the From 2008 to 2018, 2768 samples were collected at the chip via incubation in the MAUI hybridization system Genetics Laboratory at University of Oklahoma Health (Biomicro Systems, Inc., Salt Lake City, UT). After 18 h Sciences Center (OUHSC). During this period, we iden- of hybridization at 42 °C, slides were washed and tified six patients with partial duplication and seven pa- scanned using an MS200 (Roche NimbleGen, Inc.). Nim- tients with partial deletion of chromosome 21. Among bleScan version 2.4 and the SignalMap version 1.9 were 13 patients with CNVs, two patients are related while applied for data analysis (NimbleGen System Inc., Madi- others are independent. In this study, we report the mo- son, WI). CGH microarray results were analyzed refer- lecular and clinical relationship of chromosomal imbal- ring to University of California Santa Cruz (UCSC) ance on chromosome 21 and compare our results with Genome Browser (GRCh37/hg19) (http://genome.ucsc. current public data and literature to provide new way to edu/cgi-bin/hgGateway). Frequently affected regions that naming patient with certain phenotypes. were recently identified as copy number polymorphisms were excluded from data analysis according to the Methods Chromosome Number Variation (CNV) database in our Patients lab and genomic variants in human genome (Build 37). The study was approved by the Institutional Review Variants of interest were compared to disease-causing Board (IRB) of the University of Oklahoma. IRB number genes in DECIPHER v8.7 (Database of Chromosomal was 5938 and the reference number was 670,840. Imbalance and Phenotype in Humans using Ensembl Retrospectively, 2768 pediatric patients sample were col- Resources) (decipher.sanger.ac.uk/index), DGV (Database lected from 2008 to 2018 at the Genetics Laboratory at of Genomic Variants) (dgv.tcag.ca/dgv/app/home), OUHSC. In-house software was developed to extract ClinVar (www.ncbi.nlm.nih.gov/clinvar)andOMIM CNVs based on the following criteria: (www.omim.org). The patient’s clinical phenotype and var- iants of interest were compared with available information 1. CNVs only on chromosome 21, exclude whole from published reports. chromosome 21 duplication/deletion and concurrent CNVs on other chromosomes. Results 2. CNV length larger than 100 kb. Duplications 3. CNV mean log2 ratio absolute value larger than 0.3. Six patients (S1, S2, S3, S4, S5 and S6) were identified 4. CNV not overlap with common CNVs and with duplication on chromosome 21. The size of segmental duplication regions. chromosome 21 duplications ranged from 0.1 Mb to 1.2 Mb (Table 1, Fig. 1, and Additional file 1: Figure S1). After filtration, CNVs were manually curated to elim- Among the duplications, one CNV at 21q21.1 was ma- inate false positive cases based on background signal ternally inherited by patient S3 from patient S4 and pre- noise. A total of 13 samples were identified, six samples sented in another unrelated patient (S1) that includes displayed partial duplication and seven samples showed the CXADR gene (Figs. 1 and 2). These three patients partial deletion. The clinical information of the patients share the phenotype of developmental delay while pa- is summarized in Table 1. tient S3 also demonstrated pulmonary stenosis and Li et al. Molecular Cytogenetics (2018) 11:42 Page 3 of 8 Table 1 Molecular profile of patients Patient # Sex Age at study Chr21 location (hg19) Gain/Loss Size of CNVs (Mb) Clinical features DECIPHER280573 F 14y 18,582,895-18,983,265 Gain 0.4 DD, Intrauterine growth retardation, microcephaly, alopecia S4 F 32 y 18,776,205-19,072,251 Gain 0.3 DD, Mother of S3 S1 M 2 y 18,781,100-18,885,813
Load more

Recommended publications
  • A Computational Approach for Defining a Signature of Β-Cell Golgi Stress in Diabetes Mellitus
    Page 1 of 781 Diabetes A Computational Approach for Defining a Signature of β-Cell Golgi Stress in Diabetes Mellitus Robert N. Bone1,6,7, Olufunmilola Oyebamiji2, Sayali Talware2, Sharmila Selvaraj2, Preethi Krishnan3,6, Farooq Syed1,6,7, Huanmei Wu2, Carmella Evans-Molina 1,3,4,5,6,7,8* Departments of 1Pediatrics, 3Medicine, 4Anatomy, Cell Biology & Physiology, 5Biochemistry & Molecular Biology, the 6Center for Diabetes & Metabolic Diseases, and the 7Herman B. Wells Center for Pediatric Research, Indiana University School of Medicine, Indianapolis, IN 46202; 2Department of BioHealth Informatics, Indiana University-Purdue University Indianapolis, Indianapolis, IN, 46202; 8Roudebush VA Medical Center, Indianapolis, IN 46202. *Corresponding Author(s): Carmella Evans-Molina, MD, PhD ([email protected]) Indiana University School of Medicine, 635 Barnhill Drive, MS 2031A, Indianapolis, IN 46202, Telephone: (317) 274-4145, Fax (317) 274-4107 Running Title: Golgi Stress Response in Diabetes Word Count: 4358 Number of Figures: 6 Keywords: Golgi apparatus stress, Islets, β cell, Type 1 diabetes, Type 2 diabetes 1 Diabetes Publish Ahead of Print, published online August 20, 2020 Diabetes Page 2 of 781 ABSTRACT The Golgi apparatus (GA) is an important site of insulin processing and granule maturation, but whether GA organelle dysfunction and GA stress are present in the diabetic β-cell has not been tested. We utilized an informatics-based approach to develop a transcriptional signature of β-cell GA stress using existing RNA sequencing and microarray datasets generated using human islets from donors with diabetes and islets where type 1(T1D) and type 2 diabetes (T2D) had been modeled ex vivo. To narrow our results to GA-specific genes, we applied a filter set of 1,030 genes accepted as GA associated.
    [Show full text]
  • Whole Exome Sequencing in ADHD Trios from Single and Multi-Incident Families Implicates New Candidate Genes and Highlights Polygenic Transmission
    European Journal of Human Genetics (2020) 28:1098–1110 https://doi.org/10.1038/s41431-020-0619-7 ARTICLE Whole exome sequencing in ADHD trios from single and multi-incident families implicates new candidate genes and highlights polygenic transmission 1,2 1 1,2 1,3 1 Bashayer R. Al-Mubarak ● Aisha Omar ● Batoul Baz ● Basma Al-Abdulaziz ● Amna I. Magrashi ● 1,2 2 2,4 2,4,5 6 Eman Al-Yemni ● Amjad Jabaan ● Dorota Monies ● Mohamed Abouelhoda ● Dejene Abebe ● 7 1,2 Mohammad Ghaziuddin ● Nada A. Al-Tassan Received: 26 September 2019 / Revised: 26 February 2020 / Accepted: 10 March 2020 / Published online: 1 April 2020 © The Author(s) 2020. This article is published with open access Abstract Several types of genetic alterations occurring at numerous loci have been described in attention deficit hyperactivity disorder (ADHD). However, the role of rare single nucleotide variants (SNVs) remains under investigated. Here, we sought to identify rare SNVs with predicted deleterious effect that may contribute to ADHD risk. We chose to study ADHD families (including multi-incident) from a population with a high rate of consanguinity in which genetic risk factors tend to 1234567890();,: 1234567890();,: accumulate and therefore increasing the chance of detecting risk alleles. We employed whole exome sequencing (WES) to interrogate the entire coding region of 16 trios with ADHD. We also performed enrichment analysis on our final list of genes to identify the overrepresented biological processes. A total of 32 rare variants with predicted damaging effect were identified in 31 genes. At least two variants were detected per proband, most of which were not exclusive to the affected individuals.
    [Show full text]
  • Cdk15 Igfals Lingo4 Gjb3 Tpbg Lrrc38 Serpinf1 Apod Trp73 Lama4 Chrnd Col9a1col11a1col5a2 Fgl2 Pitx2 Col2a1 Col3a1 Lamb3 Col24a1
    Bnc2 Wdr72 Ptchd1 Abtb2 Spag5 Zfp385a Trim17 Ier2 Il1rapl1 Tpd52l1 Fam20a Car8 Syt5 Plxnc1 Sema3e Ndrg4 Snph St6galnac5 Mcpt2 B3galt2 Sphkap Arhgap24 Prss34 Lhfpl2 Ermap Rnf165 Shroom1 Grm4 Mobp Dock2 Tmem9b Slc35d3 Otud7b Serpinb3a Sh3d19 Syt6 Zan Trim67 Clec18a Mcoln1 Tob1 Slc45a2 Pcdhb9 Pcdh17 Plscr1 Gpr143 Cela1 Frem1 Sema3f Lgi2 Igsf9 Fjx1 Cpne4 Adgb Depdc7 Gzmm C1qtnf5 Capn11 Sema3c H2-T22 Unc5c Sytl4 Galnt5 Sytl2 Arhgap11a Pcdha1 Cdh20 Slc35f2 Trim29 B3gnt5 Dock5 Trim9 Padi4 Pcdh19 Abi2 Cldn11 Slitrk1 Fam13a Nrgn Cpa4 Clmp Il1rap Trpm1 Fat4 Nexn Pmel Mmp15 Fat3 H2-M5 Prss38 Wdr41 Prtg Mlana Mettl22 Tnrc6b Cdh6 Sema3b Ptgfrn Cldn1 Cntn4 Bcl2a1b Capn6 Capn5 Pcdhb19 Tcf15 Bmf Rgs8 Tecrl Tyrp1 Rhot1 Rnf123 Cldn6 Adam9 Hlx Rilpl1 Disp1 Atcay Vwc2 Fat2 Srpx2 Cldn3 Unc13c Creb3l1 Rab39b Robo3 Gpnmb Bves Orai2 Slc22a2 Prss8 Cdh10 Scg3 Adam33 Nyx Dchs1 Chmp4c Syt9 Ap1m2 Megf10 Cthrc1 Penk Igsf9b Akap2 Ltbp3 Dnmbp Tff2 Pnoc Vldlr Cpa3 Snx18 Capn3 Btla Htr1b Gm17231 Pcdh9Rab27a Grm8 Cnih2 Scube2 Id2 Reep1 Cpeb3 Mmp16 Slc18b1 Snx33 Clcn5 Cckbr Pkp2 Drp2 Mapk8ip1 Lrrc3b Cxcl14 Zfhx3 Esrp1 Prx Dock3 Sec14l1 Prokr1 Pstpip2 Usp2 Cpvl Syn2 Ntn1 Ptger1 Rxfp3 Tyr Snap91 Htr1d Mtnr1a Gadd45g Mlph Drd4 Foxc2 Cldn4 Birc7 Cdh17 Twist2 Scnn1b Abcc4 Pkp1 Dlk2 Rab3b Amph Mreg Il33 Slit2 Hpse Micu1 Creb3l2 Dsp Lifr S1pr5 Krt15 Svep1 Ahnak Kcnh1 Sphk1 Vwce Clcf1 Ptch2 Pmp22 Sfrp1 Sema6a Lfng Hs3st5 Efcab1 Tlr5 Muc5acKalrn Vwa2 Fzd8 Lpar6 Bmp5 Slc16a9 Cacng4 Arvcf Igfbp2 Mrvi1 Dusp15 Krt5 Atp13a5 Dsg1a Kcnj14 Edn3Memo1 Ngef Prickle2 Cma1 Alx4 Bmp3 Blnk GastAgtr2
    [Show full text]
  • V45n4a03.Pdf
    Montoya JC/et al/Colombia Médica - Vol. 45 Nº4 2014 (Oct-Dec) Colombia Médica colombiamedica.univalle.edu.co Original Article Global differential expression of genes located in the Down Syndrome Critical Region in normal human brain Expresión diferencial global de genes localizados en la Región Crítica del Síndrome de Down en el cerebro humano normal Julio Cesar Montoya1,3, Dianora Fajardo2, Angela Peña2 , Adalberto Sánchez1, Martha C Domínguez1,2, José María Satizábal1, Felipe García-Vallejo1,2 1 Department of Physiological Sciences, School of Basic Sciences, Faculty of Health, Universidad del Valle. 2 Laboratory of Molecular Biology and Pathogenesis LABIOMOL. Universidad del Valle, Cali, Colombia. 3 Faculty of Basic Sciences, Universidad Autónoma de Occidente, Cali, Colombia. Montoya JC , Fajardo D, Peña A , Sánchez A, Domínguez MC, Satizábal JM, García-Vallejo F.. Global differential expression of genes located in the Down Syndrome Critical Region in normal human brain. Colomb Med. 2014; 45(4): 154-61. © 2014 Universidad del Valle. This is an Open Access article distributed under the terms of the Creative Commons Attribution License, which permits unrestricted use, distribution, and reproduction in any medium, provided the original author and source are credited. Article history Abstract Resumen Background: The information of gene expression obtained from Introducción: La información de la expresión de genes consignada Received: 2 July 2014 Revised: 10 November 2014 databases, have made possible the extraction and analysis of data en bases de datos, ha permitido extraer y analizar información acerca Accepted: 19 December 2014 related with several molecular processes involving not only in procesos moleculares implicados tanto en la homeostasis cerebral y su brain homeostasis but its disruption in some neuropathologies; alteración en algunas neuropatologías.
    [Show full text]
  • Repositório Da Universidade De Lisboa
    UNIVERSIDADE DE LISBOA FACULDADE DE CIÊNCIAS DEPARTAMENTO DE BIOLOGIA ANIMAL TOWARDS THE IDENTIFICATION OF BIOMARKERS FOR CYSTIC FIBROSIS BY PROTEOMICS NUNO MIGUEL ANTUNES GARCIA CHARRO DOUTORAMENTO EM BIOLOGIA ESPECIALIDADE BIOLOGIA MOLECULAR 2011 ii iii iv UNIVERSIDADE DE LISBOA FACULDADE DE CIÊNCIAS DEPARTAMENTO DE BIOLOGIA ANIMAL TOWARDS THE IDENTIFICATION OF BIOMARKERS FOR CYSTIC FIBROSIS BY PROTEOMICS Tese orientada pela Doutora Deborah Penque e Professora Doutora Ana Maria Viegas Gonçalves Crespo NUNO MIGUEL ANTUNES GARCIA CHARRO DOUTORAMENTO EM BIOLOGIA (BIOLOGIA MOLECULAR) 2011 v The research described in this thesis was conducted at Laboratório de Proteómica, Departamento de Genética, Instituto Nacional de Saúde Dr. Ricardo Jorge (INSA, I.P.), Lisbon, Portugal; Clinical Proteomics Facility, University of Pittsburgh Medical Centre, Pennsylvania, USA; and Laboratory of Proteomics and Analytical Technologies, National Cancer Institute at Frederick, Maryland, USA. Work partially supported by Fundação para a Ciência e a Tecnologia (FCT), Fundo Europeu para o Desenvolvimento (FEDER) (POCI/SAU-MMO/56163/2004), FCT/Poly-Annual Funding Program and FEDER/Saúde XXI Program (Portugal). Nuno Charro is a recipient of FCT doctoral fellowship (SFRH/BD/27906/2006). vi Agradecimentos/Acknowledgements “Nothing is hidden that will not be made known; Nothing is secret that will not come to light” Desde muito pequeno, a minha vontade em querer saber mais e porquê foi sempre presença constante. Ao iniciar e no decorrer da minha (ainda) curta na investigação científica, as perguntas foram mudando, o método também e várias pessoas contribuíram para o crescimento e desenvolvimento da minha personalidade científica e pessoal. Espero não me esquecer de ninguém e, se o fizer, não é intencional; apenas falibilidade.
    [Show full text]
  • Supplementary Table S4. FGA Co-Expressed Gene List in LUAD
    Supplementary Table S4. FGA co-expressed gene list in LUAD tumors Symbol R Locus Description FGG 0.919 4q28 fibrinogen gamma chain FGL1 0.635 8p22 fibrinogen-like 1 SLC7A2 0.536 8p22 solute carrier family 7 (cationic amino acid transporter, y+ system), member 2 DUSP4 0.521 8p12-p11 dual specificity phosphatase 4 HAL 0.51 12q22-q24.1histidine ammonia-lyase PDE4D 0.499 5q12 phosphodiesterase 4D, cAMP-specific FURIN 0.497 15q26.1 furin (paired basic amino acid cleaving enzyme) CPS1 0.49 2q35 carbamoyl-phosphate synthase 1, mitochondrial TESC 0.478 12q24.22 tescalcin INHA 0.465 2q35 inhibin, alpha S100P 0.461 4p16 S100 calcium binding protein P VPS37A 0.447 8p22 vacuolar protein sorting 37 homolog A (S. cerevisiae) SLC16A14 0.447 2q36.3 solute carrier family 16, member 14 PPARGC1A 0.443 4p15.1 peroxisome proliferator-activated receptor gamma, coactivator 1 alpha SIK1 0.435 21q22.3 salt-inducible kinase 1 IRS2 0.434 13q34 insulin receptor substrate 2 RND1 0.433 12q12 Rho family GTPase 1 HGD 0.433 3q13.33 homogentisate 1,2-dioxygenase PTP4A1 0.432 6q12 protein tyrosine phosphatase type IVA, member 1 C8orf4 0.428 8p11.2 chromosome 8 open reading frame 4 DDC 0.427 7p12.2 dopa decarboxylase (aromatic L-amino acid decarboxylase) TACC2 0.427 10q26 transforming, acidic coiled-coil containing protein 2 MUC13 0.422 3q21.2 mucin 13, cell surface associated C5 0.412 9q33-q34 complement component 5 NR4A2 0.412 2q22-q23 nuclear receptor subfamily 4, group A, member 2 EYS 0.411 6q12 eyes shut homolog (Drosophila) GPX2 0.406 14q24.1 glutathione peroxidase
    [Show full text]
  • Appendix 2. Significantly Differentially Regulated Genes in Term Compared with Second Trimester Amniotic Fluid Supernatant
    Appendix 2. Significantly Differentially Regulated Genes in Term Compared With Second Trimester Amniotic Fluid Supernatant Fold Change in term vs second trimester Amniotic Affymetrix Duplicate Fluid Probe ID probes Symbol Entrez Gene Name 1019.9 217059_at D MUC7 mucin 7, secreted 424.5 211735_x_at D SFTPC surfactant protein C 416.2 206835_at STATH statherin 363.4 214387_x_at D SFTPC surfactant protein C 295.5 205982_x_at D SFTPC surfactant protein C 288.7 1553454_at RPTN repetin solute carrier family 34 (sodium 251.3 204124_at SLC34A2 phosphate), member 2 238.9 206786_at HTN3 histatin 3 161.5 220191_at GKN1 gastrokine 1 152.7 223678_s_at D SFTPA2 surfactant protein A2 130.9 207430_s_at D MSMB microseminoprotein, beta- 99.0 214199_at SFTPD surfactant protein D major histocompatibility complex, class II, 96.5 210982_s_at D HLA-DRA DR alpha 96.5 221133_s_at D CLDN18 claudin 18 94.4 238222_at GKN2 gastrokine 2 93.7 1557961_s_at D LOC100127983 uncharacterized LOC100127983 93.1 229584_at LRRK2 leucine-rich repeat kinase 2 HOXD cluster antisense RNA 1 (non- 88.6 242042_s_at D HOXD-AS1 protein coding) 86.0 205569_at LAMP3 lysosomal-associated membrane protein 3 85.4 232698_at BPIFB2 BPI fold containing family B, member 2 84.4 205979_at SCGB2A1 secretoglobin, family 2A, member 1 84.3 230469_at RTKN2 rhotekin 2 82.2 204130_at HSD11B2 hydroxysteroid (11-beta) dehydrogenase 2 81.9 222242_s_at KLK5 kallikrein-related peptidase 5 77.0 237281_at AKAP14 A kinase (PRKA) anchor protein 14 76.7 1553602_at MUCL1 mucin-like 1 76.3 216359_at D MUC7 mucin 7,
    [Show full text]
  • Title CNV Analysis in Tourette Syndrome Implicates Large Genomic Rearrangements in COL8A1 and NRXN1 Author(S)
    View metadata, citation and similar papers at core.ac.uk brought to you by CORE provided by HKU Scholars Hub CNV Analysis in Tourette Syndrome Implicates Large Genomic Title Rearrangements in COL8A1 and NRXN1 Nag, A; Bochukova, EG; Kremeyer, B; Campbell, DD; et al.,; Author(s) Ruiz-Linares, A Citation PLoS ONE, 2013, v. 8 n. 3 Issued Date 2013 URL http://hdl.handle.net/10722/189374 Rights Creative Commons: Attribution 3.0 Hong Kong License CNV Analysis in Tourette Syndrome Implicates Large Genomic Rearrangements in COL8A1 and NRXN1 Abhishek Nag1, Elena G. Bochukova2, Barbara Kremeyer1, Desmond D. Campbell1, Heike Muller1, Ana V. Valencia-Duarte3,4, Julio Cardona5, Isabel C. Rivas5, Sandra C. Mesa5, Mauricio Cuartas3, Jharley Garcia3, Gabriel Bedoya3, William Cornejo4,5, Luis D. Herrera6, Roxana Romero6, Eduardo Fournier6, Victor I. Reus7, Thomas L Lowe7, I. Sadaf Farooqi2, the Tourette Syndrome Association International Consortium for Genetics, Carol A. Mathews7, Lauren M. McGrath8,9, Dongmei Yu9, Ed Cook10, Kai Wang11, Jeremiah M. Scharf8,9,12, David L. Pauls8,9, Nelson B. Freimer13, Vincent Plagnol1, Andre´s Ruiz-Linares1* 1 UCL Genetics Institute, Department of Genetics, Evolution and Environment, University College London, London, United Kingdom, 2 University of Cambridge Metabolic Research Laboratories, Institute of Metabolic Science, Addenbrooke’s Hospital, Cambridge, United Kingdom, 3 Laboratorio de Gene´tica Molecular, SIU, Universidad de Antioquia, Medellı´n, Colombia, 4 Escuela de Ciencias de la Salud, Universidad Pontificia
    [Show full text]
  • Genome-Wide Methylation Study on Depression: Differential Methylation and Variable Methylation in Monozygotic Twins
    OPEN Citation: Transl Psychiatry (2015) 5, e557; doi:10.1038/tp.2015.49 www.nature.com/tp ORIGINAL ARTICLE Genome-wide methylation study on depression: differential methylation and variable methylation in monozygotic twins A Córdova-Palomera1,2, M Fatjó-Vilas1,2, C Gastó2,3,4, V Navarro2,3,4, M-O Krebs5,6,7 and L Fañanás1,2 Depressive disorders have been shown to be highly influenced by environmental pathogenic factors, some of which are believed to exert stress on human brain functioning via epigenetic modifications. Previous genome-wide methylomic studies on depression have suggested that, along with differential DNA methylation, affected co-twins of monozygotic (MZ) pairs have increased DNA methylation variability, probably in line with theories of epigenetic stochasticity. Nevertheless, the potential biological roots of this variability remain largely unexplored. The current study aimed to evaluate whether DNA methylation differences within MZ twin pairs were related to differences in their psychopathological status. Data from the Illumina Infinium HumanMethylation450 Beadchip was used to evaluate peripheral blood DNA methylation of 34 twins (17 MZ pairs). Two analytical strategies were used to identify (a) differentially methylated probes (DMPs) and (b) variably methylated probes (VMPs). Most DMPs were located in genes previously related to neuropsychiatric phenotypes. Remarkably, one of these DMPs (cg01122889) was located in the WDR26 gene, the DNA sequence of which has been implicated in major depressive disorder from genome-wide association studies. Expression of WDR26 has also been proposed as a biomarker of depression in human blood. Complementarily, VMPs were located in genes such as CACNA1C, IGF2 and the p38 MAP kinase MAPK11, showing enrichment for biological processes such as glucocorticoid signaling.
    [Show full text]
  • CBR3 (NM 001236) Human Untagged Clone – SC119368 | Origene
    OriGene Technologies, Inc. 9620 Medical Center Drive, Ste 200 Rockville, MD 20850, US Phone: +1-888-267-4436 [email protected] EU: [email protected] CN: [email protected] Product datasheet for SC119368 CBR3 (NM_001236) Human Untagged Clone Product data: Product Type: Expression Plasmids Product Name: CBR3 (NM_001236) Human Untagged Clone Tag: Tag Free Symbol: CBR3 Synonyms: hCBR3; HEL-S-25; SDR21C2 Vector: pCMV6-XL4 E. coli Selection: Ampicillin (100 ug/mL) Cell Selection: None Fully Sequenced ORF: >OriGene ORF within SC119368 sequence for NM_001236 edited (data generated by NextGen Sequencing) ATGTCGTCCTGCAGCCGCGTGGCGCTGGTGACCGGGGCCAACAGGGGCATCGGCTTGGCC ATCGCGCGCGAACTGTGCCGACAGTTCTCTGGGGATGTGGTGCTCACCGCGCGGGACGTG GCGCGGGGCCAGGCGGCCGTGCAGCAGCTGCAGGCGGAGGGCCTGAGCCCGCGCTTCCAC CAACTGGACATCGACGACTTGCAGAGCATCCGCGCCCTGCGCGACTTCCTGCGCAAGGAG TACGGGGGGCTCAATGTACTGGTCAACAACGCGGCCGTCGCCTTCAAGAGTGATGATCCA ATGCCCTTTGACATTAAAGCTGAGATGACACTGAAGACAAATTTTTTTGCCACTAGAAAC ATGTGCAACGAGTTACTGCCGATAATGAAACCTCATGGGAGAGTGGTGAATATCAGTAGT TTGCAGTGTTTAAGGGCTTTTGAAAACTGCAGTGAAGATCTGCAGGAAAGGTTCCACAGT GAGACACTCACAGAAGGAGACCTGGTGGATCTCATGAAAAAGTTTGTGGAGGACACAAAA AATGAGGTGCATGAGAGGGAAGGCTGGCCCAACTCACCTTATGGGGTGTCCAAGTTGGGG GTCACAGTCTTATCGAGGATCCTGGCCAGGCGTCTGGATGAGAAGAGGAAAGCTGACAGG ATTCTGGTGAATGCGTGCTGCCCAGGACCAGTGAAGACAGACATGGATGGGAAAGACAGC ATCAGGACTGTGGAGGAGGGGGCTGAGACCCCTGTCTACTTGGCCCTCTTGCCTCCAGAT GCCACTGAGCCACAAGGCCAGTTGGTCCATGACAAAGTTGTGCAAAACTGGTAA Clone variation with respect to NM_001236.3 255 c=>t;606 g=>a This product is to be used for laboratory
    [Show full text]
  • Identification of Novel Genes in Human Airway Epithelial Cells Associated with Chronic Obstructive Pulmonary Disease (COPD) Usin
    www.nature.com/scientificreports OPEN Identifcation of Novel Genes in Human Airway Epithelial Cells associated with Chronic Obstructive Received: 6 July 2018 Accepted: 7 October 2018 Pulmonary Disease (COPD) using Published: xx xx xxxx Machine-Based Learning Algorithms Shayan Mostafaei1, Anoshirvan Kazemnejad1, Sadegh Azimzadeh Jamalkandi2, Soroush Amirhashchi 3, Seamas C. Donnelly4,5, Michelle E. Armstrong4 & Mohammad Doroudian4 The aim of this project was to identify candidate novel therapeutic targets to facilitate the treatment of COPD using machine-based learning (ML) algorithms and penalized regression models. In this study, 59 healthy smokers, 53 healthy non-smokers and 21 COPD smokers (9 GOLD stage I and 12 GOLD stage II) were included (n = 133). 20,097 probes were generated from a small airway epithelium (SAE) microarray dataset obtained from these subjects previously. Subsequently, the association between gene expression levels and smoking and COPD, respectively, was assessed using: AdaBoost Classifcation Trees, Decision Tree, Gradient Boosting Machines, Naive Bayes, Neural Network, Random Forest, Support Vector Machine and adaptive LASSO, Elastic-Net, and Ridge logistic regression analyses. Using this methodology, we identifed 44 candidate genes, 27 of these genes had been previously been reported as important factors in the pathogenesis of COPD or regulation of lung function. Here, we also identifed 17 genes, which have not been previously identifed to be associated with the pathogenesis of COPD or the regulation of lung function. The most signifcantly regulated of these genes included: PRKAR2B, GAD1, LINC00930 and SLITRK6. These novel genes may provide the basis for the future development of novel therapeutics in COPD and its associated morbidities.
    [Show full text]
  • Long Non-Coding RNA CBR3-AS1 Mediates Tumorigenesis and Radiosensitivity of Non-Small Cell Lung Cancer Through Redox and DNA Repair by CBR3-AS1 /Mir-409-3P/SOD1 Axis
    Long Non-coding RNA CBR3-AS1 Mediates Tumorigenesis and Radiosensitivity of Non-small Cell Lung Cancer through Redox and DNA Repair by CBR3-AS1 /miR-409-3p/SOD1 Axis Shilong Liu ( [email protected] ) Harbin Medical University Ning Zhan Xiang'an Hospital of Xiamen University Chunzi Gao The First Aliated Hospital of Harbin medical university Piao Xu Xiang'an Hospital of Xiamen University Hong Wang school of ophthalmology and optometry and eye hospital,school of biomedical engineering,wenzhou medical university Siyu Wang Harbin Medical University Third Hospital: Tumor Hospital of Harbin Medical University Shiqi Piao Harbin Medical University Third Hospital: Tumor Hospital of Harbin Medical University Suwei Jing Harbin Medical University Third Hospital: Tumor Hospital of Harbin Medical University Research Keywords: NSCLC, CBR3-AS1, miR-409-3p, SOD1, radiosensitivity, ROS Posted Date: July 20th, 2021 DOI: https://doi.org/10.21203/rs.3.rs-703986/v1 License: This work is licensed under a Creative Commons Attribution 4.0 International License. Read Full License Page 1/30 Abstract Background: Long noncoding RNA (lncRNA) CBR3-AS1 has important functions in various cancers. However, the biological functions of CBR3-AS1 in non-small lung cancer (NSCLC) remains unclear. This study aimed to investigated the roles and molecular mechanisms of lncRNA CBR3-AS1 in NSCLC tumorigenesis and radiosensitivity. Methods: The association of CBR3-AS1 expression with the clinicopathological features and prognosis of NSCLC was studied based on The Cancer Genome Atlas database and veried in tumor and adjacent normal tissues of 48 NSCLC patients. The effect of CBR3-AS1 knockdown or overexpression on proliferation, apoptosis, migration, and invasion of NSCLC cells were studied through CCK-8, ow cytometry, and transwell assays, and tumorigenesis experiments in nude mice.
    [Show full text]