DOCSLIB.ORG

Transcriptomic Analysis of Early Stages of Intestinal Regeneration in Holothuria Glaberrima David J

Total Page：16

File Type：pdf, Size：1020Kb

Download full-text PDF Read full-text

Load more

Transcriptomic Analysis of Early Stages of Intestinal Regeneration in Holothuria glaberrima David J. Quispe-Parra1, Joshua G. Medina-Feliciano1, Sebastián Cruz-González1, Humberto Ortiz-Zuazaga2, José E. García-Arrarás1* 1University of Puerto Rico, Biology Department, San Juan, 00925, Puerto Rico. 2University of Puerto Rico, Department of Computer Sciences, San Juan, 00925, Puerto Rico. Table S1. Results of transcriptome assessment with BUSCO Parameter BUSCO result Core genes queried 978 Complete core genes detected 99.1% Complete single copy core genes 27.2% Complete duplicated core genes 71.9% Fragmented core genes detected 0.4% Missing core genes 0.5% Table S2. Transcriptome length statistics and composition assessments with gVolante Parameter Result Number of sequences 491 436 Total length (nt) 408 930 895 Longest sequence (nt) 34 610 Shortest sequence (nt) 200 Mean sequence length (nt) 832 N50 sequence length (nt) 1 691 Table S3. RNA-seq data read statistic values Accession Quantity of reads Sample Mapped reads (SRA) Before Filtering After Filtering SRR12564573 NormalA 89 424 588.00 88 112 720.00 94.18% SRR12564572 NormalB 74 105 862.00 72 983 434.00 93.79% SRR12564570 NormalC 60 626 094.00 59 767 896.00 91.55% SRR12564564 Day1A 32 499 910.00 31 721 976.00 90.67% SRR12564563 Day1B 35 164 514.00 34 237 960.00 91.37% SRR12564571 Day1C 43 519 280.00 42 179 220.00 91.53% SRR12564567 Day3A 64 094 536.00 62 995 792.00 90.26% SRR12564566 Day3B 71 654 462.00 70 158 078.00 91.07% SRR12564565 Day3C 71 259 560.00 70 418 332.00 90.75% SRR12564569 Day3D* 107 688 184.00 106 083 898.00 - SRR12564568 Day3E* 108 372 334.00 106 767 522.00 - *Samples used for the assembly but not for differential expression analysis Table S4. Genes and primers used for RT-qPCR Gene Primers F: AGGTCAAAATGTCCGGCCTCTGT VBP R: TCACGCTGGCGGTGTCAAAACT F: ACGGCGAAGGTAGCATCCGTTT FoxA R: ATGGCAATCCAGCAAGCGCCAA F: CCTGCAATAATCCGGTGAGT Wnt6 R: CGCGAATGTAAATGTCATGG F: CGCTCTCCATTTCAGAGGAC Sox4 R: GTCTTTCTGCCTCCTCAACG F: TGCCTGAGCTTTCTGTTCCT Tap26 R: CCCTCAAAGAATGGTGGAAA F: CAATGGTTGTTGCTGGAGTCTTT R: NADH CGCAGAAGTAGCCGCGAATAT F: CGTTGAAATACCGTCCATCC Tenascin-N R: AACGAAGGATACGCTGGAGA Table S5. Mean Ct values obtained from RT-qPCR Gene Stage Ct Mean Ct SD Normal 28.636 1.268 VBP Day 1 28.263 0.640 Day 3 27.958 0.738 Normal 23.611 0.371 FoxA Day 1 27.643 3.124 Day 3 27.824 3.201 Wnt6 Normal 28.607 1.399 Day 1 25.253 1.965 Day 3 27.842 3.703 Normal 26.038 0.784 Sox4 Day 1 25.424 1.143 Day 3 29.242 1.014 Normal 27.634 1.319 Tap26 Day 1 26.727 0.483 Day 3 29.512 1.311 Normal 18.843 0.271 NADH Day 1 20.829 0.355 Day 3 22.583 0.341 Normal 21.025 3.217 Tenascin Day 3 30.992 1.519 Table S6. Comparison of expressed transcripts in RNA-seq with previous studies RT- Northern Blot/In RNA-seq PCR/qPCR situ Gene Day 1 Day 3 Day 3 Days 2-3 (Log2FC) (Log2FC) Myc 2.72 ↑ 2.05 ↑ ↑ NA β-catenin 0.88 0.46NS -NS NA Melanotransferrin 3.55 ↑ 3.7 ↑ ↑ NA Serum amyloid A 2.39 ↑ 3.2 ↑ NA ↑ protein WNT9 2.69 ↑ 2.88 ↑ NA ↑ BMP 3.53 ↑ 3.31 ↑ NA ↑ survivin -0.90NS -0.31NS -NS - ↑: Upregulated; ↓: Downregulated; -: No significant change; NS: Not significant (Pvalue > 0.05) Table S7. Comparison of expressed transcripts in RNA-seq with microarray study Gene RNA-seq Microarray Day 1 Day 3 Day 3 (Log2FC) (Log2FC) Tensc-R 3.26↑ 2.03 NS ↑ Actin-1 6.12↑ 7.47↑ ↑ Actin-2 1.71↑ 1.56↑ ↑ Collagen alfa-1 -1.54↓ -0.67 NS ↑ Laminin alpha1 -3.67↓ -2.79↓ ↑ Stromelysin-3 -4.16↓ -2.65↓ ↑ (MMP-11) Hox9 1.03↑ -0.83 NS ↑ Krueppel like -1.09↓ 0.12 NS ↓ Gelsolin -0.79 NS -2.69↓ ↓ ↑: Upregulated; ↓: Downregulated; -: No significant change; NS: Not significant (Pvalue > 0.05) Table S8. Differentially expressed transcripts between day 3 vs 1 comparison Adjusted p- ID Description Log2FC value Transcript_223195 15-hydroxyprostaglandin dehydrogenase 2.13 3.58E-02 [NAD(+)] Transcript_298217 4-aminobutyrate aminotransferase, 2.98 2.81E-05 mitochondrial Transcript_334800 40S ribosomal protein S15 6.73 1.89E-04 Transcript_254071 actin, cytoskeletal 3B|actin, cytoskeletal 3 3.00 1.19E-02 Transcript_432551 actin, muscle 3.65 5.45E-03 Transcript_383802 adenylyltransferase and sulfurtransferase 3.21 3.38E-02 MOCS3-like Transcript_308851 alcohol dehydrogenase class-3 2.33 1.59E-02 Transcript_425811 calreticulin 2.45 9.78E-08 Transcript_298293 collagen alpha-1(XII) chain|tenascin-X 2.08 7.99E-05 Transcript_196327 creatine kinase, flagellar 5.16 4.69E-02 Transcript_380459 cryptochrome-2 2.03 3.75E-03 Transcript_226806 cytochrome P450 3A24 2.25 1.83E-02 Transcript_262552 cytochrome P450 3A9 4.03 3.31E-02 Transcript_175314 cytochrome P450 4V2 2.00 4.85E-02 Transcript_172290 cytosol aminopeptidase 2.21 1.97E-05 Transcript_184414 dehydrogenase/reductase SDR family 2.25 1.39E-03 member 7 Transcript_175770 deleted in malignant brain tumors 1 protein 2.65 2.63E-02 Transcript_461577 deoxyribodipyrimidine photo-lyase 2.68 2.66E-03 Transcript_432963 DNA replication licensing factor mcm5 2.57 4.81E-07 Transcript_359454 dynein light chain LC6, flagellar outer arm 2.35 6.25E-04 Transcript_347359 ectonucleotide 3.16 4.27E-03 pyrophosphatase/phosphodiesterase family member 7-like Transcript_273238 epidermal growth factor-like protein 7 2.49 1.23E-05 Transcript_276903 ERI1 exoribonuclease 2 2.86 3.80E-03 Transcript_365063 extracellular transglutaminase 2.62 5.99E-09 Transcript_350713 fibrillin-1 2.08 9.82E-03 Transcript_356914 ficolin-2-like 3.74 1.04E-02 Transcript_179574 ficolin-2-like 3.05 3.76E-02 Transcript_221519 formin-J 2.02 1.31E-04 Transcript_358088 fucose mutarotase 2.46 1.86E-08 Transcript_351559 G patch domain-containing protein 3 4.02 5.91E-03 Transcript_185057 GDH/6PGL endoplasmic bifunctional 2.07 2.55E-06 protein|hexose-6-phosphate dehydrogenase (glucose 1-dehydrogenase) Transcript_402303 GTP 3',8-cyclase, mitochondrial|cyclic 2.32 8.19E-03 pyranopterin monophosphate synthase, mitochondrial|molybdenum cofactor biosynthesis protein 1 Transcript_438891 H2.0-like homeobox protein|Homeobox 3.45 1.75E-11 domain-containing protein Transcript_251717 hairy/enhancer-of-split related with YRPW 3.17 2.39E-02 motif protein 1 Transcript_456276 heparan sulfate glucosamine 3-O- 3.31 1.15E-02 sulfotransferase 1 Transcript_438353 homeobox protein EMX1 3.86 8.19E-03 Transcript_290553 isoamyl acetate-hydrolyzing esterase 1 2.80 5.95E-05 homolog Transcript_409717 isochorismatase domain-containing protein 2.95 4.66E-03 2|isochorismatase domain-containing protein 2, mitochondrial Transcript_258900 KRP170 2.69 1.74E-02 Transcript_189831 L-gulonolactone oxidase 2.45 6.22E-03 Transcript_297492 laminin subunit alpha-2|laminin subunit 2.21 1.74E-05 alpha-1 Transcript_305145 LOW QUALITY PROTEIN: DNA 2.94 6.14E-07 replication licensing factor mcm2 Transcript_381204 LOW QUALITY PROTEIN: transcription 3.54 6.83E-09 factor Sox-10 Transcript_285150 LOW QUALITY PROTEIN: zygotic DNA 2.29 2.08E-07 replication licensing factor mcm6-B Transcript_294196 low-density lipoprotein receptor-related 2.14 2.64E-04 protein 1 Transcript_328691 MAM and LDL-receptor class A domain- 2.14 7.82E-04 containing protein 1 Transcript_257273 methylsterol monooxygenase 1 3.02 3.79E-03 Transcript_324570 microfibril-associated glycoprotein 2.48 3.32E-02 4|tenascin-N Transcript_263515 polycystic kidney disease protein 1-like 2 2.32 1.61E-02 Transcript_269460 probable D-lactate dehydrogenase, 3.55 2.01E-02 mitochondrial|lactate dehydrogenase D Transcript_236563 protein FAM166B-like 17.42 4.96E-04 Transcript_437843 protein lin-52 homolog 2.10 2.16E-03 Transcript_375637 protein Wnt-6 2.25 2.75E-03 Transcript_197666 putative aminopeptidase W07G4.4 2.06 2.59E-04 Transcript_311247 putative hydroxypyruvate isomerase 2.52 5.99E-04 Transcript_443748 pyridine nucleotide-disulfide 2.41 1.73E-02 oxidoreductase domain-containing protein 2|pyridine nucleotide-disulphide oxidoreductase domain 2 Transcript_297199 ryncolin-1-like 5.18 3.37E-02 Transcript_406209 sulfite oxidase 3.85 2.99E-07 Transcript_54760 testis-specific serine/threonine-protein 5.30 3.42E-02 kinase 4-like Transcript_251414 transcription factor Sp5 2.40 4.19E-03 Transcript_384474 transmembrane protein KIAA1109 2.08 1.48E-05 Transcript_266841 tuftelin 2.47 1.33E-02 Transcript_368226 ubiquitin 6.29 1.18E-03 Transcript_270219 ubiquitin-40S ribosomal protein S27a 6.47 4.00E-04 Transcript_437026 uncharacterized protein K02A2.6-like 3.43 2.72E-05 Transcript_190019 uncharacterized protein K02A2.6- 2.32 1.79E-02 like|Reverse transcriptase domain- containing protein Transcript_291904 uncharacterized protein 2.14 3.79E-04 LOC105438010|Glycoside hydrolase family 31 domain containing protein Transcript_283678 uncharacterized protein 4.75 9.63E-03 LOC583353|neurotrypsin Transcript_26623 uncharacterized protein LOC592324 7.59 2.53E-06 Transcript_442525 uncharacterized protein 2.01 2.72E-04 LOC753842|Protease inhibitor I35 (TIMP) domain containing protein Transcript_270528 uncharacterized protein 2.01 7.71E-05 LOC757055|glyoxylate/hydroxypyruvate reductase A HPR2 Transcript_263687 valacyclovir hydrolase-like 2.34 1.86E-03 Transcript_428635 zygotic DNA replication licensing factor 2.64 3.93E-04 mcm3 Transcript_167684 Transcript_294311 - -3.44 2.27E-02 Transcript_251847 - -2.32 7.18E-05 Transcript_254514 - -2.01 2.89E-02 Transcript_395263 14-3-3 family protein artA|14-3-3 protein 3 -5.90 2.83E-03 Transcript_285870 26S proteasome non-ATPase regulatory -3.03 1.24E-09 subunit 5 Transcript_42693 26S proteasome regulatory subunit 6A- -2.16 6.22E-06 B|26S protease regulatory subunit 6A- B|26S protease regulatory subunit 6A-like Transcript_48454 40S ribosomal protein
Recommended publications
  • Critical Evaluation of Gene Expression Changes in Human Tissues In

    Critical Evaluation of Gene Expression Changes in Human Tissues In

    Supplementary Material ‘Critical Evaluation of Gene Expression Changes in Human Tissues in Response to Supplementation with Dietary Bioactive Compounds: Moving Towards Better-Quality Studies’ by Biljana Pokimica and María-Teresa García-Conesa Table S1. Characteristics of the human trials included in this review: study design, type of participants, control and intervention description, dose and duration of treatment, analyses and related bioavailability studies. Study Experimental Characteristics Reference Clinical trial Participants C (Control T (Treatment with Total daily dose, Bioavailability studies: type of sample, design (RCT, (health status, description) bioactive compounds, duration (d or h)1 compounds and (or) metabolites analysed, crossover, gender) products or diet) main results2 parallel) Mix meals and diets Persson I et al., Single arm Healthy, C: not included T: mix Veg T: 250 g, NR 2000 [1] men 21 d Møller P et al., RCT, Healthy, C1: placebo tablet + T: mix FruVeg T: 600 g, Plasma: (NS↑) β-car, T, C2 (post- vs pre-) 2003 [2] parallel, mix energy drink (same 24 d (NC) VitC, T, C2 (post- vs pre-) double blinded amount of sugars as T) (NS↓, 69%) VitC, β-car, C1 (post- vs pre-) (regarding C1 C2: tablet with and C2) antioxidants + minerals (same amount as T) + energy drink (same amount of sugars as T) Almendingen K Randomized, Healthy, C: no proper control T1,2: mix FruVeg T1: 300 g, Plasma: ↑α-car, β-car, T2 vs T1 (post-) et al., 2005 [3] crossover, mix included (comparison T2: 750 g, (NS↑) Lyc, Lut, T2 vs T1 (post-) [4] single
  • A Computational Approach for Defining a Signature of Β-Cell Golgi Stress in Diabetes Mellitus

    A Computational Approach for Defining a Signature of Β-Cell Golgi Stress in Diabetes Mellitus

    Page 1 of 781 Diabetes A Computational Approach for Defining a Signature of β-Cell Golgi Stress in Diabetes Mellitus Robert N. Bone1,6,7, Olufunmilola Oyebamiji2, Sayali Talware2, Sharmila Selvaraj2, Preethi Krishnan3,6, Farooq Syed1,6,7, Huanmei Wu2, Carmella Evans-Molina 1,3,4,5,6,7,8* Departments of 1Pediatrics, 3Medicine, 4Anatomy, Cell Biology & Physiology, 5Biochemistry & Molecular Biology, the 6Center for Diabetes & Metabolic Diseases, and the 7Herman B. Wells Center for Pediatric Research, Indiana University School of Medicine, Indianapolis, IN 46202; 2Department of BioHealth Informatics, Indiana University-Purdue University Indianapolis, Indianapolis, IN, 46202; 8Roudebush VA Medical Center, Indianapolis, IN 46202. *Corresponding Author(s): Carmella Evans-Molina, MD, PhD ([email protected]) Indiana University School of Medicine, 635 Barnhill Drive, MS 2031A, Indianapolis, IN 46202, Telephone: (317) 274-4145, Fax (317) 274-4107 Running Title: Golgi Stress Response in Diabetes Word Count: 4358 Number of Figures: 6 Keywords: Golgi apparatus stress, Islets, β cell, Type 1 diabetes, Type 2 diabetes 1 Diabetes Publish Ahead of Print, published online August 20, 2020 Diabetes Page 2 of 781 ABSTRACT The Golgi apparatus (GA) is an important site of insulin processing and granule maturation, but whether GA organelle dysfunction and GA stress are present in the diabetic β-cell has not been tested. We utilized an informatics-based approach to develop a transcriptional signature of β-cell GA stress using existing RNA sequencing and microarray datasets generated using human islets from donors with diabetes and islets where type 1(T1D) and type 2 diabetes (T2D) had been modeled ex vivo. To narrow our results to GA-specific genes, we applied a filter set of 1,030 genes accepted as GA associated.
  • Protein Identities in Evs Isolated from U87-MG GBM Cells As Determined by NG LC-MS/MS

    Protein Identities in Evs Isolated from U87-MG GBM Cells As Determined by NG LC-MS/MS

    Protein identities in EVs isolated from U87-MG GBM cells as determined by NG LC-MS/MS. No. Accession Description Σ Coverage Σ# Proteins Σ# Unique Peptides Σ# Peptides Σ# PSMs # AAs MW [kDa] calc. pI 1 A8MS94 Putative golgin subfamily A member 2-like protein 5 OS=Homo sapiens PE=5 SV=2 - [GG2L5_HUMAN] 100 1 1 7 88 110 12,03704523 5,681152344 2 P60660 Myosin light polypeptide 6 OS=Homo sapiens GN=MYL6 PE=1 SV=2 - [MYL6_HUMAN] 100 3 5 17 173 151 16,91913397 4,652832031 3 Q6ZYL4 General transcription factor IIH subunit 5 OS=Homo sapiens GN=GTF2H5 PE=1 SV=1 - [TF2H5_HUMAN] 98,59 1 1 4 13 71 8,048185945 4,652832031 4 P60709 Actin, cytoplasmic 1 OS=Homo sapiens GN=ACTB PE=1 SV=1 - [ACTB_HUMAN] 97,6 5 5 35 917 375 41,70973209 5,478027344 5 P13489 Ribonuclease inhibitor OS=Homo sapiens GN=RNH1 PE=1 SV=2 - [RINI_HUMAN] 96,75 1 12 37 173 461 49,94108966 4,817871094 6 P09382 Galectin-1 OS=Homo sapiens GN=LGALS1 PE=1 SV=2 - [LEG1_HUMAN] 96,3 1 7 14 283 135 14,70620005 5,503417969 7 P60174 Triosephosphate isomerase OS=Homo sapiens GN=TPI1 PE=1 SV=3 - [TPIS_HUMAN] 95,1 3 16 25 375 286 30,77169764 5,922363281 8 P04406 Glyceraldehyde-3-phosphate dehydrogenase OS=Homo sapiens GN=GAPDH PE=1 SV=3 - [G3P_HUMAN] 94,63 2 13 31 509 335 36,03039959 8,455566406 9 Q15185 Prostaglandin E synthase 3 OS=Homo sapiens GN=PTGES3 PE=1 SV=1 - [TEBP_HUMAN] 93,13 1 5 12 74 160 18,68541938 4,538574219 10 P09417 Dihydropteridine reductase OS=Homo sapiens GN=QDPR PE=1 SV=2 - [DHPR_HUMAN] 93,03 1 1 17 69 244 25,77302971 7,371582031 11 P01911 HLA class II histocompatibility antigen,
  • Smith Bacterial SBP56 Identified As a Cu-Dependent Methanethiol

    Smith Bacterial SBP56 Identified As a Cu-Dependent Methanethiol

    Bacterial SBP56 identified as a Cu-dependent methanethiol oxidase widely distributed in the biosphere EYICE, Özge, MYRONOVA, Nataliia, POL, Arjan, CARRIÓN, Ornella, TODD, Jonathan D, SMITH, Thomas <http://orcid.org/0000-0002-4246-5020>, GURMAN, Stephen J, CUTHBERTSON, Adam, MAZARD, Sophie, MENNINK-KERSTEN, Monique Ash, BUGG, Timothy Dh, ANDERSSON, Karl Kristoffer, JOHNSTON, Andrew Wb, OP DEN CAMP, Huub Jm and SCHÄFER, Hendrik Available from Sheffield Hallam University Research Archive (SHURA) at: http://shura.shu.ac.uk/17252/ This document is the author deposited version. You are advised to consult the publisher's version if you wish to cite from it. Published version EYICE, Özge, MYRONOVA, Nataliia, POL, Arjan, CARRIÓN, Ornella, TODD, Jonathan D, SMITH, Thomas, GURMAN, Stephen J, CUTHBERTSON, Adam, MAZARD, Sophie, MENNINK-KERSTEN, Monique Ash, BUGG, Timothy Dh, ANDERSSON, Karl Kristoffer, JOHNSTON, Andrew Wb, OP DEN CAMP, Huub Jm and SCHÄFER, Hendrik (2018). Bacterial SBP56 identified as a Cu-dependent methanethiol oxidase widely distributed in the biosphere. The ISME journal, 1 (12), 145-160. Copyright and re-use policy See http://shura.shu.ac.uk/information.html Sheffield Hallam University Research Archive http://shura.shu.ac.uk OPEN The ISME Journal (2017), 1–16 www.nature.com/ismej ORIGINAL ARTICLE Bacterial SBP56 identified as a Cu-dependent methanethiol oxidase widely distributed in the biosphere Özge Eyice1,2,9, Nataliia Myronova1,9, Arjan Pol3, Ornella Carrión4, Jonathan D Todd4, Tom J Smith5, Stephen J Gurman6, Adam Cuthbertson1,
  • The Function of NM23-H1/NME1 and Its Homologs in Major Processes Linked to Metastasis

    The Function of NM23-H1/NME1 and Its Homologs in Major Processes Linked to Metastasis

    University of Dundee The Function of NM23-H1/NME1 and Its Homologs in Major Processes Linked to Metastasis Mátyási, Barbara; Farkas, Zsolt; Kopper, László; Sebestyén, Anna; Boissan, Mathieu; Mehta, Anil Published in: Pathology and Oncology Research DOI: 10.1007/s12253-020-00797-0 Publication date: 2020 Licence: CC BY Document Version Publisher's PDF, also known as Version of record Link to publication in Discovery Research Portal Citation for published version (APA): Mátyási, B., Farkas, Z., Kopper, L., Sebestyén, A., Boissan, M., Mehta, A., & Takács-Vellai, K. (2020). The Function of NM23-H1/NME1 and Its Homologs in Major Processes Linked to Metastasis. Pathology and Oncology Research, 26(1), 49-61. https://doi.org/10.1007/s12253-020-00797-0 General rights Copyright and moral rights for the publications made accessible in Discovery Research Portal are retained by the authors and/or other copyright owners and it is a condition of accessing publications that users recognise and abide by the legal requirements associated with these rights. • Users may download and print one copy of any publication from Discovery Research Portal for the purpose of private study or research. • You may not further distribute the material or use it for any profit-making activity or commercial gain. • You may freely distribute the URL identifying the publication in the public portal. Take down policy If you believe that this document breaches copyright please contact us providing details, and we will remove access to the work immediately and investigate your
  • Supplementary Table S4. FGA Co-Expressed Gene List in LUAD

    Supplementary Table S4. FGA Co-Expressed Gene List in LUAD

    Supplementary Table S4. FGA co-expressed gene list in LUAD tumors Symbol R Locus Description FGG 0.919 4q28 fibrinogen gamma chain FGL1 0.635 8p22 fibrinogen-like 1 SLC7A2 0.536 8p22 solute carrier family 7 (cationic amino acid transporter, y+ system), member 2 DUSP4 0.521 8p12-p11 dual specificity phosphatase 4 HAL 0.51 12q22-q24.1histidine ammonia-lyase PDE4D 0.499 5q12 phosphodiesterase 4D, cAMP-specific FURIN 0.497 15q26.1 furin (paired basic amino acid cleaving enzyme) CPS1 0.49 2q35 carbamoyl-phosphate synthase 1, mitochondrial TESC 0.478 12q24.22 tescalcin INHA 0.465 2q35 inhibin, alpha S100P 0.461 4p16 S100 calcium binding protein P VPS37A 0.447 8p22 vacuolar protein sorting 37 homolog A (S. cerevisiae) SLC16A14 0.447 2q36.3 solute carrier family 16, member 14 PPARGC1A 0.443 4p15.1 peroxisome proliferator-activated receptor gamma, coactivator 1 alpha SIK1 0.435 21q22.3 salt-inducible kinase 1 IRS2 0.434 13q34 insulin receptor substrate 2 RND1 0.433 12q12 Rho family GTPase 1 HGD 0.433 3q13.33 homogentisate 1,2-dioxygenase PTP4A1 0.432 6q12 protein tyrosine phosphatase type IVA, member 1 C8orf4 0.428 8p11.2 chromosome 8 open reading frame 4 DDC 0.427 7p12.2 dopa decarboxylase (aromatic L-amino acid decarboxylase) TACC2 0.427 10q26 transforming, acidic coiled-coil containing protein 2 MUC13 0.422 3q21.2 mucin 13, cell surface associated C5 0.412 9q33-q34 complement component 5 NR4A2 0.412 2q22-q23 nuclear receptor subfamily 4, group A, member 2 EYS 0.411 6q12 eyes shut homolog (Drosophila) GPX2 0.406 14q24.1 glutathione peroxidase
  • Protein Targets of Acetaminophen Covalent Binding in Rat and Mouse

    Protein Targets of Acetaminophen Covalent Binding in Rat and Mouse

    ORIGINAL RESEARCH published: XX XX 2021 doi: 10.3389/fchem.2021.736788 1 58 2 59 3 60 4 61 5 62 6 63 7 64 8 65 9 66 10 Protein Targets of Acetaminophen 67 11 68 12 Covalent Binding in Rat and Mouse 69 13 70 14 Q2 Liver Studied by LC-MS/MS 71 15 Q3 72 Q1 16 Timon Geib, Ghazaleh Moghaddam, Aimee Supinski, Makan Golizeh† and Lekha Sleno* Q4 73 17 Q5 74 18 Chemistry Department, Université du Québec à Montréal, Montréal, QC, Canada Q6 75 19 76 20 Acetaminophen (APAP) is a mild analgesic and antipyretic used commonly worldwide. 77 21 78 Although considered a safe and effective over-the-counter medication, it is also the leading 22 79 23 cause of drug-induced acute liver failure. Its hepatotoxicity has been linked to the covalent 80 24 binding of its reactive metabolite, N-acetyl p-benzoquinone imine (NAPQI), to proteins. The 81 Edited by: 25 aim of this study was to identify APAP-protein targets in both rat and mouse liver, and to 82 26 Marcus S Cooke, 83 University of South Florida, compare the results from both species, using bottom-up proteomics with data-dependent 27 United States 84 28 high resolution mass spectrometry and targeted multiple reaction monitoring (MRM) 85 Reviewed by: 29 experiments. Livers from rats and mice, treated with APAP, were homogenized and 86 Hartmut Jaeschke, 30 University of Kansas Medical Center digested by trypsin. Digests were then fractionated by mixed-mode solid-phase extraction 87 31 Research Institute, United States prior to liquid chromatography-tandem mass spectrometry (LC-MS/MS).
  • The Microbiota-Produced N-Formyl Peptide Fmlf Promotes Obesity-Induced Glucose

    The Microbiota-Produced N-Formyl Peptide Fmlf Promotes Obesity-Induced Glucose

    Page 1 of 230 Diabetes Title: The microbiota-produced N-formyl peptide fMLF promotes obesity-induced glucose intolerance Joshua Wollam1, Matthew Riopel1, Yong-Jiang Xu1,2, Andrew M. F. Johnson1, Jachelle M. Ofrecio1, Wei Ying1, Dalila El Ouarrat1, Luisa S. Chan3, Andrew W. Han3, Nadir A. Mahmood3, Caitlin N. Ryan3, Yun Sok Lee1, Jeramie D. Watrous1,2, Mahendra D. Chordia4, Dongfeng Pan4, Mohit Jain1,2, Jerrold M. Olefsky1 * Affiliations: 1 Division of Endocrinology & Metabolism, Department of Medicine, University of California, San Diego, La Jolla, California, USA. 2 Department of Pharmacology, University of California, San Diego, La Jolla, California, USA. 3 Second Genome, Inc., South San Francisco, California, USA. 4 Department of Radiology and Medical Imaging, University of Virginia, Charlottesville, VA, USA. * Correspondence to: 858-534-2230, [email protected] Word Count: 4749 Figures: 6 Supplemental Figures: 11 Supplemental Tables: 5 1 Diabetes Publish Ahead of Print, published online April 22, 2019 Diabetes Page 2 of 230 ABSTRACT The composition of the gastrointestinal (GI) microbiota and associated metabolites changes dramatically with diet and the development of obesity. Although many correlations have been described, specific mechanistic links between these changes and glucose homeostasis remain to be defined. Here we show that blood and intestinal levels of the microbiota-produced N-formyl peptide, formyl-methionyl-leucyl-phenylalanine (fMLF), are elevated in high fat diet (HFD)- induced obese mice. Genetic or pharmacological inhibition of the N-formyl peptide receptor Fpr1 leads to increased insulin levels and improved glucose tolerance, dependent upon glucagon- like peptide-1 (GLP-1). Obese Fpr1-knockout (Fpr1-KO) mice also display an altered microbiome, exemplifying the dynamic relationship between host metabolism and microbiota.
  • Characterization of Visceral and Subcutaneous Adipose Tissue

    Characterization of Visceral and Subcutaneous Adipose Tissue

    J. Perinat. Med. 2016; 44(7): 813–835 Shali Mazaki-Tovi*, Adi L. Tarca, Edi Vaisbuch, Juan Pedro Kusanovic, Nandor Gabor Than, Tinnakorn Chaiworapongsa, Zhong Dong, Sonia S. Hassan and Roberto Romero* Characterization of visceral and subcutaneous adipose tissue transcriptome in pregnant women with and without spontaneous labor at term: implication of alternative splicing in the metabolic adaptations of adipose tissue to parturition DOI 10.1515/jpm-2015-0259 groups (unpaired analyses) and adipose tissue regions Received July 27, 2015. Accepted October 26, 2015. Previously (paired analyses). Selected genes were tested by quantita- published online March 19, 2016. tive reverse transcription-polymerase chain reaction. Abstract Results: Four hundred and eighty-two genes were differ- entially expressed between visceral and subcutaneous Objective: The aim of this study was to determine gene fat of pregnant women with spontaneous labor at term expression and splicing changes associated with par- (q-value < 0.1; fold change > 1.5). Biological processes turition and regions (visceral vs. subcutaneous) of the enriched in this comparison included tissue and vascu- adipose tissue of pregnant women. lature development as well as inflammatory and meta- Study design: The transcriptome of visceral and abdomi- bolic pathways. Differential splicing was found for 42 nal subcutaneous adipose tissue from pregnant women at genes [q-value < 0.1; differences in Finding Isoforms using term with (n = 15) and without (n = 25) spontaneous labor Robust Multichip Analysis scores > 2] between adipose was profiled with the Affymetrix GeneChip Human Exon tissue regions of women not in labor. Differential exon 1.0 ST array. Overall gene expression changes and the dif- usage associated with parturition was found for three ferential exon usage rate were compared between patient genes (LIMS1, HSPA5, and GSTK1) in subcutaneous tissues.
  • Volatile Sulfur Compounds in Coastal Acid Sulfate Soils, Northern N.S.W

    Volatile Sulfur Compounds in Coastal Acid Sulfate Soils, Northern N.S.W

    VOLATILE SULFUR COMPOUNDS IN COASTAL ACID SULFATE SOILS, NORTHERN N.S.W Andrew Stephen Kinsela A thesis submitted in fulfilment of the requirements for the degree of Doctor of Philosophy School of Biological, Earth & Environmental Sciences THE UNIVERSITY OF NEW SOUTH WALES, AUSTRALIA 2007 DECLARATION ORIGINALITY STATEMENT ‘I hereby declare that this submission is my own work and to the best of my knowledge it contains no materials previously published or written by another person, or substantial proportions of material which have been accepted for the award of any other degree or diploma at UNSW or any other educational institution, except where due acknowledgement is made in the thesis. Any contribution made to the research by others, with whom I have worked at UNSW or elsewhere, is explicitly acknowledged in the thesis. I also declare that the intellectual content of this thesis is the product of my own work, except to the extent that assistance from others in the project's design and conception or in style, presentation and linguistic expression is acknowledged.’ Signed ………………………………………………… Date …………………………………………………… iii ACKNOWLEDGEMENTS There are numerous people who have assisted me throughout the course of my thesis. I therefore want to take this opportunity to thank a few of those who contributed appreciably, both directly and indirectly. First of all, I would like to express my heartfelt gratitude to my supervisor, Associate Professor Mike Melville. Mike’s initial teachings as part of my undergraduate studies first sparked my interest in soils. Since then his continued enthusiasm on the subject has helped shape the way I approach my own work.
  • Development and Validation of a Protein-Based Risk Score for Cardiovascular Outcomes Among Patients with Stable Coronary Heart Disease

    Development and Validation of a Protein-Based Risk Score for Cardiovascular Outcomes Among Patients with Stable Coronary Heart Disease

    Supplementary Online Content Ganz P, Heidecker B, Hveem K, et al. Development and validation of a protein-based risk score for cardiovascular outcomes among patients with stable coronary heart disease. JAMA. doi: 10.1001/jama.2016.5951 eTable 1. List of 1130 Proteins Measured by Somalogic’s Modified Aptamer-Based Proteomic Assay eTable 2. Coefficients for Weibull Recalibration Model Applied to 9-Protein Model eFigure 1. Median Protein Levels in Derivation and Validation Cohort eTable 3. Coefficients for the Recalibration Model Applied to Refit Framingham eFigure 2. Calibration Plots for the Refit Framingham Model eTable 4. List of 200 Proteins Associated With the Risk of MI, Stroke, Heart Failure, and Death eFigure 3. Hazard Ratios of Lasso Selected Proteins for Primary End Point of MI, Stroke, Heart Failure, and Death eFigure 4. 9-Protein Prognostic Model Hazard Ratios Adjusted for Framingham Variables eFigure 5. 9-Protein Risk Scores by Event Type This supplementary material has been provided by the authors to give readers additional information about their work. Downloaded From: https://jamanetwork.com/ on 10/02/2021 Supplemental Material Table of Contents 1 Study Design and Data Processing ......................................................................................................... 3 2 Table of 1130 Proteins Measured .......................................................................................................... 4 3 Variable Selection and Statistical Modeling ........................................................................................
  • Assessing the Human Canonical Protein Count[Version 1; Peer Review

    Assessing the Human Canonical Protein Count[Version 1; Peer Review

    F1000Research 2017, 6:448 Last updated: 15 JUL 2020 REVIEW Last rolls of the yoyo: Assessing the human canonical protein count [version 1; peer review: 1 approved, 2 approved with reservations] Christopher Southan IUPHAR/BPS Guide to Pharmacology, Centre for Integrative Physiology, University of Edinburgh, Edinburgh, EH8 9XD, UK First published: 07 Apr 2017, 6:448 Open Peer Review v1 https://doi.org/10.12688/f1000research.11119.1 Latest published: 07 Apr 2017, 6:448 https://doi.org/10.12688/f1000research.11119.1 Reviewer Status Abstract Invited Reviewers In 2004, when the protein estimate from the finished human genome was 1 2 3 only 24,000, the surprise was compounded as reviewed estimates fell to 19,000 by 2014. However, variability in the total canonical protein counts version 1 (i.e. excluding alternative splice forms) of open reading frames (ORFs) in 07 Apr 2017 report report report different annotation portals persists. This work assesses these differences and possible causes. A 16-year analysis of Ensembl and UniProtKB/Swiss-Prot shows convergence to a protein number of ~20,000. The former had shown some yo-yoing, but both have now plateaued. Nine 1 Michael Tress, Spanish National Cancer major annotation portals, reviewed at the beginning of 2017, gave a spread Research Centre (CNIO), Madrid, Spain of counts from 21,819 down to 18,891. The 4-way cross-reference concordance (within UniProt) between Ensembl, Swiss-Prot, Entrez Gene 2 Elspeth A. Bruford , European Molecular and the Human Gene Nomenclature Committee (HGNC) drops to 18,690, Biology Laboratory, Hinxton, UK indicating methodological differences in protein definitions and experimental existence support between sources.