US 2015 0037370A1 (19) United States (12) Patent Application Publication (10) Pub. No.: US 2015/0037370 A1 Corbeil et al. (43) Pub. Date: Feb. 5, 2015
(54) DIATOM-BASEDVACCINES (86). PCT No.: PCT/US2O12/062112 S371 (c)(1), (71) Applicants: The Regents of the University of (2) Date: Apr. 23, 2014 California, Oakland, CA (US); Synaptic Related U.S. Application Data Research, LLC, Baltimore, MD (US) (60) Provisional application No. 61/553,139, filed on Oct. (72) Inventors: Lynette B. Corbeil, San Diego, CA 28, 2011. (US); Mark Hildebrand, La Jolla, CA Publication Classification (US); Roshan Shrestha, San Diego, CA (US); Aubrey Davis, Lakeside, CA (51) Eiko.29s (2006.01) (US) Rachel Schrier, Del Mar, CA CI2N 7/00 (2006.01) (US); George A. Oyler, Lincoln, NE A6139/02 (2006.01) (US); Julian N. Rosenberg, Naugatuck, A61E36/06 (2006.01) CT (US) A6139/02 (2006.01) (52) U.S. Cl. (73) Assignees: SYNAPTIC RESEARCH, LLC, CPC ...... A61K 39/295 (2013.01); A61K 36/06 Baltimore, MD (US): THE REGENTS (2013.01); A61 K39/107 (2013.01); A61 K OF THE UNIVERSITY OF 39/102 (2013.01); C12N 700 (2013.01); A61 K CALIFORNIA, Oakland, CA (US) 2039/523 (2013.01) USPC ...... 424/2011; 424/93.21; 424/261.1;
y x- - - 9 (57) ABSTRACT 22) PCT Fled: Oct. 26, 2012 This invention pprovides diatom-based vaccines. Patent Application Publication Feb. 5, 2015 Sheet 1 of 19 US 2015/0037370 A1
83 : RE: Repests 388x ExF8.
Patent Application Publication Feb. 5, 2015 Sheet 2 of 19 US 2015/0037370 A1
Fig. 2 Patent Application Publication Feb. 5, 2015 Sheet 3 of 19 US 2015/0037370 A1
'. : 88:838: Patent Application Publication Feb. 5, 2015 Sheet 4 of 19 US 2015/0037370 A1
mine corveiescent tra &888 isix:
Fig. 4 Patent Application Publication Feb. 5, 2015 Sheet 5 of 19 US 2015/0037370 A1
88: 3:33 Patent Application Publication Feb. 5, 2015 Sheet 6 of 19 US 2015/0037370 A1
Fig. 6 Patent Application Publication Feb. 5, 2015 Sheet 7 of 19 US 2015/0037370 A1
Patent Application Publication Feb. 5, 2015 Sheet 8 of 19 US 2015/0037370 A1
AGCTIGCGCITICCGAGAACCCCCAA AGCAACGGC'CCAATCAAGAATGATCCGA CAACGGCGAGCATAGCA ACACGTCCGTCTTGGAGTAGAATCATCAGT, GTGGATGAATA CACAGATGAATGACATTAAAAGCATGAACATGTAGAGAGTAGGAGGTAGAGATTGAATG GTAGCATTGCGATGT (GTTTTGGTCAGCAATGATGAGTGGATACCAAATGAGAAAG TTGAATCTCGCCTTTGAGCT CACCCGACGTATTGACCAAAG TAGCCTGACAAAATCC TTGGAGAGACAAGAGGATCAAAGAACCAGGGGGGCGATAACCCAAGCCGTCCAA AGAGGCAAGGAGGAGAAACT CACCCAGTGAGAAGAAGGAAGGCAGGGCGGTGGCG AAAGCAGAGGCAA CGAGGACAGACTCCTGGGGEGAGCAACGAATACCAGAAG GA GAAGTTTAGACACTTGAACCGCTACCTACAATGACAAACTATCCTA: CGATTTTGATGTTC GTTGGTTAGAATTCAA ACTGTAAGTTGGATTGTGAGAAGATCAGAAGTTGAACGAACACA TCTTTCCGATCATTCACCTCCACACTGCAACAACACGG ACTCTCCGCGGCAGCTCTC GTCCCCATICTCTCTCCTGTTCTGGCTCTGACACGACCAAACCAA CGACAAGTTTCACA AAAGGGAGTCCTTTAACGAGATAE GTTTTTTATAAAGAGTCCCAAEAGAAAGACAAATTG ATTCCTCCGTGCAAACGCGCAAATAAACACCACGTCCAAATCCATACTTTCAGAGTA TCCAACAAGTGTTGAAGGACAGGTAGTGAACTAACGTATCTTCCCCCCGACTGGAECCA TCAACAAGGCGAA CAAATCCATCAACCCCAAAAATCGATACCAAACCGATA CAACAAGIGACAAAAAAGCTGAACGAGAAACGAAAAGAAAAAACAAAA AAATTAGAGCAAAAAAACAGACACAAATAC GTAAAACACAACAAECCAGICA CAGGCGGCCGCAAGGCACCCCAGGCTTACACITATGCTTCCGGCCGAAAIG GGGATGAGAGGACCGCGAGATTCAGGAGCAAGGAAGCRAAAAGGAGAAA AAAACACGGAATACCACCGTTGAATATCCCAATGGCATCGTAAAGAACATTGAGG CATCAGICAGGCCAATGACCTATAACCAGACCGTTCAGCTGGATAACGGCCT AAAGACCGAAAGAAAAAAAGCACAAGITATCCGGCCTTACACACIGCC CGCCGAGAAGCCACCGGAATCCGAGGCAAGAAAGACGGTGAGCTGGGAA GGGAEAGGCACCCTTGACACCGTCCATGAGCAAACTGAAACGTCATCGC CGGAGGAAACCACGACGATTCCGGCAGCTACACAATATCGCAAGAGTGGCG GACGGIGAAAACCGGCCIATTCCCAAAGGGTTTATTGAGAAATGTTTCGTC CAGCCAAECCCTGGGTGAGTTTCACCAGTTTGATTTAAACGTGGCCAATAGGACAACTT CCGCCCCCGTTTCACCAGGGCAAATATTAACGCAAGGCGACAAGGTGCTGATGCCG
Fig. 8A Patent Application Publication Feb. 5, 2015 Sheet 9 of 19 US 2015/0037370 A1
CGGCGACAGGCACAGCCGTGGAGGCTCCAGTCGGCAGAAGCTAATG AAACAACAGACGCGAGAGGGCAGGGCGGGGCGAAAGATCGGACCGGCACT AAAAGCCAGATAACAGAGCGATGCGCGCGATTTGCGGIATAAGAAATAAC GAATGAACCCGAAGAGCAAAAAGAGGTAGCTATGAAGCAGCGTATACAGTGAC AGGACAGCGACAGCTACAGGCCAAGGCAAATGATGICAAATCTCCGGCTGG AAGCACAACCAGCAGAAGAAGCCCGCGCTGCGTGCCGAACGCTGGAAAGCGGAAAA CAGGAAGGGAGGCGAGGCGCCCGGAGAAATGAACGGCCTTGCGACGAG AACAGGGGCGGGAAAIGCAGAAGGACACCTATAAAAGAGAGAGCCGTATCG CGGTGGAGACAGAGGATATATTGACACGCCCGGGCGACGGATGGGATCCCCC GGCCAGGCACGCGCGICAGAAAAGTCCCCGTGAACTTACCCGGGGGCAA CGGGGAGAAAGCGGCGCATGAGACCACCGATAGGCCAGTGTGCCGGTCCCGTATC GGGGAAGAAGGGCGACCAGCCACCGCGAAAATGACACAAAAACGCCATAACCTGA GTCGGGGAAATAAATGICAGGCTCCCTATACACAGCCAGTCGCAGGCGACCATA GTGACGGATAGIGIGITACAGTATTAGTAGICTGTTTTTTATGCAAAACAATT TAATAATGAAAACATTACGTCTCGITCAGCITICTGTACAAAGGGTT GAATCGCATGCGGTACCGGCGGAAGGIGAGCAAGGGCGAGGAGCTGTTCACCGGGGTGG TGCCCAICCTGGTCGAGCIGGACGGCGACCAAACGGCCACAAGTTCAGCGICTCCGGCGA GGCGAGGGCGATGCCACCTACGGCAAGCTGACCCIGAAGTTCATCTGCACCACCGGCA AG TCCCCGTCCCCTGGCCCACCCTCGTGACCACCCTGACC TACGGCCTGCAGTCCTTCAGCC GCTACCCCGACCACATGAAGCAGCACCACCTTCAAGTCCGCCATGCCCGAAGGCACGT CCAGGAGCGCACCATCTTCTTCAAGGACGACGGCAACTACAAGACCCGCGCCGAGGGAAG TTCGAGGGCGACACCCTGGTTGAACCGCACGAGCIGAAGGGCATCGACTTCAAGGAGGACG GCAA CATCCI'GGGGCACA AGCI'GGAGTACA ACACAACAGCCACAACGTCTATA ICAI'GGC CGACAAGCAGAAAACOGCACAAGGIGAACTTCAAGACCGCCACA ACACCAGGACGGC AGCGIGCAGCi"CGCCGACCACIACCAGCAGAACACCCCCATCGGCGACGGCCCCGGCGC IGCCCGACAACCACTACCTGAGCACCCAGCCGCCCTGAGCAAAGACCCCAA CGAGAAGCG CCATICACATGGICCIGCTGGAGTTCGIGACCGCCGCCGGGAT"CACTCTCGGCA'GGACGAG CTGACAAGTAAGCGGCCGCATACGGAGGGAACAATGAGCCGTAGCACAATGGTA
Fig. 8B Patent Application Publication Feb. 5, 2015 Sheet 10 of 19 US 2015/0037370 A1
CATCGGCAGCTAAGATCCAATGGCAAGGACCAAGTGCGGAACTGTGCAGCA GATCTTAGCGTGAGAGGTATTGTCCTCTGTCAGGAG TAGATAGTAGATGETCTTTTTAAA CTAAAAIGCTAACGTCCGAA. TCC, CATCGCAGCTA ATCCGACACAAAAGACAAAA GCTAGGTATGTGTACTA CATCTCCGTGCTAGAAACACATAGATAGGAAACACACCA: CAATAGTCATTGTAGCTTACTTATACACGCAGCAC TTCCCCTGACTGGCAGAGGC GCATTGAGAAAATCGATCT CAACAAGTTTAG TAGCACCCCTAGACCATACTAAG TCTCCTTCGTCTTTGGTGTAGGCATGTTGGACACAACGAGGTAAAACACAACACAAACAA GTGTCCAGCAAAGTAGTAGCTGCTCCAGTTCTCCCGGGGGATCCACTAGTECTAGAGCGGC CGGCCGCCACCGCGGTGGAGCTCCAGCTTTTGTCCCTTAGGAGGG'TAATGCGCGC GGCGTAACAGCCAAGCGCCGGGAAAG ACCGCECACAATCCACA CAACATACGAGCCGGAAGCATAAAGGTAAAGCCTGGGGTGCCTAATGAGTGAGC AACTC ACATTAATGCCTTC CGCT CACTCCCCCCTTCCAGCCGGAAACCGTCGTCCCACCTCC ATTAATGAATCGGCCAACGCGCGGGGAGAGGCGGTTTCCGTATTGGGCGCTCTCCGCTTC CTCGCT CACT CACTCGCT, GCCCCCCCCTTCCGCTCCCCCGACCGCTATCAGCCACCA AAGGCGGTAATACGGTTACCACAGAATCAGGGGATAACGCAGGAAAGAA CATGGAGCAA AAGGCCAGCAA AAGGCCAGGAACCGTAAAAAGGCCGCGTGCTGGCGTCCAAGGC CCGCCCCCCTGACGAGCAT CACAAAAATCGACGCCAAGICAGAGGGGCGAAACCCGACA GGACTATAAAGATACCAGGCGTCCCCCTGGAAGCCCCCG GCGCECTCCTGTCCGA CCCTGCCGCTTACCGGATACCGTCCGCCTTCTCCC, TCGGGAAGCGGGCGC TTC CA, TAGCTCACGCTGTAGGTATCT CACTTCGGTGTAGGTCGTCCCTCCAAGCTGGGCTGTGTG CACGAACCCCCCGTTCAGCCCGACCGCGCGCCTATCCGGTAACTATCGCTTGAGCCA ACCCGGTAAGACACGACTTATCGCCACTGGCAGCAGCCACGGTAACAGGATTAGCAGAGC GAGGTATGTAGGCGGTGCTACAGAGTTCTTGAAGGGGGCCTAACTACGGCTACACTAGA AGGACAGTATTTGGTATCTGCGCTCTGCTGAAGCCAGTACCTTCGGAAAAAGAGTGGTA GCTCTTGATCCGGCAAACAA ACCACCGCTGGAGCGGGGTTTTTGGCAAGCAGCA GATTACGCGCAGAAAAAAAGGA CTCAAGAAG ACCTTGATCTTCACGGGGTCTGAC GCTCAGTGGAACGAAAACTCACGTTAAGGGATTGGTCATGAGATTACAAAAAGGATC TCACCAGAICCITTAAAAAAAATGAAGTAAACAACEAAAGTATATATGAGTA AACTTGGTCTGACAGTTACCAATGCTTAATCAGTGAGGCACCTATCECAGC (GATCTGTCTA
Fig. 8C Patent Application Publication Feb. 5, 2015 Sheet 11 of 19 US 2015/0037370 A1
TTTCGTCATCCAAGTGCCGACCCCCGCGGTAGAAACTACGATACGGGAGGGCT TACCATCTGGCCCCAGTGCTG CAATGATACCGCGAGACCCACGCT CACCGGCTCCAGATT ATCAGCAATAAACCAGCCAGCCGGAAGGGCCGAGCCCAGAACTGGTCCTCCAACTTTATCC GCCICCATCCAGTCATAAG GCCGGGAAGC AGAGAAGAGCGCCAGTAAA GTTTCCCCAACC TriGriCCCA GCACAGCCACGTCC'C' CACCCTCC, CCTTGG AT GGCTICATICAGCTCCGGCCCA ACGATCAAGGCGAGACAEGATCCCCCA GTGGC AAAAAAGCGGTTAGCTCCTTCGGTCCCCGATCGGCAGAAGTAAGTIGGCCGCAGTGT TATCACTCATGGTTAGGCAGCACTGCATAATTCCTTACGTCAGCCATCCGTA AGAG CTTTTCGIGACTGGTGAGTACT CAACCAAGTCACGAGAAAGEGRATGCGGCGACCG AGTIGCTCTTGCCCGGCGT CAAACGGGATAATACCGCGCCACAAGCAGAACTTAAAAG TGCTCATCATGGAAAACGTTCTTCGGGGCGAAAACTCCAAGGATCTEACCGCTGTGAG ATCCAGTCGATGTAACCCACCGTG (CACCCAACTGACCAGCATCTEACTTCACC AGCGTTTCGGGTGAGCAAAAACAGGAAGGCAAAAIGCCGCAAAAAAGGGAATAAGGGCGA CACGGAAA GTGAA, ACCAACCCCiCAAAAGAAGCAATCAGGG TTATTGTCTCATGAGCCGATACAATTGAATGTATTAGAAAAATAAACAAATAGGGGT CCGCGCACATTTCCCCCAAAACGCCACCAAATTCTAACCGIAA; ATTTCTTAAAA' CCCCTTAAATTTTTGTAAAICAGCCATTTTTAACCAAAGGCCCAAATCGGCAAAAC CCITATAAATCAAAAGAATAGACCGAGATAGGGTTGAGTGGTCCAGTTTGGAACAAGA GT CCACTATTAAAGAACGGGACTCCAACGTCAAAGGGCGAAAAACCGCTACAGGGCGA TGGCCCACTACGTGAACCAT CACCCTAATCAAGTTTGGGGTCGAGGGCCGTAAAGCA CTAAATCGGAACCCAAAGGGAGCCCCCGATTTAGAGCTTGACGGGGAAAGCCGGCGAACG TGGCGAGAAAGGAAGGGAAGAAAGCGAAAGGAGCGGGCGCAGGGCGCTGGCAAGTGTAGC GGTCACGCTGCGCGAACCACCACACCCGCCGCGCTTAATGCGCCGCTACAGGGCGCGTCC CATICGCCATTCAGGCGCGCAACGGGGAAGGGCGATCGGGCGGGCCCTCGCTA TACGCCAGCTGGCGAAAGGGGGATGGCGCAAGGCGATTAAGEGGGTAACGCCAGGGET TTCCCAGTCACGACGGAAAACGACGGCCA GTGAGCGCGCGEAAFACGACCACAAG GCCGAATCGGTACGTACCCCCCCCCCCCCGAGGICGACGCTATCGATA (SEQ ID NO:8) Underlined in FCP promoter and terminator Boid as Gateway B fragment Italic c e GFP Fig. 8D Patent Application Publication Feb. 5, 2015 Sheet 12 of 19 US 2015/0037370 A1
AGCTGCGCTCCGAGAACCCCCAAAGCAACGGCTCCAACAAGAAG ACCGA CAACGGCGAGCATAG CAACACGTCCGT CTTGGAG TAGAATCACAE GTGGGATGAATA CACAGATGAATGACATTAAAAGCATGAACAGTTAGAGAGTAGGAGGAGAGATTGAATG GTAGCATEGCGATGETGETTEGGCAGCATAGAEGAGGGAEACCAAATGATGAAAG TTGAACCGCGTGAGCTCAGCGGACGATGACGAAAGTAGCCGATCAAAAICC TTGGAGAGTACAAGAGGATCAAAGAATCCAGTGGGGGCGATAACTCCAAGCTCGTTCCAA AGAGGCAAGGAGGTAGAAAC CACCCAGTTGA, GAAGAAGGAAGGCAGGGCGGGGCG AAAGCAGAGGCAACGAGGACAGACTTCCTGGGGTTGAGCAACGAATATECCAGAAGGA GAAGTTTAGAGACTGAACCCCACCACAATGACAAAGTACGTACGATTGATGTG GTTGGTTATGAATTCAAACTGAAGGGATTGGAGAAGACAGAAGTGAACGA ACACA TCTCCGATCATICAC CTCCACACGCAA CAACACGGACECCCGCGGCAGGTCC GTCGCCATCTCGTCCTGGTTGGCGGAGACGAGGAAAGCAA CGACAAGCACA AAAGGGAGCCAA CGAGAATGAAAAGAGCCCAAAGAAAGACAAATG ATTCCTCCGTGCAAACGCGCAAATAAACACCACGTCCATTA, AICCATACITICAGAGTA TCCAACAAGGTTGAACGACAGGTAGTGAACTAACGTATCCCCCCCGACTGGACCA CAACAAGGCGAACAAAICCATCAA CCTCTCATAAATTACECATEACCAAACCGAA CAACAAGTGTACAAAAAAGCAGTCTGTAAAGAAGIGCACCGTGTCATCTGACCA GCAGAACTAAAAGAGCTGCTGGAGGAAATAAAAAAGCGGCAGAGAAACAGAGGGGCTA CGGGTGTAGAAAAAGAAAAAACCACACTTTTCCAACGAGTGAAACAATTCACCGGAAG TAAGAGCGGGCGAAACCTGTAGCGGGAGATGAGACAGCGAATAAAGCAATTATCAAGAT TTGGAAGATAATTGAACTTAAAAGGATTAATTTCTTAGAAGATGACGAAATGCTAATT TTGAAAGAAGTATTGAAAAAGAGAAATTTAGATGAAGCAAGAGAGATTTCGAAGAA ATCAATTCCGAAGCGACAGTAAG CAAATGTCTCATACCTGAATGAGATATCC ACCGAGGGAGCTAAGAAAG TAGAAAGTCGTATTAATAAGGCAATCACATTCCGCCCTTCTG TTGAGGAGTTTCAGAAATTCAAGATTTGGTGAAAACGTACCGAAAACAAAGGTTATAGA GGATCTTCAACAAAAACAAAGAAACACAGAAGCE 'AGCEGCGACACGAAAACCATT CAACGTACACCGGAGTTGAAAGAACAGTTGAAGACAGCAAT AGAGGATTCTTACAAAACA GTCAAGGCAAA CCTTGACAGGCAGATGACGAGAATCTTAATCACGGAETACGTCCGGA
Fig. 9A Patent Application Publication Feb. 5, 2015 Sheet 13 of 19 US 2015/0037370 A1
TGAGGGAGAAGGTCGTTTACTTATAAAAAAGAGAAETTAACCAAAGAAAAIGCGGATE" TCTAGTCCCGAAGCGGCAAAAATTCAATTAGCGGAAACGGGATTACAATCGAGCGA AAAATGAAGGGATTGAGCCGAGTGTGGTTGGGGCATTAGTTTACAGCGATTGAGCTA TCACCCATTTGCAGAAGGTAATGGACGTATGGCGAGAGTCATAGAAATAAAATTT ACTT GATGCAGGTTATCCGGCATTTACCAAATTTAGTGACAGTTTGAACCCCAGATTATTCCTC AAA CGAA AGCATCAACTAAATCCGCAACGAGCAGGAAGGGTAGGAGTTTAAAAGA GTTGGCAAAAAAAGGAAGCAAGGAAGATAACGAGCAGAATTAGAAAAAACTGACCGCACT ICEACGGACITGACAGAAAGEGCGGTAGAAAA"TCGGCTGC''':GAGETTACCCAGCTTC GACAAAGGGGAACGCAIGCGGIACCGGCGGAATGGIGAGCAAGGGCGAGGAGC GTTCACCGGGGTGGTGCCCATCCTGGTCGAGCTGGACGGCGACGTAAACGGCCACAAGTT CAGCGTGICCGGCGAGGGCGAGGGCGAGCCACCTACGGCAAGCTGACCCTGAAGTTCAC TGCACCACCGGCAAGCTGCCCCTGCCCTGGCCCACCCTCGTGACCACCCTGACCTACGGCG TGCACTCCTTCACCCGCTACCCCCACCACATGAACCACCACCACTTCTTCAA CTCCGCCAT GCCCGAAGGCTACGTCCAGGACCGCACCAICTTCTTCAAGGACGACGGCAACTACAAG ACC CGCGCCGAGGTGAAGTTCGAGGGCGACACCCTGGTGAACCGCATCGAGCTGAAGGGCACG ACTI'CAAGGAGGACGGCAA CATCCTGGGGCACAAGCTGGAGTACAACTACAACAGCCACAA CGICTATATCATGGCCGACAAGCAGAAGAACGGCATCAAGGTGAACTICAAGATCCGCCAC AACATCGAGGACGGCAGCGTGCAGCTCGCCGACCACTACCAGCAGAA CACCCCCATCGGCG ACGGCCCCGIGCIGCTGCCCGACA ACCACTACCTGAGCACCCAGICCGCCCIGAGCAAAGA CCCCAA CGAGAAGCGCGATCACA TCGTCCTCCTGGAGTTCGTGACCGCCGCCGCGATCACT CTCCCCATCCACCACCTCTACAACTAAGCCCCCCCATACTCCA TCCT CAATCAATGACCC GTAGCACAATGGTTACATCGGCAGCTAAGATCCAATGGCAAG GACCAAGGCGGAACT TGTTTTGCTTAGCAGATCTTAGCGTGAGAGGTATTGTCCCGTCAGGAG TAGATAGTA GATGTTCTTTTTAAACTAAAATGCTAACTGTTCCGAATTCCTCATCGCAGCTAATCCGTAC ACAAAAGACAAAAIGCTAGGAGGACACACCCTGGCAGAAAGACAAGA TAGGAAACACACCATCAATAGTCATTGTAGCTTACTTATACTACGCATT, GCACTTCCC TGAGTGGCAGAGGCGCATTGAGAAAATCGATCTCAA CATAGTATGTAGCATCCCCTAG ICCATTACTTAAGTCTCCTTCGCTCG T G TAGGCATGT, GCACACAACCAGGAAAA CACAACACAAACAATGTGTCCAGCAAAGTAGTAGCGCTCCAGEECTCCCGGGGGACCAC
Fig. 9B Patent Application Publication Feb. 5, 2015 Sheet 14 of 19 US 2015/0037370 A1
TAGTTCTAGAGCGGCCGGCCGCCACCGCGGGGAGCTCCAGCTGTCCCTAGGAG GGTTAAIGCGCGCIGGCGTAAICATGGCAAGCGICCIGIGIGAAAIGITATCC GCTCACAATTCCACACAACATACGAGCCGGAAGCATAAA GTGAAAGCCGGGGTGCCTAA TGAGTGAGC'AACCACATAATGCGGCGCCAC, GCCCGCCCAGCGGGAAAC TGTCGTGCCAGCTGCATTAATGAATCGGCCAA CGCGCGGGGAGAGGCGGTTTGCGTATTGG GCGCTCTTCCGCTTCCTCGCTCACTGACCGCTGCGCTCGGCGTTCGGCGCGGCGAGCG GTATCAGCT CACT CAAAGGCGGTAATACGGACCACAGAA CAGGGGATAACGCAGGAA AGA ACATGTGAGCAAAAGGCCAGCAAAAGGCCAGGAACCGTAAAAAGGCCGCGTTGCGGC GTTTTTCCATAGGCTCCGCCCCCCTGACGAGCACACAAAAATCGACGC,CAAGICAGAGG TGGCGAAACCCGACAGGACTATAAAGATACCAGGCGTTTCCCCCTGGAAGCTCCCTCGGC (GCICICCGCC(ACCCGCCGC'ACCGGAEACC'GCCGCCERCBCCCCGGGAAG CGTGGCGCTTC CATAGCTCACGCGAGGACCAGTCGGGTAGGCGTCGCTCC AAGCTGGGCTGTGTGCAC GAACCCCCCGTCAGCCCGACCGCGCGCCTEACCGGTAACT ATCGTCTGAGCCAACCCGGTAAGACA CGACTTATCGCCACGGCAGCAGCCA CTGGAA CAGGATTAGCAGAGCGAGGTATGTAGGCGGGCACAGAGTECTGAAGTGGGGCCTAAC TACGGCACACTAGAAGGACA GTATTGGTACGCGCC GCTGAAGCCA GT ACCCG GAAAAAGAGTTGGTAGCTCTTGACCGGCAAACAAACCACCGCTGGTAGCGGGGTTTTTT TGTTTGCAAGCAGCAGATTACGCGCAGAAAAAAAGGACCAAGAAGA"CCT"'GACT TCTACGGGGT CGACGCTCAGTGGAA CGAAAACTCACGTAAGGGATTGGCATGAGAT TATCAAAAAGGATCT CACCTAGATCCTTAAATAAAAAGAAGAAATCAATCTA AAGTATATATGAGTAAACTTGGTCTGACAGACCAATGCTAATCAGTGAGGCACCTAC TCAGCGATCTGTCTATTCGTTCATCCATAGTTGCCTGACTCCCCGTCGTGTAGATAACTA CGATACGGGAGGGCTTACCATCGGCCCCAGGCTG CAATGAACCGCGAGACCCACGCC ACCGGCTCCAGATTTATCAGCAATAAACCAGCCAGCCGGAAGGGCCGAGCGCAGAAGTGGT CCTGCAACTTACCGCCCCACCAGC'AAA' GGCCGGGAAGC AGAGAA GTA GTTCGCCAGTTAATAGTTTGCGCAACGTTGTTGCCATTGCTACAGGCATCGTGGTGTCACG CTCG TCGTTTGGTATGGCTTCATTCAGCCCGGTTCCCAACGATCAAGGCGAGTTACAGA TCCCCCAGTIGGCAAAAAAGCCGITAGCCCICCGTCCCCGACGSIGCACAAGTA AGTTGGCCGCAGIGITATCACTCATGGITATGGCAGCACTGCATAATTCTCACGTCAT Fig. 9C Patent Application Publication Feb. 5, 2015 Sheet 15 of 19 US 2015/0037370 A1
GCCATCCGTAAGATGCTTTCTGTGACTGGTGAGTACT CAACCAAGECATCGAGAATAG TGTATGCGGCGACCGAGTTGCTCTTGCCCGGCGTCAAEACGGGAAATACCGCGCCACAFA GCAGAACTTAAAAGTGCCATCATTGGAAAACGTCTTCGGGGCGAAAACTCTCAAG GAT CTTACCGCTGTTCAGATCCAGTTCGATGT AACCCACTCCTCCACCCAACTGACTTCAGCA TCTTTT ACTTCACCAGCGTTTCTGGGTGAGCAAAAACAGGAAGGCAAAATGCCGCAAAAA AGGGAATAAGGGCGACACGGAAATGTTGAATAC CATACTCTCCTTTTT CAATAATG AAGCATTTATCAGGGTTATGTCCATGACCGGATACAATTGAATGTATTAGAAAAAT AAACAAATAGGGGTTCCGCGCACATTCCCCGAAAAGTGCCACCAAATTGTAAGCGTAA TATTTTGITAAAATCGCGTTAAATTTTCTTAAACACC CATTT AACCAAAGGCC GAAATCGGCAAAAICCCTATAAATCAAAAGAATAGACCGAGATAGGGTGAGTGTGTTC CAGTTTGGAACAAGAGCCACTATAAAGAACGGGACTCCAACGTCAAAGGGCGAAAAAC CGTCTATCAGGGCGATGGCCCACTACGTGAACCAT CACCCTAATCAAGTTTGGGGCG AGGGCCGTAAA GCACTAAATCGGAACCCAAAGGGAGCCCCCGATTTAGAGCTTGACGGG GAAAGCCGGCGAA CGTGGCGAGAAAGGAAGGGAAGAAAGCGAAAGGAGCGGGCGCTAGGGC GCTGGCAAGIGAGCGGTCACGCGCGCGTAACCACCACACCCGCCGCGCTA AGCGCCG CACAGGGCGCGTCCCATCGCCATTCAGGCGCGCAAC GTGGGAAGGGCGATCGGGC GGGCCTCTCGCTATTACGCCAGCTGGCGAAAGGGGGATGGCTGCAAGGCGATTAAGTG GGTAACGCCAGGGTTTTCCCAGTCACGA CGTTGAAAACGACGGCCA GTGAGCGCGCGTAA TACGACT CACTATAGGGCGAATGGGTAC GTACCGGGCCCCCCCCGAGGTCGACGGATC GATA (SEC ID NO: 9)
Underlined - FCP promoter and terminator Bold as Gateway B fragment Doible Underlined - DR2 domain with start codon added Italic -e eGFP
Fig. 9D Patent Application Publication Feb. 5, 2015 Sheet 16 of 19 US 2015/0037370 A1
AGCTTGCGCTTTCCGAGAACTCCCCATAAGTCAACGGCTCCAACAAGAATGACCGA CAACGGCGAGCATAGCAACACGTCCGT CTTAGGAGTACAATCATCAGTGGGAGAATA CACAGATGAATGACAAAAAGCATGAACA GTAGAGAG TAGGAGGTAGAGATTGATAG GTAG CATTGCGAGTGTGGCAGCAAGAGAGGGATACCAAATGAGAAAG TTGAATCTCGCGTTTGAGCCAGCGGTACGAGA CGAAAGAGCC GATCAAAAICC TTGGAGAGTACAAGAGGATCAAAGAATCCAGTGGGGGCGATAACTCCAAGCTCGTCCAA AGAGGCAATGGAGGTAGAAACT CACCCA GTGAGAAGAAGGAAGGCAGGGCGGGGCG AAAGCAGAGGCAACGAGGACAGACTCCGGGGGAGCA ACGAATATCCAGAAGGA GAAGTTTAGAGAGTGAACCGCTACCTACAATGACAAAGA CGACGATTTGATGTG GTTGGTTATGAATTCAAACTGTAAGTTGGATTGGAGAAGATCAGAAGTGAACGAACACA CTTTCCGATCATTCACCTCCACACTCCAACAACACCGTACTCTCCGCC, GCAGCCTCT GTCGCCATCTCTGCCTGTGGGCTGGAGACGAGGAA AGCAA CGACAAGTECACA AAAGGGAGTTCCTTAACGAGATAGTTTTTAAAAGAGTCCCAAT AGAAAGACAAATG ATTCCTCCGGCA AACGC (CAAATAAACACCACGTCCAAATCCAACICAGAGA TCCAACAAGTGTTGAAGGACAGGTAGTTGAAGTAACGEATCTCCCCCCGACTGGATCCA CAACAAGGCGAACAAATCCATCAACCCCAAAAITATCGATTEACCAAACCGAA CAACAAGTGTACAAAAAAGCATGTCTGTGAACGAGGTGGCTCCACTCTCTTC:GTGCCA GCTGAGCTCAAGGATGCGCTGGAGGAAACAAGAAGGCTGCTGAGAAGTCGAGGGAGCTA CCGGAGTGGAGAAGGAGAAGACCACCCTCTCCAACGGGAAGCAATTCTTCACCGGATC TAAGTCTGGAGCTAAGCCAGGGCTGGAGAGAGACCGCTAACAAGGTGAACTACCAAGAT CTCGAGGAIA ACCCAA CCCAAGGGACECAC CTCCGAGGAEGACGEA ACGC AACT TCGAGTCTAACGGCCAAGAACGAGAAGTCCCGATGAGGCTCGTGAGATCTCTAAGAA GTCTATCCCAGAGGCACCGGAAGCAAAGCCACCCCCAGAGTECGATGATAC CTC ACCGAGGGAGCTAAGAAGGTGGAG CTCGTATCAACAAGGCTATCAC CTCCGTCCATCTG TGGAGGAGTTCTCTGAGATCCAAGATCCGTGAAGACCCCCCAAAGACCAAGGGATCGA GGATCTCCACCAAGACCAACGAGAT CACCGAGGCTCTCGCGCTACCCTAAGACCATC CAACGTACCCCAGAGCTCAAGGAGCAA CTCAAGACCGCTATCGAGGATTTCCTCCAAAACT CT CAAGGAAAGCCACCACCGTG (CAAATGATCGAGA ACCCAACCACGG ACTCCGTCCAGA
Fig. 10A Patent Application Publication Feb. 5, 2015 Sheet 17 of 19 US 2015/0037370 A1
TGAGGGAGAGGGACGTCTCCTCTACAAGAAGGAGA ACCT CACCAAGGAGAACGCTGTGTTC TCTTCTCCAGAGGCGCTAAGACCAACTCGCTGAGACCGGGATTCACAACCG (CTA AGAACGAGGGAATCGAGCCACGTGGTGGGAGCCCGGACCAA CGCTCATCGCTA CCACCCATTCGCTGAGGGAAACGGACGTATGGCCGTGTGACGGAACAAGATCCTCCTC GATGCT(GGAACCCACCTTCACCAAGTCTCGAGAGTTCGAGCCACAAATCACCCAC AAA CCAAGGCTIC ACCAAGC'GCACCCTCBGAGGGGGGGAGECCT CAAGGA GCTCGCTAAGAAGGGATCTA AGGAGGATAACGAGCAAAACCiCGAGAAGACCGATCGTACC TCTACCGATCTC CACCCAGCGCGGGAGAACTCGCGCCCTC.ACCCAGCTIC GTACAAAGTGGTGAACGCAGCGGTACCGGCGGAATGGTGAGCAAGGGCGAGGAGCT GTTCACCGGGGGGTGCCCAICCTGGCGAGCTGGACGGCGACGTAAACGGCCACAAGTEC AGCGTCTCCGGCGAGGGCGAGGGCGATGCCACC TACGGCAAGCCACCCTGAACTTCATC GCACCACCGGCAAGCT'GCCCGTGFCCCGGCCCACCCTCGTGACCACCCTGACCTACGGCGT GCAGICCITCAGCCGCTACCCCGACCACATGAAGCAGCACGACITCCAAGTCCGCCATG CCCGAA (GCACGTCCAGO-AGCCCACCACTCTCCAA (ACCACCCAA CACAAGACCC GCGCCGAGGT"GAAGTTCGAGGGCGACACCCIGGTGAACCGCATCGAGCTGAACGGCATCGA CTTCAAGGAGGACGGCAA CATCCTGGGGCACAAGCTGGAGTACAACTACAACAGCCACAAC GT"CIATATCATGGCCGACAAGCAGAAGAACGGCATCAAGGTGAACTTCAAGATCCGCCACA ACA TCGAGGACGGCAGCGTGCAGCTCGCCGACCACTACCAGCAGAACACCCCCATCGGCGA CGGCCCCGTGCTGCTGCCCGACAACCACTACCTGAGCACCCAGCCGCCCTGAGCAA AGAC CCCAA CGAGAAGCGCGATCACAIGGTCCIGCTGGAGTTCGTGACCGCCGCCGGGATCACTC TCGGCATGGACGAGCTGTACAAGTAAGCGGCCGCATACGGATTGGTGAACAATGAGCCG TAGCACAATGGTTACATCGGCTAGCAAGATCCAAGGCAAGGACCAAGBGCTGGAACT GTTTGCTTAG CAGATCTTAGCGTGAGAGGTATTGTCCTCTGECAGGAGTAGAAGTAG ATGTTCTTTTTAAACAAAATGCTAACTGTTCCGAATTCCTCATCGCAGCTAATCCGTACA TCAAAAGACAAAAIGCTAGGTATGTGTACTACA CTCCTGTTGCEAGATAAGACAATGAT AGGAAACACACCACAATAGTCATTGTAGC ACTATACACGCATEGCACTCCCC TGAGGGCAGAGGCGCATTGAGAAAATCGATCTCA ACATAGTTATGTAGCATCCCCTAGA ICCATACTTAAGCTCCTCGCGGGTAGGCATGGGACACAACGAGGAAAAC ACAACACAAACAATGTGTCCAGCA AAG TAGAGCGC'CCAGTECTCCCGGGGGACCACT
Fig. 10B Patent Application Publication Feb. 5, 2015 Sheet 18 of 19 US 2015/0037370 A1
AGTCTAGACCGGCCGGCCGCCACCGCCGTGGAGCTCCAGCTTT G"'CCCTTAGIGAGG GT AAIGCGCGCTTGGCGTAATCATCGCAAGCIGICCIGGiGAAAIC AICCC CT CACAATTCCACACAACATACGAGCCGGAAGCAAAAGTGTAAAGCCTGGGGTGCCTAA GAGGAGCTAACCACATTAATGCGTTGCGCTCACTGCCCGCTTTCCAGTCGGGAAACCT GTCGTGCCAGCTGCATAATGAATCGGCCAA CGCGCGGGGAGAGGCGGTTTGCGTATTGGG CGCCTTCCGCTCCTCGCT CACTCACTCGCTGCGCTCGGTCGTTCGGCTGCGGCGAGCGC TATCAGCTCACTCAAAGGCGGAATACGGTATCCACAGAATCAGGGGATAACGCAGGAAA GAACATGTGAGCAAAAGGCCAGCAAAAGGCCAGGAACCGTAAAAAGGCCGCGTTGCTGGCG TTTTCCAAGGCTCCGCCCCCCTGACGAGCATCACAAAAATCGA, CGCTCAAGTCAGAGG GGCGAAACCCGACAGGACTATAAAGATACCAGGCGTTTCCCCCTGGAAGCTCCCTCGTGCG CTCCCTGTCCGACCCGCCGCTTACCGGAACCGCCGCCTTCTCCCTCGGGAAGC GTGGCGCTTTCTCATAGCTCACGCTGTAGGATCTCAGTTCGGTGTAGGTCGTTCGCTCCA AGCGGGCGIGGCACGAACCCCCCGICAGCCCGACCGCGCGCCEEACCGGTAACA TCGCTTGAGTCCAACCCGGTAAGACA CGACTTACGCCACTGGCAGCAGCCACTGGTAAC ACGATAGCACAGCGAGC AIGAGGCGCGCTACAGAGCE GAAG (GGGCCEAAC ACCGCTACACTAGAAGCACAGATTTCCTACTGCGCTCTCCTGAACCCACTTACCTTCCG AAAAAGAGGGAGCCTGACCGGCAAACAAACCACCGCGGAGCCGGGTTT GTTGCAAGCAGCAGATTACGCGCAGAAAAAAAGGATCCAAGAAGATCCTTGACT CTACGGGGTCTGACGCTCAGTGGAACGAAAACTCACGTTAAGGGATTTGGTCATGAGAT ATCAAAAAGGATCTTCACCTAGATCCTTTTAAATTAAAAATGAAGTFTAAATCAATCTAA AGTATATATGAGAAACGGCTGACAGACCAAIGCTAACAGGAGGCACCAC CAGCGATCTGT CATTTCGTTCATCCATAGGCCTGACTCCCCGTCGTGTAGATAACTAC GATACGGGAGGGCTTACCATCGGCCCCAGGCGCAATGATACCGCGAGACCCACGCCA CCGGCTCCAGATTATCAGCAATAAACCAGCCAGCCGGAAGGGCCGAGCGCAGAAGTGGTC CTGCAACTTATCCGCCTCCACCAGC AAA GTTGCCGGGAAGCTAGAGTAAGAG TTCGCCAGTTAAAGGCGCAACGGGCCAGCTACAGGCACGTGGGCACGC CGCGTTTGGTAGGCCACAGCCCGGCCCAA CGACAAGGCGAG ACAGA CCCCCAT G T G T GCAAAAAAGCGGTAGCTCCITCGGCCICCGATCGIGICAGAACTAA
Fig. 10C Patent Application Publication Feb. 5, 2015 Sheet 19 of 19 US 2015/0037370 A1
GTIGGCCGCAGGITATCACTCATGGTTATGGCAGCAC GCATAATTCCTTACTG: CATG CCATCCGTAAGATGCTTTCGGACGGTGAGTACCAACCAAGICATICTGAGAATAG TATGCGGCGACCGAGTGCCGCCCGGCGCAAACGGGAAAACCGCGCCACAAG CAGAACTTTAAAAG GCTCATCATTGGAAAACGTCTCGGGGCGAAAACTCTCAAGGATC TTACCGCTGTTGAGATCCAGTTCGATGTAACCCACCGTGCACCCAACTGATCTCAGCA CTTTTACTTTCACCAGCGTTCGGGTGAGCAAAAACAGGAAGGCAAAAGCCGCAAAAAA GGGAATAAGGGCGACACGGAAATGTTGAATAC CATACTCTCCTT CAATAATGA AGCATTTATCAGGGATTGICCATGAGCGGAACAATGAAGAT AGAAAAAA AACAAATAGGGGTTCCGCGCACATTTCCCCGAAAAGGCCACCTAAATTGTAAGCGTAA ATTTTGTAAAATCGCGAAATTGAAATCAGCCATTTTAACCAAAGGCCG AAATCGGCAAAATCCCTTAAAATCAAAAGAAAGACCGAGATAGGGTTGAGGTTGTTCC AGTTTGGAACAAGAGCCACTATTAAAGAACGGGA CTCCAACGTCAAAGGGCGAAAAACC GT CTATCAGGGCGAGGCCCACACGTGAACCAT CACCCAATCAAGGGGGTCGA GGTGCCGTAAAGCACTAAACGGAACCCTAAAGGGAGCCCCCGATTAGAGCTGACGGGG AAAGCCGGCGAACGGGCGAGAAAGGAAGGGAAGAAAGCGAAAGGAGCGGGCGCTAGGGCG CTGGCAAGTGTAGCGGTCACGCGCGCGTAACCACCACACCCGCCGCGCTAATGCGCCGC TACAGGGCGCGTCCCATICGCCATTCAGGCGCGCAACGGGGAAGGGCGATCGGGCG GGCCTCTTCGCTATTACGCCAGCTGGCGAAAGGGGGATCTCCTCCAAGGCGATTAAGTTGG GTAACGCCAGGGTTTCCCAGTCACGACGTTGAAAACGACGGCCAGTGAGCGCGCGAAT ACGACCACTATAGGGCGAATGGGTACGTACCGGGCCCCCCCTCGAGGCGACGGACG ATA (SEQ ID NO: 10)
Underlined as FCP promoter and terminator Bold = GWB fragment DCuble Urderlined - DR2 do?lain with Start COdori added (COdon biased for expression in a diatom) Italic - eGFP
Fig. 10D US 2015/0037370 A1 Feb. 5, 2015
DATOM-BASEDVACCNES sequence identity, to a frustulin protein of SEQID NO:6 or SEQ ID NO:7. In some embodiments, the antigen is CROSS-REFERENCE TO RELATED expressed under the control of a promoter endogenous to the APPLICATIONS diatom. In some embodiments, the promoter endogenous to the diatom is an rpL41 promoter or a fucoxanthin chlorophyll 0001. This application is a U.S. national phase under 35 binding protein (FCP) promoter. U.S.C. S371 of Intl. Appl. No. PCT/US2012/062112, filed on 0007. In a related aspect, the invention provides expres Oct. 26, 2012, which claims the benefit under 35 U.S.C. sion cassettes capable of and Suitable for expressing recom S119(e) of U.S. Provisional Application No. 61/553,139, binant antigenic peptides and proteins in a diatom host cell. In filed on Oct. 28, 2011, which are hereby incorporated herein Some embodiments, the expression cassettes comprise: by reference in their entirety for all purposes. 0008 i) a promoter selected from the group consisting of fucoxanthin chlorophyll binding protein (FCP) promoter and STATEMENT OF GOVERNMENTAL SUPPORT ribosomal protein L41 (rpL41) promoter, the promoter oper 0002 This invention was made with government support ably linked to: under Grant No. FA9550-08-1-0178, awarded by the Air 0009 ii) a nucleic acid encoding a diatom cell surface Force Office of Scientific Research (AFOSR), and Grant Nos. polypeptide selected from a frustulin and p150 cell surface 2011-67015-30177 and 2012-67015-301.97, awarded by The protein; the nucleic acid encoding the diatom cell Surface National Institute of Food and Agriculture/USDA. The gov polypeptide operably linked to; and ernment has certain rights in the invention. 0010 iii) a nucleic acid encoding an antigen heterologous to a diatom. The expression cassette drives or promotes FIELD expression of the antigen in the diatom, in varying embodi 0003. The present invention relates to diatom-based vac ments in the membrane system of or to the surface of the cines. diatom. Embodiments of the antigens are as described below and herein. In varying embodiments, the fucoxanthin chloro BACKGROUND phyll binding protein (FCP) promoter is a nucleic acid having at least at least 90% sequence identity, e.g., at least 91%, 92%, 0004 Killed pathogen vaccines are expensive, require 93%, 94%, 95%, 96%, 97%, 98%, 99% or 100% sequence additional adjuvants and two or more doses and often have identity, to SEQ ID NO:1. In varying embodiments, the side effects. Alternatively, live modified or recombinant nucleic acid encoding a diatom cell Surface polypeptide attenuated bacterial or virus vectored vaccines may revert to encodes e-frustulin or a frustulin polypeptide having at least virulence, interfere with the normal flora or cause problems at least 90% sequence identity, e.g., at least 91%, 92%, 93%, with environmental containment. 94%. 95%, 96%, 97%, 98%, 99% or 100% sequence identity, to SEQID NO:6 or SEQID NO:7. SUMMARY 0011. The invention further provides plasmids or vectors 0005. In one aspect, the invention provides a diatom or comprising the expression cassettes. In varying embodi population of diatoms, comprising an antigen, wherein the ments, the plasmid or vector comprises a GatewayTM back antigen is heterologous to the diatom. In some embodiments, bone. In varying embodiments, the plasmid or vector com the antigen is mixed with or attached to the diatom. In some prises a plasmid comprising a nucleic acid sequence having at embodiments, the antigen is attached to the Surface of the least 90% sequence identity, e.g., at least 91%, 92%, 93%, diatom. In some embodiments, the antigen is in the cytoplasm 94%. 95%, 96%, 97%, 98%, 99% or 100% sequence identity, of the diatom. In some embodiments, the antigen is in the to a plasmid of SEQID NOS:8, 9 or 10. In further aspects, the membrane system of the diatom. In some embodiments, the invention provides diatom host cells comprising the expres antigen is in the plasma membrane of the diatom. In some sion cassettes and/or plasmids or vectors. Embodiments of embodiments, the antigen is a peptide or polypeptide com the diatom host cells are as described herein. prising one or more immunostimulatory epitopes. 0012. In some embodiments, the diatom is an intact cellor 0006. In some embodiments, the diatom comprises a population of intact cells. In some embodiments, the diatom nucleic acid encoding the antigen and expresses the antigen. is a live cell or population of live cells. In some embodiments In some embodiments, the antigen is expressed and/or trans the diatom or population of diatoms are intact but dead cells. lated in the cytoplasm of the diatom. In some embodiments, In some embodiments the diatom or population of diatoms the antigen is expressed and or trafficked to the Surface or are formulated as microparticles or nanoparticles. attached to the Surface of the diatom. In some embodiments, 0013. In some embodiments, the antigen induces and/or the antigen is expressed and/or trafficked to the cell mem elicits an immune response against the antigen in an animal. brane system of the diatom. In some embodiments, the anti Generally, the immune response against the antigen is pro gen is expressed and/or trafficked to the plasma membrane of tective, e.g., prevents or treats a disease in the animal. In the diatom. In some embodiments, the antigen is expressed as various embodiments, the animal is a mammal, a bony fish a fusion protein with a surface-expressed polypeptide endog (e.g., Salmoniformes, Salmonoidei, Salmonidae), a shrimp or enous to the diatom. In some embodiments, the Surface-ex prawn (e.g., Penaeoidea, Penaeidae, Litopenaeus), a mollusk pressed polypeptide endogenous to the diatom is a diatom cell (e.g., Mollusca, Bivalvia) or an avian (e.g., Ayes, Galliformes Surface polypeptide, e.g., frustulin or p150 cell Surface pro (a fowl), Phasianidae: Phasianinae; Gallus). In some embodi tein. In some embodiments, the antigen is expressed as a ments, the antigen is an immunostimulatory polypeptide or fusion protein with e-frustulin. In some embodiments, the peptide. In some embodiments, the antigen is a viral antigen antigen is expressed as a fusion protein with a frustulin pro (e.g., influenza, Varicella Zoster, herpes, HIV, respiratory Syn tein having at least 90% sequence identity, e.g., at least 91%, cytial virus (RSV), papilloma, Hepatitis A, Hepatitis B. 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99% or 100% Hepatitis C), a bacterial antigen (e.g., Vibrio, Salmonella, E. US 2015/0037370 A1 Feb. 5, 2015 coli, Shigella, Campylobacter; Yersinia, Histophilus, Staphy ments, the antigen comprises the IbpA DR2 domain and lococcus, Streptococcus, Legionella), a fungal antigen (e.g., BRSV N protein, e.g., expressed as separate antigens or as a Cryptococcus, Candida) or a parasitic antigen (e.g., Plasmo fusion protein. In varying embodiments, the antigen com dium, Trypanosoma). prises the IbpADR2 domain and one or more BRSV antigens 0014. In some embodiments, the animal is a mammal. In selected from N protein, F protein and G protein. Some embodiments, the mammal is a human or a non-human 0018. In some embodiments, the antigen induces and/or primate. In some embodiments, the mammal is a domesti elicits a protective immune response in the mammal against cated mammal (e.g., feline or canine) In some embodiments, bovine respiratory syncytial virus (BRSV), parainfluenza-3 the mammal is an agricultural mammal (e.g., bovine, ovine, (PI), bovine viral diarrhea virus (BVDV) or bovine herpes porcine, equine). In some embodiments, the animal is a labo virus 1 (BHV-1). In some embodiments, the antigen com ratory animal (e.g. mouse, rat, rabbit, hamster, guinea pig). In prises BRSV N, F and/or G proteins. In some embodiments, varying embodiments, the animal is a marine animal, e.g., a the antigen induces and/or elicits a protective immune fish, a crustacean, a mollusk. In some embodiments, the ani response in the mammal against infection of a bacterium mal is a bony fish (e.g., Salmoniformes, Salmonoidei, Salmo selected from the group consisting of Mannheimia nidae), e.g., salmon, trout, catfish, whitefish, tilapia, bass, haemolytica, Pasteurella multocida, Mycoplasma bovis, char, or another species of farmed fish. In some embodiments, Vibrio parahaemolyticus and Legionella pneumophila. the animal is a crustacean, e.g., a shrimp or prawn (e.g., 0019. In some embodiments, the antigen induces and/or Penaeoidea, Penaeidae, Litopenaeus), e.g., a penaeid shrimp, elicits a protective immune response in the mammal against a e.g., white shrimp, pink shrimp, pinkspotted shrimp, brown Vibrio cholerae infection. In some embodiments, the antigen shrimp, blue shrimp, crystal shrimp, black tiger shrimp. In comprises one or more epitopes of Cholera Toxin B (CTB) or Some embodiments, the animal is a mollusk orbivalve, e.g., a Cholera Toxin A (CTA). In some embodiments, the antigen clam, an oyster. In some embodiments, the animal is an avian, comprises one or more epitopes of V. cholerae colonization e.g., a fowl, e.g., a turkey, a chicken. factors TcpA. TcpF and CBP-A. In some embodiments, the 0015. In some embodiments, the antigen is a viral antigen antigen comprises a Tcp-A2-CTB chimera. In some embodi (e.g., influenza, varicella Zoster, herpes, HIV. RSV, papil ments, the antigen comprises CTB and TcpA, e.g., expressed loma, Hepatitis A, Hepatitis B. Hepatitis C). In some embodi separately or as a fusion protein. In some embodiments, the ments, the antigen induces and/or elicits a protective immune antigen comprises CTB and TcpF, e.g., expressed separately response in the animal against a viral antigen. or as a fusion protein. In some embodiments, the antigen 0016. In some embodiments, the antigen is a bacterial comprises toxin co-regulated pilus (TCP), TcpA. TcpF and antigen (e.g., Vibrio, Salmonella, E. coli, Shigella, Campylo the chitin binding product (CBP-A), e.g., expressed sepa bacter, Yersinia, Histophilus, Staphylococcus, Streptococcus, rately or as a fusion protein. In some embodiments, the anti Legionella). In some embodiments, the antigen induces and/ gen comprises a combination of the above V. cholera anti or elicits a protective immune response in the animal against genS. a bacterial antigen. In some embodiments, the antigen 0020. In some embodiments, the antigen induces and/or induces and/or elicits a protective immune response in the elicits a protective immune response in the animal against an animal against a bacterial pathogen selected from the group enteric pathogen (e.g., Salmonella, Shigella, Campylobacter, consisting of Vibrio, Salmonella, Shigella, Campylobacter; Yersinia, Escherichia coli, Giardia, Entamoeba histolytica). Yersinia, Histophilus, Staphylococcus, Streptococcus, In some embodiments, the antigen induces and/or elicits a Legionella, Listonella, Moritella, Aeromonas, Piscirickett protective immune response in the animal againstan infection sia, Flavobacterium, Edwardsiella, Renibacterium, Lacto of an enteric pathogen selected from the group consisting of coccus and Photobacterium. Bacterial pathogens to marine Salmonella typhimurium, Yersinia enterocolitica, Shigella animals, e.g., fish, include without limitation Vibrio spp., sonnei, Shigella flexneri, Campylobacter jejuni, Entamoeba Listonella anguillarum, Vibrio harveyi, Vibrio Salmonicida, histolytica, or Giardia spp. Moritella viscosa, Aeromonas Salmonicida Subsp. salmoni 0021. In some embodiments, the immunogenic protein cida, Aeromonas salmonicida, Yersinia ruckeri, Piscirickett expressed on the surface of or with the diatom may be used for sia salmonis, Flavobacterium branchiophilum, Flavobacte oral Vaccination of marine animals, e.g., fish, crustaceans rium psychrophilum, Edwardsiella ictaluri, Edwardsiella (e.g., shrimp or prawns), or mollusks (e.g., bivalves). For tarda, Renibacterium salmoninarum, Lactococcus garvieae, example, shrimp populations are susceptible to a number of Photobacterium damsela subspecies piscicida, Streptococ viral diseases, including without limitation, infectious hypo cus iniae, Streptococcus phocae, and Flavobacterium colum dermal and hematopoietic necrosis virus (IHHNV), yellow FOFe. head virus (YHV), taura syndrome virus (TSV), infectious 0017. In some embodiments, the antigen elicits and/or myonecrosis (IMN), and white spot syndrome virus (WSSV). induces a protective immune response in the mammal against Fish are Susceptible to a number of viral diseases, including a Histophilus somni infection. In some embodiments, the without limitation, infectious pancreatic necrosis (IPNV), antigen comprises one or more epitopes of H. Somnivirulence pancreas disease (PDV), infectious salmon anemia (ISAV), factor Immunoglobulin Binding Protein A (IbpA). In some infectious hematopoietic necrosis (VHSV), viral nervous embodiments, the antigen comprises the IbpA DR2 domain. necrosis, iridoviral disease (RSIV), channel catfish virus dis In varying embodimens, the IbpADR2 domain is encoded by ease (CCV), Spring viremia of carp (SVCV), and grass carp a nucleic acid sequence having at least 90% sequence iden hemorrhage disease (GCHDV). tity, e.g., at least 91%, 92%, 93%, 94%, 95%, 96%, 97%, 0022. In varying embodiments, the antigen elicits and/or 98%, 99% or 100% sequence identity, to a nucleic acid of induces a protective immune response against white spot SEQ ID NO:4. In varying embodiments, the antigen com syndrome virus (WSSV). In varying embodiments, the prises the IbpA DR2 domain and Ibp A5, e.g., expressed as WSSV antigen is one or both of VP19 and VP466 proteins. In separate antigens or as a fusion protein. In varying embodi varying embodiments, the VP19 protein comprises an amino US 2015/0037370 A1 Feb. 5, 2015
acid sequence having at least 90% sequence identity, e.g., at Siosira allenii, Thalassiosira angulate, Thalassiosira least 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99% or anguste-lineata, Thalassiosira Antarctica, Thalassiosira ant 100% sequence identity, to SEQ ID NO: 11. In varying arctica var. borealis, Thalassiosira af Antarctica, Thalassio embodiments, the VP 19 protein is encoded by a nucleic acid Sira concaviuscula, Thalassiosira curviseriata, Thalassio sequence having at least 90% sequence identity, e.g., at least Sira delicatula, Thalassiosira eccentric, Thalassiosira 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99% or 100% gessneri, Thalassiosira gravida, Thalassiosira guillardii, sequence identity, to SEQ ID NO: 12. In varying embodi Thalassiosira hendeyi, Thalassiosira lundiana, Thalassiosira ments, the VP466 protein comprises an amino acid sequence mala, Thalassiosira mediterranea, Thalassiosira minima, having at least 90% sequence identity, e.g., at least 91%, 92%, Thalassiosira minuscula, Thalassiosira nodulolineata, 93%, 94%, 95%, 96%, 97%, 98%, 99% or 100% sequence Thalassiosira nordenskioeldii, Thalassiosira Oceanica, identity, to SEQ ID NO: 13. In varying embodiments, the Thalassiosira pacifica, Thalassiosira profilinda, Thalassio VP466 protein is encoded by a nucleic acid sequence having Sira proschkinae, Thalassiosira pseudonana, Thalassiosira at least 90% sequence identity, e.g., at least 91%, 92%, 93%, punctigera, Thalassiosira rotula, Thalassiosira tenera, 94%. 95%,96%.97%, 98%, 99% or 100% sequence identity, Thalassiosira tumida, Thalassiosira weissflogii, Thalassio to SEQID NO: 14. Sira sp. 422A, Thalassiosira sp. B101, Thalassiosira sp. 0023. In varying embodiments, the antigen elicits and/or CCO3-04, Thalassiosira sp. CCMP1064, Thalassiosira sp. induces a protective immune response against Vibrio harveyi. CCMP1065, Thalassiosirasp. CCMP1093, Thalassiosirasp. In varying embodiments, the V. harveyiantigen is one or more CCMP1277, Thalassiosirasp. CCMP1281, Thalassiosirasp. of VhhP2, DegQ, Vh-HL1 and Vh-ompK proteins. In vary CCMP1987, Thalassiosira sp. CCMP353, Thalassiosira sp. ing embodiments, the VhhP2 protein comprises an amino CCMP988, Thalassiosira sp. CCMP991, Thalassiosira sp. acid sequence having at least 90% sequence identity, e.g., at Cleve BA153110, Thalassiosira sp. DDZ-2010a, Thalassio least 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99% or sira sp. DITS301-08, Thalassiosira sp. MBTD-CMFRI 100% sequence identity, to SEQ ID NO: 15. In varying S033, Thalassiosira sp. MBTD-CMFRI-S069, and/or embodiments, the VhhP2 protein is encoded by a nucleic acid Thalassiosira sp. MBTD-CMFRI-S132. In some embodi sequence having at least 90% sequence identity, e.g., at least ments, the diatom is Thalassiosira pseudonana. 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99% or 100% 0026. In varying embodiments, the diatom or population sequence identity, to SEQ ID NO: 16. In varying embodi of diatoms comprise no additional adjuvant; the silica in the ments, the DegQ, protein comprises an amino acid sequence diatom cell wall acts as an adjuvant. In some embodiments, having at least 90% sequence identity, e.g., at least 91%.92%, the diatom or population of diatoms further comprise an 93%, 94%, 95%, 96%, 97%, 98%, 99% or 100% sequence adjuvant. The adjuvant can be in the cytoplasm or attached to identity, to SEQ ID NO: 17. In varying embodiments, the the Surface of the diatom. In some embodiments, the adjuvant DegQ, protein is encoded by a nucleic acid sequence having is a bacterial toxin. In some embodiments, the bacterial toxin at least 90% sequence identity, e.g., at least 91%, 92%, 93%, is selected from the group consisting of Cholera Toxin B 94%. 95%,96%.97%, 98%, 99% or 100% sequence identity, (CTB), E. coli heat labile toxin (LT), tetanus toxin (Tet), and to SEQ ID NO: 18. In varying embodiments, the Vh-HL1 fragments thereof that stimulate and/or enhance an immune protein comprises an amino acid sequence having at least response. In some embodiments, the diatom comprises a 90% sequence identity, e.g., at least 91%, 92%, 93%, 94%, nucleic acid encoding the bacterial toxin or fragment thereof, 95%, 96%, 97%, 98%, 99% or 100% sequence identity, to and expresses the bacterial toxin or fragment thereof. The SEQID NO: 19. In varying embodiments, the Vh-HL1 pro bacterial toxin adjuvant may be expressed in the cytoplasm, tein is encoded by a nucleic acid sequence having at least 90% membrane system (e.g., plasma membrane) or on the Surface sequence identity, e.g., at least 91%, 92%, 93%, 94%. 95%, of the diatom. In some embodiments, the antigen and the 96%, 97%, 98%, 99% or 100% sequence identity, to SEQID bacterial toxin are expressed as a fusion protein. In some NO:20. In varying embodiments, the Vh-ompK protein com embodiments, the adjuvant is a cytokine. In some embodi prises an amino acid sequence having at least 90% sequence ments, the cytokine is selected from the group consisting of identity, e.g., at least 91%,92%, 93%, 94%, 95%,96%.97%, IL-1, IL-2, IL-5, IL-6, IL-12, IL-15, Flt3L, GM-CSF, MIP 98%, 99% or 100% sequence identity, to SEQID NO: 21. In 1C, IFN-Y, and mixtures thereof. In some embodiments, the varying embodiments, the Vh-ompK protein is encoded by a diatom comprises a nucleic acid encoding the cytokine or nucleic acid sequence having at least 90% sequence identity, fragment thereof, and expresses the cytokine or fragment e.g., at least 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, thereof. The cytokine may be expressed in the cytoplasm, in 99% or 100% sequence identity, to SEQID NO: 22. the membrane system or on the Surface of the diatom. In some 0024. In some embodiments, the antigen is a cancer-asso embodiments, the antigen and the cytokine are expressed as a ciated antigen. fusion protein. In some embodiments, the adjuvant is a Toll 0025. In some embodiments, the diatom is a Bacillari like receptor agonist, e.g., flagellin and/or Meningococcal ophyta (e.g., Bacillariophyceae (Raphid, pennate diatoms), outer membrane protein C (OMPC). Coscinodiscophyceae (centric diatoms), Fragilariophyceae 0027. In a further aspect, the invention comprises compo (Araphid, pennate diatoms) and/or Mediophyceae). In some sitions comprising a diatom or population of diatoms, as embodiments, the diatom is a Coscinodiscophyceae (e.g., described herein and a pharmaceutically acceptable carrier. Chaetocerotophycidae, Corethrophycidae, Coscinodisco 0028. In another aspect, the invention comprises methods phycidae, Rhizosoleniophycidae, and/or Thalassiosirophy of stimulating (e.g., inducing and/or eliciting) an immune cidae). In some embodiments, the diatom is a Thalassiosiro response in an animal, comprising administering to the ani phycidae. In some embodiments, the diatom is a mala diatom or population of diatoms, as described herein, or Thalassiosirales. In some embodiments, the diatom is a a composition, as described herein, in an amount effective to Thalassiosiraceae. In some embodiments, the diatomis of the stimulate the immune response in the animal. Administration genus Thalassiosira (e.g., Thalassiosira aestivalis, Thalas of the diatom induces and/or elicits an immune response US 2015/0037370 A1 Feb. 5, 2015
against the antigen expressed by the diatom. Generally, the istration of one agent can precede administration of the other. immune response against the antigen is protective, e.g., pre Simultaneous physiological effect need not necessarily vents or treats a disease in the animal. require presence of both agents in the circulation at the same 0029. In some embodiments, the diatom or population of time. However, in certain embodiments, co-administering diatoms are administered mucosally or transdermally. In typically results in both agents being simultaneously present Some embodiments the diatoms or populations are adminis in the body (e.g., in the plasma) at a significant fraction (e.g., tered in the water or food or by aerosol. In some embodi 20% or greater, preferably 30% or 40% or greater, more ments, the diatom or population of diatoms are administered preferably 50% or 60% or greater, most preferably 70% or across the oral, ocular, nasal, vaginal, rectal, pulmonary or 80% or 90% or greater) of their maximum serum concentra conjunctival mucosa. In some embodiments, the diatom or tion for any given dose. population of diatoms are administered orally, Sublingually, 0037. The term “effective amount” or “pharmaceutically buccally, intranasally, intravaginally, intrarectally, conjuncti effective amount” refer to the amount and/or dosage, and/or vally, intrapulmonarily, by aerosol or transdermally. In some dosage regime of one or more compounds necessary to bring embodiments, the diatom or population of diatoms is admin about the desired result e.g., an amount Sufficient to mitigat istered systemically. ing in an animal one or more symptoms associated with the disease being treated or prevented, or an amount Sufficient to DEFINITIONS lessen the severity or delay the progression of the disease 0030. As used herein, the term “diatom” refers to any of being treated in an animal (e.g., therapeutically effective various microscopic one-celled or colonial algae of the phy amounts), an amount Sufficient to reduce the risk or delaying lum Bacillariophyta. In varying embodiments, the diatom is the onset, and/or reduce the ultimate severity of a disease of the class Coscinodiscophyceae (e.g., Chaetocerotophy being prevented in an animal (e.g., prophylactically effective cidae, Corethrophycidae, Coscinodiscophycidae, Rhizosole amounts). niophycidae, and/or Thalassiosirophycidae). In some 0038. The phrase “cause to be administered’ refers to the embodiments, the diatom is a Thalassiosirophycidae. In some actions taken by a medical professional (e.g., a physician), or embodiments, the diatom is a Thalassiosirales. In some a person controlling medical care of a Subject, that control embodiments, the diatom is of the family Thalassiosiraceae. and/or permit the administration of the agent(s)/compound(s) In some embodiments, the diatom is of the genus Thalassio at issue to the Subject. Causing to be administered can involve Sira. Diatoms of use preferably have cell walls of silica. diagnosis and/or determination of an appropriate therapeutic Generally, the cell walls of silica comprise two halves called or prophylactic regimen, and/or prescribing particular agent the epitheca and hyptotheca. (s)/compounds for a subject. Such prescribing can include, 0031. The term “antigen” refers to a peptide or polypep for example, drafting a prescription form, annotating a medi tide that elicits and/or induces an immune response in an cal record, and the like. animal. Preferably, the immune response is protective or therapeutic (e.g., treats an ongoing disease), e.g., against an 0039. As used herein, the terms “treating and “treatment' infectious agent or a cancer-associated antigen. refer to delaying the onset of retarding or reversing the 0032. The term "heterologous” refers to antigens (e.g., progress of reducing the severity of oralleviating or prevent peptides, polypeptides) that are not endogenous to the dia ing either the disease or condition to which the term applies, tOm. or one or more symptoms of such disease or condition. 0033. The term “administration refers to all routes of 0040. The term “mitigating refers to reduction or elimi immunization, including systemic and local administration. nation of one or more symptoms of that pathology or disease, 0034. The terms “systemic administration' and “systemi and/or a reduction in the rate or delay of onset or severity of cally administered’ refer to a method of administering a one or more symptoms of that pathology or disease, and/or compound or composition to an animalso that the compound the prevention of that pathology or disease. In certain embodi or composition is delivered to sites in the body, including the ments, the reduction or elimination of one or more symptoms targeted site of pharmaceutical action, via the circulatory of pathology or disease can include, but is not limited to, system. Systemic administration includes, but is not limited reduction or elimination burden of the infectious agent or to, oral, mucosal (e.g., oral, intranasal, intravaginal, intrarec CaCC. tal, conjunctival, Sublingually, buccally, intrapulmonary, or 0041. The terms “subject,” “individual,” and “patient” by aerosol) and parenteral (e.g., other than through the ali interchangeably refer to an animal, e.g., a mammal, a bony mentary tract, Such as intramuscular, intravenous, intra-arte fish (e.g., Salmoniformes, Salmonoidei, Salmonidae), a rial, transdermal and Subcutaneous) administration, as well as shrimp or prawn (e.g., Penaeoidea, Penaeidae, Litopenaeus), administration into the egg (in ovo). a mollusk (e.g., Mollusca, Bivalvia) or an avian (e.g., Ayes, 0035. The terms “mucosal administration' and “mucosal Galliformes (a fowl), Phasianidae: Phasianinae; Gallus). In immunization” refers to administration via a mucosal Surface, varying embodiments, the animal is a human or a non-human e.g., oral, intranasal, intravaginal, intrarectal, conjunctival, primate, but also domesticated mammals (e.g., canine or Sublingually, buccally, intrapulmonary, or by aerosol. See, feline), laboratory mammals (e.g., mouse, rat, rabbit, ham e.g., Pavot, et al., Vaccine 30 (2012) 142-154. Ster, guinea pig) and agricultural mammals (e.g., equine, 0036. The term “co-administering or “concurrent admin bovine, porcine, Ovine). In various embodiments, the Subject istration', when used, for example with respect to the antigen can be a human (e.g., adult male, adult female, adolescent and another active agent (e.g., an adjuvant or a second anti male, adolescent female, male child, female child) under the gen), refers to administration of the compound and/or analogs care of a physician or other healthworker in a hospital, psy and the active agent Such that both can simultaneously chiatric care facility, as an outpatient, or other clinical con achieve a physiological effect. The two agents, however, need text. In certain embodiments the subject may not be under the not be administered together. In certain embodiments, admin care or prescription of a physician or other healthworker. US 2015/0037370 A1 Feb. 5, 2015
0042. A “fusion protein’ refers to a composition compris is determinative of the presence of the antigen in a heteroge ing at least one polypeptide or peptide domain which is asso neous population of proteins and other biologics, e.g., in a ciated with a second domain. The second domain can be a biological sample, e.g., a blood, serum, plasma or tissue polypeptide, peptide, polysaccharide, or the like. The sample. Thus, under designated immunoassay conditions, the “fusion' can be an association generated by a peptide bond, a antibodies or binding agents with a particular binding speci chemical linking, a charge interaction (e.g., electrostatic ficity bind to a particular antigen at least two times the back attractions, such as Salt bridges, H-bonding, etc.) or the like. ground and do not substantially bind in a significant amount If the polypeptides are recombinant, the “fusion protein’ can to other antigens present in the sample. Specific binding to an be translated from a common message. Alternatively, the antibody or binding agent under Such conditions may require compositions of the domains can be linked by any chemical or electrostatic means. The fusion proteins of the invention can the antibody or agent to have been selected for its specificity also include additional sequences, e.g., linkers, epitope tags, for a particular protein. A variety of immunoassay formats enzyme cleavage recognition sequences, signal sequences, may be used to selectantibodies specifically immunoreactive with a particular protein. For example, solid-phase ELISA secretion signals, and the like. immunoassays are routinely used to selectantibodies specifi 0043. An “immunogen' refers to a compound or compo cally immunoreactive with a protein (see, e.g., Harlow & sition comprising a peptide, polypeptide or protein which is Lane. Using Antibodies, A Laboratory Manual (1998), for a “immunogenic, i.e., capable of eliciting, augmenting or description of immunoassay formats and conditions that can boosting a cellular and/or humoral immune response, either be used to determine specific immunoreactivity). Typically a alone or in combination or linked or fused to another sub specific or selective binding reaction will produce a signal at stance. An immunogenic composition can be a peptide of at least twice over the background signal and more typically at least about 5 amino acids, a peptide of 10 amino acids in length, a fragment 15 amino acids in length, a fragment 20 least than 10 to 100 times over the background. amino acids in length or greater. The immunogen can com 0046. A “transmission blocking antibody' is an antibody prise a “carrier polypeptide and a hapten, e.g., a fusion which inhibits the transmission to a host and/or growth or protein or a carrier polypeptide fused or linked (chemically or replication of an infectious agent, e.g., a virus, a bacterium, a otherwise) to another composition (described below). The fungus and/or a parasite. immunogen can be recombinantly expressed in an immuni 0047. An “immunogenic composition' is a composition Zation vector, which can be simply naked DNA comprising the immunogen's coding sequence operably linked to a pro which elicits the production of antibodies or a cell-mediated moter, e.g., a simple expression cassette. The immunogen immune response when administered to an animal. includes antigenic determinants, or epitopes (described 0048. An “immunological carrier' or “carrier in the below), to which antibodies or TCRs bind, which are typi immunological context (as opposed to a carrier which is a cally 3 to 10 amino acids in length. nonactive composition for the purpose of formulating, storing 0044 An “antibody' refers to a polypeptide of the immu or carrying a pharmaceutical) is an composition which, when noglobulin family or a polypeptide comprising fragments of linked, joined, chemically coupled or fused to a second com an immunoglobulin that is capable of noncovalently, revers position (e.g., protein, peptide, polysaccharide or the like) ibly, and in a specific manner binding a corresponding anti boosts or augments the cellular or humoral response to the gen. An exemplary antibody structural unit comprises a tet composition. Any physiologic mechanism can be involved in ramer. Each tetramer is composed of two identical pairs of this augmentation or boosting of the immune response. An polypeptide chains, each pair having one “light” (about 25 immunogenic carrier is typically a polypeptide linked or kD) and one “heavy chain (about 50-70 kD), connected fused to a second composition of interest comprising a pro through a disulfide bond. The recognized immunoglobulin tein, peptide or polysaccharide, where the carrier stimulates a genes include the K. W. C. Y., Ö, e, and Ll constant region genes, cellular (T cell mediated) immune response that boosts or as well as the myriad immunoglobulin variable region genes. augments the humoral (B cell mediated, antibody-generat Light chains are classified as either K or W. Heavy chains are ing) immune response to the composition of interest. These classified as Y. L. C., 6, or e, which in turn define the immu second compositions can be “haptens, which are typically noglobulin classes, IgG, IgM, IgA, Ig|D, and IgE, respec defined as compounds of low molecular weight or repeating tively. The N-terminus of each chain defines a variable region low molecular weight units that are not immunogenic by of about 100 to 110 or more amino acids primarily respon themselves, but that, when coupled to carrier molecules, can sible for antigen recognition. The terms variable light chain elicit antibodies directed to epitopes on the hapten. For (VL) and variable heavy chain (VH) refer to these regions of example, the lack of an adequate immune response to the light and heavy chains respectively. As used in this applica major polysaccharide of the Haemophilus influenzae type b tion, an “antibody encompasses all variations of antibody capsule (PRP) in very young infants can be overcome by and fragments thereof that possess a particular binding spe conjugating PRP to a T-cell dependent carrier protein (see cifically, e.g., for tumor associated antigens. Thus, within the Zepp (1997) Eur. J. Pediatr. 156:18-24). Alternatively, a pep Scope of this concept are full length antibodies, chimeric tide can be linked to a carrier simply to facilitate manipulation antibodies, humanized antibodies, human antibodies, single of the peptide in the generation of the immune response (see, domain antibodies or nanobodies, single chain antibodies e.g., Rondard (1997) Biochemistry 36:8962-8968). (ScFV), Fab, Fab', and multimeric versions of these fragments 0049. An "epitope” refers to an antigenic determinant or (e.g., F(ab')2) with the same binding specificity. antigen site that interacts with an antibody or a T cell receptor 0045. The phrase “specifically (or selectively) bind.” (TCR). An “antigen' is a molecule or composition that when used in the context of describing the interaction induces the production of an immune response. An antibody between an antigen, e.g., a protein, to an antibody or anti or TCR binds to a specific conformational (possibly charge body-derived binding agent, refers to a binding reaction that dependent) domain of the antigen, called the “antigenic deter US 2015/0037370 A1 Feb. 5, 2015 minant’ or “epitope' (TCRs bind the epitope in association 0052 For sequence comparison, typically one sequence with a third molecule, a major histocompatibility complex acts as a reference sequence, to which test sequences are (MHC) protein). compared. When using a sequence comparison algorithm, 0050. The terms “cancer-associated antigen” or “tumor test and reference sequences are entered into a computer, associated antigen' or “tumor-specific marker” or “tumor Subsequence coordinates are designated, if necessary, and marker” interchangeably refers to a molecule (typically pro sequence algorithm program parameters are designated. tein, carbohydrate or lipid) that is preferentially expressed on Default program parameters can be used, or alternative the Surface of a cancer cell in comparison to a normal cell, and parameters can be designated. The sequence comparison which is useful for inducing and/or eliciting an immune algorithm then calculates the percent sequence identities for response against the cancer cell or tumor. Oftentimes, a can the test sequences relative to the reference sequence, based on cer-associated antigen is a cell Surface molecule that is over the program parameters. expressed in a cancer cell in comparison to a normal cell, for 0053. The term “comparison window, and variants instance, 1-fold over expression, 2-fold overexpression, thereof, includes reference to a segment of any one of the 3-fold overexpression or more in comparison to a normal cell. number of contiguous positions selected from the group con Oftentimes, a cancer-associated antigen is a cell Surface mol sisting of from 20 to 600, usually about 50 to about 200, more ecule that is inappropriately synthesized in the cancer cell, for usually about 100 to about 150 in which a sequence may be instance, a molecule that contains deletions, additions or compared to a reference sequence of the same number of mutations in comparison to the molecule expressed on a contiguous positions after the two sequences are optimally normal cell. Oftentimes, a cancer-associated antigen will be aligned. Methods of alignment of sequences for comparison expressed exclusively on the cell Surface of a cancer cell and are well known in the art. Optimal alignment of sequences for not synthesized or expressed on the Surface of a normal cell. comparison can also be conducted by the local homology Examples of known TAAs include without limitation, mela algorithm of Smith and Waterman Add. APL. Math. 2:482 noma associated antigens (MAGE-1, MAGE-3, TRP-2, mel (1981), by the homology alignment algorithm of Needle man anosomal membrane glycoprotein gp100, gp75 and MUC-1 and Wunsch J. Mol. Biol. 48:443 (1970), by the search for (mucin-1) associated with melanoma); CEA (carcinoembry similarity method of Pearson and Lipman Proc. Natl. Acad. onic antigen) which can be associated, e.g., with ovarian, Sci. (U.S.A.) 85: 2444 (1988), by computerized implemen melanoma or colon cancers; folate receptor alpha expressed tations of these algorithms (GAP, BESTFIT, BLAST, by ovarian carcinoma; free human chorionic gonadotropin FASTA, and TFASTA in the Wisconsin Genetics Software beta (hCG f) subunit expressed by many different tumors, Package, Genetics Computer Group (GCG), 575 Science Dr., including but not limited to myeloma; HER-2/neu associated Madison, Wis.), Karlin and Altschul Proc. Natl. Acad. Sci. with breast cancer, encephalomyelitis antigen HuD associ (U.S.A.) 87:2264-2268(1990), or by manual alignment and ated with Small-cell lung cancer, tyrosine hydroxylase asso visual inspection (see, e.g., Ausubel et al., Current Protocols ciated with neuroblastoma; prostate-specific antigen (PSA) in Molecular Biology (1995 supplement)). associated with prostate cancer, CA125 associated with ova 0054 Examples of an algorithm that is suitable for deter rian cancer; and the idiotypic determinants of a B cell lym mining percent sequence identity and sequence similarity phoma can generate tumor-specific immunity (attributed to include the BLAST and BLAST 2.0 algorithms, which are idiotype-specific humoral immune response). Moreover, described in Altschuletal. (1977) Nuc. Acids Res. 25:3389 antigens of human T cell leukemia virus type 1 have been 3402, and Altschul et al. (1990).J. Mol. Biol. 215:403-410, shown to induce specific CTL responses and antitumor respectively. Software for performing BLAST analyses is immunity against the virus-induced human adult T cell leu publicly available through the National Center for Biotech kemia (ATL). See, e.g., Haupt, et al., Experimental Biology nology Information (on the internet at ncbi.nlm.nih.gov/). and Medicine (2002) 227:227-237: Ohashi, et al., Journal of This algorithm involves first identifying high scoring Virology (2000) 74(20):9610-9616. sequence pairs (HSPs) by identifying short words of length W 0051. The terms “identical” or percent “identity,” and vari in the query sequence, which either match or satisfy some ants thereof in the context of two or more polynucleotide positive-valued threshold score T when aligned with a word sequences, refer to two or more sequences or Subsequences of the same length in a database sequence. T is referred to as that are the same. Sequences are “substantially identical” if the neighborhood word score threshold (Altschul et al., they have a specified percentage of nucleic acid residues or supra). These initial neighborhood word hits act as seeds for nucleotides that are the same (e.g., at least 60% identity, initiating searches to find longer HSPs containing them. The optionally at least 65%, 70%, 75%, 80%, 85%, 90%, 95%, word hits are extended in both directions along each sequence 96%, 97%, 98%, or 99% identity over a specified region (or for as far as the cumulative alignment score can be increased. the whole reference sequence when not specified)), when Cumulative scores are calculated using, for nucleotide compared to a reference sequence (e.g., SEQID NOs: 1-22) sequences, the parameters M (reward score for a pair of and aligned for maximum correspondence over a comparison matching residues; always >0) and N (penalty score for mis window, or designated region as measured using one of the matching residues; always <0). For amino acid sequences, a following sequence comparison algorithms or by manual scoring matrix is used to calculate the cumulative score. alignment and visual inspection. The present invention pro Extension of the word hits in each direction are halted when: vides polynucleotides improved for expression in diatom host the cumulative alignment score falls off by the quantity X cells that are substantially identical to the polynucleotides of from its maximum achieved value; the cumulative score goes described herein. Optionally, the identity exists over a region to zero or below, due to the accumulation of one or more that is at least about 50 amino acids in length, or more pref negative-scoring residue alignments; or the end of either erably over a region that is 100, 200,300, 400, 500, 600, 800, sequence is reached. The BLAST algorithm parameters W.T. 1000, or more, nucleic acids in length, or over the full-length and X determine the sensitivity and speed of the alignment. of the sequence. The BLASTN program (for nucleotide sequences) uses as US 2015/0037370 A1 Feb. 5, 2015
defaults a wordlength (W) of 11, an expectation (E) or 10, other, or a third nucleic acid, under Stringent conditions. M=5, N=-4 and a comparison of both strands. Foramino acid Stringent conditions are sequence dependent and will be dif sequences, the BLASTP program uses as defaults a ferent in different circumstances. Generally, stringent condi wordlength of 3, and expectation (E) of 10, and the BLO tions are selected to be about 5° C. lower than the thermal SUM62 scoring matrix (see Henikoff and Henikoff (1989) melting point (Tm) for the specific sequence at a defined ionic Proc. Natl. Acad. Sci. USA 89:10915) alignments (B) of 50, strength and pH. The Tm is the temperature (under defined expectation (E) of 10, M-5, N=-4, and a comparison of both ionic strength and pH) at which 50% of the target sequence Strands. hybridizes to a perfectly matched probe. Typically, stringent 0055. The BLAST algorithm also performs a statistical conditions will be those in which the salt concentration is analysis of the similarity between two sequences (see, e.g., about 1 molar at pH 7 and the temperature is at least about 60° Karlin and Altschul (1993) Proc. Natl. Acad. Sci. USA C 90:5873-5787). One measure of similarity provided by the 0059. In the present invention, mRNA encoded by the BLAST algorithm is the smallest sum probability (P(N)), nucleic acids of the invention can be identified in Northern which provides an indication of the probability by which a blots under stringent conditions using the sequences dis match between two nucleotide or amino acid sequences closed here or fragments of typically, at least about 100 would occur by chance. For example, a nucleic acid is con nucleotides. For the purposes of this disclosure, stringent sidered similar to a reference sequence if the Smallest Sum conditions for such RNA-DNA hybridizations are those probability in a comparison of the test nucleic acid to the which include at least one wash in 6xSSC for 20 minutes at a reference nucleic acid is less than about 0.2, more preferably temperature of at least about 50° C., usually about 55° C. to less than about 0.01, and most preferably less than about about 60°C., or equivalent conditions. 0.001. Standard BLAST algorithm parameters have an 0060 Another indication that protein sequences are sub expected threshold of 10 (according to the stochastic model of stantially identical is if one protein is immunologically reac Karlin and Altschul (PNAS, 87:2264-2268(1990)); a word tive with antibodies raised against the other protein. size of 28; reward and penalty of 17-2 (a ratio of 0.5, or 1/-2, 0061 Conservatively modified variations” of a particular is used for sequences that are 95% conserved); and a linear nucleic acid sequence refers to those nucleic acids which GAP coSt. encode identical or essentially identical amino acid 0056. The term “substantial identity” of polynucleotide sequences, or where the nucleic acid does not encode an sequences means that a polynucleotide comprises a sequence amino acid sequence, to essentially identical sequences. that has at least 80% sequence identity, e.g., at least about Because of the degeneracy of the genetic code, a large number 85%, 90%, 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, of functionally identical nucleic acids encode any given 99%, or higher, compared to a reference sequence (e.g., SEQ polypeptide. For instance, the codons CGU, CGC, CGA, ID NOS: 1-22), using sequence alignment/comparison algo CGG, AGA, and AGG all encode the amino acid arginine. rithms set to standard parameters. One of skill will recognize Thus, at every position where an arginine is specified by a that these values can be appropriately adjusted to determine codon, the codon can be altered to any of the corresponding corresponding identity of proteins encoded by two nucleotide codons described without altering the encoded polypeptide. sequences by taking into account codon degeneracy, amino Such nucleic acid variations are “silent variations, which are acid similarity, reading frame positioning and the like. one species of “conservatively modified variations.” Every 0057 “Substantial identity” of amino acid sequences for nucleic acid sequence herein which encodes a polypeptide these purposes means sequence identity of at least 80% also describes every possible silent variation. One of skill will sequence identity, e.g., at least about 85%, 90%, 91%, 92%, recognize that each codon in a nucleic acid (except AUG, 93%, 94%, 95%, 96%, 97%, 98%, 99%, or higher, using which is ordinarily the only codon for methionine, and UGG, sequence alignment/comparison algorithms set to standard the single codon for Trp) can be modified to yield a function parameters. Polypeptides which are “substantially similar ally identical molecule by standard techniques. Accordingly, share sequences as noted above except that residue positions each 'silent variation of a nucleic acid which encodes a which are not identical may differ by conservative amino acid polypeptide is implicit in each described sequence. changes. Conservative amino acid Substitutions refer to the 0062. The term “conservatively modified variations' interchangeability of residues having similar side chains. For refers to individual substitutions, deletions or additions which example, a group of amino acids having aliphatic side chains alter, add or delete a single amino acid or a small percentage is glycine, alanine, Valine, leucine, and isoleucine; a group of of amino acids (typically less than 5%, more typically less amino acids having aliphatic-hydroxyl side chains is serine than 1%) in an encoded sequence, where the alterations result and threonine; a group of amino acids having amide-contain in the Substitution of an amino acid with a chemically similar ing side chains is asparagine and glutamine; a group of amino amino acid; and the alterations, deletions or additions do not acids having aromatic side chains is phenylalanine, tyrosine, alter the structure, function and/or immunogenicity of the and tryptophan; a group of amino acids having basic side sequence. Conservative Substitution tables providing func chains is lysine, arginine, and histidine; and a group of amino tionally similar amino acids are well known in the art. The acids having Sulfur-containing side chains is cysteine and following six groups each contain amino acids that are con methionine. Preferred conservative amino acids substitution servative substitutions for one another: groups are: Valine-leucine-isoleucine, phenylalanine-tyro sine, lysine-arginine, alanine-valine, asp arctic acid-glutamic 0063. 1) Alanine (A), Serine (S), Threonine (T): acid, and asparagine-glutamine. Determination of “substan 0064. 2) Aspartic acid (D), Glutamic acid (E); tial identity” can be focused over defined subsequences, such 0065 3) Asparagine (N). Glutamine (Q); as known structural domains. 0.066 4) Arginine (R), Lysine (K); 0058 Another indication that nucleotide sequences are 0067 5) Isoleucine (I), Leucine (L), Methionine (M), substantially identical is if two molecules hybridize to each Valine (V); and US 2015/0037370 A1 Feb. 5, 2015
0068 6) Phenylalanine (F), Tyrosine (Y), Tryptophan destroying the biological function of a regulatory element and (W). that such limited modifications can result in algal regulatory 0069. The term “frustulin refers to nucleic acids and elements that have Substantially equivalent or enhanced func polypeptide polymorphic variants, alleles, mutants, and inter tion as compared to a wild type algal regulatory element. species homologs that: (1) have an amino acid sequence that These modifications can be deliberate, as through site-di has greater than about 90% amino acid sequence identity, for rected mutagenesis, or can be accidental Such as through example, 91%, 92%, 93%, 94%. 95%, 96%, 97%, 98% or mutation in hosts harboring the regulatory element. All Such 99% or greater amino acid sequence identity, preferably over modified nucleotide sequences are included in the definition a region of at least about 25, 50, 75, 100, 200, 400, or more of an algal regulatory element as long as the ability to confer amino acids, or over the full-length, to an amino acid expression in unicellular green algae is Substantially retained. sequence encoded by a frustulin nucleic acid (e.g., GenBank Accession Nos. XM 002290463.1 (FRU1) and BRIEF DESCRIPTION OF THE DRAWINGS XM 002290320.1 (FRU2); (2) bind to antibodies, e.g., poly clonal antibodies, raised against an immunogen comprising 0072 FIG. 1 illustrates Ibp A protein diagram and vaccine an amino acid sequence of a frustulin polypeptide (e.g., antigen sites. Domains depicted: Heparin Binding Domain XP 002290499.1 (FRU1) and XP 002290356.1 (FRU2)); (HBD), Carbohydrate Recognition Domain (CRD), RGD oranamino acid sequence encoded by a frustulin nucleic acid motif, overlapping about 200 bp and 22 bp repeats (Repeats), (e.g., frustulin polynucleotides described herein), and conser and C-terminal Direct Repeat domains with Fic motifs (DR1/ vatively modified variants thereof; (3) specifically hybridize Fic and DR2/Fic). Recombinant protein subunits expressed, under stringent hybridization conditions to an anti-sense purified and used for vaccination (A3, A5 and DR2). rDR2 Strand corresponding to a nucleic acid sequence encoding a protected against H. Somnisepticemia in mice and pneumonia frustulin protein, and conservatively modified variants in cattle. thereof (4) have a nucleic acid sequence that has greater than (0073 FIG. 2 illustrates cytotoxicity (cell retraction or about 90%, preferably greater than about 91%, 92%, 93%, rounding) of H. Somni 2336 (100 MOI), 20x concentrated 94%. 95%, 96%, 97%, 98%, 99%, or higher nucleotide culture supernatant (CCS) and recombinant DR2 protein sequence identity, preferably over a region of at least about (rDR2) or H496A mutant rDR2 H/A (20 ug/ml each) on 25, 50, 100, 200,500,750, 1000, 1200 or more nucleotides, or Bovine Alveolar Type 2 (BAT2), Bovine Turbinate (BT) and over the full-length, to a frustulin nucleic acid (e.g., frustulin HeLa cells, expressed as % of cells with cytotoxic changes. H. polynucleotides, as described herein, and frustulin polynucle somni causes bovine pneumonia and is mainly found in the otides that encode frustulin polypeptides, as described lung alveoli, BAT2 bovine target cells are the main target in herein). Based on the knowledge of frustulinhomologs, those vivo and are much more susceptible to rDR2 than bovine of skill can readily determine residue positions that are more upper respiratory BT cells or human HeLa cervical carci tolerant to Substitution. For example, amino acid residues noma cells. rDR2 H/A is essentially non-toxic. conserved amongst species are less tolerant of substitution or 0074 FIGS. 3A-B illustrate protection of calves against deletion. Similarly, amino acid residues that are not con H. Somni experimental pneumonia by vaccination. A) Volume served amongst species are more tolerant of Substitution or of lung lesions expressed as % of lung with pneumonic deletion, while retaining the function of the frustulin protein. lesions at necropsy (% lung lesions). NOTE: rDR2 vaccine 0070 An "expression cassette' refers to a nucleic acid protected best (p<0.05 compared with GST control). B). H. construct, which when introduced into a host cell, results in somni culture results from vaccinated calves. Again rDR2 transcription and/or translation of a RNA or polypeptide, protected best. *(<0.05). respectively. (0075 FIG. 4 illustrates antibody neutralization of IbpA (0071. The term “promoter” or “regulatory element” refers DR2 cytotoxicity for BAT2 cells. Note that untreated control to a region or sequence determinants located upstream or cells had very little retraction but cells treated with IbpADR2 downstream from the start of transcription that direct tran and pre-immune calfserum were nearly all (>80%) retracted. Scription. As used herein, a promoter includes necessary Both convalescent phase serum and serum from Ibp A DR2 nucleic acid sequences near the start site of transcription, Such immunized calves neutralized cytotoxicity (retraction) p<0. as, in the case of a polymerase II type promoter, a TATA 05. element. A promoter also optionally includes distal elements, 0076 FIG. 5 illustrates mRNA accumulation control in T. which can be located as much as several thousand base pairs pseudonana. Left, relative mRNA levels determined by qRT from the start site of transcription. A "constitutive promoter PCR during exponential growth for four native genes in T. is a promoter that is active under most environmental and pseudonana, including nitrate reductase (NR), Acetyl CoA developmental conditions. An “inducible' promoter is a pro carboxylase (ACCase), fucoxanthin chlorophyll binding pro moter that is active under environmental or developmental tein (FCP), ribosomal protein L41 (rpL41). Right, mRNA regulation. The term “operably linked’ refers to a functional levels for T. pseudonana transformants containing the glu linkage between a nucleic acid expression control sequence tathione acetyltransferase gene under control of FCP expres (such as a promoter) and a second nucleic acid sequence. Such sion. Wild-type (Wt) is at the left, 4 transformants are shown as a nucleic acid encoding an antigen, wherein the expression to the right. Average expression level for the transformants control sequence directs transcription of the nucleic acid cor relative to WT is twice as high. responding to the second sequence. An "algae promoter” or 0077 FIG. 6 illustrates cytoplasmic and plasma mem “bacterial promoter is a promoter capable of initiating tran brane expression, panels show GFP fluorescence (GFP), GFP Scription in algae and/or bacterial cells, respectively. Such a plus chlorophyll (GFP+chl), and brightfield (Bf). promoter is therefore active in a microalgae cell, e.g., a dia (0078 FIG. 7 illustrates a comparison of IbpA DR2/GFP tom host cell, but need not originate from that organism. It is expression in clonal, transformant populations performed understood that limited modifications can be made without with imaging flow cytometry. Data indicates that the percent US 2015/0037370 A1 Feb. 5, 2015 age of T. pseudonana cells expressing GFP is dramatically stable, inexpensive particles results in efficacious mucosal increased when the Ibp A DR2 domain is optimized for vaccines. Diatom-based vaccines can also be used via other expression in T. pseudonana. routes of administration. 0079 FIGS. 8A-D illustrate the nucleic acid sequence of I0084 Killed pathogen vaccines are expensive, require plasmid vector pMHL 79 (SEQID NO:8). pMHL vector is additional adjuvants, multiple doses and often have undesir a pBluescript vector that has had the FCP promoter and ter able side effects. Alternatively, live modified or recombinant minator from a diatom engineered into it as well as the eGFP attenuated bacterial or virus vectored vaccines may revert to gene and the Gateway B fragment for recombination-based virulence, interfere with the normal flora or cause problems insertion. with environmental containment. Since diatoms are not pathogens, the problems with live bacteria or viruses do not 0080 FIGS. 9A-D illustrate the nucleic acid sequence of apply. In contrast, diatom-based vaccines expressing an anti plasmid vector pMHL 79+HSDR2 (SEQ ID NO:9). This gen are not expensive, carry endogenous adjuvants and are plasmid comprises a nucleic acid sequence encoding the safe. IbpA DR2 domain. I0085 Microparticles and nanoparticles are better mucosal 0081 FIGS. 10A-D illustrate the nucleic acid sequence of vaccine antigens than soluble proteins because particles are plasmid vector pMHL 79--HSDR2 CO (SEQ ID NO:10). taken up by appropriate epithelial cells (e.g. M cells in the This plasmid comprises a nucleic acid sequence encoding the intestine) and stimulate antigen presenting cells (APCs) Such IbpA DR2 domain with codon bias for improved expression as dendritic cells (DCs). Diatoms are microparticles (e.g., in a diatom host cell. Thalassiosira pseudonana is 4x6 um) but can also be tested as nanoparticles (<0.1 micron) after sonication. The biosilica DETAILED DESCRIPTION cell wall of T. pseudonana is non-toxic, with a different chemical structure than fibrous silica which causes silicosis, 1. Introduction and can also act as an adjuvant as has been shown for silica based immune stimulators. Others have shown that organic 0082. The present invention is based, in part, on the dis silica is a good adjuvant itself. Expression of an adjuvant covery that unicellular algae known as diatoms engineered to antigen (e.g., Cholera Toxin B (CTB), E. coli heat labile toxin express antigens of pathogens (e.g., inside the cell or on their (LT), tetanus toxin (Tet)) on the diatom surface causes bind cell surface) able to induce protective immunity suitable for ing to ganglioside GM 1 on the epithelial cell, and acts as an use as Vaccines against Such pathogens. Diatoms not only adjuvant. In preliminary experiments, we treated human provide an antigen expression platform, but because their cell peripheral blood mononuclear cells with T. pseudonana. walls are made of nanostructured silica and associated frus Monocytes but not T cells were stimulated to produce large tule proteins and other macromolecules, they may act as an amounts of TNF alpha, indicating activation. Activated adjuvant. Diatoms replicate in natural or artificial seawateras monocytes, macrophages and/or dendritic cells present anti well as fresh water, at generally ambient temperature with gens to T cells, thereby eliciting immune responses. Mono Sunlight and require minimal nutrients, making inexpensive cytes preferentially respond to particulate antigens, and production feasible in underdeveloped countries. Diatoms attachment of proteins to a particulate improves immunoge can also be Sonicated to form nanoparticles and/or lyo nicity to both CD4+ and CD8+T-cells, as well as generating a philized for long term storage. Ingestion of algae is safe and broader T-cell cytokine response. Furthermore, TNFC. people are known to ingest >10' microparticles per day in expression is involved in the maturation of monocytes to a normal living, including silica based particles. Mucosal or dendritic cell phenotype. Dendritic cells are extremely effi transdermal delivery of diatom-based vaccines provide an cient at presenting antigen to T-cells at very low frequencies efficacious, effective, safe, low cost, stable vaccine delivery (1/1000). vehicle. The use of a mucosal or transdermal diatom Surface I0086 Diatoms also have low intrinsic protease activity so display or cytoplasmic expression of antigens for immuniza the Surface or cytoplasmically expressed proteins are stable. tionallows rapid, widespread, economical, refrigeration-free, Nanoparticles are taken up better than microparticles and and needleless vaccines to be deployed. uptake of particulate adjuvants/antigens enhances immune 0.083 Diatom-based vaccines constitute a new, transfor responses. The diatom-based vaccines can be used as micro mational idea because these unicellular algae, with biosilica particles (whole diatoms) or nanoparticles after Sonication cell walls, are easily grown in water at ambient temperatures, (<0.1 microns). providing low cost in resource-limited settings. The vaccines are stable without refrigeration and can be lyophilized for 2. Diatom-Based Vaccines dispensing oral vaccines in food or water. Diatom-based vac I0087. The diatom-based vaccines comprise a diatom com cines can be formulated as microparticles or nanoparticles, prising one or more antigens that are heterologous to the both of which are better at Stimulating immune responses diatom. The one or more antigens can be in the cytoplasm of than soluble antigens. The biosilica cell wall may act as an the diatom, in the cell membrane system (e.g., plasma mem adjuvant. By expressing an immunostimulatory adjuvant, brane) or attached to the surface of the diatom. In various e.g., Cholera Toxin B (CTB) subunit, E. coli heat labile toxin embodiments, the diatom is engineered to express the one or (LT) cytokines, TLR receptor agonists, or other protein adju more antigens, e.g., in the cytoplasm, in the cell membrane vants, or fragments thereof, in the cytoplasm, in the mem system, or on the Surface of the cell. In some embodiments, brane system or on the Surface of the diatom, adjuvantactivity the one or more antigens are expressed as a fusion protein can be enhanced. Additionally, transmucosal antigen stimu with a surface-expressed polypeptide endogenous to the dia lation can be enhanced by the inclusion of specific domains of tom. In some embodiments, the Surface-expressed polypep CTB or LT. Expression of protective, antigens in the cyto tide endogenous to the diatom is a frustulin polypeptide. In plasm, in the membrane system or on the Surface of these Some embodiments, the antigen is expressed under the con US 2015/0037370 A1 Feb. 5, 2015
trol of a promoter endogenous to the diatom. In some embodi 6777-6783. In some embodiments, the adjuvant is a Toll-like ments, the promoter endogenous to the diatom is selected receptor agonist combined with one or more cytokines TLR from the group consisting of fucoxanthin chlorophyll binding ligands combined with one or more cytokines (e.g., IL-15) protein (FCP) promoter and ribosomal protein L41 (rpL41) enhance immune responses. See, e.g., BerZofsky, Vaccine promoter. (2012) 30: 4323-4327. In some embodiments, the diatom 0088. In some embodiments, the diatom is a Bacillari comprises a nucleic acid encoding the adjuvant or fragment ophyta (e.g., Bacillariophyceae (Raphid, pennate diatoms), thereof, and expresses the adjuvant or fragment thereof. The Coscinodiscophyceae (centric diatoms), Fragilariophyceae adjuvant may be expressed in the cytoplasm, in the membrane (Araphid, pennate diatoms) and/or Mediophyceae). In some system or on the Surface of the diatom. In some embodiments, embodiments, the diatom is a Coscinodiscophyceae (e.g., the antigen and the adjuvant are expressed as a fusion protein. Chaetocerotophycidae, Corethrophycidae, Coscinodisco phycidae, Rhizosoleniophycidae, and/or Thalassiosirophy 3. Antigens cidae). In some embodiments, the diatom is a Thalassiosiro phycidae. In some embodiments, the diatom is a 0090 Vaccine-preventable diseases in animal subjects, Thalassiosirales. In some embodiments, the diatom is a including humans, domesticated and agricultural mammals, Thalassiosiraceae. In some embodiments, the diatomis of the fish, crustaceans, mollusks, fowl, can be prevented and/or genus Thalassiosira (e.g., Thalassiosira aestivalis, Thalas mitigated by administration of an antigen known to elicit a Siosira allenii, Thalassiosira angulate, Thalassiosira protective immune response expressed in the cytoplasm, in anguste-lineata, Thalassiosira Antarctica, Thalassiosira the membrane system or on the surface of a diatom. The 25holera25an var. borealis, Thalassiosira af Antarctica, diatom-based vaccines comprise one or more antigens that Thalassiosira concaviuscula, Thalassiosira curviseriata, induce an immune response in the Subject, Sufficient to pro Thalassiosira delicatula, Thalassiosira eccentric, Thalassio tect against and/or counteract the disease or condition to be Sira gessneri, Thalassiosira gravida, Thalassiosira guillar treated or prevented, e.g., an infectious disease (viral, bacte dii, Thalassiosira hendeyi, Thalassiosira lundiana, Thalas rial, fungal, parasitic) or a cancer. Antigens useful to induce a Siosira mala, Thalassiosira mediterranea, Thalassiosira protective immune response are known in the art and find use minima, Thalassiosira minuscula, Thalassiosira nodulolin in the diatom-based vaccines, e.g., to prevent against contrac eata, Thalassiosira nordenskioeldii, Thalassiosira Oceanica, tion of an infectious disease, to treat infectious diseases by Thalassiosira pacifica, Thalassiosira profilinda, Thalassio immunotherapy or to facilitate retraction or inhibition of pro Sira proschkinae, Thalassiosira pseudonana, Thalassiosira gression of cancer. In various embodiments, the antigen is punctigera, Thalassiosira rotula, Thalassiosira tenera, from a virus, a bacterium, a fungus or a parasite. In various Thalassiosira tumida, Thalassiosira weissflogii, Thalassio embodiments, the antigen is a tumor-associated antigen. In Sira sp. 422A, Thalassiosira sp. B101, Thalassiosira sp. Some embodiments, the antigen is an immunostimulatory CCO3-04, Thalassiosira sp. CCMP1064, Thalassiosira sp. polypeptide or peptide. CCMP1065, Thalassiosirasp. CCMP1093, Thalassiosirasp. 0091. In some embodiments, the antigen is a viral antigen CCMP1277, Thalassiosirasp. CCMP1281, Thalassiosirasp. (e.g., from influenza, Varicella Zoster, herpes, HIV, respira CCMP1987, Thalassiosira sp. CCMP353, Thalassiosira sp. tory syncytial virus (RSV) (e.g., N, F and/or G proteins), CCMP988, Thalassiosira sp. CCMP991, Thalassiosira sp. papilloma, Hepatitis A, Hepatitis B. Hepatitis C), a bacterial Cleve BA1531 10, Thalassiosira sp. DDZ-2010a, Thalassio antigen (e.g., from Vibrio, Salmonella, Shigella, Campylo sira sp. DITS301-08, Thalassiosira sp. MBTD-CMFRI bacter; Yersinia, Histophilus, Staphylococcus, Streptococcus, S033, Thalassiosira sp. MBTD-CMFRI-S069, and/or Legionella), a fungal antigen (e.g., from Cryptococcus, Can Thalassiosira sp. MBTD-CMFRI-S132. In some embodi dida) or a parasitic antigen (e.g., from Plasmodium, Trypa ments, the diatom is Thalassiosira pseudonana. nosoma, Giardia, Entomoeba, Trichomonas). Vaccine-pre 0089. In some embodiments, the diatom or population of Ventable diseases in humans with known antigens that can be diatoms further comprise an adjuvant. The adjuvant can be in delivered to a subject in a diatom-based vaccine include, e.g., the cytoplasm or attached to the surface of the diatom. In Cholera, Diphtheria, Haemophilus 27 holera27a, type B, Some embodiments, the adjuvant is exogenous to the diatom, Hepatitis A, Hepatitis B. Hepatitis C, Influenza, Japanese e.g., a bacterial toxin, a cytokine. In some embodiments, the Encephalitis, Measles, Meningococcal infection, Mumps, bacterial toxin is selected from the group consisting of Chol Pertussis, Pneumococcal infection, Poliomyelitis, Rabies, era Toxin B (CTB), tetanus toxin (Tet), E. coli heat labile Rubella, Smallpox, Tetanus, Typhoid, Varicella, and Yellow toxin (LT), and immunogenic fragments thereof. In varying Fever. embodiments, the adjuvant is an immunostimulatory cytok 0092. Vaccines are available for 20 to 30 infectious dis ine, e.g., IL-1, IL-2, IL-5, IL-6, IL-12, IL-15, Flt3L, GM eases of cattle. Illustrative bovine diseases that can be pre CSF, MIP-1C, IFN-Y, and mixtures thereof. In varying vented and/or mitigated by administration of an antigen embodiments, the adjuvant is a mixture of IL-5 and GM-CSF. known to elicit a protective immune response expressed in the Co-administration of GM-CSF and IL-5 with antigen cytoplasm, in the membrane system or on the Surface of a enhances immune responses. See, e.g., Ma, et al., Am J diatom include without limitation Clostridial diseases (e.g., Reprod Immunol (2012) PMID:22934542. In some embodi Blackleg, Malignant Edema, Black's Disease, Enterotoxemia ments, the adjuvant is a Toll-like receptoragonist, e.g., flagel and Redwater); Anthrax, respiratory diseases (e.g., IBR (In lin and/or Meningococcal outer membrane protein C (OMP fectious Bovine Rhinotracheitis) (Rednose), PI3 (Parainflu C). TLR ligand-antigen conjugates activate enhanced enza-3), BVD (Bovine Virus Diarrhea), BRSV (Bovine Res immune responses. Recombinant flagellin and Meningococ piratory Syncytial Virus) (e.g., BRSV N, F or G proteins), cal outer membrane protein C (OMPC) activate via TLR5 Pasteurella multocida, Manheimia haemolytica, and Haemo and TLR2, respectively. See, e.g., Fujita and Taguchi. Ther philus somnus (aka, Histophilus somni)), reproductive dis Deliv. (2012)3(6):749-60; Lahiri, et al., Vaccine (2008) 26: eases (e.g., IBR, BVD, Brucellosis (Bangs), Vibriosis US 2015/0037370 A1 Feb. 5, 2015
(Campylobacter), Leptospirosis and Trichomoniasis), Scours Avian Influenza, Avian Encephalomyelitis, Mycoplasma, (e.g., Rota and CoronaVirus), E. coli and Pinkeye (Moraxella Infectious Coryza (serotypes A, B, C), Infectious Bronchits, spp). Egg Drop Syndrome, and Salmonella Enteritidis (SE). Poul 0093. In some embodiments, the antigen in the cytoplasm, try vaccines can be delivered mucosally, e.g., in food or water, in the membrane system or on the surface of the diatom elicits or by aerosol or systemically, e.g., Subcutaneously, intramus or induces a protective immune response in the mammal cularly or into the egg (in ovo). against a Histophilus somni infection. In some embodiments, 0099. In some embodiments, the antigenic protein the antigen comprises one or more epitopes of H. Somni expressed in the cytoplasm, in the membrane system or on the virulence factor Immunoglobulin Binding Protein A (IbpA). Surface of or with the diatom may be used in the aquaculture In some embodiments, the antigen comprises the IbpA DR2 industry for oral/surface mucosal vaccination of marine ani domain. In varying embodiments, the antigen comprises the mal or an aquaculture animal, e.g., fish, crustacean (e.g., IbpA DR2 domain and Ibp A5, e.g., expressed as separate shrimp), or mollusk (e.g., bivalve). See, e.g., Sommerset, et antigens or as a fusion protein. See, e.g., Geertsema et al., al., Expert Rev. Vaccines. (2005) 4(1):89-101. In such Vaccine (2011) 28:4805-4812. In varying embodiments, the embodiments, the diatoms can be mixed into the water or food antigen comprises the IbpA DR2 domain and BRSV N pro of the animal. For example, shrimp populations are Suscep tein, e.g., expressed as separate antigens or as a fusion protein. tible to a number of viral diseases: infectious hypodermal and In varying embodiments, the antigen comprises the IbpA hematopoietic necrosis virus (IHHNV), yellow head virus DR2 domain and one or more BRSV antigens selected from (YHV), taura syndrome virus (TSV), infectious myonecrosis the group consisting of N protein, F protein and G protein. (IMN), and white spot syndrome virus (WSSV). 0094. In some embodiments, the antigen induces and/or 0100. In varying embodiments, the antigen elicits and/or elicits a protective immune response in the mammal against induces a protective immune response against white spot bovine respiratory syncytial virus (BRSV), parainfluenza-3 syndrome virus (WSSV). In varying embodiments, the (PI), bovine viral diarrhea virus (BVDV) or bovine herpes WSSV antigen is one or both of VP19 and VP466 proteins. In virus 1 (BHV-1). In some embodiments, the antigen com varying embodiments, the VP19 protein comprises an amino prises the BRSV N, F and/or G proteins. In some embodi acid sequence having at least 90% sequence identity, e.g., at ments, the antigen induces and/or elicits a protective immune least 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99% or response in the mammal against infection of a bacterium 100% sequence identity, to SEQ ID NO: 11. In varying selected from the group consisting of Mannheimia embodiments, the VP 19 protein is encoded by a nucleic acid haemolytica, Pasteurella multocida, Mycoplasma bovis, sequence having at least 90% sequence identity, e.g., at least Vibrio parahaemolyticus and Legionella pneumophila. 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99% or 100% 0095 Illustrative equine diseases that can be prevented sequence identity, to SEQ ID NO: 12. In varying embodi and/or mitigated by administration of an antigen known to ments, the VP466 protein comprises an amino acid sequence elicit a protective immune response expressed in the cyto having at least 90% sequence identity, e.g., at least 91%, 92%, plasm, in the membrane system or on the Surface of a diatom 93%, 94%, 95%, 96%, 97%, 98%, 99% or 100% sequence include without limitation tetanus, Eastern/Western Equine identity, to SEQ ID NO: 13. In varying embodiments, the Encephalomyelitis (EEE/WEE), rabies, West Nile Virus VP466 protein is encoded by a nucleic acid sequence having (WNV), anthrax, botulism, Equine Herpesvirus (EHV), at least 90% sequence identity, e.g., at least 91%, 92%, 93%, Equine Viral Arteritis (EVA), Equine Influenza, Potomac 94%. 95%, 96%, 97%, 98%, 99% or 100% sequence identity, Horse Fever (PHF), Rotavirus, Strangles, and Streptococcus to SEQID NO: 14. See, e.g., Ha, et al., J. Microbiol Biotech equi. mol. (2008) 18(5):964-7; Huang, et al., Molecular & Cellular 0096 Illustrative canine diseases that can be prevented Proteomics (2002) 1.3:223-231; and van Hulten, et al., Jour and/or mitigated by administration of an antigen known to nal of General Virology (2002) 83:257-265. elicit a protective immune response expressed in the cyto 0101 Viral diseases affecting fish include infectious pan plasm, in the membrane system or on the Surface of a diatom creatic necrosis (IPNV), pancreas disease (PDV), infectious include without limitation Canine Parvovirus, Canine Dis salmon anemia (ISAV), infectious hematopoietic necrosis temper, Canine Parainfluenza, Canine Adenovirus Type 2, (VHSV), viral nervous necrosis, iridoviral disease (RSIV), Canine Leptospira canicola, L. grippotyphosa, L. ictero channel catfish virus disease (CCV), spring viremia of carp haemorrhagiae, L. 28holer, Canine Coronavirus, Measles, (SVCV), grass carp hemorrhage disease (GCHDV). Bacterial Bordetella bronchiseptica, Porphyromonas Denticanis-Gu pathogens to fish Such as Vibrio spp., Listonella anguillarum, lae-Salivosa (Canine periodontitis), and rabies. Vibrio harveyi, Vibrio salmonicida, Moritella viscosa, Aero 0097 Illustrative feline diseases that can be prevented monas Salmonicida Subsp. salmonicida, Aeromonas salmo and/or mitigated by administration of an antigen known to nicida, Yersinia ruckeri, Piscirickettsia Salmonis, Flavobac elicit a protective immune response expressed in the cyto terium branchiophilum, Flavobacterium psychrophilum, plasm, in the membrane system or on the Surface of a diatom Edwardsiella ictaluri, Edwardsiella tarda, Renibacterium include without limitation Feline Panleukopenia, Feline Rhi salmoninarum, Lactococcus garvieae, Photobacterium notracheitis, Feline Calicivirus, Chlamydia psittaci (Chlamy 30holer Subspecies piscicida, Streptococcus iniae, Strepto dophila felis), Feline Leukemia, Feline infectious peritonitis, coccus phocae, Piscirickettsia salmonis, and Flavobacterium and rabies. columnare may be targeted by immunization with antigenic 0098 Illustrative poultry diseases that can be prevented display on the diatom surface. Moreover, there are many and/or mitigated by administration of an antigen known to major parasitic pathogens in fish, for which no commercially elicit a protective immune response expressed in the cyto available vaccines are currently available: Paramoeba spp. plasm, in the membrane system or on the Surface of a diatom (Amoebic gill disease), Cryptobia salmositica, Ichthyobodo include without limitation Infectious Bursal Disease (IBD), spp., Ichthyophthirius multifilis (White spot disease), Cryp Newcastle Disease, Marek’s Disease, Fowl Pox, Gumboro, tocaryon irritans, Trichondina spp., Tetramicra brevifilum, US 2015/0037370 A1 Feb. 5, 2015
Pleistophora anguillarum, Nucleospora salmonis, Myxobo e.g., expressed separately or as a fusion protein. In some lus cerebrialis (whirling disease), Tetracapsula bryosalmo embodiments, the antigen comprises a combination of the nae (proliferative kidney disease; PKD), Kudoa thyrsites, above Y cholera antigens. See, e.g., Price and Holmes, PloS Gyrodactylus spp., Dactylogyrus spp., Benedinia spp., Eubo ONE (2012)7(8): e42434; Kundu, et al., FEMS Immunol Med thrium spp., Lepeophtheirus salmonis, Caligus spp. See, e.g., Microbiol (2009) 56: 179-184: Muse, et al., FEMS Immunol Ha, et al., J Microbiol Biotechnol. (2008) 18(5):964-7 and Med Microbiol (2012) 66: 98-115. Sommerset, et al., Expert Rev. Vaccines. (2005) 4(1):89-101. 0104. In some embodiments, the antigen induces and/or As appropriate or desired, aquaculture vaccines can be deliv elicits a protective immune response in the animal against an ered, e.g., in food and by immersion in water containing enteric pathogen (e.g., Salmonella, Shigella, Campylobacter, diatom expressed antigens. Yersinia). In some embodiments, the antigen induces and/or 0102. In varying embodiments, the antigen elicits and/or elicits a protective immune response in the animal against an induces a protective immune response against Vibrio harveyi. infection of an enteric pathogen selected from the group In varying embodiments, the V. harveyiantigen is one or more consisting of Salmonella spp., Yersinia enterocolitica, Shi of VhhP2, DegO, Vh-HL1 and Vh-ompK proteins. In vary gella sonnei, Shigella flexneri, Campylobacter jejuni, Enta ing embodiments, the VhhP2 protein comprises an amino moeba histolytica, and Giardia. acid sequence having at least 90% sequence identity, e.g., at 0105. In various embodiments, the antigen in the cyto least 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99% or plasm, in the membrane system or on the Surface of the 100% sequence identity, to SEQ ID NO: 15. In varying diatom-based vaccine is a Plasmodium antigen. Numerous embodiments, the VhhP2 protein is encoded by a nucleic acid Plasmodium antigens are known and find use in a diatom sequence having at least 90% sequence identity, e.g., at least based vaccine that inhibits or prevents the transmission and/ 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, 99% or 100% or continued life cycle of a Plasmodium parasite, and/or the sequence identity, to SEQ ID NO: 16. In varying embodi progression of a Plasmodium parasitic infection. For ments, the DegQ, protein comprises an amino acid sequence example, antigens associate with the intra-mosquito stage having at least 90% sequence identity, e.g., at least 91%, 92%, (sexual stages), one can distinguish: antigen Pfg27, Pfs 16, 93%, 94%, 95%, 96%, 97%, 98%, 99% or 100% sequence Pfs25, Pfs28, Pfs45/48 or Pfs230; for the intravascular identity, to SEQ ID NO: 17. In varying embodiments, the (sporozoite) stage: antigen CSP-1, STARP, SALSA or SSP-2: DegQ, protein is encoded by a nucleic acid sequence having for the intrahepatic stage: antigen LSA-1, EXP-1, LSA-3. at least 90% sequence identity, e.g., at least 91%, 92%, 93%, STARP, SALSA or SSP-2; and for the intra-erythrocyte 94%. 95%,96%.97%, 98%, 99% or 100% sequence identity, (merozoite) stage: antigen RAP-1, RAP-2, SERA-1, MSP-1, to SEQ ID NO: 18. In varying embodiments, the Vh-HL1 MSP-2, MSP-3, MSP-4, MSP-5, AMA-1, EMP-1, Pf35, Pf55 protein comprises an amino acid sequence having at least or EBA-175. Plasmodium polypeptides, including without 90% sequence identity, e.g., at least 91%, 92%, 93%, 94%, limitation, CDPK4, HAP2, MAPK-2, MDV 1/Peg3, P47, 95%, 96%, 97%, 98%, 99% or 100% sequence identity, to P48/45, P230, PKG, AP2-0, DOZI, HMGP2, Nek-4, SEQID NO: 19. In varying embodiments, the Vh-HL1 pro Ce1TOS, CDPK3, Chitinase, CTRP, IMC1b, MAOP, P25, tein is encoded by a nucleic acid sequence having at least 90% P28, SOAP. Cap380, CSP, ECP1, IMC1a, LAP1/CCp3/SR, sequence identity, e.g., at least 91%, 92%, 93%, 94%. 95%, LAP2/CCp1, LAP3/CCp5, LAP4/CCp2, LAPS/FNPA, 96%, 97%, 98%, 99% or 100% sequence identity, to SEQID LAP6/CCp4, transglutaminase, CSP, CRMP1, CRMP2, NO:20. In varying embodiments, the Vh-ompK protein com MAEBL, TRAP and UOS3/TREP/S6, and immunogenic prises an amino acid sequence having at least 90% sequence fragments thereof, also find use. identity, e.g., at least 91%,92%, 93%, 94%, 95%,96%.97%, 0106. In various embodiments, the antigen is selected 98%, 99% or 100% sequence identity, to SEQID NO: 21. In from the group consisting of: pollen, hepatitis C virus (HCV) varying embodiments, the Vh-ompK protein is encoded by a core, E1, E2 and NS2 proteins, antigens from Plasmodium nucleic acid sequence having at least 90% sequence identity, species selected from the group consisting of P. vivax, P e.g., at least 91%, 92%, 93%, 94%, 95%, 96%, 97%, 98%, faliciparum circumsporozoite protein (CS), human Pfalci 99% or 100% sequence identity, to SEQID NO: 22. See, e.g., parum, P. vivax, P ovalae, and P. malariae, TRAP MSP-1, Sun, et al., Vaccine (2009) 27:2733-2740; Mao, et al., Aquac MSP-2, MSP-3, MSP-4, MSP-5, AMA-1 RESA, SALSA, ulture (2011) 318:268-272; Zhu, et al., Vaccine (2006) STARP, LSAT and LSA3, HIV-gp120/160 envelope glyco 24:6046-6052; Zhang, et al., Appl Environ Microbiol (2008) protein, Streptococcus Surface protein antigen, influenza 74:6254-62. nucleoprotein, hemagglutinin-neuraminidase Surface infec 0103) In some embodiments, the antigen in the cytoplasm, tion, TcpA pilin subunit, VP1 protein, LMCV nucleoprotein, in the membrane system or on the surface of the diatom Leishmania major Surface glycoprotein (gp63), Bordetella induces and/or elicits a protective immune response in the pertussis Surface protein, rabies virus G protein, Streptococ mammal against a Vibrio 31 holera infection. In some cus M protein, Staphylococcal proteins, Helicobacter pylori embodiments, the antigen comprises one or more epitopes of proteins, Respiratory Syncytial virus (RSV) For G proteins, Cholera Toxin B (CTB) or Cholera Toxin A (CTA). In some Epstein Ban virus (EBV) gp340 or nucleoantigen3A, hemag embodiments, the antigen comprises one or more epitopes of glutinin, Borrelia burgdoferi outer Surface protein (Osp) A, V 31 holera colonization factors TcpA. Tcp and CBP-A. In Mycobacterium tuberculosis 38 kD lipoprotein or 30 kD pro Some embodiments, the antigen comprises a Tcp-A2-CTB tein (Ag85), 10 kD or 65 kD proteins, Neisseria chimera. In some embodiments, the antigen comprises CTB 32holera32ant32 class 1 outer protein, Varicella Zoster virus and TcpA, e.g., expressed separately or as a fusion protein. In 1E62 and gp1, Rubella virus capsid protein, Hepatitis B virus Some embodiments, the antigen comprises CTB and TcpF. pre S1 ag, Herpes simplex virus type 1 glycoprotein G or gp e.g., expressed separately or as a fusion protein. In some D or CP27, Murray valley encephalitis virus Eglycoprotein, embodiments, the antigen comprises toxin co-regulated pilus Hepatitis A virus VP1, polio virus capsid protein VP1,VP2 (TCP), TcpA. TcpF and the chitin binding product (CBP-A), and VP3, Chlamydia trachomatis surface protein, Hepatitis B US 2015/0037370 A1 Feb. 5, 2015 virus envelope Ag pre S2. Human rhinovirus (HRV) capsid, codon.cgi?species 35128. In various embodiments, pre papillomavirus peptides from oncogene E6 and E7. Listeria ferred or more common codons for amino acid residues in T. Surface protein, Varicella virus envelope protein, Vaccinia pseudonana are as follows: virus envelope protein, Brucella Surface protein, Rotavirus, VP-3, VP-4, VP-5, VP-7 and VP-8, combination of one or more of the antigens. Amino Acid Preferred codons for Residue improved expression in diatoms 0107. In various embodiments, the antigen is a breast can Ala GCT, GCA, GCC cer antigen, a lung cancer antigen, a pancreatic cancer anti Arg CGT gen, a colon cancer antigen, or a melanoma cancer antigen. ASn AAT, AAC Antigens that elicit antibodies in a Subject that specifically Asp GAT bind to a tumor-associated antigen (“TAA) can be delivered Cys TGT, TGC Gln CAA, CAG to the Subject using the diatom-based vaccines. Examples of Glu GAG known TAAS include without limitation, melanoma associ Gly GGA ated antigens (MAGE-1, MAGE-3, TRP-2, melanosomal Ile ATC, ATT membrane glycoprotein gp100, gp75 and MUC-1 (mucin-1) His CAT, CAC Leu TTG, CTC associated with melanoma); CEA (carcinoembryonic anti Lys AAG gen) which can be associated, e.g., with ovarian, melanoma or Met ATG colon cancers; folate receptor alpha expressed by ovarian Phe TTC Pro CCA, CCT carcinoma; free human chorionic gonadotropin beta (hCGB) Ser TCT Subunit expressed by many different tumors, including but Thr ACC, ACT not limited to myeloma; HER-2/neu associated with breast Trp TGG cancer, encephalomyelitis antigen HuD associated with Tyr TAC Small-cell lung cancer, tyrosine hydroxylase associated with Wall GTG, GTC, GTT neuroblastoma; prostate-specific antigen (PSA) associated STOP TAA, TAG, TGA with prostate cancer, CA125 associated with ovarian cancer, and the idiotypic determinants of a B cell lymphoma can 0110. In certain instances, less preferred or less common generate tumor-specific immunity (attributed to idiotype-spe codons for expression in a diatom host cell can be included in cific humoral immune response). Moreover, antigens of a polynucleotide sequence encoding an antigenic polypep human T cell leukemia virus type 1 have been shown to tide, for example, to avoid sequences of multiple or extended induce specific CTL responses and antitumor immunity codon repeats, or extended sequences of reduced Stability against the virus-induced human adult T cell leukemia (ATL). (e.g., extended A/T-rich sequences), or having a higher prob See, e.g., Haupt, et al., Experimental Biology and Medicine ability of secondary structure that could reduce or interfere (2002) 227:227-237; Ohashi, et al., Journal of Virology with expression efficiency. In various embodiments, the poly (2000) 74(20):9610-96.16. nucleotide sequence can be synthetically prepared. For 0108 Polynucleotides encoding one or more antigenic example, the desired amino acid sequence of a known anti polypeptides, or immunogenic fragments thereof, can be genic polypeptide, or fragment thereof, desired to be altered for improved expression in diatom host cells, e.g., expressed in a diatom host cell can be entered into a software Thalassiosira pseudonana. For example, codons in the wild program with algorithms for determining codon usage for a type polynucleotides encoding one or more antigenic diatom host cell. Illustrative software includes GeneDesigner polypeptides rarely used by the diatom host cell can be available from DNA 2.0, on the internet at dna20.com/gene replaced with a codon coding for the same or a similar amino designer2 and Reverse Translate (on the internet at bioinfor acid residue that is more commonly used by the diatom host matics.org/sms2/rev trans.html). cell (e.g., employing diatom nuclear codon bias), thereby allowing for more efficient expression of the antigenic 4. Methods of Promoting an Immune Response polypeptide and higher yields of the expressed antigenic 0111 Diatom-based vaccines can be administered to a polypeptide in the diatom host, in comparison to expression Subject to induce a protective immune response against a of the antigenic polypeptide from the wild-type polynucle disease or condition (e.g., an infectious disease or cancer) otide. Methods for altering polynucleotides for improved which the Subject is at risk of developing, or which may expression in a diatom host cell, particularly in a T. pseud progress in the Subject. Onana host cell, are known in the art and described in, e.g., 0112 The pharmaceutical compositions comprising dia Lioudmila, et al., Journal of Phycology (2000) 36(2):379 tom-based vaccines can be formulated for parenteral, topical, 386. oral, mucosal, transdermal, intrapulmonary, systemic or local 0109. In various embodiments, polynucleotide sequences administration. In various embodiments, the pharmaceutical encoding antigenic polypeptides can be improved for expres compositions are administered parenterally, e.g., transder sion in a diatom host cell by changing codons that are not mally, intravenously, Subcutaneously, intradermally, or into common in the diatom host cell (e.g., used less than about the egg (in ovo), or intramuscularly. In some embodiments, 20% of the time). For improved expression of polynucleotide the diatom based vaccines are administered mucosally (e.g., sequences encoding antigenic polypeptides in T. pseudonana orally, intranasally, conjunctivally, intrarectally or intravagi host cells, codons rare or not common to the nucleus of T. nally). In some embodiments, the diatom-based vaccines are pseudonana in the native T. pseudonana nucleic acid delivered in the food and/or water of the animal or by aerosol. sequences are reduced or eliminated. A representative codon Thus, the invention provides compositions for parenteral table Summarizing codon usage in the T. pseudonana nucleus administration that comprise the diatoms described above is found on the internet at kazusa.or.jp/codon/cgi-bin/show Suspended in an acceptable carrier, preferably an aqueous US 2015/0037370 A1 Feb. 5, 2015 carrier. A variety of aqueous carriers may be used, e.g., phos prevent development and/or spread of the disease. Such an phate buffered saline, water, buffered water, 0.4% saline, amount is defined as an “immunogenically effective dose. In 0.3% glycine, hyaluronic acid and the like. These composi this use, the precise amounts again depend on the patients tions may be sterilized by conventional, well known steriliza state of health and weight, the mode of administration, and the tion techniques, or may be sterile filtered. The resulting aque nature of the formulation. ous solutions may be packaged for use as is, or lyophilized, the lyophilized preparation being combined with a sterile 5. Expression Cassettes and Recombinant Vectors Solution prior to administration. The compositions may con tain pharmaceutically acceptable auxiliary Substances as 0118. To use isolated sequences in the above techniques, required to approximate physiological conditions, such as pH recombinant DNA vectors suitable for transformation of adjusting and buffering agents, tonicity adjusting agents, wet microalgae, e.g., diatom host cells, are prepared. Techniques ting agents and the like, for example, Sodium acetate, sodium for transformation are well known and described in the tech lactate, Sodium chloride, potassium chloride, calcium chlo nical and Scientific literature. For example, a DNA sequence ride, Sorbitan monolaurate, triethanolamine oleate, etc. encoding an antigen can be combined with transcriptional 0113 For solid compositions, conventional nontoxic solid and other regulatory sequences which will direct the tran carriers may be used which include, for example, pharmaceu Scription of the sequence from the gene in the intended cells tical grades of mannitol, lactose, starch, magnesium Stearate, of the transformed diatom host cells. In some embodiments, Sodium saccharin, talcum, cellulose, glucose, Sucrose, mag an expression vector that comprises an expression cassette nesium carbonate, and the like. For oral administration, a that comprises the nucleic acid encoding the antigen or anti pharmaceutically acceptable nontoxic composition is formed gens of interest further comprises a promoter operably linked by incorporating any of the normally employed excipients, to the nucleic acid encoding the antigen. In other embodi such as those carriers previously listed, and generally 10-95% ments, a promoter and/or other regulatory elements that direct of active ingredient and more preferably at a concentration of transcription of the nucleic acid encoding the antigen or anti 25%-7.5%. gens of interest are endogenous to the diatom and the expres 0114 For aerosol and/or intrapulmonary administration, sion cassette comprising the nucleic acid encoding the anti the diatom-based vaccines are preferably supplied in finely gen orantigens of interest is introduced, e.g., by homologous divided form along with a surfactant and propellant. The recombination, Such that the heterologous nucleic acid Surfactant must, of course, be nontoxic, and preferably encoding the antigen orantigens of interest is operably linked soluble in the propellant. Representative of such agents are to an endogenous promoter and is expression driven by the the esters or partial esters of fatty acids containing from 6 to endogenous promoter. 22 carbon atoms, such as caproic, octanoic, lauric, palmitic, 0119 Regulatory sequences include promoters, which Stearic, linoleic, linolenic, olesteric and oleic acids with an may be either constitutive or inducible. In some embodi aliphatic polyhydric alcohol or its cyclic anhydride. Mixed ments, a promoter can be used to direct expression of the esters, such as mixed or natural glycerides may be employed. nucleic acid encoding the antigen orantigens of interest under A carrier can also be included, as desired, as with, e.g., leci the influence of changing environmental conditions. thin for intranasal delivery. Examples of environmental conditions that may affect tran 0115. In sometherapeutic applications, diatom-based vac Scription by inducible promoters include anaerobic condi cines are administered to a patient in an amount Sufficient to tions, elevated temperature, or the presence of light. Promot induce and immune response and to prevent, reduce, inhibit, ers that are inducible upon exposure to chemicals reagents are ameliorate, mitigate or reverse disease symptoms. An amount also used to express the nucleic acid encoding the antigen or adequate to accomplish this is defined as a “therapeutically antigens of interest. Other useful inducible regulatory ele effective dose.” Amounts effective for this use will dependon, ments include copper-inducible regulatory elements (Mettet e.g., the particular polypeptide, the manner of administration, al., Proc. Natl. Acad. Sci. USA 90:4567-4571 (1993); Furstet the weight and general state of health of the patient, and the al., Cell 55:705-717 (1988)); tetracycline and chlor-tetracy judgment of the prescribing physician. cline-inducible regulatory elements (Gatz et al., Plant J. 0116. The vaccines of the invention contain as an active 2:397-404 (1992); Roder et al., Mol. Gen. Genet. 243:32-38 ingredient an immunogenically effective amount of the dia (1994); Gatz, Meth. Cell Biol. 50:411-424 (1995)); ecdysone tom-based vaccine, as described herein. Useful carriers are inducible regulatory elements (Christopherson et al., Proc. well known in the art, and include, e.g., thyroglobulin, albu Natl. Acad. Sci. USA 89:6314-6318 (1992); Kreutzweiser et mins such as human serum albumin, Cholera Toxin B (CTB), al., Ecotoxicol. Environ. Safety 28:14-24 (1994)); heat shock tetanus toxin (Tet), E. coli heat-labile toxin (LT) and immu inducible regulatory elements (Takahashi et al., Plant nogenic fragments thereof, polyamino acids such as poly(D- Physiol. 99:383-390 (1992); Yabe et al., Plant Cell Physiol. lysine:D-glutamic acid), influenza, hepatitis B virus core pro 35:1207-1219 (1994); Ueda et al., Mol. Gen. Genet. 250:533 tein, hepatitis B virus recombinant vaccine and the like. The 539 (1996); and lac operon elements, which are used in vaccines can also contain a physiologically tolerable (accept combination with a constitutively expressed lac repressor to able) diluent such as water, phosphate buffered saline, or confer, for example, IPTG-inducible expression (Wilde et al., saline, and further typically include an adjuvant. Adjuvants EMBO J. 11:1251-1259 (1992)). An inducible regulatory Such as incomplete Freund's adjuvant, aluminum phosphate, element also can be, for example, a nitrate-inducible pro aluminum hydroxide, Saponins, or alum are materials well moter, e.g., derived from the spinach nitrite reductase gene known in the art. (Backet al., Plant Mol. Biol.17:9 (1991)), oralight-inducible 0117 Vaccine compositions containing the polypeptides promoter, such as that associated with the Small subunit of or nucleic acids described herein are administered to a patient RuBP carboxylase or the LHCP gene families (Feinbaum et to elicit a protective (e.g., that prevents or treats a disease in al., Mol. Gen. Genet. 226:449 (1991); Lam and Chua, Sci the animal) immune response against the antigen and thus ence 248:471 (1990)), or a light. US 2015/0037370 A1 Feb. 5, 2015
0120 In one example, a promoter sequence that is respon 0.125 Nucleic acid sequences encoding one or more anti sive to light may be used to drive expression of a nucleic acid gens of interest are expressed recombinantly in diatom host encoding the antigen or antigens of interest (e.g., Hahn, Curr cells. As appreciated by one of skill in the art, expression Genet. 34:459-66, 1999; Loppes, Plant Mol Biol 45:215-27, constructs can be designed taking into account Such proper 2001; Villand, Biochem J327:51-7), 1997. Other light-induc ties as codon usage frequencies of the organism in which the ible promoter systems may also be used. Such as the phyto nucleic acid encoding the one or more antigens of interest is chrome/PIF3 system (Shimizu-Sato, Nat Biotechnol 20): to be expressed. Codon usage frequencies can be tabulated 1041–4, 2002). Further, a promoter can be used that is also using known methods (see, e.g., Nakamura et al. Nucl. Acids responsive to heat can be employed to drive expression in Res. 28:292, 2000). Codon usage frequency tables, including algae such as Chlamydomonas (Muller, Gene 111:165-73, those for diatoms, are also available in the art (e.g., in codon 1992; von Gromoff, Mol Cell Biol 9:3911-8, 1989). Addi usage databases of the Department of Plant Genome tional promoters, e.g., for expression in algae Such as green Research, Kazusa DNA Research Institute (on the internet at microalgae, include the RbcS2 and Psal) promoters (see, e.g., kazusa.or.jp/codon). Stevens et al., Mol. Gen. Genet. 251: 23-30, 1996; Fischer & 0.126 Cell transformation methods and selectable markers Rochaix, Mol Genet Genomics 265:888-94, 2001). for bacteria and cyanobacteria are well known in the art 0121. In some embodiments, the promoter may be from a (Wirth, Mol Gen Genet. 1989 March; 216(1):175-7: Kok gene associated with photosynthesis in the species to be trans sharova, Appl Microbiol Biotechnol 2002 February: 58(2): formed or another species. For example such a promoter from 123-37: Thelwell). Transformation methods and selectable one species may be used to direct expression of a protein in markers for use in bacteria, also useful in diatom host cells, transformed algal cells (e.g., diatom cells) or cells of another are well known (see, e.g., Green and Sambrook, Molecular photosynthetic marine organism. Suitable promoters may be Cloning: A Laboratory Manual, Cold Spring Harbor Labora isolated from or synthesized based on known sequences from tory Press: 4' edition (2012)). other diatoms and/or photosynthetic organisms. Preferred promoters are those for genes from other photosynthetic spe 6. Methods of Expressing Antigenic Polypeptides in cies that are homologous to the photosynthetic genes of the Diatoms algal host to be transformed. For example, a series of light harvesting promoters from the fucoxanthin chlorophyll bind 0127. The polynucleotides encoding antigenic polypep ing protein have been identified in Phaeodactylum tricornu tides, and immunogenic fragments thereof, are expressed in tum (see, e.g., Apt, et al. Mol. Gen. Genet. 252:572-579, and produced from a diatom host cell, e.g., a diatom that is a 1996). In other embodiments, a carotenoid chlorophyll bind Bacillariophyta (e.g., Bacillariophyceae (Raphid, pennate ing protein promoter, such as that of peridinin chlorophyll diatoms), Coscinodiscophyceae (centric diatoms), Fragilari binding protein, can be used. ophyceae (Araphid, pennate diatoms) and/or Medio 0122. In some embodiments, a promoter used to drive phyceae). In some embodiments, the diatom is a Thalassio expression of a heterologous nucleic acid encoding an anti sirophycidae. In some embodiments, the diatom is a gen or antigens of interest is a constitutive promoter. Thalassiosirales. In some embodiments, the diatom is a Examples of constitutive strong promoters for use in microal ThalassioSiraceae. In some embodiments, the diatomis of the gae include, e.g., the promoters of the atpA, atpB, and rbcL genus Thalassiosira (e.g., Thalassiosira pseudonana). Fur genes. Various promoters that are active in cyanobacteria are ther diatom species of use as host cells to express polynucle also known. These include promoters such as the (constitu otides encoding antigenic polypeptides are discussed above tive) promoter of the psbA3 gene in cyanobacteria and pro and herein. moters such as those set forth in U.S. Patent Application 0128. The nucleus of diatom host cells are transformed, Publication No. 20020164706, which is incorporated by ref e.g., by homologous recombination techniques, to contain erence. Other promoters that are operative in plants, e.g., and stably express one or more polynucleotides encoding one promoters derived from plant viruses, such as the CaMV35S or more antigenic polypeptides or an immunogenic fragment promoters, can also be employed in algae (e.g., diatoms). thereof, as described herein, integrated into the nuclear 0123. A promoter can be evaluated, e.g., by testing the genome. ability of the promoter to drive expression in plant cells, e.g., 0129. Transformation of the nuclei of diatom host cells diatom host cells, in which it is desirable to introduce an can be carried out according to techniques well known to expression construct that expresses an antigen or antigens of those persons skilled in the art. Examples of such techniques interest. include without limitation electroporation, particle bombard ment, biolistic methods or gene gun. 0124. A vector comprising nucleic acid sequences that encode one or more antigens of interest will typically com 0.130 Expression of the antigenic polypeptides in the dia prise a marker gene that confers a selectable phenotype on tom host cells can be detected using any method known in the algae or bacterial cells. Such markers are known. For art, e.g., including immunoassays (ELISA, Western Blot) example, the marker may encode antibiotic resistance. Such and/or nucleic acidassays (RT-PCR). Sequences of expressed as resistance to kanamycin, G418, bleomycin, hygromycin, polypeptides can be confirmed using any method known in and the like. In some embodiments, selectable markers foruse the art (e.g., mass spectrometry). in Chlamydomonas can be markers that provide spectinomy I0131) Antigenic polypeptides expressed in a diatom host cin resistance (Fargo, Mol Cell Biol 19:6980-90, 1999), kana cell are generally properly folded without performing dena mycin and amikacin resistance (Bateman, Mol-Gen Genet. turation and refolding. Recombinant expression of proteins 263:404-10, 2000), Zeomycin and phleomycin resistance from heterologous polynucleotides incorporated into the (Stevens, Mol Gen Genet. 251:23-30, 1996), and paromomy nuclear genome of a diatom host cell is known in the art and cin and neomycin resistance (Sizova, Gene 277:221-9, 2001). described in numerous publications, including, e.g., Poulsen, US 2015/0037370 A1 Feb. 5, 2015
et al., J Phycol (2006) 42:1059-1065; Apt, et al., Mol Gen (2009) 106:870-875). The biosilica cell wall of T. pseud Genet (1996) 252:572-579, and Dunahay, et al., J. Phycol. Onana is non-toxic, with a different chemical structure than (1995)31:1004-1012. fibrous silica which causes silicosis, and can also act as an adjuvant as has been shown for silica based immune stimu 7. Kits lators (Lincopan, et al., BMC Biotech (2009) 9:5-24). Algae in 0.132. In various embodiments, the invention provides kits general are completely safe for ingestion with no adverse comprising one or more diatom-based vaccines, as described effects and are used as food Supplements because many algal herein. In varying embodiments, the kits comprise diatom cellular constituents are beneficial to health (Gantar and host cells engineered to express one or more antigens of Svircev. J. Phycol (2008) 44:260-268). Ingestion of algae in interest that are packaged in one or multiple unitary doses for the microparticle range is safe since people are known to administration as a vaccine (e.g., to induce a protective ingest other types of microparticles at >10' per day in normal immune response upon administration). In varying embodi living, including silica based particles (Powell, et al., Br J ments, the diatom host cells may be formulated for adminis Nutr (2007) 98:S59-S63). Safety should not be an issue in tration by the routes described above, e.g., oral, intravenous, cattle. Subcutaneous, mucosal. Depending on the desired route of 0.136. Histophilus somni infection is targeted in the delivery, the diatoms may be formulated in a liquid and pack present example because it is a significant cause of Bovine aged in a vial, in a pressurized container (e.g., for aerosolized Respiratory Disease, a high priority economically important and/or intrapulmonary delivery), freeze-dried, compressed disease of U.S. livestock. Bovine respiratory disease is said to into tablets and/or mixed into food. be “the most important cause of economic losses for the cattle backgrounding and feedlot industries (McVey, An Hlth Res EXAMPLES Rey (2009) 10:165-167). The economic loss to the North American beef cattle industry was estimated to be greater 0133. The following examples are offered to illustrate, but than $500,000,000 per year (Miles, An Hlth Res Rey (2009) not to limit the claimed invention. 10:101-103). Fulton reported BRD to be the leading cause of morbidity and mortality in feedlots (Fulton, An Hlth Res Rev Example 1 (2009) 10:131-239). Earlier studies indicated that 75% of clinical diagnoses and 64% of necropsy diagnoses offeedlot Diatom-Based Vaccines Against Bovine Respiratory cattle were respiratory tract disease (Jensen, et al., JAm Vet Disease Med Assoc (1976) 169:500-506). Not only is BRD a very 0134. The goal is to develop vaccines using diatoms (uni significant cause of mortality but it also greatly decreases the cellular algae) to express protective antigens of pathogens. market value of surviving cattle (Smith, An Hlth Res Rev These diatom based mucosal (e.g. orally, Sublingually, buc (2009) 10:105-108) and adds to infrastructure and labor costs cally, intranasally, intravaginally, intrarectally, conjuncti (Jim, An Hlth Res Rev (2009) 10:109-110). There is also a vally, intrapulmonarily, by aerosol or transdermally) or sys great impact on the dairy industry, with BRD accounting for temic vaccines would provide low cost, stable vaccines 22.5% of unweaned heifer mortality and 46.5% of weaned against widespread infectious diseases. heifer mortality (Patrick, An Hlth Res Rev (2009) 10:111 0135 Diatoms provide an expression platform and, 112). We chose to express the Histophilus somni (Angen, Int. because their cell walls are made of nanostructured silica, J. Syst. Evol. Microbiol. (2003) 53:1449-1456) (formerly also act as an adjuvant (Lincopan, et al., BMC Biotech (2009) Haemophilus somnus) surface subunit antigen IbpADR2/Fic 9:5-24). Furthermore, as mucosal vaccines, they stimulate the on the diatom Surface and intracellularly, in order to test common mucosal immune system to protect against bovine protection in experimental bovine respiratory disease. In a respiratory disease and may have broader applications to recent review, Miles indicated that it is time to “focus on the infections of other mucosal sites. Diatoms are attractive as animal’s response to the pathogens' of bovine respiratory vaccines because they replicate in natural or artificial sea disease (Miles, An Hlth Res Rev (2009) 10:101-103). water at generally ambient temperature with Sunlight and 0.137 Histophilus somni is one etiologic agent of bovine minimal nutrients, making inexpensive production feasible. respiratory disease which allows testing protection of diatom Because they are photosynthetic autotrophs, diatoms require expressed antigens against this and other infections of the little nutrient and can be grown on a large scale in artificial or bovine respiratory tract. We have defined the mechanism of filtered sea water at ambient temperatures. This, plus their virulence and protection due to H. Somni IbpA DR2/Fic stability, allows for inexpensive production of effective vac (Worby, et al., Molec Cell (2009)34:93-103: Zekarias, Infect cines. They can also be lyophilized for long term storage and Immun (2010)78:1850-1858) and have a reproducible bovine can be Sonicated to produce fine particles and nanoparticles. experimental model of H. Somni pneumonia. Using this Diatoms are in the microparticle size range (T. pseudonana is model in the natural host, we have demonstrated that immu 4x6 microns) but could be converted to fine particles (2.5-0.1 nization with the recombinant H. Somni Ibp A DR2 subunit microns) or even nanoparticles (<0.1 micron) after briefsoni protein protects calves against challenge with the virulent cation or mechanical crushing. Microparticles, fine particles bacteria (Geertsema, et al., Vaccine. (2011) 29(29-30):4805 and nanoparticles are better mucosal vaccine antigens than 12). To investigate the mechanisms of protection, we soluble proteins because particles are taken up best by appro expressed the recombinant protein and made antibodies. The priate epithelial cells and are best at Stimulating antigen pre Fic motif in IbpA DR2 was shown to cause retraction and senting cells such as dendritic cells (Adair B M. “Nanopar rounding up of HeLa cells (Worby, et al., Molec Cell (2009) ticle vaccines against respiratory viruses.” In Wiley 34:93-103) and bovine respiratory epithelial cells (Zekarias, Interdisciplinary Reviews: Nanomedicine and Nanobiotech Infect Immun (2010) 78:1850-1858). Antibodies to IbpA nology. 1: 405-414, 2009: Foged, et al., Intl J Pharmaceut DR2 neutralized cytotoxicity. We also showed that a mutant (2005) 298:315-322; Sharp, et al., Proc Natl AcadSci USA recombinant IbpA DR2 protein with the critical histidine US 2015/0037370 A1 Feb. 5, 2015
replaced by alanine (DR2 H/A) was not toxic but did protect ders, et al., Infect Immun (1986)54:555-560; Widders, et al., mice against H. Somni septicemia in a preliminary study. Res Vet Sci (1989) 46:212-217:Yarnall, et al., Scand.J Immu Therefore, IbpA DR2 H/A is a toxoid of use to stimulate nol (1988) 28:129 137) and specificity of antibodies for vari immunity against H. Somni. The IbpA DR2 and Ibp A DR2 ous H. Somni antigens (Corbeil, et al., Infect Immun (1987) H/A genes are available for cloning into diatoms and the 55:1381-1386; Corbeil, et al., Infect Immun (1991) 59:4295 antibodies are available for demonstrating Surface expression 4301; Gogolewski, et al., Infect Immun (1987).55:1403-1411; of IbpA DR2 and DR2 H/A. The nucleic acid sequence and Yarnall, et al., J Clin Microbiol (1989) 27:111 117). Passive the deduced amino acid sequence of IbpA DR2 has been immunization studies showed that antibody to a 40K outer published, e.g., in Cole, et al., J Gen Microbiol (1993) 139: membrane protein (OMP) antigen was protective and the 2135-21.43. antigen was conserved (Corbeil, et al., Infect Immun (1991) 0138 Although H. Somni is an important cause of BRD, 59:4295-4301; Gogolewski, et al., Infect Immun (1988) the etiology of the BRD complex is multifactorial. The most 56:23.07 2316). IgG2 antibodies were most protective (Cor prevalent viruses include bovine respiratory syncytial virus beil, et al., CanJ Wet Res (1997) 61:207-213). Other virulence (BRSV), parainfluenza-3 (PI), bovine viral diarrhea virus factors (or antigens) of H. Somni have been shown to undergo (BVDV) and bovine herpes virus 1 (BHV-1) (Ellis, An Hlth antigenic or phase variation, so are not good vaccine candi Res Rey (2009) 10:149-153: Fulton, et al., An Hlth Res Rev dates (Ekins, et al., J Bacteriol (2004) 186:4407-441.1; (2009) 10:131-239). Prevalent bacteria include H. somni, Inzana, et al., Infect Immun (1992) 60.2943-2951; Inzana, et Mannheimia haemolytica, Pasteurella multocida and Myco al., Infect Immun (1997) 65:4675-4681; Tagawa, et al., Vet plasma bovis (Confer, An Hlth Res Rev (2009) 10:145-148: erinary Microbiol (2000) 71.245-254; Tremblay, et al., Vet Fulton, et al., An Hlth Res Rey (2009) 10:131-239). Stress is Microbiol (2006) 114: 104-114). In the course of these studies another critical factor, which may be due to weaning, ship of H. Somni host-parasite relationships, we discovered a Sur ping, Sudden changes in weather, social restructuring, novel face immunoglobulin binding protein (IgEP, later called feedstuff or handling, humidity, ventilation, dust etc. (Snow IbpA) which consisted of a surface fibrillar network (Cole, et der. An Hlth Res Rev (2009) 10:117-119). Host response is al., Molec Microbiol (1992) 6:1895-1902: Corbeil, et al., also critical in pathogenesis and protection in BRD (CZupryn Infect Immun (1997) 65:4250-4257: Widders, et al., J Med ski, An Hlth Res Rev (2009) 10:141-143). We have studied Micro (1988) 26:307-311; Widders, et al., Infect Immun bacterial/viral synergy in BRD (Berghaus, et al., Vaccine (1989) 57:639 642; Yarnal, et al., Scand.J Immunol (1988) (2006) 24:6018-6027; Corbeil, et al., Vet Immunol Immuno 28:129 137:Yarnall, et al., J Gen Microbiol (1988) 134:1993 pathol (2006) 113:191-199; Gershwin, et al., Vet Immunol 1999: Yarnal, et al., JClin Microbiol (1989)27:111-117). We Immunopathol (2005) 107:119-130) but this proposal will have since developed methods for genetic exchange in H. focus on protection against H. Somni pneumonia in order to somni (Sanders, et al., FEMS Microbiol Letters (1997) 154: devise means of intervention to prevent or control BRD. 251-258), made partial or complete Ibp.A deletions (Hoshi 0.139. Histophilus somni is a prevalent cause of bovine noo, et al., Microb Pathog. (2009) 46:273-282; Sanders, et pneumonia but also causes septicemia, myocarditis, throm al., Microbial Pathog. (2003) 34:131-139), analyzed the botic meningoencephalitis, abortion and arthritis (Confer, An genetic sequence of IbpA (Cole, et al., J Gen Microbiol Hlth Res Rey (2009) 10:145-148; Corbeil, An Hlth Res Rev (1993) 139:2135-2143: Tagawa, et al., Microbial Pathog. (2008) 8:151-160; Gogolewski et al., Vet Pathol (1987) (2005) 39:159-170) and shown that four serum sensitive 24:250-256: Harris, et al., Can. Vet. J. (1989) 30:816-822: strains of H. Somni from asymptomatic carriers lack the Humphrey, et al., Am. J. Vet. Res. (1982) 43:791-795: whole IbpA ORF (Cole, et al., Molec Microbiol (1992) O'Toole, et al., Wet Pathol (2009) 46:1015-1017: Sandal, et 6:1895-1902). This correlation of Ibp A with serum resistance al., Microbes Infect (2009) 11:254-263; Sandal, et al., Trends was also detected by IgG2 Fc binding studies (Widders, et al., in Microbiol (2010) 18:90-99; Widders, et al., Infect Immun Infect Immun (1989) 57:639 642). Ibp.A deletion studies (1986) 54:555-560), as well as disease in domestic sheep, showed that IbpA was toxic for murine and bovine macroph bighorn sheep and bison (Diaz-Aparicio, et al., CanJ Wet Res ages with inhibition of phagocytosis and disruption of actin (2009) 73:157-160; Dyer, J Wet Diagn Invest (2001) 13:419 filaments (Hoshinoo, et al., Microb Pathog. (2009) 46:273 421; Lees, et al., CanJ Wet Res (1994) 58:202-210; Tanaka, et 282). The sequence of IbpA revealed many putative func al., J Wet MedSci (2005) 67:255-262: Ward, et al., CanJ Vet tional domains, including adhesion domains or motifs in the Res (1995) 59:173-178: Ward, et al., Can J Wet Res (1999) N-terminal region (HBD, CRD and RGD) (FIG. 1). Three 63:166-169; Ward, et al., Can J Wet Res. (2006) 70:34-42). domains (A3, A5 and DR2) were expressed in E. coli, purified Asymptomatic genital or respiratory carriers are also com and used for vaccine studies in mice and calves (Geertsema, mon (Corbeil. An Hlth Res Rev (2008) 8:151-160; Humphrey, et al., Vaccine (2008) 26:4506–4512; Geertsema, et al., Vac et al., Am. J. Vet. Res. (1982) 43:791-795). We have developed cine (2011) 28: 4805-481). IbpA DR2 protected both mice bovine and mouse models for H. Somni induced BRD, bovine (Geertsema, et al., Vaccine (2008) 26:4506–4512) and calves abortion and septicemia (Geertsema, et al., Microbial Pathog (Geertsema, et al., Vaccine (2011) 28:4805-481). We recently (2007) 42:22-28: Geertsema, et al., Vaccine (2008) 26:4506 reported that cytotoxicity to HeLa cells is due to the Fic motif 4512; Geertsema, et al., Vaccine. (2011) 29(29-30):4805-12; in the DR1 and DR2 domains of IbpA (Worby, et al., Molec Gogolewski, et al., Vet Pathol (1987) 24:250 256: Gogo Cell (2009) 34:93-103). lewski, et al., Infect Immun (1987) 55:1403-1411; Gogo 0140. We showed that the Fic motif inactivates RhoGT lewski, et al., Infect Immun (1988) 56:2307-2316; Gogo Pases by adenylylation (also called ampylation) resulting in lewski, et al., J Clin Microbiol (1989) 27:1767-1774; disruption of actin filaments and cell rounding or retraction Widders, et al., Infect Immun (1986)54:555-560; Widders, et (Worby, et al., Molec Cell (2009) 34:93-103). We then al., Res Vet Sci (1989) 46:212-217). The bovine studies showed the bovine alveolar type 2 (BAT2) cells were more defined isotypic antibody responses to H. Somni (Gogo susceptible to H. Somni and its IbpA enriched concentrated lewski, et al., J Clin Microbiol (1989) 27:1767-1774; Wid culture supernatant (CCS) toxicity than bovine turbinate (BT) US 2015/0037370 A1 Feb. 5, 2015
cells (FIG. 2) (Zekarias, et al., Infect Immun (2010) 78:1850 0.143 Gershwin and Corbeil have collaborated to investi 1858). HeLa cells were least susceptible (Zekarias, et al., gate H. Somni/BRSV Synergism in calves (Berghaus, et al., Infect Immun (2010)78:1850-1858). In this case, cytotoxicity Vaccine (2006)24:6018-6027; Gershwin, et al., Vet Immunol refers to retraction and rounding, not necessarily cell death. Immunopathol (2005) 107:119-130). First it was shown that We could not detect markers of either apoptosis or autophagy. BRSV aerosol infection of calves 6 days before intrabron When cells were kept for 14 hours after the 4hr treatment with chial inoculation of H. Somni resulted in a greater IgE H. Somni or its CCS, the cells were still retracted but had not response to H. Somni as well as more severe pneumonia of detached from the glass or plastic. The greater Susceptibility longer duration. Then we found that the specificity of the IgE of BAT2 cells was relevant to disease since H. Somni is host response in dual infection differed from the IgG response (Corbeil, et al., Vet Immunol Immunopathol (2006) 113:191 specific for ruminants (Corbeil, An Hlth Res Rev (2008) 199). The IgE immunodominant H. Somni antigen was the 8:151-160; Harris, et al., Can. Vet. J. (1989) 30:816-822: 41K major outer membrane protein (MOMP). IgG antibodies Humphrey, et al., Am. J. Vet. Res. (1982) 43:791-795; Ward, et did not recognize the MOMP at the dilution used but reacted al., CanJ Wet Res (1995) 59:173-178: Ward, et al., CanJ Vet strongly to the 40KOMP (Corbeil, et al., Vet Immunol Immu Res (1999) 63:166-169: Ward, et al., Can J Wet Res. (2006) nopathol (2006) 113:191-199), which was previously shown 70:34-42) and is found primarily in the alveoli at necropsy in to be protective (Gogolewski, et al., Infect Immun (1988) BRD (Bryson, et al., J. Comp. Pathol. (1990) 103:433-445: 56:23.07 2316). Interestingly, the IgE antibodies which Gogolewski, Wet Pathol (1987) 24:250-256). Colonization of strongly reacted with the MOMP, did not react with the trun the upper respiratory tract, as modeled by BT cells, with less cated, 33K MOMP in the IbpA negative strain 129Pt. This cytotoxicity may be relevant to the carrier state. The role of implied that this asymptomatic carrier strain may not stimu the Fic motif of IbpA DR2 in bovine disease was defined late a strong IgE response, since the dominant IgE epitopes using a mutant recombinant DR2 protein with the critical were missing (Corbeil, et al., Vet Immunol Immunopathol histidine in Fic replaced by adenine (DR2 H/A). DR2/Fic (2006) 113:191-199). Since IgE responses to BRSV and H. protein caused retraction of BAT2 cells and DR2 H/A did not, somni are associated with increased pathology, lack of IgE confirming the role of the Fic motif (FIG. 2). stimulating epitopes may be advantageous (Gershwin, et al., 0141. This finding was then extended by confocal micros Vaccine (1998) 16:1225-36; Gershwin, et al., Vet Immunol copy showing that the IbpA DR2 was taken up into BAT2 Immunopathol (2005) 107:119-130; Kalina, Vaccine (2004) cells even though live H. Somnibacteria did not invade the 22:1465-72; Ruby, et al., Vet Microbiol (2000) 76:373-383). cells (Zekarias, et al., Infect Immun (2010) 78:1850-1858). 0144 Of relevance to this study is the characterization of Therefore we investigated paracellular migration using BAT2 diatom cell wall proteins via proteomics (Frigeri, et al., Mol monolayers in Transwells. The results showed that IbpA Cell Proteomics (2006) 5:182-193), and the biochemical and DR2/Fic mediates crossing the alveolar barrier by causing molecular characterization of a specific cell Surface protein BAT2 cells to retract, so that H. Somni invades the blood called p150 that is associated with a specific substructure of stream (Zekarias, et al., Infect Immun (2010) 78:1850-1858). the T. pseudonana cell wall at a particular period of growth Others have shown that the Fic motif is involved in pathoge (Davis, et al., J Phycol (2005) 41:577-589). This study nicity of Vibrio parahaemolyticus (Yarbrough, et al., Science included cell Surface protein labeling and purification, pro (2009) 323:269-272) and Legionella pneumophila (Roy, et tein sequence determination, antibody production, and al., Cell Biol (2009) 2:1-3). Since Fic motifs are found in the assessment of its cell Surface localization as a function of cell genomes of many bacterial pathogens, this is a new frontier in cycle stage using 48holer-based fluorescence microscopy microbial pathogenesis (Kinch, et al., PloS ONE (2009) 4:1-9: (Davis, et al., J. Phycol (2005) 41:577-589). Another class of Roy, et al., Cell Biol (2009) 2:1-3: Worby, et al., Molec Cell general cell wall coat proteins identified in diatoms are called (2009)34:93-103:Yarbrough, et al., Science (2009)323:269 frustulins, which are ubiquitous (found in all diatom species 272: Zekarias, et al., Infect Immun (2010) 78:1850-1858). examined) (Fischer, et al., J Phycol (1999) 35(1): 113-120: Antibody to rIbpADR2 neutralized cytotoxicity and paracel Kroger, et al., EMBOJ (1994) 13(19):4676-4683; Kroger, et lular migration. The neutralization of DR2/Fic cell retraction al., Euro J Biochem (1996) 239(2):259-264). Sequences parallels in vivo bovine and murine protective vaccination responsible for targeting these proteins to the cell wall have studies wherein IbpA DR2 vaccination protected (Geert been identified, and fluorescent labeling at the cell surface has sema, et al., Vaccine (2008) 26:4506–4512; Geertsema, et al., been accomplished using GFP fusions (Fischer, et al., J. Phy Vaccine (2011) 28: 4805-481). col (1999) 35(1): 113-120: Kroger, et al., Protist (2000) 151 0142. After developing a method to reproducibly induce (3):263-273). Expression of the GFP foreign protein at the severe BRSV disease using aerosol infection with a clinical diatom cell surface demonstrates the ability needed to express isolate (CA-1), studies were done to demonstrate that vacci H. Somni recombinant IbpADR2 and DR2H/A at the surface. nation with formalin inactivated BRSV vaccine could induce 1) Strain Variation of H. Somni Ibp A vaccine exacerbated disease (Gershwin, et al., Vaccine (1998) 0145 IbpA causes BAT 2 cells to retract, permitting the 16:1225–36; Gershwin, et al., Am J Wet Res. (2000) 61:291-8; virulent bacteria to cross the alveolar barrier, indicating that Gershwin, et al., Vet Immunol Immunopathol (2005) 107: IbpA is an important virulence factor of H. Somni. Also, 119-130; Woolums, et al., Am J Wet Res. (1999)60(4):473-80; vaccination with IbpA DR2 protein protected mice (Geert Woolums, et al., Vaccine. (1999) 17(11-12): 1293-7). Both sema, et al., Vaccine (2008) 26:4506–4512) or calves (Geert infection and vaccination with BRSV modulates immune sema, et al., Vaccine (2011) 28: 4805-4812 and below) responses towards a Th2 cytokine profile and induces IgE against H. Somni infection and antibody to Ibp A DR2 pro antibody formation (Gershwin, et al., Am J Wet Res. (2000) tected bovine alveolar cells against cytotoxicity (Geertsema, 61:291-8; Gershwin, et al., Vet Immunol Immunopathol et al., Vaccine (2011) 28: 4805-4812, Zekarias, et al., Infect (2005) 107:119-130; Kalina, et al., Vaccine (2004) 22:1465 Immun (2010) 78:1850-1858). These studies show that IbpA 72). DR2 is a protective antigen. Therefore, presence of IbpA was US 2015/0037370 A1 Feb. 5, 2015
evaluated in different strains in order to define whether anti against H. Somni induced bovine pneumonia. This protection genic conservation occurs (Zekarias, et al., Vet Microbiol. is associated with specific serum IgG1 and IgG2 antibody (2011) 149:177-185). We found that a minority of preputial responses and IgG1, IgG2 and IgA responses in bronchial carrier strains lacked Ibp A but all other tested disease or secretions. Since rDR2 immunized calves had lowest IgE carrier isolates were IbpA positive. The tested positive strains antibody levels, IgE mediated immunopathogenesis is least had either both IbpA DR1/Fic and IbpA DR2/Fic or only likely with DR2 immunization. IbpADR2/Fic by PCR. Cytotoxicity and sequence analysis of 0.148. To access the mechanism of protection in this calf DR2/Fic from selected strains revealed conservation of vaccine study, we determined whether Sera from immunized sequence and function. In addition to previous immunization protected calves neutralized the 50holeraš0ant50 of Ibp A studies with Ibp A DR2, passive protection of mice against H. DR2 for BAT2 cells in culture. Untreated control cells or somni septicemia with antibody to Ibp A DR2/Fic indicated those treated with H. Somni plus bovine convalescent phase that the IbpA DR1/Fic and/or DR2/Fic domains are candidate serum or bovine antibodies to Ibp A DR2 had significantly vaccine antigens which should protect against many strains of less (P<0.01) cell retraction than those treated with bacteria H. Somni (Zekarias, et al., Vet Microbiol. (2011) 149:177 plus preimmune serum (FIG. 4). 185). Conservation of IbpA DR2/Fic in most carrier strains 3) Antibodies to IbpA Subunits A3, A5 and DR2 in Bovine indicates that they may be virulent if introduced to susceptible Experimental H. Somni Pneumonia. animals at susceptible sites. Conservation of the IbpA DR2 0149 Isotypic antibody levels in serum from earlier H. antigen in all disease isolates tested is encouraging for devel somni infection studies (29 calves in 3 different studies with opment of protective vaccines with diatoms expressing IbpA experimental H. Somnipneumonia without vaccination) were DR2. evaluated throughout the infection period to determine the 2) Vaccination of Calves with ribpADR2 Protects Against H. kinetics of the IgG1 and IgG2 responses to recombinant Ibp A somni Induced Pneumonia. subunits A3, A5, and DR2 as well as control whole cell and 0146 We tested whether a bovine vaccine composed of Supernatant antigens. Calves responded to all antigens but IbpA recombinant subunits (see FIG.1) would protect against backgrounds and kinetics differed. Backgrounds were high challenge with virulent H. Somni. To test this vaccine, healthy est with the control whole cell and culture supernatant anti 5-6 week old calves were received from a nearby dairy and gens for both IgG1 and IgG2 responses. IgG2 antibody levels vaccinated twice with ribpA3, rIbpAS, and ribpA DR2 (200 began to increase by wk 2 but were never as high as IgG1 micrograms/dose) or GST (negative control at 67 micro responses, which began to increase at wk 1. Interestingly, grams—amount of GST in 200 micrograms of fusion pro there was no detectable IgG2 response to the DR2 antigen in teins), 5-6 calves per group. Two weeks later, calves were convalescent calves. If an IgG2 response could be elicited challenged intrabronchially with 5x10 H. somnistrain 2336. with IbpA DR2 vaccination, better protection may result. Clinical signs were monitored and calves were necropsied at Perhaps persistence of H. Somni in the lung for weeks after the day 4 after challenge by a veterinary pathologist. Gross lung clinical stage of experimental pneumonia in our earlier stud lesion Volumes were estimated by a standardized protocol ies (Gogolewski, et al., J Clin Microbiol (1989) 27:1767 and samples were taken for bacterial culture and histopathol 1774) is due to the undetectable IgG2 antibodies to Ibp A ogy. Viral serology revealed no increases in titer throughout DR2. the experiment, indicating passive transfer of antibodies from 4) Vaccine Studies with Purified IbpA DR2 and IbpA DR2 the vaccinated dams rather than active infection of calves. H/A in a Mouse Septicemia Model. Serum and bronchio-alveolar secretions were collected for 0150. We previously developed amouse septicemia model assay of isotypic antibodies to the vaccine antigens. The DR2 for H. Somni infection because this organism causes septice immunized group had the lowest clinical scores. The Volume mia in cattle (Geertsema, et al., Microbial Pathog (2007) of lesions (percentage of the lung at necropsy or "percent 42:22-28: Geertsema, et al., Vaccine (2008) 26:4506-4512). lesions”) and bacterial cultures were the most revealing mea Then we showed that vaccination of mice with purified sures of protection (FIG. 3A). DR2 vaccinated animals had recombinant IbpA DR2 protected against H. Somni septice less pneumonic lung than the GST controls (p<0.05), even mia (Geertsema, et al., Vaccine (2008) 26:4506–4512). Since though variation within groups was rather great. No H. Somni antibodies to IbpA DR2 reacted strongly with IbpA DR2 was cultured from lungs of DR2 vaccinated calves, which was H/A, we hypothesized that this non-cytotoxic protein would also significantly different from the control group (p<0.05) serve as a toxoid vaccine. This was tested in the mouse model (FIG. 3B). of H. Somni septicemia. Preliminary data, with only 4 mice 0147 Antibody studies with the subunit antigens con per group, indicates that IbpA DR2 H/A protects essentially firmed that the protection was related to specific antibodies. as well as Ibp A DR2. The bovine model is much more rel Both IgG1 and IgG2 antibody responses were detected and evant to bovine respiratory disease, so we propose to test specific for the immunizing antigen in each group. IgE anti IbpA DR2 H/A as a toxoid vaccine in calves, in comparison body levels have been associated with adverse reactions and with IbpA DR2, both expressed on the surface of diatoms. with worse clinical signs of longer duration in calves with H. 0151. With respect to the development of protein expres somni pneumonia (Ellis, et al., Can Vet J (1997) 38:45-47: sion systems in diatoms, we have characterized mRNA accu Gershwin, et al., Vet Immunol Immunopathol (2005) 107: mulation from four different genes in T. pseudonana and can 119-130). Therefore, we measured IgE antibody levels in drive expression at different levels (FIG. 5, left). Genes with serum. Although all groups had IgE responses to H. Somni, the highest levels of mRNA accumulation were the FCP DR2 elicited the lowest IgE response, an indication of a good (fucoxanthin chlorophyll binding protein), and rpL41 (ribo vaccine. Antibodies (IgG1, IgG2 and IgA) in lung lavage fluid Somal protein L41) genes. To demonstrate the ability to over collected at necropsy also had the highest ELISA readings express genes, transgenic T. pseudonana were examined for when tested against the antigen used for immunization. These over-expression of the glutathione acetyltransferase gene studies show that immunization of calves with rDR2 protects (GAT) using the FCP promoter, showing an average mRNA US 2015/0037370 A1 Feb. 5, 2015 20 accumulation level in four different transformants of twice 4812. Briefly, the IbpADR2 and mutant DR2 (H/A) encoding the wild-type level (FIG. 5, right), demonstrating over-ex region was PCR amplified using primer sequences (Forward: pression. We have also constructed a series of GatewayTM 5'-AGCTCCATGGGAAAATCAT CTCCGCAAGAG-3': vectors that enable rapid cloning of any gene of interest under Reverse: 5'-AGCTGGATCCTGATTTTTTTGC the control of the previously described promoters. CAACTCTTTTAAA-3") and cloned into a GST-tag plasmid 0152 Targeting of expressed proteins to three subcellular vector pBT41a. Recombinant H. Somni IbpA DR2/Fic locations can be accomplished. Cytoplasmic expression has expressed in E. coli BL21 cells was purified by glutathione the potential advantages of increased expression of protein (a affinity chromatography. This ribp A DR2 is used to quanti larger Volume than cell Surface) and increased protein stabil tate bovine antibody responses by ELISA and the construct in ity due less exposure to extracellular proteases (diatom intra E. coli is the source of the sequence for expression in T. cellular protease activity is intrinsically low), because the pseudonana. diatom silica cell wall is an effective physical barrier against 0156 b) Constructs and expression in T. pseudonana. Ini the breakdown of intracellular components by external tially the DR2 domain was fused to GFP and placed under the agents. Cytoplasmic expression requires cell rupture to control of the rpl41 promoter for cytoplasmic expression. A release the antigens, which could increase adjuvanticity by Small percent of the clonal population demonstrated high forming nanoparticles. Cell membrane expression, including levels of expression of this protein in the cytoplasm. To the plasma membrane, might combine protection with avail increase the percentage of cells expressing, the DR2 domain ability to the outside, which could improve antigenicity. Cell was codon optimized for expression in T. pseudonana in Surface expression has the advantage of immediate use of silico with the program Reverse Translate (on the internet at transgenic diatoms with no processing necessary. The choice bioinformatics.org/sms2/rev trans.html), and a start codon of highly abundant cell surface proteins (Davis, et al., J. Phy was included at the beginning of the DR2 domain. Integrated col (2005) 41:577-589; Fischer, et al., J. Phycol (1999) 35(1): DNA Technologies (IDT) synthesized the optimized gene, 113-120: Kroger, et al., EMBOJ (1994) 13(19):4676-4683; which was then cloned into pMHL 79 using the GatewayTM Kroger, et al., Euro J Biochem (1996) 239(2):259-264) to based cloning platform (Invitrogen). The diatom transforma generate fusions should maximize surface protein yields. tion vector pMHL 79 utilizes the T. pseudonana FCP pro Expression of GFP in T. pseudonana in the cytoplasm and in moter and terminator and contains GFP in frame with the the plasma membrane has been demonstrated (FIG. 6). desired insert for a C-terminal fusion. T. pseudonana was 0153. Subsequent efforts have focused on improving and transformed with the IbpA DR2/GFP construct using the increasing the expression. The IpbADR2 domain was codon biolistic method following established techniques (Poulsen, optimized for expression in T. pseudonana in silico with the et al., J Phycol (2006) 42:1059-1065). Transformants program Reverse Translate (on the internet at bioinformatics. expressing GFP in the cytoplasm were isolated (FIG. 6). A org/sms2/rev trans.html), and a start codon was included at second construct was generated that fused the codon opti the beginning of the DR2 domain. Integrated DNA Technolo mized DR2 domain to a plasma membrane targeted protein gies (IDT) synthesized the optimized gene, which was then under the control of FCP. This fusion protein was successfully cloned into pMHL 79 using the GatewayTM-based cloning localized in the cell membrane of T. pseudonana (FIG. 6). platform (Invitrogen). The diatom transformation vector 0157 Regarding cell-surface localization, T. pseudonana pMHL 79 utilizes the T. pseudonana FCP promoter and encodes three frustulin genes. E-frustulin finds use because it terminator and contains GFP in frame with the desired insert is the smallest (489 amino acids). Although cell surface tar for a C-terminal fusion. T. pseudonana was transformed with geting sequences have been identified in the frustulins (Fis the Ibp A DR2/GFP construct using the biolistic method. cher, et al., J. Phycol (1999) 35(1): 113-120), domains on the Transformants expressing GFP in the cytoplasm were iso frustulins that facilitate cell surface attachment have not been lated and imaged with fluorescence microscopy (FIG. 6) and characterized. For this reason, in initial constructs, fusions to imaging flow cytometry. Imaging flow cytometry provided full-lengthe-frustulin targeting genes are used, althoughtrun statistical validation of observations made by fluorescence cated forms of e-frustulin may also be employed. GFP fusion microscopy; specifically, a Substantially larger percentage of solely to e-frustulin is included in the constructs for control a clonal population is observed to express the fusion protein experiments to enable determination of the rate of appearance when IbpA is codon optimized for expression in T. pseud and level of protein at the cell surface during the growth cycle onana (FIG. 7). to determine these basic parameters and optimal conditions Expression of H. Somni Antigens (IbpA DR2 and DR2 H/A) for expression of the antigenic fusions. To reduce overall on the Surface and in the Cytoplasm of Diatoms. fusion protein size, GFP is not included in the antigenic 0154 We have expressed IbpA DR2 and DR2 H/A in E. fusions—in this case monitoring of cell Surface expression is coli (Geertsema, et al., Vaccine (2008) 26:4506–4512; Geert done by ELISA or IFA with antibodies to the antigen. sema, et al., Vaccine (2011) 28: 4805-4812: Worby, et al., Molec Cell (2009) 34:93-103, Zekarias, et al., Infect Immun Optimization of Recombinant Diatom Antigens and (2010) 78:1850-1858). Earlier, we expressed IbpA p76 (con Determination of Effect on Bovine Turbinate (BT) Plus taining DR2 see FIG. 1) at the surface of B. abortus vaccine Bovine Alveolar Type 2 (BAT2) Epithelial Cells In Vitro. strain RB51. Now we have demonstrated intracellular expres A) Optimization of Diatom Antigens: sion of IbpA DR2 fused to GFP (FIG. 6) and have expressed 0158 Surface expressed IbpA DR2 or DR2 H/A frustulin rDR2 at the plasma membrane in T. pseudonana (FIG. 6). fusion proteins can be measured by ELISA with antibodies to Experimental Design and Methods H. somni IbpA DR2. 0155 a) Model antigen constructs. The primers for IbpA3, Experimental Design and Methods Ibp A5 and IbpA DR2 antigen expression have been 0159 Antigen expression is monitored by ELISA with described, e.g., in Geertsema, et al., Vaccine (2011) 28: 4805 anti-H. Somni IbpA DR2 and recombinant diatoms (or soni US 2015/0037370 A1 Feb. 5, 2015 cated samples) on the solid phase. Amount of antigen per somni pneumonia. The hypothesis was strengthened by a diatom is determined by ELISA with calculations based on a Small preliminary mouse septicemia experiment which standard curve of dilutions of known protein concentrations showed that vaccination with IbpA DR2 or with Ibp A DR2 of purified recombinant IbpA DR2. This method has been H/A both protected against septicemia. Since we will use the developed in our lab and we have recombinant IbpA DR2. same dose of recombinant diatom expressed protein in the Western blotting will determine specificity and immunofluo current vaccines as we used for the soluble recombinant vac rescence will evaluate cell Surface display. cines in calves (FIG.3), we propose that the diatom expressed vaccines should protect also. In fact, since these vaccines are B) Determination of Effect on Bovine Turbinate (BT) Plus particulate and have adjuvant-like biosilica in their cell walls, Bovine Alveolar Type 2 (BAT2) Epithelial Cells In Vitro. the diatom based vaccines may protect better than the recom binant soluble protein in our previous studies. Lastly, since H. (0160 Both H. somni IbpA DR2 and DR2 H/A have been somni pneumonia is caused by a mucosal route, we hypoth used in cytotoxicity studies with bovine turbinate (BT) cells esize that an intranasal vaccine should protect as well as, or and bovine alveolar type 2 (BAT2) epithelial cells (see FIG. better than, Subcutaneous vaccination. 2). BT cells were less sensitive to retraction than BAT2 cells to IbpADR2 (FIG.2 and Zekarias, et al., Infect Immun (2010) Experimental Design and Methods 78:1850-1858) but IbpADR2 H/A did not cause retraction or rounding (FIG. 2 and Zekarias, et al., Infect Immun (2010) 0163 Overall Experimental Design and Methods: 78:1850-1858). It is not clear whether retraction of bovine 0164 Recombinant diatom vaccines expressing Ibp A respiratory epithelial cells would be harmful or beneficial in DR2 or DR2 H/A are compared with parent diatoms as nega vivo. We found that cells rounded up after 4 hours treatment tive controls in protecting against H. Somni induced bovine in cell culture (Zekarias, et al., Infect Immun (2010) 78:1850 respiratory disease. The overall design is to produce recom 1858). However, if the cultures were incubated for 14 hours binant diatom expressing IbpADR2 and DR2 H/An antigens more, the cell did not die and fall off the plastic or glass. of H. Somni at 20 ug of antigen/ml. We will compare intrana Transitory epithelial cell retraction may permit more antigen sal vaccine with Subcutaneous vaccine. Since our previous up-take and greater immune responses. These studies will subcutaneous purified Ibp A DR2 protein vaccine was protec provide background on the mechanisms of action of intact or tive, the Subcutaneous diatom expressed DR2 vaccination is Sonicated recombinant antigen expressing or parent diatoms. the positive control. The parent diatom vaccination is the The calfexperiments provide some insight into the relevance negative control for H. Somni induced pneumonia in unpro of these epithelial cell studies for both pathogenicity and tected calves. In case the IbpA DR2 induced epithelial cell immune responses. Most of the diatom expressed antigen retraction is detrimental, we will compare the systemic and remain in the upper respiratory tract due to the size (4 by 6 intranasal IbpA DR2 vaccines with the toxoid (IbpA DR2 microns) of T. pseudonana. Therefore, the effect of intact H/A) which does not cause bovine respiratory epithelial cells diatoms expressing IbpA DR2 on BT cells in vivo may be to retract in vitro (Zekarias, et al., Infect Immun (2010) more relevant than on BAT2 cells. However, sonicated dia 78:1850-1858). toms would include much smaller particles, in the range of 1 0.165 Experimental vaccination: micron and below (which should reach the alveolus). Both 0166 Recombinant diatom expressed protein vaccines intact diatoms and Sonicated diatoms are tested in the epithe will contain 200g of DR2 or DR2H/A proteinas determined lial cell studies. by ELISA with quantitation based on a standard curve with purified ribpA DR2. These experimental vaccines are com Experimental Design and Methods pared with a parent diatom vaccinated control group. A total of 32 five-six week old male Holstein calves are purchased in 0161 BT cells and BAT2 cells are treated (at confluency or year 2 and year 3 from a local dairy as in previous studies near confluency) with 20 g/ml each of positive control rIbpA (Berghaus, et al., Vaccine (2006) 24:6018-6027; Corbeil, et DR2 or DR2 H/A in tissue culture media as was done in our al., Vet Immunol Immunopathol (2006) 113:191-199; Gersh previous studies (Zekarias, et al., Infect Immun (2010) win, et al., Vet Immunol Immunopathol (2005) 107:119-130). 78:1850-1858 and FIG. 2 above). The quantity of diatoms After adapting to UC Davis animal facilities for a few days expressing 20 ug/ml of DR2 or DR2 H/A is compared with and initial sample collection (serum samples, bronchio-al the toxicity of the soluble recombinant proteins. Cells are Veolar lavage fluid (BALF) and naso-pharyngeal Swabs), six fixed with 4% fresh paraformaldehyde and stained with animals per group are vaccinated twice (three weeks apart). Rhodamine phalloidin for actin fibers. Cytotoxicity is quan Sample collection will occur at day -35, -14 and -2 and titated by counting retracted and rounded BT or BAT2 cells periodically after infection at Day 0 with H. Somni. The treated with tissue culture media, recombinant DR2 or DR2 vaccination/challenge experiments are in two replicates, with H/A or diatoms expressing DR2 or DR2 H/A. 3 animals per group at the end of year 2 and 3 animals per Determination of the Protective Immunity in a Bovine Model group at the beginning of year 3. This makes handling more of H. Somni Pneumonia by Vaccinating with Diatom feasible and allows testing of reproducibility. Expressed Antigens. 0.167 Vaccine groups: 0162 We have shown that ribp A DR2 subcutaneous vac 0168 a) Parent diatom control group (4 animals intra cine protects calves against experimental H. Somnipneumo nasally and 4 animals subcutaneously) nia (FIG.3). Antibodies from these calves reacts equally with 0.169 b) Recombinant diatoms expressing IbpADR2— reacts equally with ribpADR2 H/A in Western blots. Since Subcutaneous vaccine (6 animals) IbpA DR2 H/A has only one amino acid change in the Fic 0170 c) Recombinant diatoms expressing Ibp A DR2 motif (Histidine replaced by Alanine) but is essentially non H/A-Subcutaneous vaccine (6 animals) toxic for BT and BAT2 cells, we propose that the mutant IbpA 0171 d) Recombinant diatoms expressing IbpADR2— DR2 H/A will act like a toxoid to protect calves against H. intranasal vaccine (6 animals) US 2015/0037370 A1 Feb. 5, 2015 22
0172 e) Recombinant diatoms expressing IbpA DR2 0180 Experimental Infection with H. Somni: H/A intranasal vaccine (6 animals) 0181 Infection with H. Somni is performed according to 0173 Calves are vaccinated at day -35 and day -14, then the protocol we have used in our previous studies on synergy infected intrabronchially with virulent live H. Somnistrain of BRSV and H. Somni. Briefly, a culture of H. Somni (previ 2336 (10/calf) at day 0 as in previous studies (Berghaus, et ously calf passaged strain 2336, vial 738) is grown for 18 al., Vaccine (2006) 24:6018-6027; Corbeil, et al., Vet Immu hours and sub-cultured onto Columbia blood agar (10% nol Immunopathol (2006) 113:191-199; Gershwin, et al., Vet bovine blood) plates. The bacteria are then scraped from the Immunol Immunopathol (2005) 107:119-130). Sample col plates and suspended in RPMI 1640 medium to a suspension lection and daily clinical scoring is done as described above, that gives a turbidity of 75% T at 610 nm. This turbidity with termination at day +4. Clinical signs are monitored at represents approximately 10 bacteria/ml. Bacterial numbers each pre-infection sampling time and twice daily after infec are confirmed by plate counts of the inoculum. A final dilution tion. in RPMI 1640 is then made so as to have 10 bacteria in a 10 0.174 Immune Response Studies. ml inoculum (107 bacteria/ml.). Each calf receives the 10 ml 0175 Isotypic antibody responses (IgG1, IgG2, IgE and inoculum instilled into the trachea at the bronchial bifurcation IgA) are quantitated in BALF and Sera (except for serum IgA through a tube inserted through the Ventral meatus of the nasal because cattle have almost no serum IgA) by ELISA against cavity. Calves in groups that do not receive H. Somni will have H. Somni IbpADR2 purified recombinant protein. Antibodies 10 ml of sterile RPMI instilled using an identical technique. to Ibp A DR2 reacted equally with Ibp A DR2 and IbpA Bacteria are administered in the morning and the calves are DR2H/A in Western blots, with identical patterns of bands checked approximately 8 hours later for clinical signs. (IbpA always appears as several bands in Westerns—10, 100, 0182 Monitoring for H. Somni Shedding: Deep nasal 102, 103, 105,106). Therefore, antibodies to IbpA DR2 H/A swabs are obtained from the nasal cavity to evaluate H. Somni also react with IbpA DR2 in Westerns. Western blotting stud shedding. The swab is placed into a tube containing RPMI ies of selected preimmune sera and BALF, as well as Sera and 1640 for transport to the laboratory within 2 hours. The Swab BALF collected during immunization, at challenge and at is then streaked onto a Columbia blood agar plate and incu necropsy are done to compare reactivity with native IbpA (in bated in a candlejar for 48 hours. Plates are examined for the CCS) and with recombinant IbpA DR2 and DR2 H/A. presence of H. Somni and number of colonies estimated semi (0176 Antibody Neutralization Studies. quantitatively. (0177 Sera from calves immunized with ribpA DR2 pro 0183 Bronchoalveolar Lavage: tein neutralized cytotoxicity for BAT2 cells in vitro (FIG. 4). 0184 Lung lavage is performed using a method that we In order to compare the neutralizing ability of antibodies to have previously used successfully (Berghaus, et al., Vaccine IbpA DR2 and Ibp A DR2 H/A, pre-challenge sera and pre (2006) 24:6018-6027; Corbeil, et al., Vet Immunol Immuno immune Sera from calves immunized systemically with dia pathol (2006) 113:191-199; Gershwin, et al., Vet Immunol toms expressing these antigens are tested in BAT2 cell cyto Immunopathol (2005) 107:119-130). Each sample is cultured toxicity assays as in our previous studies. Sera from the for H. Somni. Cytospin preparations are prepared for IFA previously immunized and protected calves (see FIG. 4 examination for the presence of BRSV and for differential above) are used as positive control serum and pre-immuniza cell morphology. The fluid is then centrifuged to remove the tion Sera are used as negative control serum. cell pellet and the supernatant is stored at -20° C. until assayed for antibody content. The cell pellet is retained at Methods: -80° C. for RNA. 0.178 Power Analysis to Determine Acceptable Numbers 0185. Assessment of Clinical Signs: of Animals in Each Group: 0186. A clinical sign score is determined each day for each 0179 Power estimates to verify adequate sample size were animal after physical examination by a veterinarian (LG) performed using an online power calculator (StatisticalPower blinded to the treatment group status and scoring of signs Calculator, DSS research, Fort Worth, Tex., available on the using our standard methods (Berghaus, et al., Vaccine (2006) internet at: dissresearch.com/toolkit/spcalc/power a2.asp) 24:6018-6027; Corbeil, et al., Vet Immunol Immunopathol for two-tailed comparisons between two means. In our pre (2006) 113:191-199; Gershwin, et al., Vet Immunol Immuno vious studies of BRSV and H. Somni synergism, we deter pathol (2005) 107:119-130). Assignment of points is based mined adequate samples sizes. The current experiments with on parameters including temperature elevation, spontaneous immunization and H. Somni challenge are similar. Calcula and induced cough, nasal exudate, lung auscultation, pres tions were made using two variables comparing each H. ence of dyspnea, wheezing, anorexia, and depression. somni vaccinated groups with the control group, with 6 calves 0187 Necropsy Procedure and Pathological Evaluation: per group and an alpha value of 0.05:1) Average % of gross 0188 Calves are euthanized with barbiturates, and a lung consolidation. This '% in the vaccinated and control necropsy performed on day 28 of the experiment. The entire groups were estimated at 7+5% and 25+14%, respectively, respiratory tract is removed, and lesions are diagramed on a based on expected values. Power to detect a difference of 18% lung drawing. Areas of atelectasis and consolidation are esti between the two groups in lung consolidation was 84.3%. 2) mated as a percentage for each lobe and for the entire lung. Average daily clinical score. The average daily clinical score, Following the standard procedure used in our experiments the based on previous infection studies, was estimated at 50-50 left lung is removed intact from the left mainstem bronchus for the vaccinated and 180+100 in the control groups. Statis and infused via an intra-bronchial catheter with 10% neutral tical power to detect this difference is 81.3%. Six calves per buffered formalin until fully expanded. Samples from the group will used herein because we expect similar types of right lung are obtained for culture of aerobic?capnophilic results as in the synergy study. Two set of controls (4 calves bacteria and for fluorescent antibody examination for infec each) with parent intact or Sonicated diatoms are included tious bovine rhinotracheitis (IBR/BHV 1), bovine virus diar because we expect the same results with both. rhea virus (BVD), and BRSV, as well as for BRSV, and H. US 2015/0037370 A1 Feb. 5, 2015 somni immunoperoxidase testing. Routine sampling for his protein is conserved (non-variant), not immunosuppressive tological examination is performed on 14 standard sites in the and is protective, it finds use for expression as an antigen in a right and left lung. Additional histological samples are taken diatom host cell. IbpA DR2/Fic is also conserved and non from lesions that are present in areas that were not included in variant as determined by PCR and by sequence analysis. It the routine samples. All histological samples are labeled as to stimulates good IgG2 responses and lower IgE responses than site and fixed in 10% neutral buffered formalin. Histological other IbpA subunits (Corbeil, et al., Vet Immunol Immuno examination is performed on sections of the trachea, right pathol (2006) 113:191-199). We have also shown the Ibp A main stem bronchus and from lung samples from the right and DR2 subunit protects mice (Geertsema, et al., Vaccine (2008) left apical, middle and caudal lobes. 26:4506–4512) and calves against H. Somni infection. There (0189 Statistical Analysis: fore, this H. Somni antigen and the BRSV N protein can be 0190. To be performed on data obtained from in vivo used to induce protective Th1 rather than IgE responses. assays using nonparametric analysis, ANOVA with post-hoc Overall Experimental Design and Methods: testing. For in vitro assays triplicate assays are used to com (0192 pare using unpaired students T test and/or Fisher's exact test. 0193 The overall design is to produce recombinant pro Significance is set at p-0.05. teins of BRSV and H. Somni in diatom host cells for a com bined subunit vaccine for comparison with alum adjuvanted Example 2 killed BRSV and H. Somni vaccines typical of those inducing high IgE responses. The goal is to induce higher IgG2 and T Diatom-Based Bovine Respiratory Syncytial Virus cell responses and less IgE along with better protection. (BRSV)/Histophilus somni Vaccines for Bovine BRSV N protein alone or with IbpA DR2/Fic can be Respiratory Disease Caused by Viral/Bacterial expressed in diatom host cells employing methodologies Synergy described above and herein. For example, BRSV N protein alone or with IbpA DR2/Fic (e.g., as a fusion protein) can be 0191 BRSV is an immunomodulator. Inactivated, adju expressed under the control of a promoter from a FCP (fucox vanted BRSV vaccines induce a Th2 response (Gershwin et anthin chlorophyll binding protein) or a rpL41 (ribosomal al., Vaccine (1998) 16:1225-36; Gershwin, et al., Am J Vet protein L41) gene. For cell surface localization, the BRSVN Res. (2000) 61:291-8; Gershwin, et al., Vet Immunol Immu protein alone or with IbpADR2/Fic, can be fused as a one or nopathol. (2005) 107:119-130; Kalina, et al., Vaccine (2004) more fusion proteins to a frustulin polypeptide, e.g., full 22:1465-72; Woolums, et al., Vaccine. (1999) 17(11-12): length e-frustulin. The expression cassette can be cloned into 1293-7). H. Somni also tends to stimulate excessive IgE anti a Gateway vector, as described above, and expressed in dia bodies (Gershwin, et al., Am J Wet Res. (2000) 61:291-8; tom host cells. The recombinant proteins expressed in the Gershwin, et al., Vet Immunol Immunopathol. (2005) 107: diatom host cells can be administered to an animal host for 119-130; Ruby, et al., Vet Microbiol (2000)76:373-383). Th1 induction of an immune response without purification. In responses are more protective against both BRSV and H. varying embodiments, the BRSV N protein alone or with somni. CD8T cells are important in protecting against BRSV IbpA DR2/Fic is co-expressed or co-administered with an (Valarcher, et al., Vet Res (2007) 38:153-180) and IgG2 anti adjuvant. bodies (characteristic of a Th1 response) are important in protection against H. Somni infection (Corbeil, et al., Can J 0.194 Experimental Vaccination: Wet Res (1997) 61:207-213). Therefore it is important to 0.195 Diatom expressed 61 holeraðlant protein vaccines choose antigens and adjuvants which preferentially stimulate containing at least about 200g of each protein are compared Th1 responses. It is also desirable to choose antigens which with killed alum adjuvanted vaccines used in earlier studies do not vary among strains and which do not undergo antigenic (Berghaus, et al., Vaccine (2006) 24:6018-6027) and with an variation under immune pressure. From BRSV, protective unvaccinated control group. Eighteen 5-6 week old male Hol antigens include the G, F and N proteins. The G protein shows Stein calves are purchased from a local dairy as in previous Some antigenic variation among field isolates and also some studies (Gershwin, et al., Vet Immunol Immunopathol. (2005) studies suggest that it suppresses antiviral T cell responses 107:119-130; Corbeil, et al., Vet Immunol Immunopathol (Valarcher, et al., Vet Res (2007)38:153-180). In addition, the (2006) 113:191-199; Berghaus, et al., Vaccine (2006) G protein has been shown to modulate the immune response 24:6018-6027). After initial sample collection (serum towards Th2 (Oshansky, et al., J Infect Dis. (2010) 201:1201 samples, bronchioalveolar lavage fluid (BALF) and naso 7). The F protein is highly conserved among isolates but it pharyngeal Swabs) six animals pergroup are vaccinated twice Suppresses lymphocyte proliferation and decreases effector (three weeks apart). Sample collection at day-35, -14 and -2 function of CD8 T cells (Valarcher, et al., Vet Res (2007) and periodically after infection at Day 0 with BRSV and Day 38:153-180). The nucleoprotein (N) is highly conserved and 6 with H. Somni. Vaccine groups—dual killed vaccine, diatom not known to be immunosuppressive or immunomodulatory expressed recombinant protein vaccine (BRSVN protein-H. toward an IgE response (Valarcher, et al., Vet Res (2007) somni IbpA DR2/Fic) or mock vaccine. Calves are infected 38:153-180). In immunization experiments, vaccinia virus with BRSV (5x10" TCIDs) by aerosol, two weeks after the vectors expressing F, G or N proteins were all protective but second vaccination, at day 0 and/or with virulent live H. N protein induced the highest IgG2 BRSV antibody somnistrain 2336 (10/calf) at day 6 as in previous studies responses and BRSV specific lymphocyte proliferative (Berghaus, et al., Vaccine (2006) 24:6018-6027; Corbeil, et responses (Taylor, et al., J Gen Virol (1997) 78:3195-3206). al., Vet Immunol Immunopathol (2006) 113:191-199; Gersh Other studies with N and F protein or DNA vaccines showed win, et al., Vet Immunol Immunopathol (2005) 107:119-130). protection with the N protein gene but not with the F protein Sample collection and daily clinical scoring is done as in the gene. This same DNA vaccine was shown to partially protect above studies, with termination at day 28. The experiment is infant Rhesus macaques from infection with human RSV done in two replicates with 3 animals/group in the each rep (Vaughan, et al., Vaccine. (2005) 22:2928-42). Since the N licate (total 6 animals per group). US 2015/0037370 A1 Feb. 5, 2015 24
0196. Immune Response Studies. supernatant is stored at -20° C. until assayed for antibody 0197) Isotypic antibody responses (IgG1, IgG2, IgE and content. The cell pellet is retained at -80°C. for RNA. IgA) are quantitated in BALF and Sera (without IgA for Sera) 0209 Assessment of Clinical Signs. against BRSV and H. Somni whole pathogen antigens as well 0210. A clinical sign score is determined each day for each as BRSVN protein or H. Somni IbpADR2 proteins. Cytokine animal after physical examination by a veterinarian, as proteins in the BALF at selected time points can be assayed by described under Example 1. ELISA (e.g., TNFC., IL8, IL6, IL4 and IFN-Y). The Th1 (IFN 0211 Necropsy Procedure and Pathological Evaluation— Y) and Th2 (IL4) cytokine levels are compared with isotypic 0212 Calves are euthanized with barbiturates, and a antibody results in order to understand immunomodulation necropsy performed on day 28 of the experiment, as by the vaccines. described under Example 1. (0198 Intracellular cytokines in CD4 and CD8T Cells are 0213 Statistical Analysis is performed on data obtained quantitated by flow cytometry. On days -35, -14, -2, 6, 10. from in Vivo assays using nonparametric analysis, ANOVA 14, 21, and 28 peripheral blood lymphocytes are obtained with post-hoc testing. For in vitro assays triplicate assays are from heparinized blood. The ficoll-hypaque separated lym used to compare using unpaired student's T test and/or Fish phocytes are enumerated and aliquoted for intracellular stain er's exact test. Significance is set at p-0.05. ing with commercially available antibodies for: IL-4, IL-2, IFN-Y. These cells are incubated with media alone, N protein, Example 3 IbpA DR2/Fic, or both. The Golgi-stop method of retaining intracellular cytokines are used prior to staining antibodies to Diatom-Based Enteric Vaccines cytokines Surface markers for CD4 and CD8 are evaluated 0214 Diatom based vaccines constitute a new, transfor after staining for intracellular cytokines is complete. Addi mational idea because these unicellular algae, with biosilica tional samples are stained for viability. Multicolor flow cell walls, are easily grown in water at ambient temperatures, cytometry are used. providing low cost in resource-limited settings. The vaccines (0199 Power Analysis to Determine Acceptable Numbers would be stable without refrigeration and could be lyo of Animals in Each Group: philized for dispensing oral vaccines in food or water. Vibrio 0200 Power estimates to verify adequate sample size are 64holera CTB was expressed in Thalassioira pseudonana for calculated as under Example 1. several reasons. CTB acts as an adjuvant for mucosal immu 0201 Experimental Infection with BRSV nity and sometimes has been used as an antigen, as well, for 0202 A BRSV infection protocolis used as previously a successful cholera vaccine in animal models. Hypotheses established (Gershwin, et al., Vaccine (1998) 16:1225-36: can be tested in this model and can be translated to use of Gershwin, et al., Vet Immunol Immunopathol (2005) 107: diatom expressed antigens for oral vaccines against other 119-130). Briefly, a virulent field isolate of BRSV (CA-1) is enteric diseases. Additional V. cholera antigens may be grown on bovine turbinate cells. The cells are observed daily expressed. Subsequent studies focus on other important for cytopathic effect (CPE); when CPE is observed, the virus enteric pathogens, such as Campylobacter jejuni, Salmonella is harvested by removing the cell Supernatant, flash freezing spp., Escherichia coli and its toxins, Giardia and Entamoeba the cells to release intracellular virus, and washing the flask histolytica. with media. The virus infected media is centrifuged to remove 0215 a) Expression of cholera toxin B (CTB) in diatoms. the cell debris and is retained on ice until administration CTB is cloned in a GatewayTM vector developed by us, driven (within 30 minutes) to the calf. A representative sample is by a highly expressed promoter (rpL41) and fused to frustulin withheld and used to for TCIDso assay to determine the titer 1 from T. pseudonana. Frustulins are abundant cell Surface of the virus preparation. The titer of the virus used is usually proteins in diatoms. The recombinant CTB diatoms are in the range of 4-5x10TCIDs/ml. Calves receive 5 ml of the microparticles. The diatoms are Sonicated to provide nano virus Suspension by aerosol via face mask using a DeVilbis particles having the same organic composition as whole dia nebulizer system. tom cell walls except for size. 0203 Experimental Infection with H. Somni— 0216 b) Surface expression is confirmed by enzyme linked immunosorbant assay (ELISA) or immunofluores 0204 Infection with H. Somni is performed according to cence assay (IFA) using rabbit antibody to CTB. Specificity the protocol described under Example 1. for CTB is determined by Western blotting. 0205 Monitoring for BRSV and H. somni Shedding. 0217 c) Activity of parent diatoms and CTB expressing 0206 Deep nasal swabs are obtained from the left (BRSV) diatoms is tested in vitro with mouse macrophages by mea and right (H. Somni) nasal cavity to evaluate pathogen shed suring TNFC. production by ELISA, as an indication of acti ding on days 0-14, and 21 and 28. The BRSV Swab is put into Vation and adjuvant activity. 1 ml of EMEM and vigorously stirred to remove cells. The 0218 d) Uptake of parent and CTB diatoms by human cells are then centrifuged onto slides, fixed and examined for intestinal epithelial cells is tested in vitro using polarized cell the presence of BRSV using a FITC conjugated anti-RSV. lines such as Caco-2, HT29 or T84 cells. Diatoms are grown The Swabs for H. Somni isolation are monitored as described in the presence of rhodamine 123, which fluorescently labels under Example 1. the silica cell walls for examination of uptake by confocal 0207 Bronchoalveolar Lavage. microscopy. Induction of proinflammatory cytokines (e.g., 0208 Lung lavage is performed using a method that we TNFO, IL-6, IL-8) by epithelial cells is done by ELISA to have previously used successfully (McVey, An Hlth Res Rev measure activation. (2009) 10:165-167). Each sample is cultured for H. somni. 0219 e) The localization of parent and CTB diatoms in the Cytospin preparations are prepared for IFA examination for intestine is determined by feeding fluorescent diatoms to the presence of BRSV and for differential cell morphology. mice. In vivo imaging techniques used to localize diatoms. The fluid is then centrifuged to remove the cell pellet and the Safety is analyzed be monitoring clinical signs with or with US 2015/0037370 A1 Feb. 5, 2015
out diatom feeding. Inflammation and cellular location of 0222 Based on the cholera in vitro assays and in vivo diatoms is determined by histopathology. models, additional antigens can be expressed, for example antigens that stimulate an immune response against enteric 0220 f) Immune responses to CTB is monitored in serum pathogens, e.g., Campylobacter jejuni. and extracted feces by isotype specific ELISA. 0223. It is understood that the examples and embodiments 0221 CTB/antigen expressing diatoms are further inves described herein are for illustrative purposes only and that tigated in stimulation of protective serum and intestinal anti various modifications or changes in light thereofwill be Sug body responses in mouse and/or rabbit models for cholera. gested to persons skilled in the art and are to be included Microparticles are compared with nanoparticles produced by within the spirit and purview of this application and scope of Sonicating CTB expressing diatoms. CTB-expressing dia the appended claims. All publications, patents, and patent toms find use in protecting against oral cholera toxin and applications cited herein are hereby incorporated by refer against V 65holera infection. ence in their entirety for all purposes.
SEQUENCE LISTING
<16 Os NUMBER OF SEO ID NOS: 24
<21 Os SEQ ID NO 1 &211s LENGTH: 966 &212s. TYPE: DNA <213> ORGANISM: Artificial Sequence 22 Os. FEATURE: <223> OTHER INFORMATION: Description of Artificial Sequence: Synthetic polynucleotide
<4 OOs SEQUENCE: 1 gcqctttitt c cq agaactcc ccataagttca acggctic caa to aagaatgt atcc.gacaac 60 ggcgagcata gcaa.cacgt.c cgt.ctittgga gtagaat cat catgttgttgg atgaatacac 12O agatgaatga Cattaaaagc atgalacatgt tagagagtag gagg tagaga ttgatatggit 18O
agcattgcga tigtttgttitt tdgtcagcat atgatgagtg gataccalata tatgaaagt 24 O
tgaat ct cqc gtttgagct C agcgg tacgt tattgat ca aagtag cct g at CaaaatcC 3 OO ttggagagta Caagaggat C aaagaatcca gtggggg.cga talactic caag ct cqttctica 360 aagaggcaat ggagg tagala act catcc.ca gttgagaaga agtgaaggca gtggcggtgg 42O cgaaagcaga ggcaacgagg acagact tcc ttgggttga tigcaacgaat attt Coagaa 48O
ggagaagttt agagagttga accgctacct acaatgacaa agtatcgitat cattttgat 54 O
gttggttggit tatgaattica aactgtaagt togattgttga galagat caga agttgaacga 6 OO
acacatctitt cogat catt c acctic cacac togcaacaa.ca cqgtactitct tcc.gcggcag 660 gtctctgtcg cc attct Ctt gtCctgttgt togctgtgag acgaggaaag caacgacaag 72O titt cacaaaa gggagttcct ttaacgagat atgttttitta taaagagtcc caatagaaag 78O
acaaattgat tcctic cqtgc aaacgc.gcaa at aaacacca cqtc cattat at coatat ct 84 O ttcagagtat coaacaagtg ttgaaggaca gg tagttgaa gtaacgitatic tt CCCC ct cq 9 OO
actggat.cca toaacaaggc gaacaaatcc attcaacct c toataaatta totgatttac 96.O
Caaac C. 966
<21 Os SEQ ID NO 2 &211s LENGTH: 508 &212s. TYPE: DNA <213> ORGANISM: Artificial Sequence 22 Os. FEATURE: <223> OTHER INFORMATION: Description of Artificial Sequence: Synthetic polynucleotide
<4 OOs SEQUENCE: 2
gcggcc.gcat actggattgg taat caatg agcc.gtagca caatggittac attcggctag 60 US 2015/0037370 A1 Feb. 5, 2015 26
- Continued
Ctalagat.cca atggcaagga C caagtgctg gaacttgttt totttagca gat Cttagcg 12 O tgagaggitat ttgtcc tictd toaggagtag at agtagatgttctttittaa actaaaatgc 18O taactgttcc gaattic ct catcgcagotaa to cqtacatc aaaagacaaa atgctaggta 24 O tgttgtactac atctoctdtt gctagataag acatatgata ggaaacacac catcaat agt 3OO cattgtagct ttacttatac tacgcatttg cactitt.cccc tdagtggcag aggcgcattg 360 agaaaatcga t ct caa.cata gtt tatgtag catcc cc tag atc cattact ttaagt citcc 42O titcgt.ctttg gtgtaggcat gttggacaca acgaggtaala acaca acaca aacaatgtgt 48O c cagcaaagt agtagctgct c cagttct 508
<210s, SEQ ID NO 3 &211s LENGTH: 1186 &212s. TYPE: DNA <213> ORGANISM: Artificial Sequence 22 Os. FEATURE: <223> OTHER INFORMATION: Description of Artificial Sequence: Synthetic polynucleotide
<4 OOs, SEQUENCE: 3 atgtctgtaa atgaagttgc accqttgtca totgtaccag cagaactaaa agatgctgct 6 O ggaggaaata aaaaag.cggc agagaaatca gagggtgcta C9ggtgtaga aaaagaaaaa 12 O accacactitt to caacgagt gaaacaattt ttcaccoggaa gtaagagcgg togcgaaacct 18O gtag C9ggag atgaga Cagc gaataaagtC aattatcaag atttggalaga taatttgaac 24 O ttaaaaggat taatttctitt agaagatgat cqaaatgcta attittgaaag taatgitattg 3OO aaaaatgaga aatttittaga tigaagcaaga gagattit.cga agaaatcaat tcc taa.gc.g 360 acagttaa.gc aaatgtct catttacctgaa tittgatgata ttct caccga gqqagctaag 42O aaagtagaaa gtcgt.attaa taaggcaatc acatt cogcc cittctgttga gqagttittca 48O gaaattcaag atttggtgaa aacgttaccg aaaacaaagg ttatagagga t ctittcaa.ca 54 O aaaacaaatgaaatcacaga agctittagct gcgacatcqa aaaccattca acgtacaccg 6OO gagttgaaag aac agttgaa gacagcaata gaggatttct tacaaaa.ca.g. tca aggcaaa 660
CCtttgacag tec agatgat Cagaatctt aat cacggat tacgt.ccgga tigagggagaa 72 O ggtcgtttac tittataaaaa agaga attta accaaagaaa atgcgg tatt ttctagt ccc 78O gaag.cggcaa aaattcaatt agcggaaacg gttgattitta t caatcgagc gaaaaatgaa 84 O gggattgagc cgagtgtggit toggcatta gtttatcago gattgattgc titat caccca 9 OO tittgcagaag gtaatggacg tatggcgaga gtcat agtaa ataaaattitt acttgatgca 96.O ggittatcc.gg catttaccaa atttagtgat gagtttgaac cqcagattat tcc to aaacg 1 O2O aaagcatcaa ctaaatcc.gc aacgagcagt galagtggtag ttgagtttitt aaaagagttg 108 O gcaaaaaaag gaa.gcaagga agataacgag Cagaatt tag aaaaaactga cc.gcactitct 114 O acggacttga Cagaaagtgc ggtagaaaat t cqgctgctt tagtt 1186
<210s, SEQ ID NO 4 &211s LENGTH: 1185 &212s. TYPE: DNA <213> ORGANISM: Artificial Sequence 22 Os. FEATURE: <223> OTHER INFORMATION: Description of Artificial Sequence: Synthetic polynucleotide US 2015/0037370 A1 Feb. 5, 2015 27
- Continued
<4 OOs, SEQUENCE: 4 atgtctgttga acgaggtggc ticcact ct ct tctgtgc.cag Ctgagct cala ggatgctgct 6 O ggaggaalaca agaaggctgc tigagaagttct gagggagcta cc.ggagtgga gaaggagaag 12 O accaccct ct tccaacgtgt gaa.gcaattic titcaccoggat citaagttctgg agctaagc.ca 18O gtggctggag atgaga.ccgc taacaaggtg alactaccaag atctogagga taacct Caac 24 O citcaagggac to atct ct ct cqaggatgat cqtaacgcta actitcgagtic taacgtgctic 3OO aagaacgaga agttcCtcga tigaggctcgt gagat ct cta agaagtictat cccagaggct 360 accgtgaagc aaatgtctica cct Cocagag titcgatgata t cct caccga gggagctaag 42O alaggtggagt ct cqtaticaa Caaggctatc acct tcc.gtc. Catctgtgga ggagttctict 48O gagatcCaag atct citgaa gaccct coca aagaccalagg tdatcgagga t ct ct ct acc 54 O aagaccaacg agat caccga gqct citcgct gctacct cta agaccatcca acgtaccc.ca 6OO gagotcaagg agcaacticaa gaccgctato gaggattitcc ticcaaaactic ticaaggaaag 660 c cactic accg to aaatgat Cagalacctic alaccacggac tocticciaga tigagggaga.g 72 O ggacgt.ct Co. tct acaagaa ggaga acctic accaaggaga acgctgtgtt Ctcttct coa 78O gaggctgcta agatccaact cqctgaga cc gtggattitca toaaccgtgc taagaacgag 84 O ggaatcgagc Catctgtggit gggagct Ctc gtgtaccaac gtct catcgc titaccaccca 9 OO titcgctgagg gaaacggacg tatggctcgt gtgatctga acaagat.cct cct catgct 96.O ggatacccag ctitt caccaa gttct ctdat gagttcgagc cacaaatcat cccacaaacc 1 O2O aaggct tcta C caagttctgc tacct cttct gaggtggtgg tagttcct Caaggagctic 108 O gctaagaagg gatctaagga ggataacgag caaaacct cq agaagaccga t cqtacctict 114 O accoat ct ca ccgagt ctdc tdtggagaac totgctgctic tict ct 1185
<210s, SEQ ID NO 5 &211s LENGTH: 395 212. TYPE: PRT <213> ORGANISM: Artificial Sequence 22 Os. FEATURE: <223> OTHER INFORMATION: Description of Artificial Sequence: Synthetic polypeptide
<4 OOs, SEQUENCE: 5
Met Ser Wall Asn. Glu Wall Ala Pro Leu Ser Ser Wall Pro Ala Glu Lieu. 1. 5 1O 15 Lys Asp Ala Ala Gly Gly Asn Llys Lys Ala Ala Glu Lys Ser Glu Gly 2O 25 3O Ala Thr Gly Val Glu Lys Glu Lys Thir Thr Lieu. Phe Glin Arg Val Lys 35 4 O 45
Glin Phe Phe Thr Gly Ser Lys Ser Gly Ala Lys Pro Val Ala Gly Asp SO 55 6 O
Glu Thir Ala Asn Llys Val Asn Tyr Glin Asp Lieu. Glu Asp Asn Lieu. Asn 65 70 7s 8O
Lieu Lys Gly Lieu. Ile Ser Lieu. Glu Asp Asp Arg Asn Ala Asn. Phe Glu 85 90 95
Ser Asn Val Lieu Lys Asn. Glu Lys Phe Lieu. Asp Glu Ala Arg Glu Ile 1OO 105 11 O
Ser Lys Llys Ser Ile Pro Glu Ala Thr Val Lys Gln Met Ser His Leu 115 12 O 125 US 2015/0037370 A1 Feb. 5, 2015 28
- Continued
Pro Glu Phe Asp Asp Ile Lieu. Thr Glu Gly Ala Lys Llys Val Glu Ser 13 O 135 14 O Arg Ile Asn Lys Ala Ile Thr Phe Arg Pro Ser Val Glu Glu Phe Ser 145 150 155 160 Glu Ile Glin Asp Lieu Val Llys Thr Lieu Pro Llys Thr Llys Val Ile Glu 1.65 17O 17s Asp Lieu. Ser Thr Llys Thr Asn. Glu Ile Thr Glu Ala Lieu Ala Ala Thr 18O 185 19 O Ser Lys Thir Ile Glin Arg Thr Pro Glu Lieu Lys Glu Gln Lieu Lys Thr 195 2OO 2O5 Ala Ile Glu Asp Phe Lieu. Glin Asn. Ser Glin Gly Llys Pro Lieu. Thr Val 21 O 215 22O Glin Met Ile Glu Asn Lieu. Asn His Gly Lieu. Arg Pro Asp Glu Gly Glu 225 23 O 235 24 O Gly Arg Lieu. Lieu. Tyr Llys Lys Glu Asn Lieu. Thir Lys Glu Asn Ala Val 245 250 255 Phe Ser Ser Pro Glu Ala Ala Lys Ile Glin Lieu Ala Glu Thr Val Asp 26 O 265 27 O Phe Ile Asn Arg Ala Lys Asn. Glu Gly Ile Glu Pro Ser Val Val Gly 27s 28O 285 Ala Lieu Val Tyr Glin Arg Lieu. Ile Ala Tyr His Pro Phe Ala Glu Gly 29 O 295 3 OO Asn Gly Arg Met Ala Arg Val Ile Val Asn Lys Ile Lieu. Lieu. Asp Ala 3. OS 310 315 32O Gly Tyr Pro Ala Phe Thr Lys Phe Ser Asp Glu Phe Glu Pro Glin Ile 3.25 330 335 Ile Pro Gln Thr Lys Ala Ser Thr Lys Ser Ala Thr Ser Ser Glu Val 34 O 345 35. O Val Val Glu Phe Lieu Lys Glu Lieu Ala Lys Lys Gly Ser Lys Glu Asp 355 360 365 Asn Glu Glin Asn Lieu. Glu Lys Thr Asp Arg Thr Ser Thr Asp Lieu. Thr 37 O 375 38O
Glu Ser Ala Wall Glu Asn. Ser Ala Ala Lieu. Ser 385 390 395
<210s, SEQ ID NO 6 &211s LENGTH: 397 212. TYPE: PRT <213> ORGANISM: Thalassiosira pseudonana
<4 OOs, SEQUENCE: 6 Cys Thr Gly Asp Cys Asp Ser Asp Thr Asp Cys Lieu Pro Thir Lieu Lys 1. 5 1O 15
Cys Phe Lys Arg Gly Asp Gly Glu Ser Thr Glin Val Pro Gly Cys Gly 2O 25 3O
Thr Gly Gly Val Gly Asp Ile Pro Gly Ala Asp Tyr Cys Tyr Asp Pro 35 4 O 45
Ser Asn Gly Asp Val Ser Arg Val Asn Gly Cys Thr Pro Ser Thr Glin SO 55 6 O
Cys Asn. Ile Cys Ser Gly Asp Cys Asp Asn Asp Glu Asp Cys Ile Gly 65 70 7s 8O
Asp Tyr Lieu. Cys Phe Lys Arg Ala Asp Gly Met Lys Asn. Glin Val Pro US 2015/0037370 A1 Feb. 5, 2015 29
- Continued
85 90 95 Gly Cys Glu Ile Gly Gly Ile Gly Asp Ile Ser Gly Ala Asp Tyr Cys 1OO 105 11 O Tyr Asp Pro Ser Gly Gly Gly Lieu Ser Pro Thr Gly Ser Pro Ser Val 115 12 O 125 Gly Gly Val Met Thr Asp Ala Pro Glin Val Ala Thr Lieu. Asn Pro Ser 13 O 135 14 O Val Ser Pro Thr Phe Ala Leu Pro Ser Llys Val Ser Pro Leu Pro Thr 145 150 155 160 Asp Ile Asn Lieu. Lieu Val Gly Asn Pro Phe Ala Thr Pro Ser Ala Ala 1.65 17O 17s Pro Thir Ser Ser Lieu Pro Ser Lieu. Arg Tyr His Gly Arg Asn Met Cys 18O 185 19 O Thir Ala Asp Ser Pro Cys Gly Ala Cys Ser Gly Asp Cys Asp Gly Asp 195 2OO 2O5 Ser Gly Cys Glin Thr Gly Lieu Met Cys Phe Glin Arg Ala Arg Asp Glu 21 O 215 22O Thir Ser Glin Val Pro Gly Cys Ala Val Gly Gly Thr Glu Asp Ile Pro 225 23 O 235 24 O Gly Ala Asp Tyr Cys Tyr Asp Pro Thr Ser Glu Ser Pro Pro Leu Val 245 250 255 Trp Lieu. Gly Glu Asp Gly Cys Ser Glu Asp Gln Pro Cys Asn Arg Cys 26 O 265 27 O Ala Gly Ser Cys Ser Asn Asp Glu Asp Cys Lys Gly Asn Lieu. Glu. Cys 27s 28O 285 Phe Val Arg Ile Asp Gly Glu Ser Thr Ser Val Pro Gly Cys Ser Ser 29 O 295 3 OO Gly Gly Ile Gly Asp Val Lieu. Glu Asp Tyr Cys Tyr Asp Pro Asp Ala 3. OS 310 315 32O Ala Phe Thr Pro Ser Pro Thr Arg Thr Pro Ser Ser Leu Pro Thr Lieu. 3.25 330 335 Arg Trp Arg Gly Ser Glu Gly Cys Ser Pro Asp Ser Pro Cys Pro Ser 34 O 345 35. O Cys Thr Gly Asp Cys Asp Asn Asp Asn Asp Cys Asp Ser Thir Lieu Lys 355 360 365 Cys Phe Lys Arg Phe Ala Gly Asp Arg Thr Glin Val Pro Gly Cys Ala 37 O 375 38O Thr Gly Gly Lieu. Gly Asp Ile Pro Gly Gly Asp Tyr Cys 385 390 395
<210s, SEQ ID NO 7 &211s LENGTH: 134 212. TYPE: PRT <213> ORGANISM: Thalassiosira pseudonana
<4 OO > SEQUENCE: 7 Cys Glin Gly Asp Cys Asn. Ser Asp Ala Asp Cys Ala Gly Gly Lieu Met 1. 5 1O 15
Cys Phe Ser Arg Gly Thr Gly Glu Val Thr Ser Val Pro Gly Cys Val 2O 25 3O Ser Gly Gly Glu Gly Asp Leu Pro Gly Met Asp Tyr Cys Tyr Thr Pro 35 4 O 45 US 2015/0037370 A1 Feb. 5, 2015 30
- Continued
Phe Pro Pro Gu Thir Thir Thir Ala Thir Thir Ser Thir Thir Thir Thir Thr SO 55 6 O Thir Ser Thr Thr Thr Ala Thr Ala Pro Asp Lieu. Asn Phe Val Arg Glu 65 70 7s 8O Cys Thr Ala Glu Asp Pro Cys Asn Ala Cys Glu Gly Asp Cys Asp Asp 85 90 95 His Thr His Cys Ala Gly Ser Lieu. Glu. Cys Phe Ser Arg Asp Glin Gly 1OO 105 11 O Ser Val Asp Lieu Val Pro Gly Cys Asn Gly Lieu. Gly Val Ala Gly Met 115 12 O 125 Asp Tyr Cys Tyr Asp Pro 13 O
<210s, SEQ ID NO 8 &211s LENGTH: 6882 &212s. TYPE: DNA <213> ORGANISM: Artificial Sequence 22 Os. FEATURE: <223> OTHER INFORMATION: Description of Artificial Sequence: Synthetic polynucleotide
<4 OOs, SEQUENCE: 8 agcttgcgct tttitcc.gaga act coccata agt caacggc ticcaatcaag aatgitat cog 6 O acaacggcga gcatagcaac acgt.ccgt.ct ttggagtaga atcat catgt ttggatgaa 12 O tacacagatgaatgacatta aaa.gcatgaa catgttagag agtaggaggit agagattgat 18O atggtagc at to gatgttt gtttittggtc. agcatatgat gagtggatac Caatatgatg 24 O aaagttgaat Ctcgcgtttg agcticagogg tacgittattg atcgaaagta gcctgat Caa 3OO aatcCttgga gagtacaaga ggatcaaaga atc.ca.gtggg ggcgata act C caagct cqt 360 tctcaaagag gcaatggagg tagaalactica t cc cagttga gaagaagtga aggcagtggc 42O ggtggcgaaa goagaggcaa Caggacaga Ctt CCtgtgg gttgatgcaa caat attt C 48O
Cagaaggaga agtttagaga gttgaaccgc tacct acaat gacaaagtat citat catt 54 O ttgatgttgg ttggittatga attcaaactg taagttggat titgagaaga t cagaagttg 6OO aacgaacaca tottt cogat cattcacctic cacactgcaa caacacggta cittct tcc.gc 660 ggcaggtotc titcgc.catt Ctcttgtc.ct gttgttggct gtgagacgag gaaagcaacg 72 O acaagtttca caaaagggag titcctittaac gagatatgtt ttittataaag agt cc caata 78O gaaaga caaa ttgatt cotc cqtgcaaacg cqcaaataaa caccacgt.cc attatat coa 84 O tat ctitt cag agtatic caac aagtgttgaa gogacagg tag titgaagtaac gitat citt coc 9 OO cct cqactgg atc catcaac aaggcgaaca aatcc attca acct ct cata aattatctga 96.O tttaccaaac cqatat caac aagtttgtac aaaaaagctgaacgagaaac gitaaaatgat O2O ataaatat ca at at attaaa ttagattittg cataaaaaac agact acata atact.gtaaa O8O acacaa cata t coagt cact atgg.cgg.ccg cattaggcac cccaggctitt acactittatg 14 O
Cttc.cggctic gtataatgtg tdgattittga gttaggatcc gtc.gagattt tdaggagcta 2OO aggaagctaa aatggaga aa aaaat cactg gatataccac cqttgatata t c ccaatggc 26 O atcgtaaaga acattttgag goattt cagt cagttgctica atgtacctat aaccagaccg 32O ttcagotgga tattacggcc tttittaaaga ccgtaaagaa aaataagcac aagttittatc 38O cggc ctitt at t cacattctt gcc.cgc.ctga tigaatgctica to cqgaattic cqtatggcaa. 44 O
US 2015/0037370 A1 Feb. 5, 2015 39
- Continued cc.cgaaaagt gccaccitaaa ttgtaag.cgt taatattttgttaaaatticg cqttaaattit 576. O ttgttaaatc agct catttt ttalaccaata gg.ccgaaatc ggcaaaatcc cittataaatc 582O aaaagaatag accgagatag ggttgagtgt titt C cagtt taacaaga gtcCactatt 588 O aaagaacgtg gacticcaacg tcaaagggcg aaaaaccgtc. tat cagggcg atggcc.cact 594 O acgtgalacca t caccctaat Caagttttitt ggggtcgagg to cqtaaag Cactaaatcg 6 OOO gaac cctaaa gggagcc.ccc gatttagagc titgacgggga aag.ccggcga acgtggc gag 6 O6 O aaagga aggg aagaaag.cga aaggagcggg cqctagggcg Ctggcaa.gtg tagcggit cac 612 O gctg.cgcgta accaccacac cc.gc.cgc.gct taatgcgc.cg Ctacagggcg cgt.cc catt C 618O gccatt Cagg ctg.cgcaact gttgggaagg gcgat.cggtg cgggcct Ctt cqct attacg 624 O
Ccagctggcg aaagggggat gtgctgcaag gcgattalagt tigtaacgc Cagggittitt C 63 OO
Ccagt cacga C9ttgtaaaa cacggc.cag tagcgc.gcg taatacgact Cactataggg 636 O cgaattgggt acgtaccggg ccc.cccCt c aggtogacgg tat cata 64 O8
<210s, SEQ ID NO 11 &211s LENGTH: 121 212. TYPE: PRT <213> ORGANISM: White spot syndrome virus
<4 OOs, SEQUENCE: 11 Met Ala Thir Thr Thr Asn. Thir Lieu Pro Phe Gly Arg Thr Gly Ala Glin 1. 5 1O 15 Ala Ala Gly Pro Ser Tyr Thr Met Glu Asp Leu Glu Gly Ser Met Ser 2O 25 3O Met Ala Arg Met Gly Lieu. Phe Lieu. Ile Val Ala Ile Ser Ile Gly Ile 35 4 O 45 Lieu Val Lieu Ala Wal Met Asn Val Trp Met Gly Pro Llys Lys Asp Ser SO 55 6 O Asp Ser Asp Thr Asp Lys Asp Thr Val Asp Asp Asp Asp Thir Ala Asn 65 70 7s 8O Asp Asn Asp Asp Glu Asp Llys Tyr Lys Asn Arg Thr Arg Asp Met Met 85 90 95 Lieu. Lieu Ala Gly Ser Ala Lieu. Lieu. Phe Lieu Val Ser Ala Ala Thr Val 1OO 105 11 O Phe Met Ser Tyr Pro Lys Arg Arg Glin 115 12 O
<210s, SEQ ID NO 12 &211s LENGTH: 363 &212s. TYPE: DNA <213> ORGANISM: Artificial Sequence 22 Os. FEATURE: <223> OTHER INFORMATION: Description of Artificial Sequence: Synthetic polynucleotide
<4 OOs, SEQUENCE: 12 atggctacta c tactaatac act tccttitt ggacgtaccg gagct caagc cqcaggaccc 6 O tcgtacacga tiggaagat ct cqaaggaagt atgagtatgg Ctc.gcatggg attgttcct c 12 O attgttgcca ttt citat cqg aattct cqtc cittgcagtica togaatgtctg gatgggaccg 18O aagaaggatt C9gacagtga Caccgataag gat actgtgg atgatgatga cacggcgaac 24 O US 2015/0037370 A1 Feb. 5, 2015 40
- Continued gataatgatg acgaggacaa gtacaagaat cit accc.gtg acatgatgct tttggctgga 3OO t cagcc ct ct tttitttggt gtctg.cggca actgtct tca tagctaccc Caagaggcga 360
Cag 363
<210s, SEQ ID NO 13 &211s LENGTH: 466 212. TYPE: PRT <213> ORGANISM: White spot syndrome virus
<4 OOs, SEQUENCE: 13 Met Ser Ala Ser Lieu. Ile Lieu. Asp Glu Tyr Lieu Lys Llys Thr Ala Ser 1. 5 1O 15 Ala Val Lieu. Asp Val Ala Asp Ser Phe Glu Lys Ile Lys Gly Glu Ile 2O 25 3O Glin Ser Pro Glu Glu Ala Ala Ala Lieu. Ser Val Ala Lieu. Tyr Gly Ala 35 4 O 45 Pro Pro Llys Pro Ser Ala Ser Ala Val Ala Ser Ile Ile Thr Gly Glu SO 55 6 O Arg Thir Ser Lieu. Asn Asp Llys Tyr Lieu. Ser Asp Asn Val Lieu. Lieu Lys 65 70 7s 8O Met Ser Val Ala Arg Val Gly Glin Glu Asn. Asn Arg Lys Arg Ala Asp 85 90 95 Glin Ala Ala Asp Glu Ile Arg Thir Ile Met Glu Asp Ile Thr Gly Ser 1OO 105 11 O Lieu. Ser Gly Ala Tyr Arg Glin Tyr Ser Pro Lieu. Glu Glu Glu Asn Lys 115 12 O 125 Val His Ile Gly Ile Met Asn Asn Llys Thr Pro Ser Ile Val Cys Gly 13 O 135 14 O Tyr Tyr Thr Met Asp Thir Ser Ile Ser Ser Glu Pro Leu Ser Lieu. Thr 145 150 155 160 Asp Phe Glin Asn Pro Thr Val Ile Ala Asn Val Thr Lys Arg Met Glu 1.65 17O 17s Ser Ile Phe Ser Llys Val Asp Ser Ala Arg Ser Thr Arg Phe Asp Ala 18O 185 19 O Phe Val Asn Gly Val Ala Asn. Asn Met Asp Ile Llys Ser Ser Ile Asp 195 2OO 2O5 Trp Ala Asn Met Val Glu Asn Val Ile Llys Lieu Pro Asp Ser Thr Pro 21 O 215 22O Asn Pro Cys Ser Val Asp Thir Ile Val Ser Arg Asp Ala Ser Val Val 225 23 O 235 24 O Llys Thr Ala Val Asn Asp Ile Tyr Ala Ser Val Gly Llys Ser Tyr Cys 245 250 255
Arg Pro Ala Thr Gln Lieu. Thir Phe Met Ser Glu Ile Glu Lys Lieu. Arg 26 O 265 27 O
Lys Ala Ala Val Val Cys Phe Glu Ala Lieu Met Ser Asp Thir Arg Glu 27s 28O 285
Arg Ala Phe Val Glu Phe Lieu. Phe Tyr Val Ser Phe Lys Glu Asp Ala 29 O 295 3 OO
Ser Asn. Thir Asn. Ser Llys Lieu. Phe Val Glin Asn Llys Lieu. Ser Ser Met 3. OS 310 315 32O
Ser Gly Asn Pro Arg Glin Pro Ile Llys Lieu Val Arg Arg Ser Ala Glu 3.25 330 335 US 2015/0037370 A1 Feb. 5, 2015 41
- Continued
Glu Thir Lieu Phe Gly Lieu. Cys Phe Met Phe Llys Val Met Pro Pro Glu 34 O 345 35. O Phe Met Asn Cys Ile Phe Asn Phe Pro Thr Ile Pro His Ser Thr Glin 355 360 365 Tyr His Gly Lieu. Tyr Gly Thr Cys Lieu. Thr Pro Leu Lleu. Arg Llys Tyr 37 O 375 38O Gly Ser Ser Phe Glu Lys Ser Trp Ala His Phe Glu Glu Ile Leu Ser 385 390 395 4 OO Glu Arg Ala Asn Ala Wall Lys Llys Phe Gly Val Asn Asp Thr Arg Ile 4 OS 41O 415 Asp Cys Lieu. Asp Ala Val Ala Asn Lieu. Thr Gly Pro Val Tyr Val Lieu 42O 425 43 O Ile Lieu. Asp Lieu Val Arg Thr Lieu. Ser Ala Glin Arg Ser Cys Ser Thr 435 44 O 445 Llys Phe Lieu. Arg Glu Ile Lys Glu Asn Tyr Lieu Lleu Trp Asn Arg Phe 450 45.5 460
Wall Ser 465
<210s, SEQ ID NO 14 &211s LENGTH: 1398 &212s. TYPE: DNA <213> ORGANISM: Artificial Sequence & 22 O FEATURE; <223> OTHER INFORMATION: Description of Artificial Sequence: Synthetic polynucleotide
<4 OOs, SEQUENCE: 14 atgtc.cgctt cottgatcct cqatgaatac ttgaaaaaga cqgcttctgc cqtgttggat 6 O gtc.gcagata gttittgagaa gatta aggga gaaattcaga gtcCtgagga ggctgcagot 12 O cticagtgtag ccctittatgg cqc accqcct aaacctagog catcggcagt togcct coatt 18O attactggag agcgcacgt.c tittgaatgat aagtacctica gtgataacgt tittgctcaag 24 O atgtctgtgg ccc.gtgtggg gCaggagaac aaccgcaaga gggcagat.ca agcc.gcagat 3OO gaaatc.cgta ct attatgga gga cattact ggat.ctttga gtggtgcct a tagacaatac 360 tctic cattgg aggaggaaaa Caaggttcat atcggaatta taacaataa gacgc.caagc 42O atcg tatgtg gat attatac catggatacct caattagta gtgagcc titt gtc. cct cacc 48O gact tccaga accctacagt gat.cgcaaac gitaacgaagc gitatggaat c gat ctitcagc 54 O alaggtogatt Cagc.ccgctic cacgc.gtttic gatgcatt.cg tcaacggtgt to aaataac 6OO atggacatta agt cagtat cactgggcg aac atggtcg agaatgttat taagttgcct 660 gattcaacgc caaacccttg Ctctgtggat acaattgtct cqcgtgacgc gagcgt.cgt.c 72 O aaaacggcag ticaatgat at Ctacgctt Co gttggaaaat cct actgcag gcc agctacg 78O
Cagttgacat t catgtctga aatcgaga aa citc.cgitalagg cigcggtggit gtgtttcgag 84 O gct Ctcatgt Ctgatacaag ggagagagcc titcgtggagt to Cttitt ct a tigtgagctt C 9 OO aaggaggatg Cttctgaatac taactictaag Ctctt.cgtgc agaacaa.gct Ctcaagtatg 96.O tctggaalacc C caggcaa.cc catcaaattg gtacgacgta gcgc.cgagga aacticttitt C 1 O2O ggtttgttgtt to atgtttaa agtaatgcct c cogaattica tdaactgtat cittcaattitt 108 O ccitacgatcc cacacago act cagtaccac gigtttgtatg gtacctgtct cacgc.ctittg 114 O US 2015/0037370 A1 Feb. 5, 2015 42
- Continued citcc.gtaaat acggttcgtc ctittgaaaag togtggg.ccc actitcgaaga gattctittct 12 OO gagggtgcca atgc.cgittaa gaagtttggc gtcaacgaca Cccgitat ca CtgcCttgac 126 O gctgtagcaa atctoactgg accagttt at gttittgattic ticgat cittgt togtact ct c 132O tctgcc caac gtagctgtag cactaagttc ttgcgagaaa ttaaagagaa citat citccitt 1380 tggaacagat t cqtttct 1398
<210s, SEQ ID NO 15 &211s LENGTH: 195 212. TYPE: PRT <213> ORGANISM: Vibrio harveyi <4 OOs, SEQUENCE: 15 Met Lys Arg Arg Asn Pro Glin Gly Lieu. Thir Lieu. Lieu. Glu Lieu. Ile Ile 1. 5 1O 15 Ala Ile Val Ile Lieu. Gly Ile Lieu Ala Val Val Ala Ala Pro Arg Phe 2O 25 3O Lieu. Asn Lieu. Glin Asp Asp Ala Tyr Glin Ala Lys Met Glu Ser Ile Ala 35 4 O 45 Asp Glin Phe Glu Thr Gly Val Arg Phe Thr Glin Ser Gln Trp Leu Val SO 55 6 O Asn Gly Gly Thr Glin Glu Ala Glin Thr Asp Ile Asp Gly Tyr Gly Gly 65 70 7s 8O Gly Glu Lieu. Asp Val Asn. Glu Phe Gly Phe Pro Lieu. Gly Thr Asn Lys 85 90 95 Gly Asn Arg Asin Gly Val Ile Gly Asn Pro Tyr Asn. Ile Gly Glin Gly 1OO 105 11 O Asn Ala Gly Cys Ile Ala Val Trp Glin Ala Lieu. Lieu. Gly Asn. Glu Tyr 115 12 O 125 Ser Lieu. Ser Asn. Asn Arg Asn Ala Asn Asp Arg Phe Asp Phe Ile Thr 13 O 135 14 O Arg Arg Val Glin Asp Lys Glu Ser His Glin Ser Val Cys Tyr Tyr Thr 145 150 155 160 Phe Thir Lys Lys Gly Tyr Asp Arg Asn Pro Asp Asn. Ser Ser Phe Val 1.65 17O 17s Ile Trp Tyr Asp Ser Lys Thr Gly Ser Val Thr Thr Ser Llys Pro Thr 18O 185 19 O Arg Lieu Lys 195
<210s, SEQ ID NO 16 &211s LENGTH: 585 &212s. TYPE: DNA <213> ORGANISM: Artificial Sequence 22 Os. FEATURE: <223> OTHER INFORMATION: Description of Artificial Sequence: Synthetic polynucleotide
<4 OOs, SEQUENCE: 16 atgaaaagac gitalacc ccca gggattgacc ttgttggaat tdatcattgc tattgtaatc 6 O ttgggaatcc ticgctgttgt ggcc.gc.gc.ct aggttcCtca acct C Cagga catgcgitat 12 O
Caagcaaaaa tigagt caat tcggaccaa tittgaga cag gag to aggtt Cacacagtict 18O
Caatggct cq taaacggagg cact Caagag gcc.ca.gacgg acattgacgg atatggaggt 24 O US 2015/0037370 A1 Feb. 5, 2015 43
- Continued ggagaattgg atgtaaatga gtttgggttc ccgttgggaa ccaataaggg galacagalaat 3OO ggtgtt attg gaalacc cata caa.catcggc Caaggcaatg C9ggatgcat tcagtgtgg 360 caagcc ctitc. tcgggaacga gtact ct citt to caataata gaaatgcgaa cqatcgcttic 42O gactitc atta cqcgt.cgtgt gcaggacaaa gaatcgc acc agtctgtgttgttatt at acc 48O tttactaaaa agggatacga t cqtaatc.cc gacaatt cat cct tcgt cat citggtacgac 54 O tccaag actg gttcagtgac tacgt.ccaag cct act agac toaag 585
<210s, SEQ ID NO 17 &211s LENGTH: 45.5 212. TYPE: PRT <213> ORGANISM: Vibrio harveyi <4 OOs, SEQUENCE: 17 Met Lys Llys Pro Lieu. Lieu Ala Lieu. Thr Val Lieu. Ser Lieu. Ser Lieu. Gly 1. 5 1O 15
Ser Ile Ile Thr Pro Wall. Thir Ala Thir Ala Ala Leu Pro Leu Ser Wall 2O 25 3O Asp Gly Glu Glin Lieu Pro Ser Lieu Ala Pro Met Lieu. Glu, Llys Val Thr 35 4 O 45 Pro Ala Val Val Ser Ile Ala Val Glu Gly Lys Glin Val Glin Thir Ser SO 55 6 O Arg Ile Pro Glu Glin Phe Glin Phe Phe Phe Gly Pro Asp Phe Pro Thr 65 70 7s 8O Glu Glin Thr Arg Glu Arg Pro Phe Arg Gly Lieu. Gly Ser Gly Val Ile 85 90 95 Ile Asp Ala Lys Lys Gly Arg Ile Val Thr Asn Tyr His Val Ile Llys 1OO 105 11 O Gly Ala Asp Asp Ile Arg Val Arg Lieu. Tyr Asp Gly Arg Glu Tyr Asp 115 12 O 125 Ala Glu Lieu Val Gly Gly Asp Glu Met Ser Asp Ile Ala Lieu. Lieu Lys 13 O 135 14 O Lieu. Glu Lys Ala Lys Asp Lieu. Thr Glin Ile Llys Val Ala Asp Ser Asp 145 150 155 160 Llys Lieu. Arg Val Gly Asp Phe Thr Val Ala Ile Gly ASn Pro Phe Gly 1.65 17O 17s Lieu. Gly Glin Thr Val Thir Ser Gly Ile Val Ser Ala Lieu. Gly Arg Ser 18O 185 19 O Gly Lieu. Asn Val Glu Asn. Phe Glu Asn. Phe Ile Glin Thr Asp Ala Ala 195 2OO 2O5 Ile Asin Ser Gly Asn. Ser Gly Gly Ala Lieu Val Asn Lieu. Asn Gly Glu 21 O 215 22O
Lieu. Ile Gly Ile Asn. Thir Ala Ile Lieu. Gly Pro Asn Gly Gly Asn. Wall 225 23 O 235 24 O
Gly Ile Gly Phe Ala Ile Pro Ser Asn Met Met Lys Asn Lieu. Thir Asp 245 250 255
Glin Ile Lieu. Glu Phe Gly Glu Val Lys Arg Gly Met Lieu. Gly Val Glin 26 O 265 27 O
Gly Gly Glu Val Thir Ser Glu Lieu Ala Glu Ala Lieu. Gly Tyr Glu Ser 27s 28O 285
Ser Lys Gly Ala Phe Val Ser Glin Val Val Pro Asp Ser Ala Ala Asp US 2015/0037370 A1 Feb. 5, 2015 44
- Continued
29 O 295 3 OO Lys Ala Gly Lieu Lys Ala Gly Asp Val Ile Val Ser Ile Asin Gly Lys 3. OS 310 315 32O Ala Ile Asp Thr Phe Ala Glu Lieu. Arg Ala Lys Val Ala Thr Lieu. Gly 3.25 330 335 Ala Gly Lys Llys Val Thr Lieu. Gly Val Val Arg Asp Gly Lys Llys Llys 34 O 345 35. O Ser Phe Asp Val Thir Lieu. Gly Glu Ser Thr Asn. Wall Lys Ala Lys Ala 355 360 365 Glu Thir Lieu. His Glu Gly Lieu Lys Gly Ala Glu Lieu. Ser Asn. Thir Thr 37 O 375 38O Pro Ser Asp Ser Ile Glin Gly Val Llys Val Thr Ser Val Ala Glu Asn 385 390 395 4 OO Ser Pro Ala Ala Glin Tyr Glin Lieu Ala Glu Gly Asp Ile Ile Ile Gly 4 OS 41O 415 Val Asn Arg Lys Arg Val Lys Asn Lieu Ala Glu Lieu. Arg Ala Ile Val 42O 425 43 O Glu Lys His Glin Gly Val Lieu Ala Ile Asin Val Glin Arg Gly Asp Arg 435 44 O 445 Thr Val Tyr Lieu Val Ile Arg 450 45.5
<210 SEQ ID NO 18 &211s LENGTH: 1365 &212s. TYPE: DNA <213> ORGANISM: Artificial Sequence 22 Os. FEATURE: <223> OTHER INFORMATION: Description of Artificial Sequence: Synthetic polynucleotide
<4 OOs, SEQUENCE: 18 atgaagaa.gc citttgttggc attgaccgta ttgtc.cttgt ctittgggat c tat catcaca 6 O ccggtcaccg caa.cagcggc tittgcctictt t ctgttgatg gtgagcaact cccaagtttg 12 O gcc cctatgc ticgagalaggt gacaccagct gtggtgagta t cqcggtaga ggg talagcaa. 18O gtgcaaacct caagaatticc agaac agttc caatttittct tcgggcc tiga titt cocq act 24 O gaacaaac cc gagaacgt.cc attic.cgtggit Cttggct cqg gtgtaat cat tacgctaag 3OO aaaggit cqta t cqttacgaa ctaccatgtt at Caagggag cagacgatat tagagtacgt. 360 ttgt atgacg gtagagaata tatgcagag Ctcgttggtg gtgacgagat gtcggat at C 42O gct Ctcttga agctcaaaa ggccaaggac ttgacacaga t caaggtagc tigact Cogac 48O aagttgaggg ttggagattt cacggtggca atcggcaa.cc cct ttggact cqgacaaact 54 O gttacatctg gaattgtcag cqc cct cqgt agat.cgggct taatgtaga gaact tcgag 6OO aact tcatcc aaactgatgc tigcaattaat tctggcaact citgg.cggagc tittggtgaac 660 ttgaacggag agcttattgg aattaatact gct at Cttgg gaccgaatgg toggaacgtg 72 O ggaattggat ttgctatocc cagtaatatg atgaaaaatc. tcacggat.ca gatcttggag 78O tittggtgagg ttalagagagg catgcticgc gtcCagggcg gcgaagttac alagtgagctt 84 O gctgaa.gc.cc ticggittacga gagttccalag ggagctitt.cg titt ct caagt cqtgc.ccgac 9 OO agtgcagcag ataaggctgg tttgaaggct ggagatgtta t cqtcagcat taacggaaag 96.O gccatcgata C9ttcgcaga gct tcgc.gct aaggttgcta CdCttggagc tiggcaagaaa 1 O2O US 2015/0037370 A1 Feb. 5, 2015 45
- Continued gtgacactic gag tagttag ggacggaaag aagaagt ctt togatgtcac gct cqgc gag 108 O agcactaatg taaagcc aa ggcggagacic ctic cacgaag gacticaaggg cqc.cgaattg 114 O tcaaacacaa citc cct ctda titcgatccaa gagt caagg taacct cqgt togcagagaac 12 OO t ccc.ca.gcgg cqcaat at ca gttggctgaa ggaga catca to atcggagt galacagaaaa 126 O cgagtgaaga accttgctga gttgagagct atcgt.cgaala agcatcaagg agttcttgcc 132O atcaacgtgc agagaggaga t caactgtc. tacct cqtca ttagg 1365
<210s, SEQ ID NO 19 &211s LENGTH: 418 212. TYPE: PRT <213> ORGANISM: Vibrio harveyi <4 OOs, SEQUENCE: 19 Met Asn Llys Thir Ile Thr Lieu. Lieu. Ser Ala Lieu Lleu Lieu Pro Lieu. Ser 1. 5 1O 15
Phe Ala His Ala Ala Glu Pro Thir Lieu. Ser Pro Glu Met Wal Ser Ala 2O 25 3O Ser Glin Val Arg Ser Ala Glin Ala Lys Glin Thr Tyr Thr Tyr Val Arg 35 4 O 45 Cys Trp Tyr Arg Thr Ser Tyr Ser Lys Asp Glu Pro Ala Thr Asp Trp SO 55 6 O Glu Trp Ala Glu ASn Pro Asp Gly Ser Tyr Phe Thr Lieu. Asp Gly Tyr 65 70 7s 8O Trp Trp Ser Ser Val Ser Phe Lys Asn Met Phe Tyr Thr Asp Thr Pro 85 90 95 Glin Ser Val Ile Lys Glin Arg Cys Glu Glin Thr Lieu. Asp Lieu Ala Asn 1OO 105 11 O Glu Asn Ala Asp Ile Thr Phe Phe Ala Ala Asp Asn Arg Phe Ser Tyr 115 12 O 125 Asn His Thir Ile Trp Ser Asn Asp Pro Val Met Gln Pro Asp Glin Ile 13 O 135 14 O Asn Llys Val Val Ala Lieu. Gly Asp Ser Lieu. Ser Asp Thr Gly Asn. Ile 145 150 155 160 Phe Asn Ala Ser Gln Trp Arg Phe Pro Asn Pro Asn Ser Trp Phe Leu 1.65 17O 17s Gly His Phe Ser Asn Gly Phe Val Trp Thr Glu Tyr Ile Ala Glin Ala 18O 185 19 O Lys Asn Lieu Pro Lieu. Tyr Asn Trp Ala Val Gly Gly Ala Ala Gly Glu 195 2OO 2O5 Asn Glin Tyr Ile Ala Lieu. Thr Gly Val Gly Glu Glin Val Ser Ser Tyr 21 O 215 22O
Lieu Ala Tyr Ala Lys Lieu Ala Lys Asn Tyr Llys Pro Ala Asn. Thir Lieu. 225 23 O 235 24 O
Phe Thr Lieu. Glu Phe Gly Lieu. Asn Asp Phe Met Asn Tyr Asn Arg Ser 245 250 255
Val Pro Glu Val Llys Ser Asp Tyr Ala Glu Ala Lieu. Ile Llys Lieu. Thr 26 O 265 27 O
Asp Ala Gly Ala Lys Asn Lieu. Lieu. Lieu Met Thr Lieu Pro Asp Ala Thr 27s 28O 285
Arg Ala Pro Glin Phe Thr Tyr Ser Thr Glin Glu Glu Ile Asn Lys Ile US 2015/0037370 A1 Feb. 5, 2015 46
- Continued
29 O 295 3 OO Arg Ala Lys Ile Val Glu Met Asn. Glu Phe Ile Lys Ala Glin Ala Ala 3. OS 310 315 32O Tyr Tyr Thr Ala Glin Gly Tyr Asn Val Thr Lieu. Tyr Asp Thr His Ala 3.25 330 335 Lieu. Phe Glu Ser Lieu. Thir Ala Asn Pro Glu Gln His Gly Phe Val Asn 34 O 345 35. O Ala Ser Glin Ala Cys Glin Asp Ile Asn Arg Ser Ser Ser Val Asp Tyr 355 360 365 Lieu. Tyr His His Ser Lieu. Arg Ser Glu. Cys Ala Ser Ser Gly Ser Asp 37 O 375 38O Llys Phe Val Phe Trp Asp Val Thr His Pro Thr Thr Ala Thr His His 385 390 395 4 OO Tyr Val Ala Glu Lys Met Lieu. Glu Ser Thr Asn. Glin Lieu. Ser Asn His 4 OS 41O 415
Pro Phe
<210s, SEQ ID NO 2 O &211s LENGTH: 1254 &212s. TYPE: DNA <213> ORGANISM: Artificial Sequence 22 Os. FEATURE: <223> OTHER INFORMATION: Description of Artificial Sequence: Synthetic polynucleotide
<4 OOs, SEQUENCE: 2O atgaataaaa cqat cacatt gcttagcgct citcct tcticc cactic tottt togcc catgca 6 O gcc.galaccta cact ct cocc tagatggtc agtgcatcCC aagtaagat C ggct Caggca 12 O aagcaaacgt acacgtacgt ccdatgctgg tat cqtactt catactic caa agatgagc.ca 18O gctactgatt gggaatgggc ggaga accct gacggaagct acttic actitt ggatggittat 24 O tggtggtcct ctdttt cott caagaacatgttttacactg acacgc.ccca gag tdttatc 3OO alagcagcgat gtgagcaaac Ccttgatcto gocaacgaga acgcggatat cacgttctt C 360 gcc.gcagaca accotttctic atataatcat accatttgga gcaacgatcc agittatgcaa. 42O cc.cgaccaga t caataaggt agttgcactic ggagatt coc tict cqgatac gggaaac at C 48O tittaacgcaa gtcagtggcg ctitcc caaac ccgaacagtt ggttcttggg acatttctica 54 O aacggatt cq t ctoggacgga gtacattgcc caa.gctaaaa acct tcc tot ttata actgg 6OO gctgtgggtg gtgcc.gc.cgg taaaatcaa tat attgctic ttacaggagt tagagcaa. 660 gtct citt cat acct cqctta cqctaagttg gccaaaaatt acaa.gc.cago caacact citt 72 O ttcacact cq agtttggctt gaacgactitc atgaactata accogttctgt accqqaggta 78O aagt cagact acgcggaagc Cttgattaag ct caccgacg Ctggcgcaaa gaacttgctt 84 O cittatgacac tocctgatgc taccc.gc.gca ccacagttca cct acticgac ccaggaggag 9 OO attaataaga t cagagctaa gatcgttgaa atgaacgaat t catcaaggc ticaagctgcc 96.O tactatacgg citcaaggitta taacgtaacc ctic tatgata ct catgcact citt cagagc 1 O2O ttgacggcta accc.cgagca acatggattt gtaaatgcta gtcaggcatgtcaggat at C 108 O aaccaagtt c tagtgttga ttacctittat caccacagoc to cqcagcga gtgtgcct cq 114 O tctggaag.cg acaaatttgt tttctgggat gtaact catc caaccacggc gacticac cat 12 OO US 2015/0037370 A1 Feb. 5, 2015 47
- Continued tatgtag cag aaaagatgct cqagagtaca aaccalattgt ctaac catcc ctitc 1254
<210s, SEQ ID NO 21 &211s LENGTH: 266 212. TYPE: PRT <213> ORGANISM: Vibrio harveyi <4 OOs, SEQUENCE: 21 Met Arg Llys Ser Lieu. Lieu Ala Lieu. Ser Lieu. Lieu Ala Ala Thir Ser Ala 1. 5 1O 15 Pro Val Met Ala Ala Asp Tyr Ser Asp Gly Asp Ile His Lys Asn Asp 2O 25 3O Tyr Lys Trp Met Glin Phe Asn Lieu Met Gly Ala Phe Asp Glu Lieu Pro 35 4 O 45 Gly Glu Ser Ser His Asp Tyr Lieu. Glu Met Glu Phe Gly Gly Arg Ser SO 55 6 O Gly Ile Phe Asp Lieu. Tyr Gly Tyr Val Asp Val Phe Asn Lieu Ala Ser 65 70 7s 8O Asp Llys Gly Ser Asp Llys Val Gly Asp Pro Lys Ile Phe Met Llys Phe 85 90 95 Ala Pro Arg Met Ser Ile Asp Gly Lieu. Thr Gly Lys Asp Lieu. Ser Phe 1OO 105 11 O Gly Pro Val Glin Glu Lieu. Tyr Val Ala Thr Lieu Phe Glu Trp Asp Gly 115 12 O 125 Thir Asp Tyr Lys Thr Asn Llys Phe Ser Val Asn. Asn Gln Llys Val Gly 13 O 135 14 O Ile Gly Ser Asp Val Met Val Pro Trp Phe Gly Lys Val Gly Val Asn 145 150 155 160 Lieu. Tyr Gly Thr Tyr Glin Gly Asn Gln Lys Asp Trp Asn Gly Phe Glin 1.65 17O 17s Ile Ser Thr Asn Trp Phe Llys Pro Phe Tyr Phe Phe Glu Asn Gly Ser 18O 185 19 O Phe Ile Ser Tyr Glin Gly Tyr Ile Asp Tyr Glin Phe Gly Met Lys Glu 195 2OO 2O5 Lys Tyr Ser Ser Ala Ser Asn Gly Gly Ala Met Phe Asn Gly Ile Tyr 21 O 215 22O Trp His Ser Asp Arg Phe Ala Val Gly Tyr Gly Lieu Lys Gly Tyr Lys 225 23 O 235 24 O Asp Val Tyr Gly Ile Lys Asp Ser Asp Ala Lieu Lys Ser Thr Gly Phe 245 250 255 Gly His Tyr Ile Ala Val Thr Tyr Llys Phe 26 O 265
<210s, SEQ ID NO 22 &211s LENGTH: 798 &212s. TYPE: DNA <213> ORGANISM: Vibrio harveyi
<4 OOs, SEQUENCE: 22 atgcgaaaga gcttgcttgc act tagtttg cittgctgcta catcago acc cqttatggct 6 O gcggattact Cagacgggga t at CC acaag aatgattata agtggatgca attcaacct C 12 O atgggcgctt tdgatgaact ccc.gggagaa t cct ct catg attaccttga gatggaattic 18O ggaggcc.gct ctdgaatctt tdatttgtac gigttacgtcg atgtatt caa tottgcatcc 24 O US 2015/0037370 A1 Feb. 5, 2015 48
- Continued gacaagggta gtgatalaggt tggagatc.ca aaaat Cttta tgaagttcgc CCC gaggatg tccatcgacg ggct cactgg taaggacttg agctt.cggtc cc.gttcagga gttgtacgt.c 360 gccacactitt ttgagtggga tgggactgat tataaaacga ataagttctic tgttgaataat Cagaaagttg gaattggctic ggatgtcatg gtaccCtggit tcggaaaagt gggtgttgaat
Ctctacggga catat caagg aalaccagaag gattggaacg gattic caaat Cagtacgaac 54 O tggitttaa.gc cottct actt ctittgagaat ggttc ctitta t ct cqtacca aggatacatt gactaccagt ttggaatgaa ggagaagitat agttctgcct cgaacggagg cgcaatgttc 660 aacggaattit attggcactic ggaccgattt atggattgaa gggctataag 72 O gatgtttacg gcattaagga ttcagacgct ttgaagttcta cgggatttgg acactaCat C gcc.gtcacat ataagttt 798
SEQ ID NO 23 LENGTH: 30 TYPE: DNA ORGANISM: Artificial Sequence FEATURE: OTHER INFORMATION: Description of Artificial Sequence: Synthetic primer
<4 OOs, SEQUENCE: 23 agct coatgg gaaaat catc. tcc.gcaa.gag 3 O
SEQ ID NO 24 LENGTH: 35 TYPE: DNA ORGANISM: Artificial Sequence FEATURE: OTHER INFORMATION: Description of Artificial Sequence: Synthetic primer
<4 OOs, SEQUENCE: 24 agctggat.cc tdattitttitt gccaact citt ttaaa 35
1-119. (canceled) 125. The diatom of claim 120, wherein the antigen is an 120. A diatom comprising a nucleic acid encoding an anti antibody or fragment thereof. gen heterologous to the diatom, wherein the antigen is 126. The diatom of claim 125, wherein the antibody is a expressed as a fusion protein with a surface-expressed transmission blocking antibody. polypeptide endogenous to the diatom selected from a frus 127. The diatom of claim 125, wherein the antibody is a tulin and p150 cell surface protein, wherein the antigen is single domain antibody or a nanobody. attached to the surface of the diatom. 128. The diatom of claim 120, wherein the diatom is a 121. The diatom of claim 120, wherein the antigen is Thalassiosira pseudonana. expressed as a fusion protein with a frustulin protein having at 129. An expression cassette comprising: least 90% sequence identity to SEQ ID NO:6 or SEQ ID i) a promoter selected from the group consisting of fucox NO:7. anthin chlorophyll binding protein (FCP) promoter and ribosomal protein L41 (rpL41) promoter; the promoter 122. The diatom of claim 120, wherein the antigen is expressed under the control of a promoter endogenous to the operably linked to: diatom selected from the group consisting of fucoxanthin ii) a nucleic acid encoding a diatom cell Surface polypep chlorophyll binding protein (FCP) promoter and ribosomal tide selected from a frustulin and p150 cell surface pro protein L41 (rpL41) promoter. tein; the nucleic acid encoding the diatom cell Surface polypeptide operably linked to: 123. The diatom of claim 122, wherein the FCP promoter iii) a nucleic acid encoding an antigen heterologous to a comprises a nucleic acid sequence having at least 90% diatom. sequence identity to SEQID NO:1. 130. The expression cassette of claim 129, wherein the 124. The diatom of claim 120, wherein the diatom is an FCP promoter comprises a nucleic acid sequence having at intact cell. least 90% sequence identity to SEQID NO:1. US 2015/0037370 A1 Feb. 5, 2015 49
131. The expression cassette of claim 129, wherein the antigen is expressed as a fusion protein with a frustulin pro tein having at least 90% sequence identity to SEQID NO:6 or SEQID NO:7. 132. The expression cassette of claim 129, wherein the antigen is an antibody or fragment thereof. 133. The expression cassette of claim 132, wherein the antibody is a transmission blocking antibody. 134. The expression cassette of claim 132, wherein the antibody is a single domain antibody or a nanobody. 135. A vector or plasmid comprising the expression cas Sette of claim 129. 136. The vector or plasmid of claim 135, wherein the vector is a plasmid comprising a nucleic acid sequence having at least 90% sequence identity to SEQID NO:8. 137. A diatom comprising the expression cassette of claim 129. 138. The diatom of claim 137, wherein the diatom is a Thalassiosira pseudonana. 139. A composition comprising a diatom of claim 120 and a pharmaceutically acceptable carrier. 140. A method of stimulating an immune response in an animal, comprising administering to the animal a composi tion of claim 139 in an amount effective to stimulate the immune response in the animal. 141. The method of claim 140, wherein the diatom is administered in the water or food or by aerosol. 142. The method of claim 140, wherein the animal is a mammal.