DOCSLIB.ORG

Selective Microrna Uridylation by Zcchc6 (TUT7) and Zcchc11 (TUT4)

Total Page：16

File Type：pdf, Size：1020Kb

Download full-text PDF Read full-text
Selective Microrna Uridylation by Zcchc6 (TUT7) and Zcchc11 (TUT4) Selective microRNA uridylation by Zcchc6 (TUT7) and Zcchc11 (TUT4) The Harvard community has made this article openly available. Please share how this access benefits you. Your story matters Citation Thornton, James E., Peng Du, Lili Jing, Ljiljana Sjekloca, Shuibin Lin, Elena Grossi, Piotr Sliz, Leonard I. Zon, and Richard I. Gregory. 2014. “Selective microRNA uridylation by Zcchc6 (TUT7) and Zcchc11 (TUT4).” Nucleic Acids Research 42 (18): 11777-11791. doi:10.1093/ nar/gku805. http://dx.doi.org/10.1093/nar/gku805. Published Version doi:10.1093/nar/gku805 Citable link http://nrs.harvard.edu/urn-3:HUL.InstRepos:15034774 Terms of Use This article was downloaded from Harvard University’s DASH repository, and is made available under the terms and conditions applicable to Other Posted Material, as set forth at http:// nrs.harvard.edu/urn-3:HUL.InstRepos:dash.current.terms-of- use#LAA Published online 15 September 2014 Nucleic Acids Research, 2014, Vol. 42, No. 18 11777–11791 doi: 10.1093/nar/gku805 Selective microRNA uridylation by Zcchc6 (TUT7) and Zcchc11 (TUT4) James E. Thornton1, Peng Du1, Lili Jing1, Ljiljana Sjekloca2, Shuibin Lin1, Elena Grossi1, Piotr Sliz2,3, Leonard I. Zon1,3,4,5,6 and Richard I. Gregory1,2,3,4,* 1Stem Cell Program, Boston Children’s Hospital, Boston, MA 02115, USA, 2Department of Biological Chemistry and Molecular Pharmacology, Harvard Medical School, Boston, MA 02115, USA, 3Department of Pediatrics, Harvard Medical School, Boston, MA 02115, USA, 4Harvard Stem Cell Institute, Cambridge, MA 02138, USA, 5Department of Genetics, Harvard Medical School, Boston, MA 02115, USA and 6Howard Hughes Medical Institute, Boston, MA 02115, USA Received July 26, 2013; Revised August 21, 2014; Accepted August 25, 2014 ABSTRACT mentary sites in the 3 untranslated regions (3UTRs) of messenger RNAs (mRNAs) and induce gene silencing via Recent small RNA sequencing data has uncovered the RNA-induced silencing complex (RISC) (1). While the 3 end modification of mature microRNAs (miRNAs). canonical pathway of miRNA biogenesis is largely under- This non-templated nucleotide addition can impact stood, there are numerous modifications made to nascent miRNA gene regulatory networks through the con- miRNA species that impact their expression and function trol of miRNA stability or by interfering with the (2,3). Many of these modifications are appreciated in their repression of target mRNAs. The miRNA modify- ability to enhance or disrupt miRNA processing and re- ing enzymes responsible for this regulation remain pressive ability, while others are only recently being de- largely uncharacterized. Here we describe the abil- scribed and characterized (3–5). Recently, several groups have uncovered the importance of widespread modification ity for two related terminal uridyl transferases (TU- Tases), Zcchc6 (TUT7) and Zcchc11 (TUT4), to 3 of 3 ends of mature miRNAs and shown that this activ- ity occurs for diverse miRNA species depending on the cell mono-uridylate a specific subset of miRNAs involved line, tissue and developmental stage examined (4–12). Al- in cell differentiation and Homeobox (Hox) gene con- though the enzymes responsible for miRNA 3 nucleotide / trol. Zcchc6 11 selectively uridylates these miRNAs addition have in a few cases been identified–and their ac- in vitro, and we biochemically define a bipartite se- tivities elucidated–much remains unknown about the nu- quence motif that is necessary and sufficient to cleotide transferases involved in miRNA modification. In confer Zcchc6/11 catalyzed uridylation. Depletion of nearly every instance of mature miRNA modification only these TUTases in cultured cells causes the selective a subset of miRNAs are modified, but thus far no mech- loss of 3 mono-uridylation of many of the same miR- anism has been described to explain the underlying speci- NAs. Upon TUTase-dependent loss of uridylation, we ficity of these reactions. Given that much of this activity is observe a concomitant increase in non-templated restricted to certain cellular contexts, the selective mecha- 3 mono-adenylation. Furthermore, TUTase inhibi- nisms of mature miRNA modification may play important roles in development and tissue specification. tion in Zebrafish embryos causes developmental de- RNA-dependent nucleotidal transferases belong to the fects and aberrant Hox expression. Our results un- DNA polymerase ß superfamily of enzymes and include cover the molecular basis for selective miRNA mono- the mRNA Poly(A) Polymerases (PAPs), CCA-adding en- uridylation by Zcchc6/11, highlight the precise con- zymes responsible for adding the 3 termini to trans- trol of different 3 miRNA modifications in cells and fer RNAs (tRNAs), and terminal uridyl transferases have implications for miRNA and Hox gene regula- (TUTases) or poly(U) polymerases (PAPs) among oth- tion during development. ers (13,14). There are seven mammalian RNA-dependent nucleotidyl transferases including Zcchc11 and Zcchc6 (TUTase4/TUT4/PAPD3 and TUTase7/TUT7/PAPD2, INTRODUCTION respectively), which play roles at several levels of miRNA MicroRNAs (miRNAs) are small non-coding RNAs that biogenesis (15–17). Zcchc11 and Zcchc6 were initially iden- negatively regulate gene expression by binding to comple- tified as regulators of let-7 miRNA biogenesis in embryonic *To whom correspondence should be addressed. Tel: +617 919 2273; Fax: +617 730 0748; Email: [email protected] C The Author(s) 2014. Published by Oxford University Press on behalf of Nucleic Acids Research. This is an Open Access article distributed under the terms of the Creative Commons Attribution License (http://creativecommons.org/licenses/by/4.0/), which permits unrestricted reuse, distribution, and reproduction in any medium, provided the original work is properly cited. 11778 Nucleic Acids Research, 2014, Vol. 42, No. 18 stem cells where they recognize the let-7 precursor RNA MATERIALS AND METHODS (pre-let-7) when it is bound by the small RNA-binding pro- Uridylation assays tein Lin28 (16–18). The Lin28/pre-let-7/TUTase ternary complex is sufficient to oligo-uridylate the 3 end of pre-let- In vitro uridylation assays were performed as described pre- 7 and facilitates its degradation by the exonuclease Dis3l2 viously, except with a final RNA concentration of 300 nM (19,20). This miRNA turnover pathway serves to keep let-7 (18). Synthetic RNAs were purchased from IDT. miRNAs low in undifferentiated cells and, upon the tran- sition to differentiation, is relieved to ultimately permit RNA oligo Sequence let-7g guide UGAGGUAGUAGUUUGUACAGUU the accumulation of mature let-7 miRNAs in differenti- let-7g passenger CUGUACAGGCCACUGCCUUGC ated cells (16–18,21–23). Zcchc11 and Zcchc6 along with GL2 guide UCGAAGUAUUCCGCGUACGUU / GL2 passenger CGUACGCGGAAUACUUCGAUU GLD2 PAPD4, a TUTase previously shown to have mono- let-7i guide UGAGGUAGUAGUUUGUGCUGUU and oligo(A)-adding activity, together can add single uri- let-7i passenger CUGCGCAAGCUACUGCCUUGCU dine residues to the 3 end of certain precursor let-7 miR- let-7i domains 1/2 mut UAGUCGCUGCAUUUGUGCUGUU let-7i domains 2/3 mut UGAGGUAUGCAGCCUAGCUGUU NAs to create a 3 end structure that facilitates efficient let-7i guide 1/2/3 mut UAGUCGCUGCAGCCUAGCUGUU Dicer processing (15). This activity is Lin28-independent let-7i delG UUACAUACUAAUUUCUACUCUU GL2 with let-7 motif UCGAAGUGUAGUUUGUACGUU and is thought to occur constitutively in differentiated cells. miR-10a guide UACCCUGUAGAUCCGAAUUUGUG Interestingly Zcchc11 was independently shown to uridy- miR-26a guide UUCAAGUAAUCCAGGAUAGGC miR-10a double mut UACCCUUGCAAUCCGAAGCCUAG late the 3 end of mature miR-26 and thereby attenuate its let-7g+A guide UGAGGUAGUAGUUUGUACAGUUA activity toward target mRNAs involved in the inflamma- let-7g+U guide UGAGGUAGUAGUUUGUACAGUUU tory response (6). The repertoire of Zcchc11-targeted miR- NAs was recently expanded to include a subset of mature miRNAs involved in growth hormone regulation and dele- Expression plasmids and recombinant Zcchc11 purification tion of Zcchc11 disrupted normal growth patterns in fetal mice (8). It remains unclear how mono-uridylation blocks Human Zcchc11 cDNA region encoding amino acids 225– miRNA target repressive ability or how miR-26 and the sev- 1384 was subcloned into a modified pET-24 plasmid (No- eral other miRNAs targeted by Zcchc11 and Zcchc6 are vagen) containing an N-terminal His6-Trx (thioredoxin) tag specified, but mature miRNA uridylation consistently fails with a cleavage sequence for TEV (tobacco etch virus) pro- to alter the steady-state levels of mature miRNAs and in- tease. Protein expression in Escherichia coli BL21 (DE3) stead likely acts through changes in target specificity, RISC STAR strain was induced with 1 mM IPTG (isopropyl␤- ◦ loading or other mechanisms (8). D-thiogalactoside) for 5 h at 25 C. Large-scale purifica- To further understand the role of Zcchc11 and Zcchc6 tion of the recombinant protein was performed as follows. mature miRNA uridylation, we investigated whether these Cells were harvested and resuspended in 50 mM Hepes two TUTases have an inherent preference toward various (pH 8.0), 150 mM NaCl, 10 mM imidazole, 0.2% Igepal miRNA substrates and found that a simple sequence motif CA-630 (Sigma-Aldrich), 0.5 mM 2-mercaptoethanol and exists that is necessary and sufficient for targeting by Zc- 1 mM PMSF, supplemented with the Complete EDTA- chc11 and Zcchc6 in vitro. Intriguingly, the only miRNAs free protease inhibitors mix (Roche), and lysed by freeze- that contain this motif are known regulators
Load more

Recommended publications
  • Regulation of Pluripotency by RNA Binding Proteins
    Cell Stem Cell Review Regulation of Pluripotency by RNA Binding Proteins Julia Ye1,2 and Robert Blelloch1,2,* 1The Eli and Edythe Broad Center of Regeneration Medicine and Stem Cell Research, Center for Reproductive Sciences, University of California, San Francisco, San Francisco, CA 94143, USA 2Department of Urology, University of California, San Francisco, San Francisco, CA 94143, USA *Correspondence: [email protected] http://dx.doi.org/10.1016/j.stem.2014.08.010 Establishment, maintenance, and exit from pluripotency require precise coordination of a cell’s molecular machinery. Substantial headway has been made in deciphering many aspects of this elaborate system, particularly with respect to epigenetics, transcription, and noncoding RNAs. Less attention has been paid to posttranscriptional regulatory processes such as alternative splicing, RNA processing and modification, nuclear export, regulation of transcript stability, and translation. Here, we introduce the RNA binding proteins that enable the posttranscriptional regulation of gene expression, summarizing current and ongoing research on their roles at different regulatory points and discussing how they help script the fate of pluripotent stem cells. Introduction RBPs are responsible for every event in the life of an RNA Embryonic stem cells (ESCs), which are derived from the inner molecule, including its capping, splicing, cleavage, nontem- cell mass of the mammalian blastocyst, are remarkable because plated nucleotide addition, nucleotide editing, nuclear export, they can propagate in vitro indefinitely while retaining both the cellular localization, stability, and translation (Keene, 2007). molecular identity and the pluripotent properties of the peri-im- Overall, little is known about RBPs: most are classified based plantation epiblast.
    [Show full text]
  • S41467-020-18249-3.Pdf
    ARTICLE https://doi.org/10.1038/s41467-020-18249-3 OPEN Pharmacologically reversible zonation-dependent endothelial cell transcriptomic changes with neurodegenerative disease associations in the aged brain Lei Zhao1,2,17, Zhongqi Li 1,2,17, Joaquim S. L. Vong2,3,17, Xinyi Chen1,2, Hei-Ming Lai1,2,4,5,6, Leo Y. C. Yan1,2, Junzhe Huang1,2, Samuel K. H. Sy1,2,7, Xiaoyu Tian 8, Yu Huang 8, Ho Yin Edwin Chan5,9, Hon-Cheong So6,8, ✉ ✉ Wai-Lung Ng 10, Yamei Tang11, Wei-Jye Lin12,13, Vincent C. T. Mok1,5,6,14,15 &HoKo 1,2,4,5,6,8,14,16 1234567890():,; The molecular signatures of cells in the brain have been revealed in unprecedented detail, yet the ageing-associated genome-wide expression changes that may contribute to neurovas- cular dysfunction in neurodegenerative diseases remain elusive. Here, we report zonation- dependent transcriptomic changes in aged mouse brain endothelial cells (ECs), which pro- minently implicate altered immune/cytokine signaling in ECs of all vascular segments, and functional changes impacting the blood–brain barrier (BBB) and glucose/energy metabolism especially in capillary ECs (capECs). An overrepresentation of Alzheimer disease (AD) GWAS genes is evident among the human orthologs of the differentially expressed genes of aged capECs, while comparative analysis revealed a subset of concordantly downregulated, functionally important genes in human AD brains. Treatment with exenatide, a glucagon-like peptide-1 receptor agonist, strongly reverses aged mouse brain EC transcriptomic changes and BBB leakage, with associated attenuation of microglial priming. We thus revealed tran- scriptomic alterations underlying brain EC ageing that are complex yet pharmacologically reversible.
    [Show full text]
  • (3 ) End—Oligouridylation As a Step on the Path to Destruction
    Downloaded from genesdev.cshlp.org on September 23, 2021 - Published by Cold Spring Harbor Laboratory Press PERSPECTIVE (New ways to meet your (3؅ end—oligouridylation as a step on the path to destruction Carol J. Wilusz2 and Jeffrey Wilusz1 Department of Microbiology, Immunology, and Pathology, Colorado State University, Fort Collins, Colorado 80523, USA Messenger RNA degradation is a vital contributor to the may accomplish the same endpoint (recruitment of deg- control of gene expression that generally involves re- radative enzymes), they may not be totally interchange- moval of a poly(A) tail in both prokaryotes and eukary- able as each can be regulated differently at the level of otes. In a thought-provoking study in this issue of Genes synthesis, recruit different regulatory poly(U)- or & Development, Mullen and Marzluff (2008) present poly(A)-binding factors, or attract different degradative data supporting a novel mechanism of mRNA decay. enzymes to the transcript. This strategy for initiating They discovered that histone mRNAs, which are unique decay via 3Ј unstructured extensions may have favored in that they are never polyadenylated in mammalian the evolution of the 3Ј end of RNAs to focus on tran- cells, degrade by a cell cycle-regulated mechanism that script function rather than on maintaining sequences/ involves addition of a short oligo(U) tail at the 3Ј end. structures that allow for eventual decay of the transcript. Interestingly, this oligo(U) tract is recognized by the It also creates a ready means for the cell to degrade any Lsm1–7 complex, which then appears to feed the tran- unwanted transcripts without regard to sequence or script into the standard mRNA decay pathways.
    [Show full text]
  • Disclosure Osteoarthritis and Interleukin-6 (IL-6) Mrna Stability
    10/27/2013 Disclosure Zinc finger protein, ZCCHC-6 is highly expressed in Osteoarthritis cartilage and regulates the expression The authors declare no conflict of interest Nahid Akhtar , Ph.D. of Interleukin-6 in human chondrocytes Research Assistant Professor Department of Anatomy & Neurobiology, Northeast Ohio Medical University Rootstown, OH Ahmad Arida, M.S. Research Coordinator Department of Anatomy & Neurobiology, Northeast Ohio Medical University Rootstown, OH Nahid Akhtar Research Assistant Professor Tariq M. Haqqi, M.Phil., Ph.D. Professor Department of Anatomy & Neurobiology Department of Anatomy & Neurobiology, Northeast Ohio Medical University Northeast Ohio Medical University Rootstown, Ohio Rootstown, OH Osteoarthritis and Interleukin-6 (IL-6) mRNA stability and nucleotidyl transferases • Pre-mRNA undergoes many post-transcriptional modifications to • Higher levels of IL-6 in serum, synovial fluid and cartilage of OA patients stabilize the mRNA. Expression levels of many clinically relevant mRNAs have been reported suggesting a role of IL-6 in OA pathophysiology including cytokines are regulated by differential mRNA stability. • Increased IL-6 levels have detrimental effects on cartilage homeostasis including collagen metabolism and cartilage repair • 3’ poly(A) tail confers mRNA Cleavage and polyadenylation of pre-mRNAs stability, their export and • IL-6 is important for IL-1β induced inhibition of proteoglycan synthesis translation into protein. Poly(A) in human articular cartilage tail length is controlled by the • IL-6
    [Show full text]
  • Dissertation
    Regulation of gene silencing: From microRNA biogenesis to post-translational modifications of TNRC6 complexes DISSERTATION zur Erlangung des DOKTORGRADES DER NATURWISSENSCHAFTEN (Dr. rer. nat.) der Fakultät Biologie und Vorklinische Medizin der Universität Regensburg vorgelegt von Johannes Danner aus Eggenfelden im Jahr 2017 Das Promotionsgesuch wurde eingereicht am: 12.09.2017 Die Arbeit wurde angeleitet von: Prof. Dr. Gunter Meister Johannes Danner Summary ‘From microRNA biogenesis to post-translational modifications of TNRC6 complexes’ summarizes the two main projects, beginning with the influence of specific RNA binding proteins on miRNA biogenesis processes. The fate of the mature miRNA is determined by the incorporation into Argonaute proteins followed by a complex formation with TNRC6 proteins as core molecules of gene silencing complexes. miRNAs are transcribed as stem-loop structured primary transcripts (pri-miRNA) by Pol II. The further nuclear processing is carried out by the microprocessor complex containing the RNase III enzyme Drosha, which cleaves the pri-miRNA to precursor-miRNA (pre-miRNA). After Exportin-5 mediated transport of the pre-miRNA to the cytoplasm, the RNase III enzyme Dicer cleaves off the terminal loop resulting in a 21-24 nt long double-stranded RNA. One of the strands is incorporated in the RNA-induced silencing complex (RISC), where it directly interacts with a member of the Argonaute protein family. The miRNA guides the mature RISC complex to partially complementary target sites on mRNAs leading to gene silencing. During this process TNRC6 proteins interact with Argonaute and recruit additional factors to mediate translational repression and target mRNA destabilization through deadenylation and decapping leading to mRNA decay.
    [Show full text]
  • Selective Microrna Uridylation by Zcchc6 (TUT7) and Zcchc11 (TUT4) James E
    Nucleic Acids Research, 2014 1 doi: 10.1093/nar/gku805 Selective microRNA uridylation by Zcchc6 (TUT7) and Zcchc11 (TUT4) James E. Thornton1, Peng Du1, Lili Jing1, Ljiljana Sjekloca2, Shuibin Lin1, Elena Grossi1, Piotr Sliz2,3, Leonard I. Zon1,3,4,5,6 and Richard I. Gregory1,2,3,4,* 1Stem Cell Program, Boston Children’s Hospital, Boston, MA 02115, USA, 2Department of Biological Chemistry and Molecular Pharmacology, Harvard Medical School, Boston, MA 02115, USA, 3Department of Pediatrics, Harvard Medical School, Boston, MA 02115, USA, 4Harvard Stem Cell Institute, Cambridge, MA 02138, USA, 5Department of Genetics, Harvard Medical School, Boston, MA 02115, USA and 6Howard Hughes Medical Institute, Boston, MA 02115, USA Received July 26, 2013; Revised August 21, 2014; Accepted August 25, 2014 ABSTRACT mentary sites in the 3 untranslated regions (3UTRs) of messenger RNAs (mRNAs) and induce gene silencing via Recent small RNA sequencing data has uncovered the RNA-induced silencing complex (RISC) (1). While the 3 end modification of mature microRNAs (miRNAs). canonical pathway of miRNA biogenesis is largely under- This non-templated nucleotide addition can impact stood, there are numerous modifications made to nascent miRNA gene regulatory networks through the con- miRNA species that impact their expression and function trol of miRNA stability or by interfering with the (2,3). Many of these modifications are appreciated in their repression of target mRNAs. The miRNA modify- ability to enhance or disrupt miRNA processing and re- ing enzymes responsible for this regulation remain pressive ability, while others are only recently being de- largely uncharacterized. Here we describe the abil- scribed and characterized (3–5).
    [Show full text]
  • Novel Roles for the Terminal RNA Uridylyltransferases ZCCHC6 and ZCCHC11 in Development and Disease
    Novel Roles for the Terminal RNA Uridylyltransferases ZCCHC6 and ZCCHC11 in Development and Disease The Harvard community has made this article openly available. Please share how this access benefits you. Your story matters Citation Pearson, Daniel S. 2018. Novel Roles for the Terminal RNA Uridylyltransferases ZCCHC6 and ZCCHC11 in Development and Disease. Doctoral dissertation, Harvard University, Graduate School of Arts & Sciences. Citable link http://nrs.harvard.edu/urn-3:HUL.InstRepos:41127147 Terms of Use This article was downloaded from Harvard University’s DASH repository, and is made available under the terms and conditions applicable to Other Posted Material, as set forth at http:// nrs.harvard.edu/urn-3:HUL.InstRepos:dash.current.terms-of- use#LAA Novel Roles for the Terminal RNA Uridylyltransferases ZCCHC6 and ZCCHC11 in Development and Disease A dissertation presented by Daniel S. Pearson to The Division of Medical Sciences in partial fulfillment of the requirements for the degree of Doctor of Philosophy in the subject of Biological and Biomedical Sciences Harvard University Cambridge, Massachusetts March 2018 i © 2018 Daniel S. Pearson All rights reserved. ii Dissertation Advisor: Professor George Q. Daley Daniel S. Pearson Novel Roles for the Terminal RNA Uridylyltransferases ZCCHC6 and ZCCHC11 in Development and Disease Abstract Terminal RNA uridylyltransferases (TUTases) are a class of non-canonical polyadenylate polymerases that are thought to function primarily by adding non-templated uridines to the 3’ ends of a wide range of RNA targets. Recently, two TUTases, ZCCHC6 and ZCCHC11, were shown to uridylate mRNAs, thereby marking them for degradation. While RNA uridylation is emerging as a potent mechanism of post-transcriptional gene regulation, uridylation-independent functions of TUTases have also been reported.
    [Show full text]
  • AGO-Bound Mature Mirnas Are Oligouridylated by Tuts and Subsequently Degraded by DIS3L2
    ARTICLE https://doi.org/10.1038/s41467-020-16533-w OPEN AGO-bound mature miRNAs are oligouridylated by TUTs and subsequently degraded by DIS3L2 Acong Yang 1,4, Tie-Juan Shao1,2,4, Xavier Bofill-De Ros 1,4, Chuanjiang Lian1,3, Patricia Villanueva1, ✉ Lisheng Dai1 & Shuo Gu 1 MicroRNAs (miRNAs) associated with Argonaute proteins (AGOs) regulate gene expression in mammals. miRNA 3’ ends are subject to frequent sequence modifications, which have been 1234567890():,; proposed to affect miRNA stability. However, the underlying mechanism is not well under- stood. Here, by genetic and biochemical studies as well as deep sequencing analyses, we find that AGO mutations disrupting miRNA 3’ binding are sufficient to trigger extensive miRNA 3’ modifications in HEK293T cells and in cancer patients. Comparing these modifications in TUT4, TUT7 and DIS3L2 knockout cells, we find that TUT7 is more robust than TUT4 in oligouridylating mature miRNAs, which in turn leads to their degradation by the DIS3L2 exonuclease. Our findings indicate a decay machinery removing AGO-associated miRNAs with an exposed 3’ end. A set of endogenous miRNAs including miR-7, miR-222 and miR-769 are targeted by this machinery presumably due to target-directed miRNA degradation. 1 RNA Mediated Gene Regulation Section; RNA Biology Laboratory, Center for Cancer Research, National Cancer Institute, Frederick, MD 21702, USA. 2 School of Basic Medicine, Zhejiang Chinese Medical University, Hangzhou 310053, China. 3 State Key Laboratory of Veterinary Biotechnology and Heilongjiang Province Key Laboratory for Laboratory Animal and Comparative Medicine, Harbin Veterinary Research Institute, Chinese Academy of ✉ Agricultural Sciences, Harbin 150069, China.
    [Show full text]
  • 1 Screening by Deep Sequencing Reveals Mediators of Microrna
    bioRxiv preprint doi: https://doi.org/10.1101/2021.01.11.426275; this version posted February 20, 2021. The copyright holder for this preprint (which was not certified by peer review) is the author/funder, who has granted bioRxiv a license to display the preprint in perpetuity. It is made available under aCC-BY 4.0 International license. 1 Screening by deep sequencing reveals mediators of microRNA tailing in C. elegans Katherine Prothro*1,3, Karl-Frédéric Vieux*1, Cameron Palmer1,4, Isana Veksler-Lublinsky2, Katherine McJunkin1,5 1National Institutes of Diabetes and Digestive and Kidney Diseases Intramural Research Program, Bethesda, MD 20815 USA 2Ben Gurion University of the Negev, Beer Sheva 8410501 Israel 3Present address: Stanford University School of Medicine, Stanford, CA 94305 USA 4Present address: National Cancer Institute, Rockville, MD 20850 USA 5To whom correspondence should be addressed: Tel: +1-301-496-6991; Fax: +1-301-496-5239 ; Email: [email protected] *The authors wish it to be known that, in their opinion, the first two authors should be regarded as joint First Authors. Abstract microRNAs are frequently modified by addition of untemplated nucleotides to the 3' end, but the role of this tailing is often unclear. Here we characterize the prevalence and functional consequences of microRNA tailing in vivo, using the C. elegans model. MicroRNA tailing in C. elegans consists mostly of mono- uridylation of mature microRNA species, with rarer mono-adenylation which is likely added to microRNA precursors. Through a targeted RNAi screen, we discover that the TUT4/TUT7 gene family member CID- 1/CDE-1/PUP-1 is required for uridylation, whereas the GLD2 gene family member F31C3.2 is required for adenylation.
    [Show full text]
  • Human Social Genomics in the Multi-Ethnic Study of Atherosclerosis
    Getting “Under the Skin”: Human Social Genomics in the Multi-Ethnic Study of Atherosclerosis by Kristen Monét Brown A dissertation submitted in partial fulfillment of the requirements for the degree of Doctor of Philosophy (Epidemiological Science) in the University of Michigan 2017 Doctoral Committee: Professor Ana V. Diez-Roux, Co-Chair, Drexel University Professor Sharon R. Kardia, Co-Chair Professor Bhramar Mukherjee Assistant Professor Belinda Needham Assistant Professor Jennifer A. Smith © Kristen Monét Brown, 2017 [email protected] ORCID iD: 0000-0002-9955-0568 Dedication I dedicate this dissertation to my grandmother, Gertrude Delores Hampton. Nanny, no one wanted to see me become “Dr. Brown” more than you. I know that you are standing over the bannister of heaven smiling and beaming with pride. I love you more than my words could ever fully express. ii Acknowledgements First, I give honor to God, who is the head of my life. Truly, without Him, none of this would be possible. Countless times throughout this doctoral journey I have relied my favorite scripture, “And we know that all things work together for good, to them that love God, to them who are called according to His purpose (Romans 8:28).” Secondly, I acknowledge my parents, James and Marilyn Brown. From an early age, you two instilled in me the value of education and have been my biggest cheerleaders throughout my entire life. I thank you for your unconditional love, encouragement, sacrifices, and support. I would not be here today without you. I truly thank God that out of the all of the people in the world that He could have chosen to be my parents, that He chose the two of you.
    [Show full text]
  • Initiation of Antiviral B Cell Immunity Relies on Innate Signals from Spatially Positioned NKT Cells
    Initiation of Antiviral B Cell Immunity Relies on Innate Signals from Spatially Positioned NKT Cells The MIT Faculty has made this article openly available. Please share how this access benefits you. Your story matters. Citation Gaya, Mauro et al. “Initiation of Antiviral B Cell Immunity Relies on Innate Signals from Spatially Positioned NKT Cells.” Cell 172, 3 (January 2018): 517–533 © 2017 The Author(s) As Published http://dx.doi.org/10.1016/j.cell.2017.11.036 Publisher Elsevier Version Final published version Citable link http://hdl.handle.net/1721.1/113555 Terms of Use Creative Commons Attribution 4.0 International License Detailed Terms http://creativecommons.org/licenses/by/4.0/ Article Initiation of Antiviral B Cell Immunity Relies on Innate Signals from Spatially Positioned NKT Cells Graphical Abstract Authors Mauro Gaya, Patricia Barral, Marianne Burbage, ..., Andreas Bruckbauer, Jessica Strid, Facundo D. Batista Correspondence [email protected] (M.G.), [email protected] (F.D.B.) In Brief NKT cells are required for the initial formation of germinal centers and production of effective neutralizing antibody responses against viruses. Highlights d NKT cells promote B cell immunity upon viral infection d NKT cells are primed by lymph-node-resident macrophages d NKT cells produce early IL-4 wave at the follicular borders d Early IL-4 wave is required for efficient seeding of germinal centers Gaya et al., 2018, Cell 172, 517–533 January 25, 2018 ª 2017 The Authors. Published by Elsevier Inc. https://doi.org/10.1016/j.cell.2017.11.036 Article Initiation of Antiviral B Cell Immunity Relies on Innate Signals from Spatially Positioned NKT Cells Mauro Gaya,1,2,* Patricia Barral,2,3 Marianne Burbage,2 Shweta Aggarwal,2 Beatriz Montaner,2 Andrew Warren Navia,1,4,5 Malika Aid,6 Carlson Tsui,2 Paula Maldonado,2 Usha Nair,1 Khader Ghneim,7 Padraic G.
    [Show full text]
  • Supplemental Materials Table 1. Proteins Significantly Differentially
    Electronic Supplementary Material (ESI) for Food & Function. This journal is © The Royal Society of Chemistry 2018 1 Supplemental materials 2 Table 1. Proteins significantly differentially regulated (p<0.05, expression > ±1.5) 12 h postprandial in the liver of Mongolian Gerbils after 3 receiving either a single dose of carotenoids lycopene (LYC), lutein (LUT), all-trans β-carotene (ATBC), retinol (ROL) or control (Cremophor 4 EL solution). Protein functionality (biological process involvement and protein type) according to UniProt (www.uniprot.org). As isoforms 5 were determined also, proteins could also be in part up-and down-regulated at the same time. comparison against vehicle gene protein Mascot con- LUT ATBC LYC ROL Protein name abbreviation abbreviation* abbreviation* biological process protein category fidence score** alternative proteins 3-ketoacyl-CoA thiolase A, fatty acid Fructose-bisphosphate ↑↑ ↑↑ ↑↑ peroxisomal ACAA1A ACAA1A THIKA metabolism lipid metabolism 377 aldolase B 3-ketoacyl-CoA thiolase B, fatty acid Aspartate aminotransferase, ↑↑ peroxisomal ACAA1B ACAA1B THIKB metabolism lipid metabolism 296 mitochondrial cytoskeleton 358, 370, 607, ↓ ↓ Actin, cytoplasmic 1 ACTB ACTB ACTB filament structure 976, Aldehyde dehydrogenase, 638, 126, ↓↓ ↓↓ mitochondrial ALDH2 ALDH2 ALDH2 oxidoreductase detoxification Argininosuccinate lyase 371 Ornithine carbamoyltransferase, ↓↓ Aldo-keto reductase type L16 AKR AKR-L16 Q05KR4 oxidoreductase detoxification mitochondrial energy 413 Aldehyde dehydrogenase, ↑↑ Alpha-enolase ENO1 ENO1
    [Show full text]