Supporting Information Cylindrofridins A–C, Linear Cylindrocyclophane

Supporting Information

Cylindrofridins A–C, Linear Cylindrocyclophane-Related

Alkylresorcinols from the Cyanobacterium

Cylindrospermum stagnale

Michael Preisitsch,† Timo H. J. Niedermeyer,‡, §, ┴ Stefan E. Heiden,|| Inga Neidhardt,†,# Jana Kumpfmüller,||, ◊

Martina Wurster†, Kirsten Harmrolfs,∇ Christoph Wiesner, Rolf Müller,∇ and Sabine Mundt*,†

† Institute of Pharmacy, Department of Pharmaceutical Biology, Ernst-Moritz-Arndt-University, Friedrich- Ludwig-Jahn-Straße 17, 17489 Greifswald, Germany

‡ Interfaculty Institute of Microbiology and Infection Medicine, Eberhard Karls University, Auf der Morgenstelle 28, 72076 Tübingen, Germany

§ German Centre for Infection Research (DZIF), Partner Site Tübingen, Germany

┴ Cyano Biotech GmbH, Magnusstraße 11, 12489 Berlin, Germany

|| Institute of Pharmacy, Department of Pharmaceutical Biotechnology, Ernst-Moritz-Arndt-University, Felix- Hausdorff-Straße 3, 17489 Greifswald, Germany

# Present Address: Institute of Technology, Department of Pharmacology, Toxicology and Clinical Pharmacy, Technical University of Braunschweig, Mendelssohnstraße 1, 38106 Braunschweig, Germany

◊ Present Address: Leibniz Institute for Natural Product Research and Infection Biology, Hans Knöll Institute (HKI), Department of Biomolecular Chemistry, Beutenbergerstraße 11a, 07745 Jena, Germany

∇ Helmholtz Institute for Pharmaceutical Research Saarland, Helmholtz Centre for Infection Research, and Department of Pharmaceutical Biotechnology, Saarland University, Campus E8.1, 66123 Saarbrücken, Germany

 Sealife PHARMA GmbH, Technopark 1/Obj.C/EG, 3430 Tulln, Austria

Table of Contents

Figure S1. Influence of extraction time used for the one-step extraction and enrichment procedure on the determination of the total [7.7]paracyclophane amount in Nostoc sp. CAVN2 biomass...... 1 Figure S2. Influence of extraction procedures on the extract yield obtained from Nostoc sp. CAVN2 biomass.. 2 Figure S3. Influence of extraction procedures on the determination of the total [7.7]paracyclophane amount in 10.0 mg Nostoc sp. CAVN2 biomass...... 3 Figure S4. Influence of extraction agents used for the one-step extraction and enrichment procedure on the determination of the total [7.7]paracyclophane amount in Nostoc sp. CAVN2 biomass...... 4 Figure S5. Phylogenetic tree based on the secondary structure alignment of cyanobacterial 16S rRNA gene sequences...... 9 Figure S6. Alignment of partial 16S rRNA gene sequences of Anabaena azotica Ley HB686 (A, accession number: AJ488603), Trichormus azollae Kom BAI/1983 (B, accession number: AJ630454), redetermined partial 16S rRNA gene sequence of A. azotica FACHB-118 (C, designated as A. azotica CCY 0405 in this study), and A. azotica FACHB-118 (also known as HB686) (D, accession number: AY422691)...... 10 1 Figure S7. H NMR spectrum (500 MHz, MeOH-d4) of cylindrofridin A (1)...... 12

Figure S8. COSY spectrum (500 MHz, MeOH-d4) of cylindrofridin A (1)...... 12

Figure S9. HSQC-DEPT spectrum (500 MHz, MeOH-d4) of cylindrofridin A (1)...... 13

Figure S10. HMBC spectrum (500 MHz, MeOH-d4) of cylindrofridin A (1)...... 14 Figure S11. ATR-IR (film) spectrum of cylindrofridin A (1)...... 15 Figure S12. ECD spectrum of cylindrofridin A (1) ...... 15 1 Figure S13. H NMR spectrum (500 MHz, MeOH-d4) of cylindrofridin B (2)...... 16

Figure S14. COSY spectrum (500 MHz, MeOH-d4) of cylindrofridin B (2)...... 16

Figure S15. HSQC-DEPT spectrum (500 MHz, MeOH-d4) of cylindrofridin B (2)...... 17

Figure S16. HMBC spectrum (500 MHz, MeOH-d4) of cylindrofridin B (2)...... 18 Figure S17. ATR-IR (film) spectrum of cylindrofridin B (2)...... 19 Figure S18. ECD spectrum of cylindrofridin B (2)...... 19 1 Figure S19. H NMR spectrum (500 MHz, MeOH-d4) of cylindrofridin C (3)...... 20

Figure S20. COSY spectrum (500 MHz, MeOH-d4) of cylindrofridin C (3)...... 20

Figure S21. HSQC-DEPT spectrum (500 MHz, MeOH-d4) of cylindrofridin C (3)...... 21

Figure S22. HMBC spectrum (500 MHz, MeOH-d4) of cylindrofridin C (3)...... 22 Figure S23. ATR-IR (film) spectrum of cylindrofridin C (3)...... 23 Figure S24. ECD spectrum of cylindrofridin C (3) ...... 23

I S1. Physical, spectroscopic, and spectrometric data of cylindrocyclophane A (4)...... 24 S2. Physical, spectroscopic, and spectrometric data of cylindrocyclophane B (5)...... 25 S3. Physical, spectroscopic, and spectrometric data of cylindrocyclophane D (6)...... 27

1 Figure S1a. H NMR spectrum (600 MHz, MeOH-d4) of cylindrocyclophane A (4)...... 24

1 Figure S2a. H NMR spectrum (600 MHz, MeOH-d4) of cylindrocyclophane B (5)...... 25 Figure S2b. ATR-IR (film) spectrum of cylindrocyclophane B (5)...... 26

1 Figure S3a. H NMR spectrum (600 MHz, MeOH-d4) of cylindrocyclophane D (6)...... 27 Figure S3b. ATR-IR (film) spectrum of cylindrocyclophane D (6)...... 28

Table S1. GC-MS detection of components occurring in the upper and lower phase after biomass extraction of

Nostoc sp. CAVN2 with the biphasic solvent system (n-heptane/EtOAc/EtOH/H2O; 5:2:5:2, v/v/v/v) ...... 5 Table S2. Cyanobacterial strains screened in this study ...... 6 Table S3. Redetermined partial phylogenetic marker gene sequences of Cylindrospermum stagnale PCC 7417 ...... 11

a ) % (

n 100 u o m a

e n a h p o l c

y 50 c a r a p ] 7 . 7 [

l a t o T 0 0.5 1 2 3 6 9 12 18 24 36 48 Extraction time (h)

Figure S1. Influence of extraction time used for the one-step extraction and enrichment procedure on the determination of the total [7.7]paracyclophane amount in Nostoc sp. CAVN2 biomass. Values shown are expressed as mean + standard deviation (SD), n = 6‒9. Data were tested for Gaussian distribution using the Kolmogorov-Smirnov test. Statistical analysis with one-way ANOVA followed by Tukey's multiple comparisons test revealed no statistically significant differences. aExtraction and subsequent HPLC-UV analysis at 226 nm were done as described in the method part of the article. Calculation was performed based on peak area integration of compounds eluting in the range 5‒30 min and revealing carbamidocyclophane-like UV spectra.1 The average value of treatments using an extraction time of 0.5 hours was defined as 100% total [7.7]paracyclophane amount.

Figure S2. Influence of extraction procedures on the extract yield obtained from Nostoc sp. CAVN2 biomass. The dry biomass was subjected either to the five-step MeOH extraction procedure according to Preisitsch et al.1 or to the one-step extraction and enrichment procedure as described in the manuscript. Values shown are expressed as mean + SD, n = 4‒6. Data were tested for Gaussian distribution using the Kolmogorov-Smirnov test. Statistical analysis was performed using unpaired Mann-Whitney U-test. Two asterisks (**) indicate a significant difference of p < 0.01. aThe experimental set-up and solvent volumes have not been changed for the five-step extraction procedure. However, biomass was reduced to 10.0 mg for better comparison.

Figure S3. Influence of extraction procedures on the determination of the total [7.7]paracyclophane amount in 10.0 mg Nostoc sp. CAVN2 biomass. Previously reported extraction procedure for carbamidocyclophane quantification of Nostoc sp. CAVN10 biomass2 was used as reference extraction procedure and compared to the one-step extraction and enrichment procedure. Values shown are expressed as mean + SD, n = 6. Data were tested for Gaussian distribution using the Kolmogorov-Smirnov test. Statistical analysis was performed using the unpaired t-test with Welch's correction. One asterisk (*) indicates a significant difference of p < 0.05. aThe total [7.7]paracyclophane amount was determined by HPLC-UV analysis at 226 nm using a Varian MonoChrom 5 u MS HPLC column (250 x 4.6 mm) and a flow rate of 0.8 mL/min at 25 °C under otherwise identical conditions as described in the method part of the article. Calculation was performed based on peak area integration of compounds eluting in the range 10‒36.5 min and revealing carbamidocyclophane-like UV spectra.1 The average value of treatments using the reference extraction protocol was defined as 100% total [7.7]paracyclophane amount.

Figure S4. Influence of extraction agents used for the one-step extraction and enrichment procedure on the determination of the total [7.7]paracyclophane amount in Nostoc sp. CAVN2 biomass. aExtraction and subsequent HPLC-UV analysis at 226 nm were done as described in the method part of the article. Calculation was performed based on peak area integration of compounds eluting in the range 5‒30 min and revealing carbamidocyclophane-like UV spectra.1 The average value of treatments using the [7.7]paracyclophane- containing, lower phase of the biphasic solvent system (n-heptane/EtOAc/EtOH/H2O, 5:2:5:2, v/v/v/v) was defined as 100% total [7.7]paracyclophane amount. Values shown are expressed as mean + SD, n = 5‒10. Data were tested for Gaussian distribution using the Kolmogorov-Smirnov test. Statistical analysis was performed using the Kruskal-Wallis test followed by Dunn's multiple comparisons test. One, two, and three asterisks (*,**,***) indicate a significant difference of p < 0.05, p < 0.01, and p < 0.001, respectively.

4 Table S1. GC-MS detection of components occurring in the upper and lower phase after biomass extraction of Nostoc sp. CAVN2 with the biphasic solvent system (n-heptane/EtOAc/EtOH/H2O; 5:2:5:2, v/v/v/v)

match compound KIa retention time t (min) relative amount (%)c R factorb

upper phase

glycerol 1284 14.87 907 1.39 phytolc 1983 28.45 822 15.53 phytolc 2009 28.94 808 2.36 (2E)-3,7,11,15-tetramethyl-2-hexadecen-1-ol (phytol)c 2028 29.31 885 4.94 palmitelaidic acid 2173 32.12 891 1.91 palmitic acid 2194 32.54 927 15.29 α-linolenic acid 2351 35.60 825 2.07 stearic acid 2377 36.09 906 7.64 1-monopalmitin 2663 41.64 901 21.87 1-monostearin 2808 44.46 867 12.72

match compound KIa retention time t (min) relative amount (%)c R factorb

lower phase

glutamine 1739 23.70 906 1.53 phosphoric acid 1901 26.84 937 1.37 palmitelaidic acid 2172 32.12 907 0.92 palmitic acid 2194 32.54 908 4.38 α-linolenic acid 2351 35.59 877 1.11 stearic acid 2377 36.09 920 1.19 1-monopalmitin 2663 41.64 896 10.43 glucopyranosided 2699 42.35 931 33.44 1-monostearin 2808 44.46 864 6.11 glucopyranosided 3254 53.14 906 16.56 aKI = Kovats retention index. bOnly compounds are listed revealing a match factor ≥ 800. cRelative amounts of detected compounds were calculated based on the peak areas of the total ion chromatograms (TIC). dMultiple compound detection is due to a varying degree of silyl moieties after the derivatization procedure.

5 Table S2. Cyanobacterial strains screened in this study

detection of cultivation medium #a strainb geographical origin/date of isolationc cylindrocyclophanes/ in this study cylindrofridins Nostocalesd 1 Anabaena ambigua SAG 1403-7 BG-11 fresh water, IN/before 1967 ‒/‒ 2 Anabaena azotica CCY 0405 BG-11 rice field, CN/unknown ‒/‒ 3 Anabaena compacta EMAU BM-Ana 2 MBL Treut-See, Sauensiek, DE/1994 ‒/‒ 4 Anabaena cylindrica Bio33 BG-11 + 0,5% NaCl brackish water from Baltic Sea, near Grabow, Rügen Island, DE/2001 ‒/‒ 5 Anabaena cylindrica SAG 1403-2e BG-11 water pond, Cambridge, GB/1939 ‒/‒ 6 Anabaena solitaria EMAU AS BG-11 fountain water/1972 ‒/‒ 7 Anabaena sp. CBT 1074 BG-11 Bogengraben, Lower Oder Valley National Park, DE/between 2007 and 2009 ‒/‒ 8 Anabaena sp. CCY 9401 BG-11 sediment, Arcachon, FR/unknown ‒/‒ 9 Anabaena sp. PCC 9208 BG-11 grassland, Galicia, ES/unknwon ‒/‒ 10 Anabaena sp. SAG 12.82 BG-11 moist dune sand, Föhr Island, DE/1981 ‒/‒ 11 Anabaena sp. SAG 28.79 BG-11 soil, PK/before 1978 ‒/‒ 12 Anabaena sp. CCY 9613 BG-11 Waddensea, Mellum, DE/unknown ‒/‒ 13 Anabaena sp. CCY 9910 BG-11 soil, rice field, TW/unknown ‒/‒ 14 Anabaena sp. CCY 9911 BG-11 TW/unknown ‒/‒ 15 Anabaena sp. EMAU BM-Ana 5 MBL Plußsee, Rathjensdorf, DE/1994 ‒/‒ 16 Anabaena sp. PCC 73105e BG-11 pond water, garden near Cambridge, GB/1939 ‒/‒ 17 Anabaena spiroides EMAU BM-Ana 4 MBL Treut-See, Sauensiek, DE/1994 ‒/‒ 18 Anabaena variabilis EMAU 1 BG-11 unknown/unknown ‒/‒ 19 Anabaena viguieri SAG 27.79 BG-11 soil, FR/1955 ‒/‒ 20 Cylindrospermum alatosporum SAG 43.79 BG-11 soil, FR/1952 ‒/‒ 21 Cylindrospermum majus EMAU 95 BG-11 dyke water near Weitenhagen, DE/1957 ‒/‒ 22 Cylindrospermum majus PCC 7604 BG-11 unknown/unknown ‒/‒ 23 Cylindrospermum muscicola SAG 44.79 BG-11 soil, Gif-sur-Yvette, FR/1966 ‒/‒ 24 Cylindrospermum stagnale PCC 7417 BG-11 soil from greenhouse, Stockholm, SE/1972 +/+ 25 Cylindrospermum stagnale SAG 45.79 BG-11 soil, CL/1941 ‒/‒ 26 Nodularia spumigena EMAU 953-23 BG-11 + 0,5% NaCl brackish water, Little Bay of Jasmund, Rügen Island, DE/1983 ‒/‒ 27 Nostoc caeruleum SAG 34.91 BG-11 freshwater pool at Voslapper Groden, Wilhelmshaven, DE/1983 ‒/‒ 28 Nostoc caeruleum SAG 59.79 BG-11 fresh water, Étang de la Tour, Rambouillet, FR/1965 ‒/‒ 29 Nostoc calcicola SAG 1453-1 BG-11 soil, Utrecht, NL/before 1952 ‒/‒ 30 Nostoc commune CCY 0509 BG-11 sediment, Mountain Mauken, near Tromsø, NO/unknown ‒/‒ 31 Nostoc commune SAG 1453-3 BG-11 soil, Utrecht, NL/before 1952 ‒/‒ 32 Nostoc commune SAG 1453-5 BG-11 Scotland, GB/unknown ‒/‒ 33 Nostoc ellipsosporum SAG 1453-2 BG-11 freshwater pool (Strijkviertelplas), near Utrecht, NL/before 1952 ‒/‒ 34 Nostoc ellipsosporum SAG 1453-7 BG-11 fresh water, Wisconsin, US/1968 ‒/‒ 35 Nostoc entophytum CAVN1 BG-11 fresh water, rice field, near Hanoi, VN/unknown ‒/‒ 36 Nostoc insulare SAG 54.79 BG-11 soil/unknown ‒/‒ 37 Nostoc linckia EMAU 230 BG-11 Meiningenbrücke, Bay of Barth, DE/1971 ‒/‒ 38 Nostoc muscorum SAG 57.79 BG-11 soil, FR/before 1952 ‒/‒ 39 Nostoc muscorum SAG 1453-12a BG-11 soil, Columbia, US/before 1930 ‒/‒ 40 Nostoc pruniforme SAG 61.79 BG-11 fresh water, Schöhsee, near Plön, DE/1964 ‒/‒ 41 Nostoc punctiforme PCC 73102 BG-11 from a root section of the cycad Macrozamia, AU/1973 ‒/‒

6 detection of cultivation medium #a strainb geographical origin/date of isolationc cylindrocyclophanes/ in this study cylindrofridins 42 Nostoc punctiforme SAG 60.79 BG-11 soil, FR/before 1953 ‒/‒ 43 Nostoc punctiforme SAG 65.79 BG-11 symbiont of Blasia pusilla, Rostocker Heide, near Rostock, DE/before 1964 ‒/‒ 44 Nostoc punctiforme SAG 67.79 BG-11 symbiont of Blasia pusilla, near Bremke, DE/1974 ‒/‒ 45 Nostoc punctiforme SAG 71.79 BG-11 soil, Lascaux, FR/1964 ‒/‒ 46 Nostoc rivulare SAG 64.79 BG-11 ditch, botanical garden of the Heinrich-Heine-University, Göttingen, DE/1961 ‒/‒ 47 Nostoc sp. CBT 272 BG-11 unknown/unknown ‒/‒ 48 Nostoc sp. CBT 751 BG-11 Bogengraben, Lower Oder Valley National Park, DE/between 2007 and 2009 ‒/‒ 49 Nostoc sp. CBT 869 BG-11 unknown/unknown ‒/‒ 50 Nostoc sp. CBT 951 BG-11 soil, CH/1943 ‒/‒ 51 Nostoc sp. CBT 882 BG-11 unknown/unknown ‒/‒ 52 Nostoc sp. CBT 1006 BG-11 fresh water, Lower Oder Valley National Park, DE/between 2007 and 2009 ‒/‒ 53 Nostoc sp. CBT 1014 BG-11 Saidenbach-Haselbach dam, DE/unknown ‒/‒ 54 Nostoc sp. CBT 1020 BG-11 Saidenbach-Haselbach dam, DE/unknown ‒/‒ 55 Nostoc sp. CBT 1028 BG-11 Lower Oder Valley National Park, DE/between 2007 and 2009 ‒/‒ 56 Nostoc sp. CBT 1029 BG-11 fresh water, Lower Oder Valley National Park, DE/between 2007 and 2009 ‒/‒ 57 Nostoc sp. CBT 1056 BG-11 Lower Oder Valley National Park, DE/between 2007 and 2009 ‒/‒ 58 Nostoc sp. CBT 1082 BG-11 unknown/unknown ‒/‒ 59 Nostoc sp. CCY 0012 BG-11 Schiermonnigkoog, NL/unknown ‒/‒ 60 Nostoc sp. CCY 0026 BG-11 sediment, Rottnest Island, AU/unknown ‒/‒ 61 Nostoc sp. CCY 0504 BG-11 sediment, Mountain Mauken, near Tromsø, NO/unknown ‒/‒ 62 Nostoc sp. CCY 0505 BG-11 sediment, Mountain Mauken, near Tromsø, NO/unknown ‒/‒ 63 Nostoc sp. CCY 0506 BG-11 sediment, Mountain Mauken, near Tromsø, NO/unknown ‒/‒ 64 Nostoc sp. CCY 0507 BG-11 sediment, Mountain Mauken, near Tromsø, NO/unknown ‒/‒ 65 Nostoc sp. CCY 0508 BG-11 sediment, Mountain Mauken, near Tromsø, NO/unknown ‒/‒ 66 Nostoc sp. EMAU 104 BG-11 unknown/unknown ‒/‒ 67 Nostoc sp. HUB 70 BG-11 unknown/unknown ‒/‒ 68 Nostoc sp. HUB 205-4E BG-11 unknown/unknown ‒/‒ 69 Nostoc sp. HUB 321 BG-11 unknown/unknown ‒/‒ 70 Nostoc sp. HUB 322 BG-11 unknown/unknown ‒/‒ 71 Nostoc sp. PCC 6310 BG-11 fish pond, Nothern Galilea, IL/1963 ‒/‒ 72 Nostoc sp. PCC 6411 BG-11 pond water, California, US/1964 ‒/‒ 73 Nostoc sp. PCC 6720 BG-11 soil, island of Sumatra, ID/1950 ‒/‒ 74 Nostoc sp. PCC 7107 BG-11 shallow pond, Point Reyes Peninsula, California, US/1970 ‒/‒ 75 Nostoc sp. PCC 7118 BG-11 unknown/unknown ‒/‒ 76 Nostoc sp. PCC 7413 BG-11 surface garden soil, St Albans, Hertfordshire, UK/1950 ‒/‒ 77 Nostoc sp. PCC 7416 BG-11 shallow pool, San Andreas Valley, California, US/1972 ‒/‒ 78 Nostoc sp. PCC 7423 BG-11 dried soil sample, SN/1973 ‒/‒ 79 Nostoc sp. PCC 7524 BG-11 moderate hot spring, Maha Oya, Ampari District, LK/1973 ‒/‒ 80 Nostoc sp. PCC 7706 BG-11 rain water, calcareous stone basin, Sacy, FR/unknown ‒/‒ 81 Nostoc sp. PCC 7707 BG-11 unknown/unknown ‒/‒ 82 Nostoc sp. PCC 7717 BG-11 brackish water, Marseille, FR/1975 ‒/‒ 83 Nostoc sp. PCC 7807 BG-11 unknown/1952 ‒/‒ 84 Nostoc sp. PCC 7912 BG-11 acidic soil, rice field, river delta, SN/1970 ‒/‒ 85 Nostoc sp. PCC 7933 BG-11 mud, Friggersby, near Kirkkonummi, FI/1977 ‒/‒

7 detection of cultivation medium #a strainb geographical origin/date of isolationc cylindrocyclophanes/ in this study cylindrofridins 86 Nostoc sp. PCC 7937 BG-11 fresh water, sewage oxidation pond, Mississippi, US/1964 ‒/‒ 87 Nostoc sp. SAG 34.92 BG-11 soil, rice field, Mae Hong Son Province, TH/1986 ‒/‒ 88 Nostoc sp. SAG 35.92 BG-11 symbiont of Gunnera chilensis, botanical garden of the University of Prague, CZ/1946 ‒/‒ 89 Nostoc sp. SAG 39.87 BG-11 phycobiont of lichen Peltigera aphthosa var. variolosa, Vallée de la Brévine, CH/1958 ‒/‒ 90 Nostoc sp. SAG 70.79 BG-11 soil sample, FR/1952 ‒/‒ 91 Nostoc sp. TVN 9 BG-11 soil, field, Dak Lak Province, VN/2002 ‒/‒ 92 Nostoc spongiaeforme TVN 7 BG-11 soil, field, Dak Lak Province, VN/2002 ‒/‒ 93 unidentified cyanobacterium Bio14 MBL unknown/unknown ‒/‒ 94 unidentified cyanobacterium Bio24 BG-11 Lake Kummerow, Verchen, DE/2000 ‒/‒ 95 unidentified cyanobacterium Bio26 MBL unknown/unknown ‒/‒ 96 unidentified cyanobacterium Bio34 MBL Baltic Sea, Lubmin, DE/2004 ‒/‒ 97 unidentified cyanobacterium Bio36 BG-11 brackish water, Baltic Sea water basin near German Maritime Museum, Stralsund, DE/2000 ‒/‒ 98 unidentified cyanobacterium CAVN3 MBL fresh water, rice field, near Hanoi, VN/unknown ‒/‒ 99 unidentified cyanobacterium CAVN11 BG-11 fresh water, rice field, near Hanoi, VN/unknown ‒/‒ 100 unidentified cyanobacterium CBT 1055 BG-11 fresh water, Lower Oder Valley National Park, DE/between 2007 and 2009 ‒/‒ Oscillatorialesd 101 Pseudanabaena catenata EMAU 233 BG-11 Meiningenbrücke, Bay of Barth, DE/1974 ‒/‒ 102 unidentified cyanobacterium Bio11 BG-11 brackish water, Baltic Sea, Heringsdorf, DE/1999 ‒/‒ aNumbers in bold indicate cyanobacterial strains that are plotted on the map of Figure 2. bCulture collections: CBT, Culture Collection of Cyanobacteria of Cyano Biotech GmbH, Berlin, Germany; CCY, Culture Collection Yerseke, Royal Netherlands Institute for Sea Research (NOIZ), Yerseke, The Netherlands (screened strains are also included in the CBT collection); HUB, Culture Collection of Algae at the Humboldt-University, Berlin, Germany (meanwhile included in the CBT collection); PCC, Pasteur Culture Collection of Cyanobacteria, Biological Resource Center of Institut Pasteur (CRBIP), Paris, France; SAG, Culture Collection of Algae, Experimental Phycology and Culture Collection at the University of Göttingen (EPSAG), Göttingen, Germany. Strains with designations Bio, CAVN, EMAU, and TVN belong to the culture collection of the Institute of Pharmacy, Ernst-Moritz-Arndt-University, Greifswald, Germany. Strain designations in bold indicate cyanobacterial strains that are included in the phylogenetic analysis (Figure S5). cAU, Australia; CH, Switzerland; CL, Chile; CN, China; CZ, Czech Republic; DE, Germany; ES, Spain; FI, Finland; FR, France, GB, United Kingdom; ID, Indonesia; IL, Israel; IN, India; LK, Sri Lanka; NL, The Netherlands; NO, Norway; PK, Pakistan; SE, Sweden; SN, Senegal; TH, Thailand; TW, Taiwan, Province of China; US, United States; VN, Viet Nam. dTaxonomic assignment of strains to cyanobacterial orders based on the taxonomic scheme according to the National Center for Biotechnology Information (NCBI; http://ncbi.nlm.nih.gov), Bethesda, MD, United States. eStrain Anabaena cylindrica SAG 1403-2 and Anabaena sp. PCC 73105 are strain relatives but maintained in different culture collections.

Figure S5. Phylogenetic tree based on the secondary structure alignment of cyanobacterial 16S rRNA gene sequences. The tree was inferred using a maximum likelihood method. Numbers given on the branches display bootstrap proportions as percentage of 1000 replicates for values ≥ 50 %. The cyanobacterial strains shown in bold have been screened for the production of [7.7]paracyclophanes and related derivatives in this study. Sequences belonging to strains marked with a dagger (†) were included instead of those originating from actually screened coidentical strains, namely: Anabaena variabilis ATCC 29413 (screened as Nostoc sp. PCC 7937), Anabaena cylindrica PCC 7122 (screened as Anabaena cylindrica SAG 1403-2, Anabaena sp. PCC 73105), Trichormus azollae Kom BAI/1983 (screened as Anabaena azotica CCY 0405), Anabaena sphaerica UTEX 'B 1616' (screened as Anabaena ambigua SAG 1403-7), Nostoc commune UTEX 584 (screened as Nostoc commune SAG 1453-5), and Nostoc sp. PCC 7906 (screened as Nostoc sp. SAG 1453-12a). Filled diamonds (♦), circles (●), squares (■) and triangles (▲) denote cylindrofridin producers as well as cylindro-, carbamido- and merocyclophane producers, respectively. Reference strains according to Bergey’s Manual of Systematic Bacteriology3 are marked with an asterisk (*). The INSDC accession numbers are given in brackets. For entries that represent a whole genome, the genomic location of the considered sequence is provided additionally. Sequences used as outgroup (Bacillus subtilis DSM 10 [AJ276351] and Escherichia coli ATCC 25922 [DQ360844]) are not shown.

Figure S6. Alignment of partial 16S rRNA gene sequences of Anabaena azotica Ley HB686 (A, accession number: AJ488603), Trichormus azollae Kom BAI/1983 (B, accession number: AJ630454), redetermined partial 16S rRNA gene sequence of A. azotica FACHB-118 (C, designated as A. azotica CCY 0405 in this study), and A. azotica FACHB-118 (also known as HB686) (D, accession number: AY422691).

10 Table S3. Redetermined partial phylogenetic marker gene sequences of Cylindrospermum stagnale PCC 7417

marker gene determined partial sequence

cpcBA AATCATCTTACGCTATGTTACCTACGCTATCCTAGCAGGTGACTCCAGTGTTCTCG ATGATCGCGCTCTCAATGGACTGCGTGAAACCTACCAAGCATTGGGTACTCCTGG TTCTTCCGTAGCTGTAGGCGTTCAAAAGATCAAGGAAGCAGCGATCGCGATTGCT AACGATCCTAACGGTATCAGCAAGGGTGATTGCAGCCAATTGATTTCTGAAGTAG CTGGCTACTTTGATCGCGCTGCTGCTGCTGTTGTTTAATAGCATTACAAAAACCCA GAACCTAAAAAATTAGGTGTCTAGGTAAAAAAATTACGAATTACCAAGGAGATT TGAAATCATGGTTAAAACCCCAATTACCGAAGCTATTGCAGCTGCTGATACTCAA GGACGTTTCTTAGGAAACACCGAACTTCAAGCTGTCAACGGTCGTTTTCAACGTG CTGCTGTTAGCTTAGAAGCCGCTCGTGGCTTGACCTCAAACGCTCAACGTTTGAT TGATGGTGCAACCCAAGCTGTATACCAAAAATTCCCTTACACCACCCAAACACCA GGACCACAATACGCTGCTGACAGCCGTGGTAAGTCCAAGTGTGCTCGTGACGTTG GTCACTACCTACGCATCATCACTTATAGCTTAGTTGCTGGTGGTACAGGTCCCTTG GATGAGTACCTGATTGCTGGTTTGGCAGAAATCAACAGCTCC

hetR CATTTGCACCACCTTGAGCCGAAGCGAGTAAAAATCATTGTCGAGGAAGTAAGA CTTGCGCTGACTGAGGGCAAATTGTTGAAGATGCTGGGTTCTCAAGAACCTCGCT ATCTGATTCAATTACCTTATGTCTGGATCGAAAAATATCCTTGGCAACCTGGGCG CAGCCGCGTGCCTGGTACAAGTCTAACAAGTGAAGAAAAAAGACAAATTGAGCA GAAGCTACCAAGTAACCTGCCTGACGCTCAGTTAGTCTCTTCCTTTGAGTTTCTGG AGTTGATTGAGTTTCTGCACAAGCGATCGCAAGAGGAATTGCCATCTCACCATCA GATGCCTTTGAGCGAAGCCTTAGCGGAGCATATCAAGCGCCGTCTGCTCTAT

rbcLX CTTTGGTGATGACTCCGTACTACAATTCGGTGGTGGTACTCTTGGTCACCCTTGGG GTAACGCTCCTGGTGCTACCGCTAACCGCGTCGCCTTGGAAGCAGTTGTTCAAGC TCGTAACGAAGGCCGTAACTTGGCTCGTGAAGGTAACGATATCATCCGCGAAGCT GCCAAGTGGTCTCCTGAATTGGCTGTTGCTTGCGAACTTTGGAAAGAAATCAAGT TCGAGTTTGAAGCAATGGATACCGTCTGATCTGAGTTAAGGGTTAAGAGTTATAG AGTGAAGAGTTAAATTAATTCATAACTCGTAACTCATAATTCTTAACTTTTGTGG GCTGGGGTCAAGCATGAATCTAAAGCAAATTGCGAAGGACACAGCCAAGACTCT CCAAAGCTACTTGACTTATCAGGCGCTAAGGACGGTACTGGCACAACTAGACGA AACAAATCCTCCATTAGCGCTTTGGCTGCATAACTTTTCTGCTGGCAAAGTCCAG GATGGAGAGGCTTATATTGACGAACTGTTTCGAGAAAAGTCAGATTTGGCATTGC GGATTATGACTGTCAGGGAGCACATAGCGGCGGAAGTTACTGATTTCTTACCGGA AATGGTTCGCACTGGCATTCAGCAAGCCAATATGGAACAACGTCGCCAGCATCTA GAACGGGTCACGCAAATTAATTTGTCAAACCCCAGTCCAGAATCAGAACAGCAG ACAATCTCAAACCCGAATTTGGATAACTTATCCAATTAGTCGATCAATCTAATAG TAAACAATCGCACTACC

1 Figure S7. H NMR spectrum (500 MHz, MeOH-d4) of cylindrofridin A (1).

ppm

1.5

2.0

2.5

3.0

3.5

4.0

4.5

5.0

5.5

6.0

ppm 6.0 5.5 5.0 4.5 4.0 3.5 3.0 2.5 2.0 1.5 1.0

Figure S8. COSY spectrum (500 MHz, MeOH-d4) of cylindrofridin A (1).

12 ppm

104

ppm 6.0 5.5 5.0 4.5 4.0 3.5 3.0 2.5 2.0 1.5 1.0 a Figure S9. HSQC-DEPT spectrum (500 MHz, MeOH-d4) of cylindrofridin A (1). a Red signals are attributed to CH or CH3 groups (positively phased) and blue signals to CH2 groups (negatively phased).

13 ppm

100

120

140

160

ppm 6.0 5.5 5.0 4.5 4.0 3.5 3.0 2.5 2.0 1.5 1.0

Figure S10. HMBC spectrum (500 MHz, MeOH-d4) of cylindrofridin A (1).

Figure S11. ATR-IR (film) spectrum of cylindrofridin A (1).

0 CD[mdeg]

-2 800

600

HT[V] 400

200 200 220 240 260 280 300 Wavelength [nm] Figure S12. ECD spectrum of cylindrofridin A (1)

15 KH-GW-Cyl6.001.esp Normalized Intensity Normalized

0.35

0.30

0.25

0.20

0.15

0.10

0.05

6.0 5.5 5.0 4.5 4.0 3.5 3.0 2.5 2.0 Chemical Shift (ppm) 1 Figure S13. H NMR spectrum (500 MHz, MeOH-d4) of cylindrofridin B (2).

ppm

1.5

2.0

2.5

3.0

3.5

4.0

4.5

5.0

5.5

6.0 ppm 6.0 5.5 5.0 4.5 4.0 3.5 3.0 2.5 2.0 1.5 1.0

Figure S14. COSY spectrum (500 MHz, MeOH-d4) of cylindrofridin B (2).

16 ppm

100

105

ppm 6.0 5.5 5.0 4.5 4.0 3.5 3.0 2.5 2.0 1.5 1.0 a Figure S15. HSQC-DEPT spectrum (500 MHz, MeOH-d4) of cylindrofridin B (2). a Red signals are attributed to CH or CH3 groups (positively phased) and blue signals to CH2 groups (negatively phased).

17 ppm

104

112

120

128

136

144

152

160

168

176 ppm 6.0 5.5 5.0 4.5 4.0 3.5 3.0 2.5 2.0 1.5 1.0

Figure S16. HMBC spectrum (500 MHz, MeOH-d4) of cylindrofridin B (2).

Figure S17. ATR-IR (film) spectrum of cylindrofridin B (2).

5 4

2 CD[mdeg] 0 -1 900 800

600 HT[V] 400

200 200 220 240 260 280 300 Wavelength [nm] Figure S18. ECD spectrum of cylindrofridin B (2).

19 KH-GW-Cyl7.001.esp Normalized Intensity Normalized

0.40

0.35

0.30

0.25

0.20

0.15

0.10

0.05

6.0 5.5 5.0 4.5 4.0 3.5 3.0 2.5 2.0 Chemical Shift (ppm) 1 Figure S19. H NMR spectrum (500 MHz, MeOH-d4) of cylindrofridin C (3).

ppm

1.5

2.0

2.5

3.0

3.5

4.0

4.5

5.0

5.5

6.0 ppm 6.0 5.5 5.0 4.5 4.0 3.5 3.0 2.5 2.0 1.5 1.0

Figure S20. COSY spectrum (500 MHz, MeOH-d4) of cylindrofridin C (3).

20 ppm

100

105

ppm 6.0 5.5 5.0 4.5 4.0 3.5 3.0 2.5 2.0 1.5 1.0 a Figure S21. HSQC-DEPT spectrum (500 MHz, MeOH-d4) of cylindrofridin C (3). a Red signals are attributed to CH or CH3 groups (positively phased) and blue signals to CH2 groups (negatively phased).

21 ppm

100

110

120

130

140

150

160

170

ppm 6.0 5.5 5.0 4.5 4.0 3.5 3.0 2.5 2.0 1.5 1.0

Figure S22. HMBC spectrum (500 MHz, MeOH-d4) of cylindrofridin C (3).

Figure S23. ATR-IR (film) spectrum of cylindrofridin C (3).

7 6

2 CD[mdeg] 0 -1 900 800

600 HT[V] 400

200 200 220 240 260 280 300 Wavelength [nm] Figure S24. ECD spectrum of cylindrofridin C (3)

23 S1. Physical, spectroscopic, and spectrometric data of cylindrocyclophane A (4).

Cylindrocyclophane A (4): white, amorphous powder; UV (MeOH) λmax (log ε) 220.5 (4.23), 226 (sh) (4.19), 275 − (3.36) nm; HRESIMS m/z 583.4031 (calcd for C36H55O6 [M − H] , 583.4004, ∆ 4.6 ppm).

NormalizedIntensity

0.025

0.020

0.015

0.010

0.005

0 6.5 6.0 5.5 5.0 4.5 4.0 3.5 3.0 2.5 2.0 1.5 Chemical Shift (ppm) 1 Figure S1a. H NMR spectrum (600 MHz, MeOH-d4) of cylindrocyclophane A (4).

24 S2. Physical, spectroscopic, and spectrometric data of cylindrocyclophane B (5).

Cylindrocyclophane B (5): white, amorphous powder; UV (MeOH) λmax (log ε) 220 (4.28), 226 (sh) (4.23), 276 (3.50) nm; ATR-IR (film) νmax 3609, 3374 (br), 2928, 2855, 1711, 1619, 1592, 1431, 1373, 1257, 1132, 1018, −1 − 980, 832, 747, 618 cm ; HRESIMS m/z 625.4119 (calcd for C38H57O7 [M − H] , 625.4110, ∆ 1.4 ppm).

NormalizedIntensity

0.011

0.010

0.009

0.008

0.007

0.006

0.005

0.004

0.003

0.002

0.001

0 6.5 6.0 5.5 5.0 4.5 4.0 3.5 3.0 2.5 2.0 1.5 Chemical Shift (ppm) 1 Figure S2a. H NMR spectrum (600 MHz, MeOH-d4) of cylindrocyclophane B (5).

Figure S2b. ATR-IR (film) spectrum of cylindrocyclophane B (5).

26 S3. Physical, spectroscopic, and spectrometric data of cylindrocyclophane D (6).

Cylindrocyclophane D (6): white, amorphous powder; UV (MeOH) λmax (log ε) 220.5 (4.37), 226 (sh) (4.33), 276.5 (3.63) nm; ATR-IR (film) νmax 3368 (br), 2926, 2854, 1748, 1712, 1615, 1591, 1431, 1369, 1254, 1207, −1 − 1133, 1016, 956, 905, 826, 746, 621 cm ; HRESIMS m/z 667.4233 (calcd for C40H59O8 [M − H] , 667.4215, ∆ 2.7 ppm).

NormalizedIntensity

0.015

0.010

0.005

0 6.5 6.0 5.5 5.0 4.5 4.0 3.5 3.0 2.5 2.0 1.5 Chemical Shift (ppm) 1 Figure S3a. H NMR spectrum (600 MHz, MeOH-d4) of cylindrocyclophane D (6).

Figure S3b. ATR-IR (film) spectrum of cylindrocyclophane D (6).

28 References: (1) Preisitsch, M.; Harmrolfs, K.; Pham, H. T.; Heiden, S. E.; Füssel, A.; Wiesner, C.; Pretsch, A.; Swiatecka- Hagenbruch, M.; Niedermeyer, T. H.; Müller, R.; Mundt, S. J. Antibiot. 2015, 68, 165-177. (2) Preisitsch, M.; Bui, H. N.; Bäcker, C.; Mundt, S. J. Appl. Phycol. 2015, ASAP publication, DOI: 10.1007/s10811-015-0657-7. (3) Castenholz, R. W. In Bergey's Manual of Systematic Bacteriology; Boone, D. R.; Castenholz, R. W., Eds.; Springer-Verlag: New York, NY, USA, 2001; Vol. One, Chapter 473-599, pp 473-599.