Molecular Interactions of Colicin Fy with a Susceptible Bacterial Cell

MASARYK UNIVERSITY faculty of medicine department of biology

BACTERIOCINOGENY OF YERSINIAE:

MOLECULAR INTERACTIONS OF COLICIN FY WITH A SUSCEPTIBLE BACTERIAL CELL

Brno, 2013 Juraj Bosák

BIBLIOGRAPHIC IDENTIFICATION

Name and Surname: Juraj Bosák

Title 0f Thesis: Bacteriocinogeny of yersiniae: Molecular interactions of colicin FY with a susceptible bacterial cell Study Programme: Medical Biology 5103V022 Supervisor: doc. MUDr. David Šmajs, Ph.D. Defended in: 2013 Keywords: Antibacterial toxin, Bacteriocin, Colicin, Yersinia, Y. enterocolitica, Escherichia, Yersiniosis, Probiotics 6 ABSTRACT

There are numerous antimicrobial agents that are produced by bacteria. The role of these substances is to improve fitness of the producer in a daily fight for survival. Bacteriocins are substances that inhibit growth of other bacteria. One important subgroup of bacteriocins is represented by colicins, antimicrobial agents produced by colicinogenic strains of Escherichia coli and other related species of the family Enterobacteriaceae. These toxins specifically inhibit closely related bacteria based on the presence of a specific receptor on the cell surface. Genus Yersinia comprises important human pathogens such as Y. pestis, Y. pseudotuberculosis, and Y. enterocolitica. Growth inhibition between various strains of yersiniae is quite common. Out of numerous identified bacteriocin-like substances produced by yersiniae, only two, pesticin I and enterocoliticin, were characterized in detail. In fact, these are the only two characterized bacteriocins known to attack yersiniae. Therefore, a search for fully characterized bacteriocins that act specifically against yersiniae has been demanded.

In this study, we describe a novel colicin - colicin FY - isolated from a colicinogenic strain of Ye- rsinia frederiksenii; we show its complete plasmid sequence (pYF27601), mechanism of its toxicity, corresponding receptor (YiuR), and translocation routes into a susceptible bacterium. This is the first well characterized colicin, which is active mainly against strains of Y. enterocolitica.

The universal susceptibility of Y. enterocolitica to colicin FY together with absence of activity on strains outside the genus Yersinia suggests potential therapeutic applications of colicin FY.

ABSTRAKT

Bakterie produkují různé antimikrobiální látky, které je zvýhodňují vůči jiným bakteriím v každo- denním boji o přežití. Koliciny jsou významnou skupinou bakteriocinů; jsou produkovány některý- mi kmeny druhu Escherichia coli a příbuznými druhy čeledě Enterobacteriaceae. Koliciny se vyzna- čují inhibičním účinkem vůči příbuzným bakteriím, který je dán přítomností specifického receptoru na povrchu citlivé bakterie. U rodu Yersinia, zahrnující patogenní druhy Y. pestis, Y. pseudotuberculosis a Y. enterocolitica, byla popsána produkce různých antibakteriálních substancí, avšak pouze dvě – pesticin I a enterokoliticin - byly detailně charakterizovány. V současnosti jsou to jediné dva detailně charakterizované bakteriociny, které účinkují vůči yersiniím. Tato práce se zaměřila na charakterizaci nově objeveného antimikrobiálního agens produko- vaného nepatogenním kmenem Yersinia frederiksenii. Jedná se o nový typ kolicinu, který byl poj- menován kolicin FY. Byla získána kompletní sekvence plazmidu produkujícího kolicin FY a současně byl popsán mechanizmus účinku kolicinu FY. Protein YiuR byl identifikován jako receptor kolicinu

FY.

Kolicin FY se vyznačuje univerzálním účinkem vůči kmenům Y. enterocolitica. Současně neby- la pozorována inhibice jiných bakterií mimo rod Yersinia, což naznačuje potenciální terapeutické využití kolicinu FY.

DECLARATION

I hereby declare that I have worked independently, using only the primary and secondary sources listed in the bibliography, under the supervision of doc. MUDr. David Šmajs, Ph.D.

...... In Brno Mgr. Juraj Bosák

ACKNOWLEDGEMENTS

I would like to thank my supervisor doc. MUDr. David Šmajs, Ph.D. for his ideas, support, and pa- tience.

Special thank belongs to Petra Laiblová (Kotrsalová). She started this project and in fact discovered the new bacteriocin. My objective has been characterization of her discovery.

Many thanks also belong to my colleagues from the Department of Biology, namely Lenka Micen- ková, Lenka Mikalová, Michal Strouhal, and Marie Zobaniková for always being here for me.

Míša, thank you for your love and understanding during the years spent at The University. Your support allowed finishing my studies.

This study was supported by a grants from the Ministry of Health of the Czech Republic (NS9665-4/2008, NT13413-4/2012) and by institutional support from the Czech Republic (MSM0021622415)

CONTENTS

I. THEORETICAL PART...... 17 1. Theoretical background...... 19 1.1. Bacteriocins...... 19 1.2. Colicins ...... 20 1.2.1. Classification...... 20 1.2.2. Genetic organization ...... 22 1.2.3. Release from the producing cell...... 24 1.2.4. Structure...... 24 1.2.5. Mechanism of action...... 27 1.2.5.1. Colicin interactions with the outer membrane...... 27 1.2.5.1.1. Interaction partners in the outer membrane ...... 27 TonB-dependent transporters (TBDTs)...... 27 Outer membrane porins...... 28 1.2.5.1.2. Interaction of colicins with primary receptors...... 29 1.2.5.1.3. Interaction of colicins with secondary receptors (translocators)...... 31 Translocon of Tol-dependent colicins...... 31 Translocon of TonB-dependent colicins...... 32 1.2.5.2. Colicin interactions in the periplasmic space...... 33 1.2.5.2.1. Interaction partners in the periplasmic space ...... 33 1.2.5.2.2. Interaction of colicins with the translocation system...... 34 1.2.5.3. Colicin interactions with the inner membrane...... 35 1.2.5.3.1. Interaction of pore-forming colicins with the inner membrane...... 35 1.2.5.3.2. Interaction of enzymatic colicins with the inne membrane...... 36 1.2.5.4. Colicin interactions in the cytoplasm...... 37

II. EXPERIMENTAL PART ...... 39 2. Specific aims ...... 41 3. Materials and methods...... 43 3.1. Bacterial strains...... 43 3.2. Culture media ...... 43 3.3. Detection of the colicin production ...... 43 3.4. Preparation of crude colicin extracts ...... 45 3.5. Colicin activity assay...... 45 3.6. Isolation of plasmids...... 45 3.7. PCR product purification...... 45 3.8. Preparation of chemocompetent cells and transformation...... 45 3.9. Preparation of electrocompetent cells and transformation...... 45 3.10. Plasmid in vitro mutagenesis and construction of plasmid library...... 46 3.11. DNA sequencing and sequence analysis...... 46 3.12. Construction of the genome library...... 47 3.13. Chromosomal mutagenesis in vivo...... 47

3.14. Identification of receptor for colicin FY ...... 47 3.15. DNA cloning...... 47 3.16. Colicin purification and immunoblot analysis...... 48 3.17. Channel-forming assay...... 48 3.18. 16S rRNA analysis...... 48 3.19. Bioserotype classification ...... 49 3.20. Pulsed field gel electrophoresis ...... 49 3.21. Detection of virulence factors...... 49 3.22. Antibiotic susceptibility assay ...... 50 4. Results and discussion...... 51 4.1. Bacteriocin production in the genus Yersinia ...... 51 4.2. Activity spectrum of the bacteriocin of Y. frederiksenii 27601 ...... 53 4.3. Isolation and sequencing of the colicinogenic plasmid YF27601...... 54 4.4. Analysis of the colicinogenic region on pYF27601...... 56

4.5. Sequence analysis of colicin FY on the protein level...... 57

4.6. Cloning, purification, and protein analysis of colicin FY ...... 59

4.7. Identification and characterization of the colicin FY receptor...... 62

4.8. Comprehensive study of colicin FY activity against Y. enterocolitica...... 67 4.8.1. Characterization of Y. enterocolitica isolates...... 68

4.8.2. Susceptibility of Y. enterocolitica to colicin FY...... 72

4.9. Colicin FY activity spectrum outside the genus Yersinia ...... 74

4.10. Therapeutic potential of colicin FY ...... 75 5. Summary...... 77 6. Bibliography ...... 79

III. SUPPLEMENTS...... 105 7. Supplements ...... 107 7.1. Acronyms and abbreviations...... 107 7.2. Supplementary data...... 109 7.3. List of publications and meeting contributions...... 118 I. THEORETICAL PART

1. THEORETICAL BACKGROUND

1.1. Bacteriocins

Bacteriocins were first discovered in 1925, when a Belgian scientist Andre Gratia observed toxic activity of Escherichia coli strain V against bacterial culture E. coli ϕ (Gratia, 1925). In the following de- cades, several toxic substances produced by enteric bacteria have been identified and characterized. In 1946, Andre Gratia, together with Pierre Fredericq, demonstrated proteinaceous nature of these substances and called them “colicins” (Gratia and Fredericq, 1946). Later, production of colicin-like substances by noncoliform bacteria was discovered (Florey et al., 1946) and a general term “bacteriocin” was used for protein-like substances with activity restricted to related species (Jacob et al., 1953). Like this, the colicins became a subgroup of bacteriocins. Additional subgroups of bacteriocins have been discovered and named analogically to colicins (e.g. pyocins from Pseudomonas pyogenes, cloacins from Enterobacter cloacae, marcescins from Serratia marcescens, megacins from Bacillus mega- terium, fonticins from Pragia fontium, and aquaticins from Budvicia aquatica). Nowadays, the term bacteriocin is rather used for antibiotic peptides of Gram-positive bacteria (Jack et al., 1995), while toxins of Gram-negative bacteria are called microcins and colicins (Duquesne et al., 2007; Šmarda and Šmajs, 1998). Important Gram-positive producers of bacteriocins are lactic acid bacteria. Bacteriocins of lactic acid bacteria can be classified into two categories – peptides with a modified chain (lantibiotics) and peptides without any modifications. The toxic effect of these bacteriocins is mediated by interaction with the cell envelope structures, which leads to permeabilization of the membrane. There is more than hundred of different bacteriocins (Hammami et al., 2007; http://bactibase.pfba-lab.org), and many of them have a status “Generally Recognized As a Save (GRAS)”, which makes bacteriocins at- tractive for various applications, e.g. in food preservation. For instance, nisin A, discovered in 1928 (Rogers and Whittier, 1928), is used as a commercial food preservative in more than 40 countries (Cotter et al., 2005). Another important group of bacteriocins are peptides of staphylococci, which could be alternative agents to control multiresistant strains (Nascimento et al., 2006). Microcins are small peptides produced by Gram-negative bacteria. They share several similarities with bacteriocins of the Gram-positive bacteria, e.g. molecular mass lower than 10 kDa, ABC transporters-mediated secretion etc. There have been only around 15 microcins described; they largely vary in structure and mechanism of their toxic effect. Cell target of microcins is either the cytoplasmic membrane or enzymes of the protein synthesis and of nucleic acid metabolism. Microcin production can play an important role in composition of the gut microbiota, since several studies showed that the activity spectrum of microcins comprises pathogenic enterobacteria. For example, Wooley et al. (1999) observed growth inhibition of salmonellae by microcin 24 under in vivo and in vitro conditions. In addition, microcin B7 produced by E. coli strain H22 inhibited shigellae using in vitro and in vivo assays (Cursino et al., 2006). Probiotic strain E. coli Nissle 1917 that produces microcins M and H47 is commonly used in human medicine (Cukrowska et al., 2002; Lodinová-Žádníková and Sonnenborn, 1997; Lodinová-Žádníková et al., 1998; Lodinová-Žádníková et al., 2010). Colicins, the second group of bacteriocins produced by Gram-negative bacteria, are antimicrobial proteins with molecular mass ranging from 20 to 80 kDa, with specific activity against E. coli and closely related species. Comprehensive information about the colicin structure and function is presented in the next chapter. The colicin research helped us to better understand protein and nutrient transport across the cell envelope, mechanisms of pore formation, and enzymatic activity of nucle-

19 ases, and also provided a number of “tools” for molecular biologists, e.g. pBR322 vector and its deri- vates. It was also shown that the inhibition effect of several colicins (e.g. E1, U, Js, and pesticin I) is directed against important human pathogens, such as Yersinia sp. and Shigella sp. (Hu and Brubaker, 1974; Šmajs and Weinstock, 2001a; Šmajs et al., 1997). Likewise microcins, colicins can be potentially used as probiotics in livestock and poultry industry that represent a reservoir of human pathogens, such as E. coli O157 (reviewed in Gillor et al., 2004). The third group of bacteriocins - corpuscular (high-molecular weight) bacteriocins - is produced by Gram-negative and also Gram-positive bacteria and represents the most miscellaneous group of bacteriocins. Production of these phage tail-like bacteriocins was described in several bacterial species, including Pragia sp., Budvicia sp., Serratia sp., Pseudomonas sp., Erwinia sp., Yersinia sp. and Clostridium sp. (Gebhart et al., 2012; Jabrane et al., 2002; Kageyama, 1964; Nguyen et al., 1999; Strauch et al., 2001; Šmarda and Benada, 2005; Takeya et al., 1967). There are two groups of corpuscular bacteriocins – the R-type (rod-like) and the F-type (flexible rod-like) (Michel-Briand and Baysse, 2002). Members of the former group are similar to contractile tails of phages from the family Myoviridae, while members of the latter group resemble noncontractile, but flexible tails of Siphoviri- dae phages. A narrow specificity of corpuscular bacteriocins and the absence of nucleic acid in their particles could play an important role in construction of new therapeutic agents with directed action against individual bacterial strains (Skurnik and Strauch, 2006).

1.2. Colicins

1.2.1. Classification

Colicins are proteins produced by about 50% strains of E. coli (Šmajs et al., 2010). They are lethal for E. coli and related strains from the family Enterobacteriaceae. The colicin killing activity is condi- tioned by binding of a colicin molecule to a specific receptor on the outer membrane and translocation through the cell envelope by either Tol or TonB protein system. The colicin classification is based on the three step colicin action – binding, translocation, and killing. The first classification of colicins was made by Fredericq who identified colicin resistant mutants without a functional colicin receptor. Therefore, the classification was based on the receptor specificity. Fredericq designed colicins by alphabet letters and moreover, he subdivided colicins recognizing the same receptor using an additional number (e.g. colicins E1-E9) (Fredericq, 1946). Later, colicin- nonsusceptible mutants with functional colicin receptors were also identified and designated as “tolerant mutants” (Nagel de Zwaig and Luria, 1967). Tolerant phenotype of bacteria is associated with TonB or Tol protein systems, which colicins use to translocate through the cell envelope. The use of different translocation systems classifies colicins into two groups (Davies and Reeves, 1975a, 1975b); Group A comprises colicins that are translocated by Tol system (e.g. U, Y, K, and E1), while group B comprises colicins that use TonB system (e.g. B, D, Ia, and M). Another type of classification is based on the type of colicin activity. This way, colicins can be divided into three groups – nuclease colicins, pore-forming colicins and colicins affecting peptidoglycan layer. Nuclease colicins are further divided into colicins that cleave DNA (i.e. E2, E7, E8, and E9) (Chak et al., 1991; Pommer et al., 1998; Schaller and Nomura, 1976; Toba et al., 1988) and specific RNases (i.e. D, E3, E4, E5, and E6), which hydrolyze rRNA or tRNA molecule (Akutsu et al., 1989; Bowman et al., 1971; Ogawa et al., 1999; Tomita et al., 2000). Colicins A, B, E1, Ia, Ib K, L, N, S1, S4, U, Y, 5, and 10 are pore-forming, meaning that they form pores in the cytoplasmic membranes,

20 which affects the cell metabolism via membrane depolarization and ion efflux (Cascales et al., 2007; Gould and Cramer, 1977; Nagel de Zwaig, 1969; Plate et al., 1974; Šmajs et al., 1997; Tokuda and Konisky, 1978). A unique action was identified for pesticin I and colicin M, which hydrolyses murein (Ferber and Brubaker, 1979; Vollmer et al., 1997) and inhibits murein synthesis (El Ghachi et al., 2006; Harkness and Braun, 1989), respectively. The classification of colicins is summarized inTable 1 and Figure 1.

TABLE 1. Characterization of colicins

Primary Secondary Transport Colicin Mode of killing receptor receptor system A BtuB OmpF TolA,B,Q,R Pore-forming B FepA ? TonB,ExbB,D Pore-forming D FepA ? TonB,ExbB,D tRNase E1 BtuB TolC TolA,R Pore-forming E2 BtuB OmpF TolA,B,Q,R DNase E3 BtuB OmpF TolA,B,Q,R rRNase E4 BtuB OmpF TolA,B,Q,R rRNase E5 BtuB OmpF TolA,B,Q,R tRNase E6 BtuB OmpF TolA,B,Q,R rRNase E7 BtuB OmpF TolA,B,Q,R DNase E8 BtuB OmpF TolA,B,Q,R DNase E9 BtuB OmpF TolA,B,Q,R DNase Ia Cir Cir TonB,ExbB,D Pore-forming Ib Cir Cir TonB,ExbB,D Pore-forming Js CjrC ? Cjrb,ExbB,D ? K Tsx OmpF,A TolA,B,Q,R Pore-forming L ? OmpA,F TolA,Q,? Pore-forming M FhuA ? TonB,ExbB,D Murein synthesis inhibitor N OmpF OmpF TolA,Q,R Pore-forming S1 Cir ? TonB,ExbB,D Pore-forming S4 OmpW ? TolA,B,Q,R Pore-forming U OmpA OmpF TolA,B,Q,R Pore-forming Y OmpA OmpF TolA,B,Q,R Pore-forming 5 Tsx TolC TonB,ExbB,D Pore-forming 10 Tsx TolC TonB,ExbB,D Pore-forming Colicin-like toxins Pesticin I FyuA ? TonB,ExbB,D Murein degradation Bacteriocin 28b ? OmpA,F TolA,B,Q,R Pore-forming Cloacin DF13 IutA OmpF TolA,Q,R rRNase

21 FIGURE 1. Schematic classification of colicins

Colicins are divided into subgroups based on their general modes of action and transit machineries. For each colicin, the outer membrane proteins used for the reception step (primary receptor; green) and for translocation step (secondary receptor, blue) are indicated. The colicin L and Js are not shown due to incomplete information about the mechanism. See the text for details. Adapted from Cascales et al. (2007).

1.2.2. Genetic organization

In 1950´s, a hunt for the genomic region responsible for colicin production started, ending up with knowledge that colicins are encoded on extrachromosomal genetic elements – plasmids (Bazaral and Helinski, 1968; DeWitt and Helinski, 1965; Fredericq and Betz-Bareau, 1953). Therefore, only bacterial strains harboring colicinogenic plasmid (pCol) produce colicins. Hardy et al. (1973) described two classes of colicinogenic plasmids, type I and type II. The type I plasmids, typical for group A colicins, are small plasmids (6-10 kb), present in about 20 copies per cell. These plasmids are mobi- lizable in the presence of a conjugative plasmid. The type II plasmids are large monocopy plasmids (40‑140 kb), which are conjugative and can promote horizontal gene transfer, similarly to sexual factors. These large plasmids encode mainly colicins of group B. Studies of the Col-plasmid horizontal transfer among various multiproducer strains (e.g. colicins B/M, B/D and Ia/V) revealed also evolution mechanism of Col‑plasmid (Christenson and Gordon, 2009; Gordon and O’Brien, 2006; Jezi- orowski and Gordon, 2007; Johnson et al., 2006; Olschläger et al., 1984; Săsărman et al., 1980). Despite the presence of horizontal transfer and relatively high incidence of colicin multiproducers in nature, the frequency of a successful pCol transfer is probably quite low (Riley and Gordon, 1992).

22 FIGURE 2. Organization of the colicin operons

The genes are represented by thick arrows. The SOS promoters SOS(P ), immunity protein promoters (Pim), and transcription terminators (T) are indicated by thin arrows. The names of the colicin activity genes (cxa, in which x is specific to the colicin), colicin immunity gense (cxi), and lysis protein genes (cxl) follow the nomenclature. Note that the immunity genes for the pore-forming colicins are localized on the opposite DNA strand. Adapted from Cascales et al. (2007).

After identification of the colicinogenic plasmids, colicin operons were described (Dougan et al., 1978). A colicin gene cluster is regulated by an SOS-response regulon (Lu and Chak, 1996), which means that colicins are usually expressed under stress conditions. SOS response plays a primary role in the response of bacteria to DNA damage. Genes of SOS-response are regulated by two proteins - LexA and RecA, which are transcriptional repressor and activator, respectively (Little and Mount, 1982; Walker, 1977). In gammaproteobacteria, LexA represses transcription by binding to a

16-mer consensus sequence (CTG-N10-CAG), which is known as LexA binding site or SOS box (Er- ill et al., 2003). Sequence variability of individual SOS boxes affects binding ability of LexA protein (Walker, 1995). Gillor et al. (2008) found that over 75% promoter regions of different bacteriocins are regulated by dual and overlapping SOS boxes, which allows binding of two LexA repressor proteins. Regulation by dual SOS box allows a fine tuning of colicin expression, effectively reducing the cost of colicin production. The first gene of a colicinogenic locus is always a structural gene for colicin (colicin activity gene). In the case of nuclease colicins, colicin operon contains gene for a specific inhibitor (colicin immunity gene) downstream of the colicin gene. Expression of both proteins is tightly regulated, which

23 protects the producing cells from “colicinogenic suicide”. On the other hand, the immunity gene for pore forming colicins is located on the opposite DNA strand and is constitutively expressed at low level. In this case, the producing cell is protected against “suicide” from the internal colicin by opposite polarity of the cell membrane; the immunity protein protects the producer only against exogenous colicins. In the case of group A colicins, the colicin cluster contains also a third gene encoding a colicin lysis protein, which is responsible for release of colicin from the producing cell (Jakes and Zinder, 1984; Pugsley and Schwartz, 1983; Sabik et al., 1983; Šmajs et al., 1997; van der Wal et al., 1995). Colicins of group B do not encode a lysis protein except for colicin 5, 10, and D (Braun et al., 2002; Frey et al., 1986; Pilsl and Braun, 1995a, 1995b). Typical organization of a colicinogenic cluster is summarized in Figure 2. In addition to the typical clusters, colicin clusters with redundancies were found mainly for E- colicins. For instance, colicin E3 and E6 clusters contain additional colicin E8 immunity protein (Akutsu et al., 1989; Masaki and Ohta, 1985). Similarly, colicin E9 producer harbored colicin E9 cluster followed by functional colicin E5 immunity and lysis protein (Chak and James, 1986; Lau and Condie, 1989). Based on the various level of sequence conservation between different colicin clusters, Riley (1993a) inferred three potential mechanisms of colicin cluster evolution - intergenic recombination, intragenic recombination and selection, which suggested a common origin of all colicin clusters.

1.2.3. Release from the producing cell

A gene for the lysis protein is typically found in operons of group A colicins. Lysis proteins allow colicins to be released into the medium (Cavard et al., 1985; Jakes and Zinder, 1984; Pugsley and Schwartz, 1983) using secretion pathway different from all other known secretion pathways in Gram- negative bacteria (reviewed in Nikaido, 2003; Thanassi and Hultgren, 2000). A co-expression of the lysis protein and colicin itself leads to colicin release that causes death of the producing cell (Pugsley and Rosenbusch, 1981; Suit et al., 1983). Operons of group B colicins do not typically contain a gene for lysis protein, so their synthesis is not lethal for the producing cells. The colicin lysis proteins are small lipoproteins (~30 amino acids) whose sequences exhibit high degree of similarity. They are synthesized in precursor forms, which are driven by a signal sequence to the inner membrane and translocated by Sec machinery to the outer leaflet of the inner membrane, where they are modified (Cavard, 2004; Yokota et al., 1999). The main function of the lysis protein is to promote release of the colicin molecule, which is accompanied by activation of outer membrane phospholipase A (Cavard et al., 1987; Pugsley and Schwartz, 1984), by modifications of the cell envelope (Howard et al., 1991), by quasilysis (Jacob et al., 1952), and by death of the producing cell (Altieri et al., 1986). However, chronology of the various events is not well understood and it seems to appear simultaneously. How a lysis protein allows the colicin release has not been fully elucidated; potential mechanisms are reviewed in Cascales et al. (2007).

1.2.4. Structure

Colicins are proteins that usually contain around 500 amino acid residues with maximum of 697 residues for colicin D and minimum of 94 residues for colicin Js (Braun et al., 2002; Roos et al., 1989; Šmajs and Weinstock, 2001b). Colicin Js is an atypical colicin on the basis of an extremely small molecule and also other characteristics (e.g. colicinogenic cluster organization and spectrum of activity). Until now, more than 20 colicins were characterized on the molecular level; their molecules are typi-

24 cally organized into three domains in accordance with the three steps of their action (Šmarda and Šmajs, 1998). The central part of a colicin molecule (receptor domain, R-domain) recognizes a specific receptor located in the outer membrane, the N-terminal part (translocation domain, ‑T domain) is responsible for interaction with proteins of the cell envelope during translocation of colicin, and the C-terminal part (cytotoxic domain, C-domain) is responsible for the colicin lethal effect. Each domain is a structurally and functionally independent unit; therefore, after combining domains of various colicins, hybrid molecules possessing features of their subdomains can be obtained (Bened- etti et al., 1991; Jakes and Finkelstein, 2010; Penfold et al., 2000). The first partial crystal structure of a colicin was obtained in 1989 for C‑domain of colicin A (Parker et al., 1989). Crystal structure of C-domain was also predicted for colicin D (Graille et al., 2004), colicin E1 (Elkins et al., 1997), and colicin E9 (Kühlmann et al., 2000). However, crystal structures for their whole molecules are still not resolved. Nevertheless, the crystal structures for five whole colicin molecule have been obtained - colicin B (Hilsenbeck et al., 2004), colicin Ia (Wiener et al., 1997), colicin N (Vetter et al., 1998), colicin E3 (Soelaiman et al., 2001), and colicin M (Zeth et al., 2008) (Figure 3). Despite the low number of crystal structures, it is possible to find some relationship between the structure and function of a colicin. The central part of a colicin molecule, which rec-

FIGURE 3. Crystal structures of colicin molecules (A) Typical domain arrangement of a colicin - translocation domain (blue), receptor-binding domain (green), and cytotoxic domain (red). (B) Crystal structures of five prototype colicins - colicin E3 (pdb, 1JGH; with bound immunity protein in yellow), colicin Ia (pdb, 1CII) colicin M (pdb, 2XMX), colicin N (pdb, 1N87), and colicin B (pdb, 1RH1). Adapted from Jakes and Cramer (2012).

25 ognizes receptor molecule, contains extended helical structures. For colicin Ia and E3, an extremely long double helix was described (150 Å and 100 Å, respectively). In contrast, the R‑domain of colicin B and N contains a single half-length helix. The R‑domain of colicin M has a globular structure that contains one long helix (α3) surrounded by other five helices. The N-terminal T-domain of a colicin is typically more flexible than the rest of the molecule and without any secondary structure. The C- terminal domain of pore-forming colicins contains 10 α-helices. Two hydrophobic α-helices form a hairpin, which is completely buried within other eight α-helices. C-domain of colicin E3 has RNase activity and includes a short α-helix and six-stranded antiparallel β-sheets. Peptidoglycan affecting cytotoxic domain of colicin M is also formed by α/β structure. Few β-strands are extended to form β-barrel, a structure typical for outer membrane proteins. However, the hydrophilic residues are ex- posed to outer surface of the barrel, which is atypical for outer membrane β-barrels.

FIGURE 4. Mechanism of colicin action

The action mechanism of group A colicins (A) and group B colicins (B) is identical in the following steps: A colicin molecule recognizes an outer membrane protein as a receptor (R). After interaction of colicin R-domain (green) with a receptor, the colicin searches for a secondary receptor (T, translocator) using its T-domain (blue). Formation of a translocon – a complex combining colicin, receptor, and translocator - allows interaction of the colicin N-terminus with proteins of the translocation system in the periplasm. Colicin interaction in the periplasm facilitates translocation of the colicin cytotoxic domain (red) through the cell envelope, which is followed by the colicin lethal action.

26 1.2.5. Mechanism of action The following chapters will describe the mechanisms of colicin recognition, translocation through the bacterial envelope, and cytotoxic action in the cytoplasm. The summary of all these three steps is shown in Figure 4.

1.2.5.1. Colicin interactions with the outer membrane

1.2.5.1.1. Interaction partners in the outer membrane

All colicins target E. coli cells via interaction with the specific outer membrane proteins (Braun et al., 2002; Cao and Klebba, 2002; Lazdunski et al., 1998). Colicins parasitize two groups of outer membrane proteins – TonB‑dependent transporters (TBDTs) and outer membrane porins. The physiological roles of these proteins is to facilitate transport of essential nutrients, such as metals (e.g. siderophore bound iron), vitamins (e.g. cobalamin), and small molecules (e.g. ions), while large molecules stay outside the cell.

TonB-dependent transporters (TBDTs)

As a primary receptor, most colicins use one of the TonB-dependent transporters, such as BtuB, Cir, FepA, and FhuA (Krewulak and Vogel, 2011; Noinaj et al., 2010; Wiener, 2005) (Table 1). Typical structure of all TBDTs is β-barrel with an N-terminal plug (Figure 5). The transmembrane barrel comprises 22 antiparallel β-strands, which are connected by 10 periplasmic turns on one side and 11 extracellular loops on the other side. The β-barrel interior is ellipsoid (~30‑40 Å) and is capped with an N-terminal plug that is formed by 160 amino acid residues. The interface plug/β-barrel is extensively hydrated, which suggests rearrangement or removal of the plug domain during transport (Chimento et al., 2005). The plug divides the β-barrel interior into two pockets. The extracellular

FIGURE 5. Structure of the TonB-dependent transporters (TBDTs)

The side (A) and top (B) view of BtuB (pdb, 2GUF), which is a typical member of TBDTs and the most common colicin primary receptor. TBDTs form monomers of transmembrane 22-stranded β-barrel (green) with N-terminal plug domain (red) oriented into the interior. Highly conserved Nterminal sequence - TonB box - is shown in blue. Adapted from Jakes and Cramer (2012).

27 pocket, localized above the plug, contains a binding site for metallic substrates. The second pocket is periplasmic and contains the free N‑terminus of TBDTs. This part of the protein contains a short, highly conserved TonB box sequence. TonB box is recognized by a periplasmic protein TonB, which is anchored to the cytoplasmic membrane. Uptake of natural substrates by TBDTs requires energy (reviewed in Ferguson and Deisenhofer, 2004; Noinaj et al., 2010).

Outer membrane porins

Porins are outer membrane proteins that form hydrophilic pores (Figure 6) and so allow a passage of small nutrients and signaling molecules through the bacterial envelope (Nikaido, 2003). Five porins - OmpA, OmpF, OmpW, Tsx, and TolC are recognized by colicins, mainly as secondary receptors. OmpA is a highly conserved outer membrane protein containing two domains – transmembrane β-barrel and C-terminal periplasmic domain. The N-terminal 171 residues of OmpA form a barrel containing 8 antiparallel β-strands and four loops oriented into the extracellular space (Pautsch and Schulz, 2000). OmpA is a multifunctional protein. While the extracellular part of OmpA is recognized during F-factor-dependent conjugation, bacterial adhesion, and invasion, the periplasmic domain is important for structural integrity of the bacterial envelope. Earlier studies on OmpA pore formation predicted a small nonspeciﬁc diffusion channel, but recent studies suggest rather a larger pore that contains 16-stranded β-barrel with a C-terminal domain incorporated into the transmembrane region. Structure and functions of OmpA are recently reviewed in Confer and Ayalew (2013); Krishnan and Prasadarao (2012); Reusch (2012); Smith et al. (2007). OmpF is an outer membrane porin that was among the first crystalized and resolved membrane protein structures (Cowan et al., 1992). OmpF forms aqueous, voltage-gated channels allowing a passage of molecules smaller than 600 Da, with a slight preference for positive charge. A concentration gradient is used to transport the substrates through the OmpF channel (Heller and Wilson, 1981;

FIGURE 6. Outer membrane porin structure

The side (A) and top (B) view of OmpF (pdb, 2OMF), which is a typical member of porins and the most common colicin secondary receptor. (A) OmpF monomers form transmembrane 16stranded β-barrel (green) with eight extracellular loops. Loop 2 (blue) plays a role in the interaction of a monomer with its neighboring unit. Loop 3 (orange) is oriented into interior and narrows the channel. (B) OmpF monomers form trimmers in the outer membrane. Adapted from Nikaido (2003).

28 Nikaido, 1994). OmpF monomer forms a 16-stranded β-barrel that contains 8 extracellular loops, where the longest loop (L3) is oriented into the OmpF interior. Porin monomers associate in order to form tightly packed trimers (Cowan et al., 1992; Efremov and Sazanov, 2012). In contrast to the abundant porins described above, OmpW is a small, 8‑stranded β‑barrel that is minimally presented on the cell envelope (Hong et al., 2006). Its function is still unknown, but the recent data suggest that OmpW can play a role in protection of a cell against environmental stress (Gil et al., 2009; Xu et al., 2005). Outer membrane porin Tsx is a specific transporter of nucleosides (Fsihi et al., 1993; Krieger- Brauer and Braun, 1980; Munch-Petersen et al., 1979). Tsx forms a 12‑stranded β‑barrel with a flat- tened pore (~10×4 Å) that mimics a keyhole (Ye and van den Berg, 2004). Tsx has a high specificity for nutrients that are present at low concentrations in the extracellular environment. It differs from the above described general porins (i.e. OmpF and OmpA) that have low nutrient specificity and thus sort substrates primarily based on their molecular weight. TolC is an outer membrane protein that fundamentally differs from the other porins. TolC is a trimeric 12-stranded α/β-barrel that consists of outer membrane β-barrel and α-helical trans-periplasmic tunnel. This 140 Å long structure spans the whole bacterial envelope and is in fact an exit duct for substrates of various sizes. The TolC protein plays a common role in the cellular exclusion of diverse molecules, such as protein toxins and antibacterial drugs. Information about TolC protein are reviewed in Koronakis (2003); Koronakis et al. (2004); Masi and Pagès (2013).

1.2.5.1.2. Interaction of colicins with primary receptors

Before the first crystal structures of the colicin-receptor complexes had been resolved, it was predicted that the colicin molecule translocates through the outer membrane using the R-domain, which “somehow” triggers exit of the plug domain from the receptor barrel interior, and the colicin then simply passes through the relatively wide barrel in an unfolded state (Hilsenbeck et al., 2004). How- ever, several in vivo experiments indicated that colicin and natural substrate bind the receptor differently, and that the plug stays inside the barrel after colicin binding (Cadieux et al., 2003). Structural models of the colicin R‑domain in a complex with the corresponding receptor (Buchanan et al., 2007; Kurisu et al., 2003; Sharma et al., 2007) showed that the plug stays inside the barrel after colicin binding and blocks passage of the unfolded colicin through the receptor interior (Figure 7). Moreover, it was shown that unfolded colicin Ia cannot pass through its receptor even when the plug is completely removed (Jakes and Cramer, 2012). Structural models of all three yet resolved crystal structures of the colicin-receptor complexes showed that all the colicin E2, E3, and Ia bind to their receptor at an angle of about 45° with respect to the lipid bilayer. Colicins interact with flexible extracellular loops of the receptors and character of these interactions reflects the colicin type. Colicins E2 and E3, which belong to group A, interact with several loops of receptor BtuB almost identically (Kurisu et al., 2003; Sharma et al., 2007). In both cases, colicin interactions are dispersed among the β-barrel and do not cause any significant conformational changes either in the colicin R-domain or the receptor molecule. Moreover, a single amino acid mutation in the colicin R‑domain did not affect the colicin toxicity; even double mutants caused only a slightly reduced colicin E3 toxicity, which confirmed complexity of the colicin binding (Soelaiman et al., 2001). Compared to this, the interaction of colicin Ia (B group colicin) with its receptor Cir is different. The majority of interacting amino acid residues of the receptor is localized within two extracellular loops (L7 and L8), which undergo dramatic conformational changes after colicin binding (Buchanan et al., 2007). Two arginine residues, R436 on loop L7 and R490 on loop

29 FIGURE 7. Structures of the colicin-receptor complexes

Crystal structure of three colicin receptor complexes were resolved - the one of BtuB structure with a bound R- domain of colicin E3 (pdb, 1UJW), BtuB with the R-domain of colicin E2 (pdb, 2YDU), and the Cir with the R-domain of colicin Ia (pdb, 2HDI). The R-domain of colicins, receptor β-barrels, and receptor plugs are colored. Adapted from Jakes and Cramer (2012).

L8, are the core of colicin interaction, since they interact with as many as eight amino acid residues of the colicin R-domain. Character of colicin binding reflects mechanism of colicin translocation through the cell envelope. Tol-dependent colicins (group A) use receptor molecules only for binding to the cell envelope; therefore, conformational changes of the receptor are minimal. In contrast, the TonB‑dependent colicin (group B) interaction causes large movements in the receptor structure. This indicates that the receptor molecule can be used both as primary receptor and translocator, a protein that participates in colicin transport through the outer membrane (see next chapter). Crystal structures of the colicin-receptor complexes showed that colicin binds to its receptor without any energy requirement and that the colicin R‑domain does not change its conformation after binding to the receptor. Despite the fact that the whole central part of a colicin molecule is designated as receptor binding domain, only a small part of the R-domain is involved in the interaction with a receptor. This short sequence is localized in the extended tip of the R‑domain, separating the receptor binding region from the other two colicin domains by a pair of long α-helices of the R- domain. Thus, after colicin binds to the receptor, the T- and C-domain are ~100 Å far from the outer membrane. This feature is shared by both Tol- and TonB-dependent colicins (Buchanan et al., 2007; Kurisu et al., 2003). The recent models of colicin mechanism propose that the role of receptors is ba- sically transition of a colicin molecule from the three-dimensional extracellular environment to the two-dimensional outer membrane surface. The extended length of the colicin R-domain (e.g. colicin E3 and Ia) and 45° angle of the bound colicin allow searching for the cognate translocator protein. The extended colicin R-domain binds to the primary receptor and the T-domain is used as a fishing rod to find the translocator in the outer membrane (Kurisu et al., 2003; Zakharov and Cramer, 2004; Zakharov et al., 2004a). In addition, single‑molecule diffusion experiments showed that the colicin- receptor complex moves a net distance of ~0.5 μm per second. This is a significant part of the length of a bacterium, thus colicin search for translocator is really intensive (Spector et al., 2010).

30 1.2.5.1.3. Interaction of colicins with secondary receptors (translocators)

The importance of an additional outer membrane protein that is different from the primary receptor was described in 1985 (Pugsley, 1985), when mutations of the outer membrane protein OmpF did not affect the colicin receptor binding but abolished the colicin toxicity. The complex consisting of colicin, primary receptor, and secondary receptor is called translocon (Figure 8). The structure of a translocon slightly differs between Tol- and TonB-dependent colicins.

Translocon of Tol-dependent colicins

OmpF was confirmed as a translocator for almost all Tol-dependent colicins. The exceptions are colicin E1, 5, and 10, where the function of a translocator is executed by TolC (Zakharov et al., 2004a). Interestingly, colicin E1 is a Tol‑dependent colicin, which binds to TonB-dependent receptor BtuB; conversely, colicins 5 and 10 are TonB-dependent colicins that recognize porin as a receptor, which is typical for Tol-dependent colicins. Some studies indicate importance of OmpA and OmpC as alternative, yet obscure, translocators (Sharma et al., 2007; Šmajs et al., 1997). All E-colicins (with the exception of E1) use BtuB (receptor) and OmpF (translocator) to build their translocons, which allowed for an extensive study of the translocon formation. After binding of colicin to a receptor, the colicin-receptor complex starts to search the abundant OmpF trimer (100,000 per cell) by fishing pole mechanism. The N-terminal part (1-83 amino acid residues) of the colicin molecule is disordered, which allows its interaction with the translocator protein. This flexible part enters the periplasmic space through the OmpF pore; then, the highly conserved sequence 35DGSGW39 (TolB box) interacts with TolB protein. While the first N-terminal 64 amino acid residues are essential for formation of the translocon, the following part of the colicin T‑domain (84‑316) contains a folded structure whose function during colicin translocation is unclear. Never- theless, translocon forms in order to deliver the colicin N-terminus with a signal epitope (TolB box)

FIGURE 8. Colicin translocon

Colicin E9 complex illustrated formation of the translocon complex at the outer membrane (OM). Interaction of colicin E9 R-domain with its receptor BtuB (pdb, 1UJW and 1JCH) is followed by association of the colicin with OmpF (pdb, 2OMF) through the colicin E9 T-domain. Colicin T-domain utilizes the pore to extend the TolB box (part of 16 nt TolB binding epitope) to the periplasm. Adapted from Papadakos et al. (2012).

31 through the translocator pore into the periplasm. This triggers further colicin import (Housden et al., 2005, 2010, 2013; Sharma and Cramer, 2007; Sharma et al., 2007; Yamashita et al., 2008; Zakharov et al., 2006). The above described mechanism of the colicin translocation used by E-colicins might be suitable for all Tol-dependent colicins. The exceptions are colicin E1 that forms a similar translocon with TolC protein (Masi et al., 2007; Zakharov et al., 2004a) and colicin N, which uses OmpF trimer as both receptor and translocator. Interestingly, two potential translocation mechanisms exist for colicin N. The first proposes translocation through the OmpF pore, similarly to other Tol-dependent colicins (Jeanteur et al., 1994; Vetter et al., 1998); the other model suggests translocation of the colicin alongside the OmpF trimer, through the membrane (Baboolal et al., 2008; Clifton et al., 2012; Sharma et al., 2009). For colicins that use one porin as receptor and another as translocator (e.g. colicin K and U), the mechanism of the translocon formation is unclear, since the structures of their protein-protein complexes are yet to be resolved. However, Šmajs et al. (1997) described importance of lipopolysac- charide (LPS) for colicin U translocation, which indicates a transport mechanism outside the porins, similarly to colicin N (Baboolal et al., 2008).

Translocon of TonB-dependent colicins

Only recently, the first translocon of a TonB-dependent colicin, particularly colicin Ia, was identified (Buchanan et al., 2007; Jakes and Cramer, 2012). Colicin Ia uses one copy of Cir protein, a TonB- dependent transporter, as a primary receptor and another Cir molecule as a translocator. In general, the mechanism of colicin Ia translocation is similar to the fishing pole mechanism of Tol-dependent colicins. However, the translocator is not porin, but a TonB-dependent protein with a plug. The unstructured N-terminal part of the Ia colicin mimics interaction of a natural substrate inside the barrel, which triggers removal of the plug domain from the translocator interior. Energy transfer necessary for the plug movement is supplied by interaction of the conserved sequence (TonB box) of Cir with TonB protein anchored to the cytoplasmic membrane. When the translocator interior is open, the colicin N-terminus enters the periplasm, where it interacts with TonB protein that triggers a further colicin import. In vivo experiments with colicin B and M indicated that these two colicins did not use second copy of a receptor molecule (FepA and FhuA, respectively) as a translocator (Jakes and Cramer, 2012). The crystal structures of colicin B (Hilsenbeck et al., 2004) and colicin M (Zeth et al., 2008) differ from those using a fishing pole mechanism for translocon formation (e.g. colicin E3 or Ia). In fact, their structure does not contain an extended coiled-coil receptor domain, but is more similar to the compact molecule of colicin N, which uses unique translocation via OmpF trimer (described above). Jakes and Cramer (2012) proposed a similar translocation mechanisms for colicin B and M, where receptor and translocator is the same copy of a TonB-dependent transporter (FepA and FhuA, respectively); but this model is still full of contradiction (Devanathan and Postle, 2007; Jakes, 2012; Smallwood et al., 2009).

32 1.2.5.2. Colicin interactions in the periplasmic space

1.2.5.2.1. Interaction partners in the periplasmic space

Periplasmic space in the cell envelope of Gram-negative bacteria contains two different multipro- tein complexes – Tol and TonB (Figure 9). Both systems show structural and functional similarities (Braun and Herrmann, 1993a). They transduce energy that is needed for stability of the outer membrane and for the active transport of substrates (Krewulak and Vogel, 2011; Lloubès et al., 2001; Postle and Kadner, 2003). Despite the fact that their precise physiological roles are still unclear, it is known that both systems are parasitized by colicins and bacteriophages (Gerding et al., 2007; Lazzaroni and Portalier, 1981). Tol system consists of five proteins – TolA, TolB, TolQ, TolR, and Pal, from which TolA, TolQ, and TolR form an inner membrane complex (Derouiche et al., 1995). The moiety of TolA protein is localized in the periplasmic space as well as the TolB protein (Abergel et al., 1999). TolB protein interacts with outer membrane lipoprotein (Pal) that is associated with peptidoglycan (Bouveret et al., 1995). The TolB–Pal complex is linked to a proton motive force across the inner membrane that is required for stability of the cell envelope (Cascales et al., 2001). TonB system consists of three inner membrane proteins - TonB, ExbB, and ExbD, which all carry some degree of sequential and functional similarity to the Tol system proteins - TolA, TolQ, and TolR, respectively (Eick-Helmerich and Braun, 1989). ExbB and ExbD are inner membrane proteins with high homology to TolQ and TolR, respectively. Their role is energy transfer (proton motive force)

FIGURE 9. Models of the TonB and Tol systems

The Ton system comprises TonB, ExbB, and ExbD in the inner membrane (IM). The Tol system comprises TolA, TolQ, and TolR in the inner membrane, peptidoglycan-associated lipoprotein (Pal) in the outer membrane (OM), and TolB in the periplasm. Both systems span the periplasm and are coupled to the proton motive force. Adapted from Nikaido et al. (2003).

33 from the inner membrane to TonB protein, but the mechanism is still unclear (Ollis and Postle, 2011, 2012). The homology of Tol and Ton system also supports the fact that TolQ/R complex can energize some TonB molecules (Braun and Herrmann, 1993b). The physiological function of the energized TonB protein is interaction with the outer membrane proteins (TonB-dependent transporters), which allows an active transport of nutrients across the outer membrane. The precise mechanism of energy transduction between the inner membrane proteins and outer membrane proteins is unclear, but two potential models are proposed. In the first model, TonB protein is N-terminally anchored to the inner membrane and the disordered periplasmic domain extends to the outer membrane (Gresock et al., 2011). The other model predicts that the TonB protein is a mobile messenger that shuttles between the inner and outer membrane (Postle and Kadner, 2003). Despite the uncertainty in the energizing model (Krewulak and Vogel, 2011; Postle and Kadner, 2003; Wiener, 2005), it is clear that TonB protein directly interacts with the highly conserved TonB box of the outer membrane receptors (Cadieux and Kadner, 1999; Ogierman and Braun, 2003).

1.2.5.2.2. Interaction of colicins with the translocation system

Translocation domain of the colicin molecules contains short, highly conserved sequences (e.g. TolA box, TolB box, and TonB box), which interact with corresponding components of the translocation system. Mutations in these sequences reduce or abolish colicin lethal activity (Bouveret et al., 1997, 1998). Compensatory mutations in the corresponding target cell protein, i.e. in TolA, TolB, and TonB, can restore killing activity of these colicin mutants (Mende and Braun, 1990). Others studies confirmed a direct interaction between a colicin and proteins of the translocation systems (Gokce et al., 2000; Hands et al., 2005; Journet et al., 2001; Raggett et al., 1998). All Tol-dependent colicins interact with Tol system almost identically. Colicin N‑terminus, which enters periplasm through the translocator, binds to one or more members of the Tol family in periplasm. Most of the colicins sequentially interact with TolB and TolA; however, some colicins (e.g. E1 and N) interact only with TolA (Gokce et al., 2000; Johnson et al., 2013; Raggett et al., 1998; Schendel et al., 1997). Colicin N-terminus binds to the β-propeller domain of TolB, which causes displace- ment of Pal from the TolB-Pal complex (Bonsor et al., 2007, 2009; Loftus et al., 2006; Papadakos et al., 2012a; Zhang et al., 2010). TolB box of a colicin is an allosteric activator that induces association of TolB protein with TolA, thereby connecting the colicin molecule to the proton motive force across the inner membrane. Colicin cascade of interactions (Brownian ratchet mechanism) continues with binding to the TolA protein by colicin TolA box, which is an additional connection of colicin molecule with the energy transfer. The energy transfer is necessary to trigger translocation of the colicin cytotoxic domain through the outer membrane (Barnéoud-Arnoulet et al., 2010; Journet et al., 2001; Lazdunski et al., 1998; Lazzaroni et al., 2002; Lloubès et al., 2012). For TonB-dependent colicins to be translocated, TonB needs to interact with two distinct TonB boxes – the one present in the colicin molecule and the other one in the receptor molecule (Braun et al., 2002; Buchanan et al., 2007). To cross the outer membrane, TonB-dependent colicins acquire energy by interaction of the receptor molecule with the TonB system. Nevertheless, no energy is presumably needed to cross the periplasm, since TonB-dependent colicins use the Brownian ratchet process (Cascales et al., 2007). In addition to the TonB-receptor interaction, TonB protein interacts also with the colicin TonB box and additional predicted colicin regions (Mora et al., 2005). The part of TonB protein interacting with the colicin TonB box is in its C-terminal domain, more precisely around position 160 (Bell et al., 1990; Cadieux and Kadner, 1999; Cadieux et al., 2000; Heller et al., 1988; Traub and Braun, 1994), but also additional C-terminal regions of TonB might be involved

34 (Ghosh and Postle, 2004; Sauter et al., 2003). The colicin-TonB interactions in the periplasm result in translocation of the colicin cytotoxic domain through the outer membrane. Thus, in addition to high-affinity binding of colicin R-domain to an outer membrane receptor, much weaker interaction of the T-domain with one or more periplasmic proteins occur before the target cell is killed by colicin.

1.2.5.3. Colicin interactions with the inner membrane

The above described colicin interactions with outer membrane and periplasmic proteins eventu- ally translocate the colicin cytotoxic domain to vicinity of the inner membrane. However, a precise model for colicin C-domain translocation is still lacking. It has been proposed that the C-domain is either transported through the porins (Dover et al., 2000) or, alternatively, directly through the outer membrane by its interaction with phospholipids (Mosbahi et al., 2004, 2006; Muga et al., 1993). A chimaeric model predicts colicin translocation at the interface between the porin and LPS leaflet. Nevertheless, when the C-terminal domain has completed its translocation, the central domain remains bound to the receptor at the cell surface, and the N-terminal domain interacts with the translocation system (Benedetti et al., 1992; Duché, 2007). The way of interaction between colicin and the inner membrane depends on mechanism of the colicin toxicity. While pore-forming colicins kill the cell through interaction with the inner membrane, enzymatic colicins have to cross the inner membrane and enter cytoplasm.

1.2.5.3.1. Interaction of pore-forming colicins with the inner membrane

Pore-forming colicins have cytotoxic domains with highly conserved structures. Crystal structures of the pore-forming domains (e.g. domain of colicins A, Ia, E1, N, and B) consist of a tightly packed bundle of 10 α-helices (Elkins et al., 1997; Hilsenbeck et al., 2004; Parker et al., 1989; Vetter et al., 1998; Wiener et al., 1997) from which two helices (H8 and H9) form a hydrophobic hairpin sequestered from the aqueous phase by the other eight helices. High similarity of C-domains indicates that all pore-forming colicins form pores in a similar way, when a water soluble protein transforms into a voltage-gated membrane channel. Planar lipid membrane experiments revealed that colicins spontaneously bind to the inner membrane. First, hydrophobic hairpin is spontaneously inserted into the membrane, which is followed by insertion of other transmembrane helices using transmembrane potential (Kienker et al., 1997; Lindeberg et al., 2000). In addition, colicin pore formation in pure lipid membrane demonstrated that no proteins were required for the channel formation (Schein et al., 1978). Despite the intensive study of membrane insertion, various models of pore formation are under consideration (reviewed in Cascales et al. 2007). In contrast to the inconsistency, all evidences support a monomeric form of ion channels with a conductance of a few picosiemens under physiological membrane conditions (reviewed in Zakharov et al. 2004b). There is also a controversy about structure of the pore. Size of the colicin pore was established to be 1-2 nm (Krasilnikov et al., 1995, 1998), and any molecule with this size could have easily passed through the pores (Bullock et al., 1992; Raymond et al., 1985). This pore structure is too large even if all ten helices would be used to build the pore. Moreover, several studies showed that not all ten helices of the C-domain are necessary for correct structure of the pores (Baty et al., 1990; Nardi et al., 2001a; Slatin et al., 2004). It is therefore possible that lipid molecules participate in formation of the pore structure (Sobko et al., 2006; Zakharov et al., 2004b), but other channels features, such as com- paratively small conductance and high proton selectivity cannot be explained either with or without participation of the lipids.

35 Immunity of cells against the pore-forming colicins is another type of inner membrane interactions linked to colicins. Immunity proteins protect cells against the action of the exogenous colicins, while protection against the internal colicins is secured by an opposite transmembrane potential that is required to open the pore. Immunity proteins are inner membrane proteins expressed from the colicinogenic plasmid (Geli et al., 1988; Goldman et al., 1985). They recognize ‑C domain of their cognate colicin (Benedetti et al., 1991). The search for the colicin ‑C domain by immunity proteins is probably ensured by lateral diffusion of the inner membrane components (Zhang and Cramer, 1993). Immunity proteins of pore-forming colicins are of two types: the A type (e.g. immunity to colicins A, B, N, and U) and the E1 type (e.g. immunity to colicins E1, 5, K, 10, Ia, and Ib), which differ in structure and mechanism of colicin inactivation. The A type immunity proteins consist of four transmembrane segments (Geli et al., 1989; Pilsl et al., 1998), while the E1 type immunity proteins have only three membrane‑spanning segments (Song and Cramer, 1991). Moreover, terminal regions of the A type are both cytoplasmic, while the E1 type has the N-terminal region in cytoplasm and the C-terminal in periplasm. For inactivation of the colicin C-domain, helices of the hydrophobic hairpin (H8/H9) are recognized by A type immunity proteins (Nardi et al., 2001b), whereas E1 type immunity proteins interact with helices H6 and H7 (Lindeberg and Cramer, 2001; Šmajs et al., 2006; Zhang and Cramer, 1993). Interaction of the immunity protein with the colicin transmembrane helices suggests that the immunity proteins do not prevent membrane insertion of their cognate colicins. Rather, the A type immunity proteins inactivate colicins prior to pore formation, while the E1-type inactivates colicins shortly before the channel is opened by interaction with voltage-gated region (Cascales et al., 2007).

1.2.5.3.2. Interaction of enzymatic colicins with the inner membrane

Enzymatic colicins (i.e. DNases and RNases) have to follow their cell target into the cytoplasm; thus, they must cross the inner membrane. These colicins leave the producing cell as a heterodimer with a tightly bound immunity protein that inhibits the colicin catalytic site (Papadakos et al., 2012b). The immunity protein has to be removed to activate the colicin. Despite the fact that mechanism of translocation of the colicin C-domain into the periplasm is unclear, it was clearly shown that the immunity protein remains in the extracellular space during this process (Duché et al., 2006; Vankemmelbeke et al., 2009). Moreover, the colicin C‑domain without its immunity protein becomes extensively unfolded, which facilitates translocation of the C-domain across the membrane (Zakharov et al., 2006). Since colicin remains anchored in the translocon for the whole time of the colicin cytotoxic action (Duché, 2007; Duché et al., 1995), a proteolytic cleavage of the C-domain has been proposed for a long time. Despite the fact that various studies predicted the outer membrane protease OmpT (Duché et al., 2009) as an enzyme responsible for processing of the colicin C-domain in the periplasm, it was shown that OmpT is in fact not necessary for the colicin processing (Chauleau et al., 2011; Masi et al., 2007). The importance of another enzymatic protein, a signal peptide protease LepB, was described for colicin D, but not for other nuclease colicins (de Zamaroczy et al., 2001). In contrast, the ATP- dependent protease FtsH is required for in vivo activity of a various enzymatic colicins including E3, E9, and D, but is not required for activity of pore-forming colicins (Chauleau et al., 2011; Walker et al., 2007). Thus, FtsH appears to be responsible for the enzymatic colicin processing and transport across the inner membrane. FtsH is an essential ATP-dependent protease that is postulated to form an inner membrane channel with protease activity (Ito and Akiyama, 2005). The natural substrates of FtsH are cleaved and then pulled into the cytoplasm through the proteolytic active-site chamber of FtsH (Striebel et al., 2009; Suno et al., 2006). FtsH acts only on unfolded proteins, what supports

36 the idea that colicin molecules are unfolded after their translocation into the periplasm (see above). In addition, partial unfolding of the C-domain is a possible result of interaction of the positively charged colicin nuclease domain with anionic phospholipids of the inner membrane (Mosbahi et al., 2004; Narberhaus et al., 2009; Walker et al., 2007). Colicin M and pesticin I represent a special group of enzymatic colicins targeting peptidoglycan. Since their target molecule is not localized in the cytoplasm, their cognate immunity protein is not bound to the colicin C-domain, but instead it is anchored to inner membrane with colicin binding domain localized in the periplasm (Gross and Braun, 1996; Harkness and Braun, 1989; Olschläger et al., 1991). In addition, the periplasmic peptidyl-prolyl-cis-trans-isomerase/chaperone FkpA is required for the colicin M activity in vivo, where it helps to refold the unfolded C-domain (Helbig et al., 2011; Hullmann et al., 2008). The recent knowledge about these two colicins is reviewed in Zeth (2012).

1.2.5.4. Colicin interactions in the cytoplasm

In cytoplasm, the colicin interactions with a susceptible cell are restricted to C-domain of the nuclease colicin and its target molecule. Colicins are either hydrolases or transferases that target phosphodiester bonds in the bacterial cytoplasm. Detailed information about colicin nuclease activity is reviewed in Cascales et al. (2007). DNase colicins kill the cells by random destruction of the bacterial genome. Cell death most likely results from double-strand breaks that are caused by repeated production of a nick in DNA (James et al., 2002). Four DNase colicins have been reported: E2 E7, E8, and E9 (Chak et al., 1991; Cooper and James, 1984; Schaller and Nomura, 1976). The core of the colicin DNase active site is the so‑called H-N-H motif (Kleanthous et al., 1999) that is typical for homing endonucleases (Galburt and Stoddard, 2002). Enzymatic activity of DNase colicins is metal-dependent with Mg2+ being most likely the physiological metal ion (Walker et al., 2002). RNase colicins (i.e. E3, E4, E5, E6, and D) inhibit protein synthesis by cleaving specific phosphodiester bonds in RNA. Colicin RNases do not require metal ion cofactors and fall into two distinct groups - rRNases and tRNases. rRNase colicins (i.e. E3, E4 and E6) specifically attack 16S rRNA in 30S subunit of the bacterial ribosome. Colicin E3 has been studied intensively (Lancaster et al., 2008; Ng et al., 2010; Phang-Cheng- Tai and Davis, 1974; Sander, 1977; Zarivach et al., 2002). Colicin E3 cleaves 16S rRNA between nucleotides A1493 and G1494, which is one of the most critical region of a ribosome - a decoding center of the ribosomal A site (Demeshkina et al., 2012; Ogle et al., 2003). tRNase colicins (i.e. E5 and D) cleave a single phosphodiester bond in the anticodon loops of specific tRNAs. Colicin E5 specifically cleaves the anticodon loop of tRNAs for histidine, asparagine, tyrosine, and aspartic acid. The cleaved site is a bond after quinine (modified guanine) at position 34 in the anticodon loop (Ogawa et al., 1999). Colicin D cleaves four isoaccepting tRNAs for arginine; the cleavage site is between bases 38 and 39 in the anticodon loop (Lin et al., 2005; Tomita et al., 2000).

II. EXPERIMENTAL PART

2. SPECIFIC AIMS

This study follows up diploma thesis elaborated by Mgr. Petra Kotrsalová at the Department of Biol- ogy (Faculty of Medicine, Masaryk University) that screened the bacteriocinogeny among nonpathogenic yersiniae. She identified six bacteriocin producers, without any further characterization. There is an increasing interest in nonpathogenic microorganisms and their antimicrobial substances that naturally antagonize pathogenic agents. In fact, production of bacteriocins is a common feature of many probiotic strains and therefore, the main goal of this study was to characterize the newly identified bacteriocin produced by Yersinia frederiksenii Y27601.

The following specific aims were proposed:

• Identification of the colicinogenic determinants responsible for inhibition activity of Y. frederiksenii Y27601.

• Characterization of the newly identified antimicrobial agent – mechanism of receptor binding, translocation, and lethal activity.

• Analysis of inhibitory spectra of this antimicrobial agent.

3. MATERIALS AND METHODS

3.1. Bacterial strains

In this study, 313 bacterial strains from both clinical and environmental sources were used. Strain collection contained 178 isolates from 8 Yersinia sp. (e.g. Y. frederiksenii, Y. intermedia, Y. kristensenii, Y. aldovae, Y. rohdei, Y. ruckerii, Y. pseudotuberculosis, and Y. enterocolitica) and 118 isolates from 4 Escherichia sp. (E. coli, E. fergusonii, E. hermanii, and E. vulneris). The strains were obtained from The National Reference Laboratory for Salmonella, National Institute of Public Health (NIPH), Prague; The Czech Collection of Microorganisms (CCM), Masaryk University, Brno; The Max von Pettenkofer-Institute, Ludwig-Maximilians-University of Munich (LMU), or isolated from human patients at the University Hospital Brno (UHB) (Table 2). This collection was supplied by 17 additional bacterial strains of family Enterobacteriaceae - Budvicia aquatica (24510; from E. Aldová), Citrobacter youngae (42/57; NIPH), C. braakii (B718; UHB), C. freundii (B607; UHB), Enterobacter aerogenes (1832; NIPH), E. cloacae (B604; UHB), Klebsiella pneumoniae (B615; UHB), K. oxytoca (B632; UHB), Kluywera ascorbata (B792; UHB), Leclercia adecarboxylata (2666; CCM), Morganella morganii (B619; UHB), Pragia fontium (24613; from E. Aldová), Proteus vulgaris (B635; UHB), Ser- ratia ficaria (B779; UHB), Salmonella enterica subsp. enterica (B753; UHB), Shigella flexneri (strain 4; (Cursino et al., 2006)), and S. boydii (U1; from V. Horák). Standard laboratory bacterial stocks were used as colicin indicators (E. coli strains K12-Row, C6 (Ф), B1, P400 and Shigella sonnei strain 17), colicin producers (E. coli BZB2101 (colicin A), E. coli BZB2102 (colicin B), E. coli K30 (colicin E1), E. coli BZB2279 (colicin Ia), E. coli BZB2202 (colicin Ib), E. coli K49 (colicin K), Serattia marcescens JF246 (colicin L), E. coli K-12 (colicin S4), Shigella boydii M592 (colicin U), E. coli K339 (colicin Y), and E. coli ECOR5 (colicin 5)), or for genetic manipulation (E. coli strains 5K, TOP10F´, DH10B, and DH5α pir).

3.2. Culture media

TY broth consisting of 8 g/l tryptone (Hi-Media, Mumbai, India), 5 g/l yeast extract (Hi-Media), and 5 g/l sodium chloride in distilled water was used throughout the study. Solid TY medium contained in addition agar powder (1.5%, w/v, Hi-Media). For colicin detection and colicin activity assay, TY agar consisted of a base layer (1.5%, w/v) and a top layer (0.75%, w/v). Chloramphenicol (0.025 g/l, Sigma-Aldrich, St. Louis, USA), kanamycin (0.050 g/l, Sigma-Aldrich), or ampicillin (0.100 g/l, Sig- ma-Aldrich) was added for selection of the recombinant bacteria or maintenance of plasmids. For induction of the colicin synthesis, mitomycin C (0.0005 g/l, Sigma-Aldrich) or L-(+)-arabinose (0.2 g/l, Sigma-Aldrich) was added to bacterial culture 4 h prior to harvesting.

3.3. Detection of the colicin production

Bacterial strains were inoculated on agar plates by a stab and incubated at 37 °C for 48 h. The mac- rocolonies were killed using chloroform vapors (30 min exposure) and each plate was then overlaid with a thin layer of top agar (3 ml) containing 108 cells of an indicator strain. Plates were incubated at 37 °C overnight and next day, the zones of growth inhibition were read.

43 TABLE 2. Bacterial strains used in the study

Species Source: Strains Y. frederiksenii NIPH: Y62, Y71, Y81, Y172, Y284, Y296, Y26851, Y27334, Y27411, Y27477, (13 strains) Y27601, Y27627, Y27829 Y. intermedia NIPH: Y67, Y223, Y308, Y418, Y498, Y546, Y22377, Y25448, Y27471 (9 strains) Y. kristensenii NIPH: Y104, Y276, Y281, Y330, Y476, Y541, Y599, Y610, Y611, Y612, Y613, Y614, (15 strains) Y615, Y27637, Y29196 Y. aldovae NIPH: Y551, Y552, Y20198, Y21698, Y22412, Y25525 (6 strains) Y. rohdei NIPH: Y80, Y88, Y137, Y559 (4 strains) Y. ruckeri NIPH: Y136, Y22505, Y28544, Y28545, Y28590, Y28631 (6 strains) Y. pseudotuberculosis NIPH: 1Ye09, 3Ye06, 3Ye09, 4Ye06, Y140, Y241, Y384, Y16953, Y19236, (15 strains) Y20462, Y20723, Y22721, Y26579, Y28790, Y207240 Y. enterocolitica NIPH: 5Ye03, 15Ye03, 1Ye06, 3Ye07, 6Ye07, 7Ye07, 1Ye08, 2Ye08, 3Ye08, (110 strains) 7Ye08, YE11*, 1Ye10, 4Ye09, 7Ye09, 8Ye08, 7Ye06, 5Ye06, YE18*, 1Ye03

UHB: 7578, 7782, 8008, 7886, 8472, 8773, 8703, 8886, 9081, 9102, 9464, 10141, 9953, 9949, 2209, 3033, 3316, 7392, 7250, 4749, 5258, 4466, 6050, 7668, 7563, 7731, 7852, 9105, 7852b, 9400, 146, 8523, 8381, 823, 1541, 3504, 4364, 7825, 8264, 8282, 9375

LMU: IP2222, gk132, gk1142, gk2943, JDE029, Y101, Y141, Y142, 40/97, 146/97, 241/97, 120/98, 683/98, 910/98, 120/99, 128/99, 627/99, 99/96, 243/96, 252/96, 353/96, 159/97, 184/97, IP636, IP19049, IP22393, IP22394, IP199, IP885, IP1607, IP22460, IP135, IP24231, IP24232, Y244, IP21981, IP1601, IP19718, IP23222, IP23357, IP24309, IP7032, IP3692, IP4115, IP25728, IP23230, IP1, IP178, IP102, IP124 E. coli UHB: B1, B2, B6, B8, B9, B10, B14, B15, B17, B21, B50, B53, B57, B61, B63, B64, (39 strains) B66, B71, B73, B74, B685, B688, B692, B705, B710, B714, B716, B721, B1191, B1194, B1805, B1830, B1835, B1842, B1846, B1862, B1864, B1899, B1900 E. fergusonii NIPH: 873, 1082, 1211, 1430, 1667, 1799, 2042, 2195, 28525 (10 strains) UHB: B339 E. hermanii NIPH: 10/K02, 14/E06, 17/E05, 27/E07, 45/E04, 48/E05, 59/K06, 61/E06, (42 strains) 62/E06, 63/E06, 2098; 2123, 2129, 2295, 2399, 2400, 2419, 2423, 2446, 2457, 2475, 2487, 2497, 2512, 2517,2519, 2520, 2527, 2531, 2611, 2640, 2645, 2654, 2683, 2698, 2701, 2704, 2724

CCM: 3666, 3667, 3668, 4037 E. vulneris NIPH: 19/E05, 24/E05, 13/E06, 90/03K, 13/E07, 12/E07, 1549, 1566, 1587, (27 strains) 1645, 1650, 1723, 2131, 2136, 2150, 2161, 2165, 2481, 2493, 2663, 2682, 2728, 30056

CCM: 4038, 6381, 6382, 6383

*Strain provided without original designation. Strains from species other than Yersinia sp. and Escherichia sp. are shown in text.

44 3.4. Preparation of crude colicin extracts

A 20-fold diluted overnight TY culture of a colicinogenic strain was shaken at 37 °C for 4 h, induced by mitomycin C, incubated for additional 4 h, and centrifuged at 4,000×g for 15 min. The sediment was resuspended in 5 ml of distilled water, washed twice in distilled water, and sonicated (24 kHz). The resulting bacterial lysate was centrifuged at 4,000×g for 15 min; the supernatant was collected into a glass tube and sterilized by chloroform vapors at 4 °C overnight. Then, the supernatant (a crude colicin extract) was aliqouted and stored at -80 °C.

3.5. Colicin activity assay

The indicator bacteria (108 cells) were added into the top TY agar (3 ml) and poured on a TY plate. The antibacterial colicin activity was tested by spotting serial dilutions of a colicin extract (crude or purified) on a plate with inoculated indicator strain. The plate was then incubated overnight. The highest dilution of a colicin causing growth inhibition (clear and turbid zone) of the susceptible bacteria was considered as a colicin titer (in arbitrary units, A.U.). All assays were repeated independently at least three times.

3.6. Isolation of plasmids

All plasmids were isolated using QIAprep Spin Miniprep Kit and Plasmid Midi Kit (Qiagen, Hilden, Germany). Manufacturer’s recommendations were followed.

3.7. PCR product purification

All PCR products were purified using QIAquick PCR Purification Kit (Qiagen). Manufacturer’s recommendations were followed.

3.8. Preparation of chemocompetent cells and transformation

A 100-fold diluted overnight TY culture of a bacterial strain was shaken at 37 °C for 4 h, centrifuged

(4,000×g; 4 °C; 15 min), resuspended in 50 ml of cold 0.1M CaCl2 and incubated on ice for 1h. The bacterial suspension was one more centrifuged, resuspended in 2.5 ml of cold 0.1 M CaCl2, and incubated on ice for 1 h. The chemocompetent cells were mixed with glycerol (10% v/v), aliqouted, and stored at ‑80 °C. Chemocompetent cells (50 µl) were thawed on ice, mixed with DNA (~50 ng), incubated on ice for 30 min, and shocked at 42 °C for 42 s. Then, bacteria were incubated on ice for 30 min, inoculated into 250 µl of SOC medium (Invitrogen, Carlsbad, USA), and plated out after 1 h incubation at 37 °C.

3.9. Preparation of electrocompetent cells and transformation

A 100-fold diluted overnight TY culture of a bacterial strain was shaken at 37 °C for 4 h, centrifuged (4,000×g; 4 °C; 15 min), twice washed with 50 ml MilliQ water, and resuspended in 2.5 ml of MilliQ water. The cell suspension was mixed with sterile glycerol (10% v/v), aliqouted, and stored at ‑80 °C. DNA for transformation was dialyzed against MilliQ water for 2 h. Cells (50 µl) were thawed on ice, mixed with ~50 ng of dialyzed DNA, electroshocked (2,000 V), inoculated into 750 µl of SOC medium (Invitrogen)l and plated out after 1 h incubation at 37 °C.

45 3.10. Plasmid in vitro mutagenesis and construction of plasmid library

Plasmid mutagenesis was performed using the in vitro Tn7 transposition system (GPSTM-1 Genome Priming System, New England Biolabs, Ipswich, USA) according to the manufacturer’s recommendations. Insertions of the transposon were screened by transposon Tn7 specific primers (Tn7RN: 5´‑ACTTTATTGTCATAGTTTAGATCTATTTTG-3´; Tn7LS: 5´‑ATAATCCTTAAAAACTC- CATTTCCACCCCT-3´). For a small insert library, plasmid DNA of the recombinant strains (pPK11.1 or pPK11.2) carrying Tn7 insertion in the colicin gene was mechanically fragmented (Hy- droshear; Genomic Solutions, Holliston, USA), blunt ended, and ligated with the linearized pUC18 vector. This resulted in small insert libraries. Ninety-six colonies were sequenced for both pPK11.1 and pPK11.2 template.

3.11. DNA sequencing and sequence analysis

All constructs used in this study were verified by Sanger sequencing. DNA sequencing reaction was performed using a BigDye® Terminator v3.1 Cycle Sequencing Kit (Applied Biosystems, Foster City, USA). Manufacturer’s recommendations were followed. Reads were provided by The Genome In- stitute (Department of Genetics, Washington University School of Medicine, 4444 Forest Park Ave., 63108 Saint Louis, MO, USA). The Lasergene program package (DNASTAR, Madison, USA) was used for manipulation and assembly of the sequence data. Gene predictions and annotations were performed using Glimmer

FIGURE 10. Scheme of the chromosomal mutagenensis in vivo and identification of the insertion flanking sequences (Delcher et al., 1999; http://www.cbcb.umd.edu/software/glimmer/) and GeneMark (Lukashin and Borodovsky, 1998; http://exon.biology.gatech.edu/) software. DNA and protein sequences were also compared with NCBI database using online tools (http://blast.ncbi.nlm.nih.gov/). The MEGA 5.2.2 software (Tamura et al., 2011) was used for construction of the phylogenetic trees. Protein sequences used for the tree constructions were aligned using ClustalW. Phylogenetic trees were constructed with a maximum likelihood method from the best model identified by JTT matrix-based model (Jones et al., 1992). Positions of the external loops in the YiuR protein were predicted by Hidden Markov Model method (Bagos et al., 2004a, 2004b; http://biophysics.biol.uoa.gr/PRED-TMBB/). Primers were designed by Primer3 software (Rozen and Skaletsky, 2000; http://frodo.wi.mit.edu/).

46 3.12. Construction of the genome library

Genomic DNA from Y. kristensenii Y276 was isolated by CTAB (cetyltrimethylammonium bromide) method followed by phenol-chloroform purification (Sambrook and Russell, 2001). Isolated DNA was digested (30 µg per reaction) at 37 °C for 3 h using serial dilutions (2 - 0,001 unit) of BfuCI (New England Biolabs). Five digestions (0.5 - 0.03125 unit) containing optimally digested DNA (the most DNA fragments with size around 48 kb) were collected, purified, and cloned into BamHI digested vector pBeloBAC 11 using Gigapack® III XL Packaging Extract according to the manufacturer’s instructions. Genome library was transformed into competent E. coli DH10B.

3.13. Chromosomal mutagenesis in vivo

Chromosomal in vivo mutagenesis (Rossignol et al., 2001) was used for transposon inactivation of the colicin FY receptor gene in a susceptible strain. Suicide-plasmid NKBOR was isolated from the E. coli DH5α pir strain and subsequently electroporated to Y. kristensenii Y276. Recombinant bacteria were placed on selective 1.5% TY agar containing kanamycin (0.050 g/l) and colicin FY (200 µl of crude sterile lysate, 100 A.U.). Resulting colonies were cultivated in the liquid TY medium overnight and then verified for their nonsusceptibility to colicin YF using the colicin activity assay described above.

3.14. Identification of receptor for colicin FY The standard CTAB method followed by phenol-chloroform purification (Sambrook and Russell,

2001) was used to isolate chromosomal DNA from the colicin FY resistant mutants obtained by chromosomal in vivo mutagenesis. Position of NKBOR insertion into the bacterial chromosome was determined (Figure 10). Chromosomal DNA (1 – 5 mg) was digested at 37 °C for 3 h using 5 U EcoRI (New England Biolabs), which does not cut the NKBOR sequence. After EcoRI heat-inactivation, T4 ligase (New England Biolabs) was added to the digested DNA and the mixture was incubated at 16 °C for 16 h. A ligation mixture, containing circular form of fragmented chromosome, was used as a template for PCR amplification using GeneAmp XL PCR Kit (Applied Biosystems) and primers (NKBORout3: 5´-AACAAGCCAGGGATGTAACG-3´ and NKBORout4: 5´-GCAGGGCTTTATT- GATTCCA-3´). XL PCR profile included initial denaturation (94 °C for 1 min), 30 cycles (94 °C for 15 s, 65 °C for 6 min), additional 12 cycles with more stringent annealing conditions (94 °C for 15 s, 67 °C for 10 min with increment 15 s), and final extension step (72 °C for 10 min). The resulting PCR products, containing insertion flanking sequence, were sequenced with the same primers.

3.15. DNA cloning

The yiu locus (yiuB, yiuC and yiuR genes) was amplified from the genomic DNA of a single colony of Y. kristensenii Y276 that was resuspended in 100 µl deionized water. Bacterial suspension (1 µl) was boiled (5 min) and used as a DNA template. For the amplification, GeneAmp XL PCR Kit (Applied Biosystems) and specific primer pairs (YE1459SD-F: 5´-ACCGAAATAAATGAGC- CTATCCACTGAAT-3´, YE1459SD-R: 5´-TCATACATTCCCCCTATGGCGC-3´, YE1460SD-F: 5´-ACCGAAATAAATGACTTCTGGCTTACGTATTG-3, YE1460SD-R: 5´-TTAAATTGTTG- GTTCCGTGACTAATCCATCG-3´, YE1461SD-F: 5´-ACCGAAATAAATGGCTAAGGCCTT- TAGG-3´, and YE1461SD-R: 5´-TTAGAAATCGTAGCTGGCGCCCAC-3´) were used. Similarly, the colicin FY locus (cfyA-cfyI) was amplified from the genomic DNA of a producer colony using Pfu

47 polymerase (Fermentas, Vilnius, Lithuania) and specific primers (ColYF-XhoI-F: 5´‑AGGACTC- GAGATGACAGATTATAAAGATGTTGATCCG-3´, ImmYF: 5´-AGGACTCGAGATGGATATTA- GATACTATATAAAAAATATA-3´). The PCR profile started with denaturation at 94 °C for 5 min, followed by 40 cycles (95 °C for 30 s, 50 °C for 3 min, 72 °C for 1 min), and ended by extension at 72 °C for 10 min. All PCR products were immediately cloned using TOPO TA Cloning Kit (Invitrogen) according to the manufacturer’s instructions. The tonB gene from Y. kristensenii Y276 was cloned using In-Fusion Advantage PCR Cloning Kit (Clontech, Mountain View, USA) and specific primers (infusionYE2222F: 5´‑CTGGCGGC- CGCTCGAGATGCAGCTAAATAAATTTTTCTTGGGTCGACGGC-3´ and infusionYE2222R: 5´-AATTGGGCCCTCTAGATTAGTCCATTTCCGTCGTGCCGCCAATT-3´) in accordance with manufacturer’s instructions.

3.16. Colicin purification and immunoblot analysis

For purification of colicins, the colicin locus (cfyA-cfyI) was cloned from pCR®2.1 TOPO vector (see above) into pBAD-A vector (Invitrogen) using XhoI enzyme (New England Biolabs), where His-Tag and Express epitope were added to N-terminus of the colicin molecule. The construct was transformed into the expression strain E. coli TOP10F´. E. coli TOP10F´ strain harboring colicin determinant on pDS1068 plasmid was cultured in large volume (22 liter) till OD600=0.6 and then, the colicin expression was induced by L-(+)-arabinose (0.2 g/l, Sigma-Aldrich). Cells were harvested 4 h post induction, frozen at -80 °C, mechanically disrupted, resuspended in the lysis buffer (100 mM TrisHCl, 20% sucrose, 4 mM EDTA, 1 M β‑mercaptoethanol, 300 mM NaCl, pH7.5), sonicated (20 Hz; 20×5 min), centrifuged (4,000×g; 4 °C; 30 min), and the colicin containing supernatant was collected. The colicin was prepurified from the suspension using Ni-NTA Agarose (Qiagen) and further purified using AKTA FPLC System (GE Healthcare, Fairfield, USA) and ion-exchange columns (Source 15Q and MonoQ 5/50 GL, GE Healthcare). During the colicin purification, all collected fractions were analyzed using SDS‑PAGE followed by western blot, where the proteins were electro-transferred (100V/1h) onto Immobilon-P Transfer Membrane (Millipore, Billerica, USA). Penta-His HRP Conjugate Kit (Qiagen) and AEC Staining Kit (Sigma-Aldrich) were used for visualization of the His-tagged proteins, according to the manufacturer’s recommendations. To remove tags from the colicin molecule, enterokinase (New England Biolabs) was used (25 °C; 90 min).

3.17. Channel-forming assay

Measurements on the planar lipid bilayers were performed in teflon cells separated by a diaphragm with a circular hole (diameter 0.5 mm) bearing the membrane. The membrane was formed by paint- ing method using 3% soybean phosphatidyl choline (Sigma-Aldrich) in n-dekane:butanol (9:1 v/v). The membrane current was amplified and digitized. The signal was processed by QuB software (http://www.qub.buffalo.edu/). The colicin was always added into the cis compartment bearing a positive potential.

3.18. 16S rRNA analysis

To analyze the 16S rDNA in Y. enterocolitica strains, a part (524 bp) of the 16S rRNA gene was

48 amplified from a single bacterial colony, which was resuspended in 100 µl of deionized water, using Taq polymerase (New England Biolabs) and a pair of 16S rDNA-specific primers (16SRNA-F: 5´‑AGTTTGATCATGGCTCAG‑3´ and 16SRNA-R: 5´‑TTACCGCGGCTGCTGGCA‑3´) (Kotet- ishvili et al., 2005). PCR started with denaturation at 94 °C for 5 min, followed by 40 cycles at 95 °C for 30 s, 50 °C for 30 s, 72 °C for 1 min, and extension at 72 °C for 10 min. PCR products were sequenced and the obtained data were analyzed. Isolates were classified to subspecies based on the polymorphisms in the 30 bp region of the 16S rDNA (Neubauer et al., 2000).

3.19. Bioserotype classification

Y. enterocolitica isolates were serotyped and biotyped using previously described methods (Aleksic and Bockemuhl, 1984; Wauters et al., 1987). Isolates from the Czech Republic were serotyped using diagnostic agglutination sera O:3, O:5, O:8, and O:9 (ITEST PLUS, Hradec Králové, Czech Republic) and biotyped based on the esculin hydrolysis, indole production, xylose, and/or trehalose utilization. The bioserotype characterization of other isolates was provided with isolates.

3.20. Pulsed field gel electrophoresis

Overnight TY cultures of Y. enterocolitica were centrifuged, diluted in suspension buffer (100 mM

Tris (Sigma-Aldrich), 100 mM EDTA (Sigma-Aldrich), pH=8) to OD600 = 1.4, and mixed with equal volume of 1.6% Pulsed Field Certified Agarose (Bio-Rad Laboratories, Hercules, USA) containing 1% SDS (Sigma-Aldrich). Proteinase K (Sigma-Adrich) was added to the suspension (to a final concentration of 0.5 mg/ml) and the samples were aliquoted into plug molds. Each plug was transferred into 5 ml of the lysis buffer (50 mM Tris, 50 mM EDTA, 1% SDS, 500 µg proteinase K, pH=8) and incubated at 54 °C for 2 h. The plugs were then washed in deionized water at 54 °C (2×15 min) followed by washes (4×15 min) with TE buffer (10 mM Tris, 1 mM EDTA, pH=8). After the bacterial lysis, the plugs were digested with 50 U of NotI enzyme (New England Biolabs) at 37 °C for 3 h and were loaded into a 1% Pulsed Field Certified Agarose gel. The electrophoresis was performed using CHEF-DR II system (Bio-Rad Laboratories) in 0.5% TBE (50 mM Tris, 50 mM boric acid, 1.5 mM EDTA) at 14 °C, 6 V/cm and a ramping time of 2.5 s to 25 s over 24 h. The gels were stained with ethidium bromide (1 µg/ml) and visualized under UV light. Genomic DNA from Salmonella enterica, serotype Braenderup H9812, digested by XbaI (New England Biolabs), was used as a molecular weight standard. BioNumerics v6.1 (Applied Maths, Sint Martens Latem, Belgium) was used to analyze the restriction profiles (bands from ~50 kbp to ~500 kbp). Based on the PFGE data, dendrograms were constructed using Dice’s coefficient of similarity and Unweighted Pair Group Method with Arithmetic Mean (UPGMA) clustering at 0.5% tolerance.

3.21. Detection of virulence factors Y. enterocolitica genomic DNA was isolated from overnight cultures using DNAzol® Reagent (Invit- rogen), according to the manufacturer’s instructions. Isolated DNA (1 µl) was used as a template for multiplex PCR (Harnett et al., 1996). Three different virulence markers – ystA (134 bp), virF (231 bp), and ail (356 bp), were amplified using Taq polymerase (New England Biolabs) and specific primer pairs (Yst‑a: 5´‑GTCTTCATTTGGAGGATTCGGC‑3´, Yst-b: 5´‑AATCACTACTGACTTCG- GCTGG‑3´, ViF-a: 5´‑GCTTTTGCTTGCCTTTAGCTCG‑3´, VirF-b: 5´‑AGAATACGTCGCTC-

49 GCTTATCC‑3´, Ail-a: 5´‑TGGTTATGCGCAAAGCCATGT‑3´, and Ail-b: 5´‑TGGAAGTGGGTT- GAATTGCA‑3´). PCR started with denaturation at 94 °C for 5 min, followed by 35 cycles at 94 °C for 30 s, 55 °C for 30 s, 72 °C for 1 min, and extension at 72 °C for 10 min. When multiplex PCR results were negative, virulence markers were analyzed individually under the same PCR conditions.

3.22. Antibiotic susceptibility assay

Y. enterocolitica isolates were tested for susceptibility to 14 antibiotics using the disc diffusion method and the National Committee for Clinical Laboratory Standards guidelines (Clinical and Laboratory Standards Institute, 2012). Susceptibility assays were performed on Mueller–Hinton agar at 37 °C. The antibiotic disks (Oxoid, Basingstoke, UK) with following drugs and quantities were used: ampicillin (AMP; 10 mg), cephalothin (KF; 30 mg), doxycycline (DO; 30 mg), cefuroxime (CXM; 30 mg), ciprofloxacin (CIP; 5 mg), sulfamethoxazole-trimethoprim (SXT; 25 mg), oxolinic acid (OA; 30 mg), gentamicin (CN; 10 mg), cefotaxime (CTX; 30 mg), ceftazidime (CAZ; 30 mg), amoxicillin with clavulanic acid (AMC; 30 mg), aztreonam (ATM; 30 mg), chloramphenicol (C; 30 mg), and colistin sulphate (CT; 10 mg).

50 4. RESULTS AND DISCUSSION

4.1. Bacteriocin production in the genus Yersinia

Colicins are proteinaceous antimicrobial agents produced by colicinogenic strains of E. coli and other related species of the family Enterobacteriaceae. Even though majority of the colicin types were identified in E. coli, several colicins were originally identified in various enterobacterial species including Citrobacter freundii CA31 (colicin A, (Morlon et al., 1983)), Serratia marcescens JF246 (colicin L, (Foulds, 1972)), Shigella sonnei P9 (colicins E2, Ia, and Ib, (Cole et al., 1985; Konisky and Cowell, 1972)), S. sonnei 7 (colicin Js, (Abbott and Graham, 1961)), S. boydii M592 (colicin U, (Horák, 1994)) etc. In addition, several bacteriocins were named differently although the principal features of these proteins are similar to colicins, including bacteriocin 28b of Serratia marcescens N28b (Viejo et al., 1992), pesticin I of Yersinia pestis A1122 (Ben-Gurion and Hertman, 1958; Hu and Brubaker, 1974), cloacin DF13 of Enterobacter cloaceae DF13 (Stouthamer and Tieze, 1966), S-type pyocins of Pseudo- monas aeruginosa (reviewed in Michel-Briand and Baysse, 2002) etc. All of them share a similar molecular structure comprising three domains for colicin translocation, receptor‑binding, and the lethal effect. To date, more than 20 various colicin types have been described on the molecular level and many bacteriocin-like substances remain characterized only partially (Cascales et al., 2007; Šmarda and Šmajs, 1998). The genus Yersinia, comprising pathogenic species Y. pestis, Y. pseudotuberculosis, and Y. enterocolitica, is an important taxon for human medicine, and therefore a hunt for new bacteriocins against yersiniae has been demanded. Several studies described bacteriocin-like substances in the genus Yersinia (Bottone et al., 1979; Calvo et al., 1986; Sandhu et al., 1983; Toora et al., 1994), but only one colicin type, pesticin I, has been characterized in detail (Ferber and Brubaker, 1979; Patzer et al., 2012; Pilsl et al., 1996; Rakin et al., 1994, 1996; Vollmer et al., 1997). The yet identified bacteriocin substances of Y. intermedia, Y. kristensenii, Y. frederiksenii, and Y. enterocolitica were not characterized in detail. Therefore, the aim of this study was to map bacteriocin production of various yersinia strains and to further characterize the newly identified antimicrobial agents. As a first step, we followed and extended the work done by Petra Kotrsalová (diploma thesis available in http://www.is.muni.cz entitled: “Production of specific antibacterial agents in the genus Yersinia”) by analyzing 87 yersinia strains (only nineteen Y. enterocolitica strains provided by NIPH were analyzed) belonging to 8 species. By the cross-activity test, six bacteriocin-producing strains were identified (7% out of all tested; Table 3, Figure 11a) – Y. frederiksenii 27601, Y. intermedia Y546, and four strains of Y. ruckeri (Y136, 28544, 28590, 28631). The obtained data confirmed bacteriocin production among strains of Y. intermedia and Y. frederiksenii; on the other hand, bacteriocinogeny was not observed among strains of Y. kristensenii and Y. enterocolitica. Moreover, production of bacteriocins by Y. ruckeri had never been described before. All six identified bacteriocins were protease-sensitive and mitomycin C-inducible (data not shown). Hence, the identified bacteriocins have proteinaceous character (typical for colicins) and are different from previously partially characterized corpuscular bacteriocins of Y. intermedia and Y. frederiksenii (Calvo et al., 1986). The activity spectrum of all four Y. ruckeri bacteriocins was completely identical, so they are likely the same bacteriocin type. Bacteriocins of Y. intermedia and Y. frederiksenii had a distinct spectrum of susceptible strains. Since the bacteriocin of Y. frederiksenii was active against human pathogenic Y. enterocolitica isolates, we focused on its detailed analysis.

51 FIGURE 11. Bacteriocinogeny of yersiniae

(A) Out of 87 tested yersiniae, 6 strains were identified as producers of bacteriocins (7%). Producer strains belong to three species (Y. ruckeri, Y. intermedia, and Y. frederiksenii), from which the highest level of bacteriocinogeny (67%) was detected among Y. ruckeri isolates. (B) Y. frederiksenii 27601 inhibited growth of strains belonging to 5 species including the pathogenic Y. enterocolitica. All four Y. ruckeri producers showed an identical spectrum of activity.

52 TABLE 3. Bacteriocinogeny of the genus Yersinia

Producer strain Susceptible strains Y. frederiksenii 27601 Y. frederiksenii (Y62, Y284, 27477) Y. intermedia (22377, 27471) Y. kristensenii (Y276, Y330, Y611, Y612, Y615) Y. aldovae (Y551, Y552, 21698, 25525) Y. enterocolitica (all 19 tested strains provided from NIPH) Y. intermedia Y546 Y. frederiksenii (Y71, 27411, 27627) Y. intermedia (E67, Y498, Y308, 25448) Y. rohdei (Y137) Y. ruckeri Y136 Y. frederiksenii (Y71, Y81, Y284, 27411, 27627, 27829) Y. intermedia (Y498, 25448) Y. kristensenii (Y476) Y. rohdei (Y137) Y. ruckeri 28544 Y. frederiksenii (Y71, Y81, Y284, 27411, 27627, 27829) Y. intermedia (Y498, 25448) Y. kristensenii (Y476) Y. rohdei (Y137) Y. ruckeri 28590 Y. frederiksenii (Y71, Y81, Y284, 27411, 27627, 27829) Y. intermedia (Y498, 25448) Y. kristensenii (Y476) Y. rohdei (Y137) Y. ruckeri 28631 Y. frederiksenii (Y71, Y81, Y284, 27411, 27627, 27829) Y. intermedia (Y498, 25448) Y. kristensenii (Y476) Y. rohdei (Y137)

4.2. Activity spectrum of the bacteriocin of Y. frederiksenii 27601

Bacteriocin produced by the strain Y. frederiksenii 27601 inhibited growth of strains from five Yer- sinia species - Y. frederiksenii (3 susceptible strains out of 13 tested), Y. intermedia (2 out of 9), Y. kristensenii (5 out of 15), Y. aldovae (4 out of 6), and Y. enterocolitica (19 out of 19 tested strains). On the other hand, no susceptible strain was identified among species of Y. rohdei (4 tested strains), Y. ruckeri (6 tested strains), and Y. pseudotuberculosis (15 tested strains) (Table 3, Figure 11b). Inter- estingly, the highest number of susceptible strains was observed in Y. enterocolitica, a species causing human diarrheal infections, especially in children (Mingrone et al., 1987; Zheng et al., 2008a). De- spite the fact that Y. enterocolitica and Y. pseudotuberculosis are primarily gut pathogens, not a single strain of Y. pseudotuberculosis susceptible to bacteriocin was found. We did not analyze activity of the bacteriocin against pathogenic strains of Y. pestis. However, multilocus sequencing showed that Y. pestis and Y. pseudotuberculosis are very closely related and represent two lineages of the same species (Kotetishvili et al., 2005). Therefore, Y. pestis is presumably nonsusceptible to bacteriocin of Y. frederiksenii 27601. All colicins that had ever been characterized in detail, including pesticin I produced by Yer- sinia strains, were active against E. coli strains regardless of their producer. For the bacteriocin of

53 Y. frederiksenii 27601, the activity was tested against a set of standard colicin indicator strains - E. coli K12-Row, C6 (Ф), B1, P400, and Shigella sonnei 17 (Šmajs et al., 2010). No standard indicator was susceptible to this bacteriocin. This atypical activity spectrum indicated a yet unknown type of bacteriocin. Based on the proteinaceous character and unique spectrum of activity, we considered

bacteriocin of Y. frederiksenii 27601 as a novel type of colicin and thus, we named it as colicin FY. The letter F remained unused (the originally identified colicin F was reclassified as colicin E2 (Fredericq,

1965)); the index Y stands for Yersinia.

4.3. Isolation and sequencing of the colicinogenic plasmid YF27601

Colicins are typically produced by strains of E. coli that harbor one colicinogenic plasmid. There are two types of Col-plasmids – type I and type II (Hardy et al., 1973). The type I pCol are small plasmids (5 to 10 kb) with about 20 copies per cell; they typically encode group A colicins. The type II pCol are large monocopy plasmids (~40 kb), which usually encode colicins of group B. Colicin-like bacteriocin 28b (colicin L) produced by strains of Serratia marcescens is unique, because it is encoded chromosomally (Guasch et al., 1995). For identification of the bacteriocin coding region, total plasmid DNA from Y. frederiksenii 27601 was isolated and mutagenized. After Tn7 transposon mutagenesis in vitro and chloramphenicol selection of the recombinant bacteria, twelve colonies were obtained (named PK11.1 - PK11.12).

Next, the colicin FY production of all twelve recombinant clones was tested. Out of these, two clones (PK11.1 and PK11.2) did not inhibit the indicator strain Y. kristensenii Y276. Plasmid DNA of these

FIGURE 12. Map of the plasmid YF27601

A complete plasmid sequence comprises 5,574 bp. The localization and polarity of 8 predicted genes, the positions of few unique restriction sites, the incompatibility region (inc), and the position of the putative origin of replication (ori) are indicated. The colicin YF activity (cfyA) and immunity (cfyI) genes are shown as gray arrows.

54 two strains, with expected insertion in the colicin genes, was used to construct small insert libraries using pUC18 vector. For each plasmid, 96 clones were sequenced, which resulted in 16× average coverage of the plasmid DNA. The complete sequence of the colicin-coding plasmid comprised 5574 bp (without transposon DNA sequence) and we designated the plasmid as pYF27601. Based on the plasmid size, pYF27601 is a low molecular weight Col-plasmid (type I). Pesticin I produced by yersinia strains is coded on pPCP1 plasmid (9.6 kb), which also belongs to type I colicinogenic plasmids (Rakin et al., 1996). The average G+C content of the whole plasmid sequence was 50.0%. Plasmid YF27601 contained a 964 nucleotides long region (position: 5497-886) with high similarity to the replication origin (ori) of plasmid AlvA that encodes alveicin A, a colicin-like bacteriocin produced by Hafnia alvei (Wertz and Riley, 2004); however, a precise start position of ori was not clearly identified. Thus, the complete sequence of pYF27601 was numbered from the unique BamHI restriction target site starting with its first recognized nucleotide (GGATCC). Based on the sequence homology of the ori region, theta mechanism was predicted for replication of pYF27601. Theta mechanism is also used for replication of pAlvA and other colE1-type plasmids (Chan et al., 1985; Pan et al., 2010; Riley et al., 2000; Thomas 2000; Wertz and Riley, 2004). This mechanism of replication uses two antisense RNA molecules for regulation of the plasmid maintenance (del Solar et al., 1998). Due to the sequence diversity of ori region, only promoter sequences (“-35” and “-10” region) of RNAI and RNAII on pYF27601 were predicted (Table 4). Although the precise transcription starts of RNAI and RNAII genes are not known, the complementary regions of RNAI and RNAII molecules specified the plasmid incompatibility (inc) region that is defined by overlapping RNAI and RNAII sequences. The incompatibility region of pYF27601 substantially differs (~70% identity) from the inc region of pColE1 (Hashimoto-Gotoh and Inselburg, 1979; Tomizawa and Itoh, 1981). Therefore, it is likely that pYF27601 is compatible with ColE1-like plasmids. This prediction was verified experimentally, when pYF27601 was cloned into the laboratory strain ofE. coli carrying pCR®2.1‑TOPO, a vector containing pColE1-derived replication of origin; several bacterial clones capable of a stable maintenance of both plasmids for multiple passages were obtained.

TABLE 4. Identified ORFs and regulatory regions in pYF27601 and their characteristics

ORF Position Similarity to Lenghta Organism Identityb 1 155-682 - c 175 - - 2 645-1058 - c 137 - - 3 1005-1346 Mobilization protein MobC 113 H. alvei 56% (107) 4 1336-2799 Mobilization nuclease MobA 487 H. alvei 52% (459) 5 2908-4224 Colicin 438 A. nasoniae 44% (436) 6 4238-4576 Immunity protein for colicin Ib 112 S. sonnei P9 37% (111) 7 4692-5195 IS1 transposase B 167 E. coli K12 100% (167) 8 5114-5389 IS1 transposase A 91 E. coli H10407 99% (91) 79-108 RNAI promoterd H. alvei 93% (28) 5504-5532 RNAII promoterd H. alvei 62% (18) a Number of amino acids b Length of alignment is shown in parenthesis. c No similarity found d Analyzed sequence between regions “-35” and “-10”

55 Then, open reading frames (ORFs) were predicted on the plasmid sequence. The pYF27601 comprised 8 predicted ORFs encoding polypeptides longer than 50 amino acid residues (Table 4; Figure 12). Two ORFs were predicted for the hypothetical proteins; they were both localized in the supposed

ori region. Other six ORFs encoded proteins with known functions: beside the colicin FY activity and immunity genes, two genes for plasmid maintenance (plasmid mobilization) and two genes associated with IS1 element (encoding transposase) were found. In contrast to the whole plasmid, the genes for colicin activity and colicin immunity showed lower G+C content (42.1% and 30.7%, respectively). The identified plasmid organization clearly fitted pYF27601 among type I Col-plasmids. These plasmids typically contain only a region for plasmid maintenance and a colicinogeny locus (e.g. pColE1, pColJs, pColK, pCol-Let, and pColE2). Thus, the primary role of pYF27601 is synthesis of

the colicin FY itself. Typically, the type I colicin plasmids contains also a gene for lysis protein in the

colicinogenic locus (Cascales et al., 2007; Riley, 1993b). However, the FY-encoding region does not contain this gene, similarly to pesticin I-encoding plasmid (Pilsl et al., 1996; Rakin et al., 1996), and type II plasmids encoding colicins Ia, Ib, M and B (Christenson and Gordon, 2009; Olschläger et al., 1984; Săsărman et al., 1980).

4.4. Analysis of the colicinogenic region on pYF27601

A typical order of the colicin determinants on pCol is colicin activity gene, colicin immunity gene, and colicin lysis gene. The gene for colicin activity is always followed by a gene for immunity protein, but the orientation of the immunity gene is variable, which correlates with the type of colicin toxicity. While the activity and immunity genes of nuclease colicins are localized in the same orientation, the gene for immunity protein of pore-forming colicins has an opposite orientation and is encoded on the complementary DNA strand (Cascales et al., 2007). Pesticin I is a muramidase with organization similar to the pore-forming colicins (Rakin et al., 1996). Analysis of pYF27601 revealed two opposite colicinogenic determinants, which were designated

as cfyA and cfyI, respectively. The cfyA gene (1317 bp) encodes colicin FY. Upstream from cfyA, putative promoter regions “-10” (2817TTGACA2822) and “-35” (2840TAGTAT2845), together with ribosome binding site (2897AGGGA2901), were identified. Additionally, a single LexA binding site (2853CTGTAT- GTATATACAG2868) was found upstream from cfyA. The LexA binding site is a general regulatory sequence for proteins transcribed under stress condition (Butala et al., 2009). In contrast to other SOS-induced proteins, colicins are typically regulated by promotor containing two overlapping LexA binding sites. The presence of the double LexA binding site allows a higher stringency in colicin regulation, i.e. no or very low basal expression of colicin and high level of expression after induction

(Gillor et al., 2008). Colicin FY is regulated by a single LexA binding site, which indicates higher level of basal expression and lower response ratio on SOS induction compared to bacteriocins regulated by two LexA binding sites. This type of regulation was found also for colicins Ia, Ib, and several

colicin-like bacteriocins, e.g. cloacins and klebicins. Interestingly, the colicin FY promoter is more related to colicin Ia and Ib (single LexA site) than to yersinia produced pesticin I (double LexA site).

In fact, the mitomycin C-induction (SOS‑stress) did not significantly affect synthesis of colicinY F during preparation of the crude colicin extract. Gene cfyI (339 bp), the second determinant of the colicinogenic region, encodes the immunity

protein of colicin FY. cfyI is oriented opposite to the cfyA gene, a pattern typical for colicins that do not require proportional synthesis of colicins and their corresponding immunity proteins i.e. pore- forming colicins, colicin M, and pesticin I (Olschläger and Braun, 1987; Rakin et al., 1996). Upstream from the cfyI gene, a nearly consensus promoter was identified - regions “-10” and “-35” represent

56 sequences 4665TTGACA4660 and 4641TAAAAA4636, respectively. This fact indicates a relatively strong transcription of cfyI. In addition, 13bp long inverted repeats in the 3’ region of cfyI and in the intergenic region of cfyA-cfyI (positions: 4229-4241 and 4252-4264, respectively) were found, which represents transcription termination sites.

After the colicinogenic locus with its regulation regions was analyzed, the colicin YF and its immunity protein were characterized on a protein level.

4.5. Sequence analysis of colicin FY on the protein level

The protein corresponding to the cfyA gene, colicin FY, contains 438 amino acid residues with a calculated molecular mass of 49.6 kDa. The cfyI gene encodes immunity protein of colicin FY (13.1 kDa), consisting of 112 amino acid residues. While the colicin C-terminus contains a conserved domain, a low sequence similarity of the N- terminal part with known bacteriocins was identified using BLAST-analysis of the deduced amino acid sequence of colicin FY (Figure 13); thus, colicin FY is a novel type of bacteriocin. The N-terminal part of the colicin molecule (i.e. deduced T- and R-domain) had the highest amino acid similarity (31% and 28% of identical residues, respectively) to an uncharacterized colicin from Arsenophonus nasoniae (CBA74339) and S-type pyocin domain-containing protein of Serratia proteomaculans 568 (YP_001476768). Despite the low similarity, a conserved TonB box (42DTMTVTG48) was identified.

This indicates that colicin YF belongs to group B (Braun et al., 2002). In addition, the low similarity of the deduced receptor-binding domain suggested a novel receptor specificity of colicin YF . In contrast, the last 178 amino acid residues representing the C-terminal domain of colicin FY showed high

FIGURE 13. Sequence analysis of colicin FY

The protein sequence of colicin FY was compared to other known protein sequences using BLAST. Colicin FY is a novel type of colicin with a highly conserved C-terminal domain.

57 FIGURE 14. Phylogenetic analysis of colicin FY

The software Mega 5.2 (http://www.megasoftware.net/) was used to construct the phylogenetic trees using whole amino acid sequences of the colicin activity (A) and immunity (B) proteins. The evolutionary history was inferred by using the Maximum Likelihood method based on the JTT matrix-based model. The trees with the highest log likelihood are shown. Trees are drawn to scale 0.2 substitutions per site. All positions containing gaps and missing data were eliminated. The sequences of activity and immunity proteins of colicin L and S1 are not known, so they are not implemented in the trees. similarity to C-terminal domains of several pore‑forming colicins. Among colicin Ib molecules from various bacterial sources, C-domain of colicin Ib from Yersinia ruckeri ATCC 29473 (ZP_04617830) showed the highest similarity (69%) with the C-domain of colicin FY. Moreover, there was a sequence similarity between colicin FY and Ib immunity proteins, which directly bind to colicin C-domains.

Colicin FY immunity protein was the most similar (37%) to colicin Ib immunity protein from Salmo- nella enterica subsp. enterica serovar Newport str. CVM N18486 (EJA59795.1) and immunity protein of the putative colicin from A. nasoniae (CBA74337). Taken together, colicin FY and its immunity protein showed the highest similarity on protein level to putative colicin from A. nasoniae and to colicin Ib (including corresponding immunity proteins), respectively (Figure 14). The genus Arsenophonus (of which A. nasoniae is the type species) is an Gram-negative, endo- symbiotic, likely nonpathogenic bacteria that infects almost 5% of arthropod species (Duron et al., 2008; Hypsa and Dale, 1997; Werren et al., 1986). To date, A. nasoniae is the only species of the genus Arsenophonus being a reproductive parasite – a son-killer bacterium of wasps Nasonia vitripennis. The genome analysis revealed that A. nasoniae is the most related to bacteria of the genera Photor- abdus, Proteus, Serratia, and Yersinia (Darby et al., 2010). Extrachromosomal genetic information showed a good synteny, homology, and gene content with large enterobacterial conjugative plasmids, e.g. pColIb-P9 of S. sonnei and pGDT4 of Y. pseudotuberculosis. In addition, a putative colicin with similarity to colicin Ib was predicted in genome of A. nasoniae; however, it was not further characterized (Wilkes et al., 2010). Because of the insufficient characterization of the bacteriocin from A. nasoniae, the well-charac-

58 FIGURE 15. Cross immunity of colicin FY and Ib

Immunity protein of colicin FY inhibits the lethal effect of colicin Ib. The recombinant strain E. coli TOP10F´pDS1091 carrying the gene for colicin FY receptor and tonBYK was used as an indicator strain. Dilutions of the tested colicins are shown in the black lines.

terized pore-forming colicin Ib was designated as the most related colicin type to colicin FY, although only the cytotoxic domains were sequentially similar. A close relationship of colicin FY and Ib was also verified experimentally, when E. coli recombinant strain coding colicin FY immunity protein was immune to colicin Ib (Figure 15). Thus, a common ancestry for colicin YF - and Ib- encoding regions was proposed, a feature common for colicins (Riley, 1993b; Riley et al., 2000).

4.6. Cloning, purification, and protein analysis of colicin YF

After the genetic analysis of colicin FY, the colicin molecule itself was analyzed. First, it was necessary to purify the protein. The colicinogenic region containing both genes (cfyA and cfyI) was amplified (Yang et al., 2007) and then cloned into the cloning vector pCR®2.1-TOPO. A construct designated as pDS1008 was verified using sequencing and then, the colicinogenic region was recloned into the expression vector pBAD-A. A new construct (pDS1068) that encoded colicin FY with an N-terminal

FIGURE 16. Expression system for production of colicin FY

After arabinose-induced expression, the recombinant strain E. coli TOP10F´ carrying plasmid pDS1068 inhibited growth (clear zone around the colicin producer) of the colicin susceptible strain Y. kristensenii Y276.

59 His-tag with arabinose controlled expression was then transformed into the expression strain E. coli TOP10F´ (Figure 16). After construction of the functional expression system, large amount ofE. coli TOP10F´ (pDS1068)

expressing colicin FY was produced (60 g of wet weight cells). A two steps purification was used to

purify colicin FY. The His-tagged colicin was prepurified from the bacterial lysate using Ni-NTA Aga- rose (Figure 17a), and further purified using ion-exchange chromatography. Using this procedure, 20 mg of the colicin were obtained (estimated from gel; Figure 17b). Molecular mass of the tagged

FIGURE 17. Purification of colicin YF

(A) Purification of colicin FY containing the N-terminal histidine tag using Ni column. Colicin was eluated using increasing concentrations of imidazole. (B) Elutions from (A) after collection, dialysis, and concentration: E250 (4 ml), E500 (1.5 ml), *E500 (1.5 ml; additional purification with MonoQ column), and E1000 (1.5 ml). M - PageRuler Prestained Protein Ladder (Fermentas), M* - marker for estimation of the amount of purified colicin.

(C) Purified colicin FY before (-) and after (+) treatment with enterokinase to remove the N-terminal His-tag. The 12% polyacrylamide gel was stained with Coomassie brilliant blue. Penta-His HRP Conjugate Kit and AEC

Staining Kit were used for western blot. (D) Antibacterial activity of the purified colicin FY on Y. kristensenii Y276 indicator strain. Biological activity of the enterokinase-treated, purified colicin FY (with the N-terminal His tag removed) increased approximately by an order of magnitude to 103 arbitrary units per μl. Dilutions of the tested colicins are indicated in the black line.

60 colicin FY was 54 kDa (Figure 17c), which is in accordance with the predicted molecular mass of the native colicin FY (49.6 kDa) and similar to molecular mass of others pore-forming colicins (e.g. A (Morlon et al., 1983), B (Schramm et al., 1987), E1 (Yamada et al., 1982), Ia (Buchanan et al., 2007), U (Šmajs et al., 1997), and 10 (Pilsl and Braun, 1995a)). According to the colicin activity assay, antibacterial activity of the purified His‑tagged colicin

FY was 100 A.U. Colicin activity was ten-fold enhanced after removal of tag from the N-terminus (Figure 17d). This confirmed the importance of an intact colicin N-terminus that interacts with the transport proteins for correct colicin activity (Cascales et al., 2007; Mende and Braun, 1990).

One lethal unit of colicin FY (i.e. the lowest number of colicin molecules able to kill one susceptible bacterium) was also estimated. Based on number of lethal colicin units in one arbitrary unit for colicins E1-E9 (arbitrary unit = 2 x 108 lethal units; (Šmarda and Damborský, 1991)) and estimation of 12 the number of colicin FY molecules in sample for the colicin activity assay (10 ), one lethal unit of colicin FY corresponds to approximately 5 molecules.

A pore-forming activity of colicin FY was predicted from its sequence similarity to previously described colicins. The purified colicinY F was used to verify this hypothesis. Pore-formation and

FIGURE 18. Pore-forming activity of colicin FY

2+ (A) Colicin FY pores are opened only in the presence of sub-millimolar Ca concentration. (1 M KCl, pH=6.0, soybean phosphatidyl choline membrane with n-decane). (B) Colicin FY forms pores of the single channel conductance varying from 10 pS to 1,000 pS. The histogram maxima may be found at ~15 pS, ~50 pS, and ~100 pS (1 M

KCl, 0.5 mM CaCl2, pH=6.0, soybean phosphatidyl choline membrane with n-decane).

61 further characterization of the colicin FY pores were studied on the Faculty of Science, Charles Uni- versity. Analysis on planar lipid bilayer showed that colicin FY formed calcium‑dependent, cation- selective pores with various sizes (R. Fišer, unpublished data; Figure 18). This data are in accordance with other studies of colicin pores (reviewed in Zakharov et al. 2004b). Several studies described the crystal structures of colicins (Arnold et al., 2009; Hilsenbeck et al., 2004; Soelaiman et al., 2001; Wiener et al., 1997; Zeth et al., 2008). In cooperation with Research

group X-ray Crystallography I (CEITEC), the purified colicin FY has been also used for crystallization and further analysis of its crystal structure; however, the optimal conditions for crystallization are yet to find. Therefore, the crystal structure of colicin Ia (Wiener et al., 1997) remains yet the most

accurate model for colicin FY structure.

4.7. Identification and characterization of the colicin YF receptor All colicins target susceptible cells by interacting with the specific outer membrane proteins (Braun et al., 2002; Cao and Klebba, 2002; Lazdunski et al., 1998). Most of the Tol-dependent colicins bind to two outer membrane proteins – receptor and translocator. While receptor specifically recognizes and anchors colicin to the cell surface, translocator facilitates its translocation. In contrast to Tol- dependent colicins, TonB-dependent colicins use the receptor for both the recognition and the translocation.

A sequence homology of the receptor binding domain of colicin FY to any other colicin was not found, which can be associated with colicin specificity to an unknown receptor molecule. Therefore,

next part of this study is focused on the identification of a receptor molecule of colicin YF .

Since none of the standard E. coli indicators was susceptible to colicin FY, Yersinia-specific recep-

tor and/or translocation systems required by colicin FY were expected. A whole genome library of colicin FY susceptible strain Y. kristensenii 276 was prepared using Gigapack® III XL Packaging Extract to construct a BAC library. Approximately 600 recombinant colonies of E. coli were picked and tested

FIGURE 19. Scheme of Tn7 insertions into locus yiu of Y. kristensenii Y276

Black circles indicate Tn7 insertions that resulted in a complete resistance to colicin FY, while white circles represent Tn7 insertions that caused only a slight decrease in susceptibility (up to 1 order of magnitude) to colicin FY. Due to proximity of the transposon insertions, six black circles are not shown. A putative Fur box and a putative promoter region (“−35” and “−10” sequences) upstream from yiuB are indicated. Coordinates taken from the genome sequence of Y. enterocolitica (Thomson et al., 2006) for each yiuBCR gene are indicated. The partial decrease in susceptibility to colicin FY caused by insertions in yiuB or yiuC likely resulted from a decreased rate of yiuR transcription from the promoter region upstream of the yiuB gene.

62 for susceptibility to colicin FY. Despite a hypothetical 5× coverage of the Yersinia genome by the library, a recombinant clone susceptible to colicin FY was not identified. Therefore, another approach to identify the receptor molecule was used - the in vivo transposon mutagenesis of the chromosome of Y. kristensenii 276 (Rossignol et al., 2001). Y. kristensenii does not encode R6K replicase that normally permits replication of the suicide plasmid NKBOR. Thus, a mini-transposon NKBOR is randomly inserted into the chromosome in Y. kristensenii. A R6K-based suicide plasmid NKBOR was cloned into elelctrocompetent cells of Y. kristensenii Y276 and the bacterial suspension was spread out on agar plates containing crude colicin

FY and kanamycin. This double selection resulted in 66 recombinant colonies of Y. kristensenii Y276 with expected transposon insertion in the gene/s used by colicin FY. Fifty colonies were picked and further analyzed. Colicin activity assay revealed a complete colicin FY resistance in 42 clones and a decrease of colicin FY susceptibility in other 8 clones. Positions of the transposon insertion in 26 clones (out of 50) were identified by sequencing. In 19 clones, the transposon insertion was found in the yiuR gene, a gene designed as ykris0001_4440 (Acc. No.: ACCA01000005.1) in a draft genome sequence of strain Y. kristensenii ATCC 33638. Moreover, the insertions in yiuB and yiuC genes (i.e. two genes upstream from yiuR) were identified in case of four clones without resistance, but only with a decreased susceptibility to colicin. The other three clones were almost fully sensitive to colicin

FY and the NKBOR insertions were localized outside the yiu locus (Yersinia iron uptake locus), in the genes for ferritin or rotamase. Based on the results obtained from sequence analysis of NKBOR position, insertions in other clones (24 out of 50) were found with a specific amplification ofyiu R gene (different size of PCR products with/without transposon) andEco RI restriction (the same profile as in clones with insertion in yiuR). The analysis of NKBOR insertions for all clones is summarized in Table S1; specific positions of insertions in the yiu locus identified by sequencing are shown in Figure 19. The yiu locus contains four genes that are strongly conserved among Y. pestis and Y. pseudotuberculosis strains. Upstream of the yiu locus, a Fur-box sequence was identified, which indicates iron- regulated expression of the operon. First three genes, yiuA, yiuB, and yiuC, encode proteins with predicted functions. YiuA is a periplasmic binding protein, YiuB is an inner membrane permease of FecCD family, and YiuC is an ATP binding protein. Together, these three proteins build an ABC transporter, resembling other ABC transporters. The last gene in the yiu operon, yiuR, encodes a putative outer membrane TonB-dependent receptor. YiuR shares the highest similarity (45%) with IrgA, an enterobactin receptor from Vibrio cholerae. Among E. coli proteins, Cir receptor is the most similar (38%) to YiuR (Kirillina et al., 2006). The same authors also described the iron uptake hierarchy of four known iron transporters with order Ybt>Yfe>Yfu>Yiu. Interestingly, the importance for the iron transport was not confirmed for YiuR, but only for the ABC proteins. However, a precise role of YiuR in iron uptake is unclear, as YiuR is overexpressed in iron-starved cells (Pieper et al., 2010). The iron uptake via Yiu system is even more obscure for Y. enterocolitica, where the yiu locus does not contain the yiuA gene. Identical situation is also in the draft genome sequence of Y. kristensenii ATCC33638. Despite uncertainty of the YiuR function in iron uptake, the transposon mutagenesis of Y. kristensenii Y276 indicated that yiuR gene encodes a putative receptor for colicin FY. YiuR from Y. kristensenii is a putative outer membrane protein, which consists of 696 amino acid residues; it shares 37% similarity with Cir of E. coli, which is involved in iron acquisition and uptake of colicin Ia and Ib (Buchanan et al., 2007; Jakes and Finkelstein, 2010; Konisky and Cowell, 1972).

The above predicted function of YiuR as a colicin FY receptor was verified by a cloning approach, when several variants of yiu locus from the colicin sensitive strain Y. kristensenii Y276 were cloned into various colicin FY resistant strains. Susceptibility of strains with the cloned yiu locus is sum

63 TABLE 5. Complementation of colicin FY resistant strains

Tested strain Susceptibility Relevant genotype a to colicin FY Y. kristensenii Y104 R Control Y. kristensenii Y104 (pDS1082) S (2) yiuR from Y. kristensenii Y276 Y. kristensenii Y104 (pDS1088) S (2) yiuBCR from Y. kristensenii Y276 Y. pseudotuberculosis Y207240 R Control Y. pseudotuberculosis Y207240 (pDS1082) S (2) yiuR from Y. kristensenii Y276 E. coli TOP10F´ R Control E. coli TOP10F´ (pDS1082) R yiuR from Y. kristensenii Y276 E. coli TOP10F´ (pDS1091) S (3) yiuR and tonB from Y. kristensenii Y276

a The numbers in parentheses indicate the highest colicin dilutions active on bacteria (e.g. 2 = 102). R – resistance; S – susceptibility

marized in Table 5. YiuR without any other cloned gene was able to cause colicin FY susceptibility of the originally resistant strains Y. kristensenii Y104 and Y. pseudotuberculosis 207240, which confirmed function of YiuR as a colicin YF receptor.

Obtained results also provided explanation for different colicin YF susceptibility of two entero- pathogenic yersiniae - Y. enterocolitica and Y. pseudotuberculosis. While all 19 previously tested

strains of Y. enterocolitica were susceptible to colicin FY, all of the 15 tested strains of Y. pseudotuberculosis were resistant (Table 3; Figure 11b). Cloning experiments revealed that the difference in susceptibility to colicin was related to YiuR. Thus, sequences of YiuR from susceptible and resistant yersinia strains were analyzed and variability was found (Figure 20). Susceptible strains of Y. enterocolitica and Y. kristensenii harbor almost identical sequence of YiuR, which are significantly different

from YiuR of colicin FY resistant strains of Y. pseudotuberculosis. Therefore, it is likely that this variability of the receptor sequence causes resistance of Y. pseudotuberculosis and that the variable amino

acid residues specify recognition of colicin FY by YiuR. Colicins typically interact with extracellular loops of their receptors; therefore, the extracellular loops of YiuR were predicted and variability of all 11 extracellular loops was analyzed (Table 6). With exception of loop 11, the sequence variability between susceptible and resistant strains was found in all extracellular loops of YiuR. In the case of

colicin Ia and receptor Cir (model with high similarity to colicin FY and receptor YiuR), the interactions were mapped and most of them were localized in loops L7 and L8 of the receptor (Buchanan et al., 2007). Compared to YiuR from Y. kristensenii and Y. pseudotuberculosis, the same loops are the longest and the most divergent, as 16 out of total 45 variable amino acid residues are located in these

two loops and therefore represent potential positions for the interaction with colicin FY. Based on the close relationship between Y. pestis and Y. pseudotuberculosis (Kotetishvili et al.,

2005), we predicted colicin FY resistance for Y. pestis (experimentally not tested). Sequence analysis of YiuR from Y. pestis showed that it is almost identical to the YiuR of Y. pseudotuberculosis (Figure 20) and confirmed the previous hypothesis. In contrast to the successfully complemented, originally resistant yersinia strains, the recom-

binant strain E. coli TOP10F´ encoding YiuR was nonsusceptible to colicin FY (Table 5). In fact, this could be a reason for the failure to identify the receptor molecule in the genomic library of

Y. kristensenii Y276, which was cloned and screened in E. coli. Colicin FY nonsusceptibility of E. coli carrying yiuR indicated a nonfunctional translocation system for the colicin. Based on the putative

64 FIGURE 20. Comparison of YiuR sequences

Sequences of YiuR from two susceptible and two nonsusceptible yersiniae were compared using ClustalW method. Amino acid variability is shown in red. Positions with an amino acid difference between the susceptible and nonsusceptible strains that could be important for interaction with colicin FY are marked by asterisks. The positions are numbered based on the consensus sequence. Sequence of Y. pseudotuberculosis YPIII (YP_001721478.1), Y. pestis KIM10+ (NP_670172.1), Y. enterocolitica 8081 (YP_001005769.2), and Y. kristensenii Y276 (AFC36226.1) were used.

TonB-dependence of colicin FY and receptor YiuR and the similarity with TonB-dependent colicin

Ib and its receptor Cir, the tonB gene from colicin sensitive Y. kristensenii Y276 (tonBYK) was cloned into a recombinant E. coli carrying the yiuR gene. Introduction of both genes (yiuR and tonBYK) caused a full colicin susceptibility of originally resistant E. coli (Table 5). This experiment clearly demonstrated that colicin FY recognizes YiuR as a receptor and also that the interaction with TonB protein system is important for colicin lethal effect. The fact that tonB gene was not found in the screening of colicin FY nonsusceptible insertion mutants (in vivo chromosome mutagenesis) could

65 TABLE 6. Differences in amino acid sequences of YiuR external loops

Loops Y. kristensenii Y276 Y. pseudotuberculosis YPIII a (position) (colicin FY susceptible strain) (colicin FY resistant strain) L1 (178-186) QEDSNSGDI ****K**** L2 (213-229) RSEDKIIDGYNEQRLRN ***********Q**M** L3 (253-267) QDRNTTAGRSVALNG **K*S*P**TL**** L4 (290-314) GNSTSYVQRDETRNPSREMKSVDNI ******I**********Q******* L5 (337-359) EELYDEGNQLASAKDLTKLTRGS *****K****P**S**K****W* L6 (383-391) DQDENYGTH ***Q***** L7 (417-450) RSPDLRQATDNWGQITGGK--GDPA **********D***LS**GKG*L** IIVGNSSLKPE L*L***N**** L8 (476-518) TDFKDKITEVRRCTDTTGKASGQCM ***********N*DI**-NTT***V INGNSYKFISDRTNVDKA F**IN*******I***** L9 (544-563) TQSEQKSGQFSGKPLNQMPK ********A*A*Q******* L10 (587-614) RGKTSEYLNRTSIGTTTPSYTFVDL ***A********M*SR********* GAN *** L11 (640-648) NDKVLDGRR ********* a External loops were predicted by Hidden Markov Model method (http://biophysics.biol.uoa.gr/PRED-MBB/). Asterisks denote identical amino acid residues in both proteins . be caused by a decreased viability of Y. kristensenii tonB mutants. Lower viability was previously described for tonB mutated strains of Salmonella and Escherichia (Ferber et al., 1981; Gorbacheva

et al., 2001). Since TonBYK was necessary for the colicin activity, it is clear that TonB protein from

E. coli (TonBEC) was not able to mediate translocation of colicin FY through the bacterial envelope of recombinant E. coli containing functional YiuR receptor. It could be a result of inefficient energizing

of the YiuR protein by TonBEC and/or inefficient interaction between colicin FY and TonBEC. A lack of

cross-complementation in E. coli was previously described for TonB from Y. enterocolitica (TonBYE)

and TonB from S. marcescens (Gaisser and Braun, 1991; Koebnik et al., 1993). TonBYE protein failed

to interact with E. coli receptors and also with colicins (Koebnik et al., 1993). The ability of TonBYE to

complement TonBEC functions was variable and correlated with similarity of the receptor and colicin

TonB boxes to the consensus TonB box sequence. In term of the colicin function, TonBYK facilitated a partial susceptibility of E. coli to colicins B and M, but not to colicins D, Ia, and Ib. Analogously,

TonB EC was not able to mediate translocation of colicin FY, which was adapted to TonB system of yersiniae. Moreover, the sequences of TonB from Y. kristensenii Y276 and E. coli DH10B were analyzed. Both TonB proteins had an overall similarity of only 46% of their amino acid residues (Figure 21). The middle part of TonB was previously described to be an important region for interaction with TonB boxes of colicins and receptors (Brewer et al., 1990; Cadieux and Kadner, 1999; Cadieux et al., 2000; Gaisser and Braun, 1991; Killmann et al., 2002). Q160, a single amino acid residue in this het-

erologous region of TonBEC was proposed to be an important position for colicin activity (Bruske and Heller, 1993). However, the colicin susceptibility of bacteria was lost after deletion of Q160 together with six other amino acid residues around (157SRNQPQY163). In addition, Q160 region could be part of a bigger region that is required for contact with the outer membrane receptor (Vakharia-Rao et al., th 2007). Our comparison showed that TonBYK differs from TonBEC in their 160 position (K instead of

66 FIGURE 21. Comparison of TonB sequences

Sequences of TonB from Y. kristensenii Y276 (AFC36227.1) and E. coli DH10B (YP_001730249.1) were compared using ClustalW method. Amino acid variability is shown in red. The positions are numbered based on

TonB YK. The important position Q160 in TonBEC is indicated by an asterisk.

Q) and that only 3 out of 7 amino acid residues were identical in the 157-163 region. This variability could explain the failure of TonBEC to interact with colicin FY and/or receptor YiuR of E. coli.

TonB box sequences of related colicins (i.e. FY, Ia, and Ib) and their receptors (YiuR and Cir) were 42 48 also analyzed. The N-terminus of colicin FY contained a sequence ( DTMTVTG ) designed as TonB box, which differs from TonB box of colicins Ia and Ib 23( EIMAVDI29). Moreover, the TonB box of YiuR (32DTMVVTA38) was also different in case of Cir protein 6( ETMVVTA12). TonB boxes of the receptor are more conserved (1 variable amino acid residue) than TonB boxes of the analyzed colicins (5 variable amino acid residues) A fact that mutations in TonB box of the receptor can be suppressed by mutations in the Q160 region of TonB protein (Bell et al., 1990; Braun et al., 1991) supported a theory about coevolution of TonB proteins and proteins with TonB box sequence (colicins and outer membrane receptors). In fact, evolution of colicin TonB boxes together with TonB could result in novel colicin types with different spectra of susceptible bacterial strains. The common evolutionary origin of both colicin

FY-YiuR and colicin Ib-Cir systems would support the observed similarity between colicin receptors

(Cir and YiuR), and also similarity of colicins FY to Ib and their immunity proteins, which resulted in partial cross-immunity of colicin FY and colicin Ib producers. The putative colicin of A. nasoniae with a potentially interesting spectrum of activity may be another, yet uncharacterized member of this colicin lineage.

4.8. Comprehensive study of colicin FY activity against Y. enterocolitica Based on both genetic and phenotypic features, Y. enterocolitica is considered a heterogeneous species. Strains of Y. enterocolitica belong to many different serogroups and to six different biotypes. Pathogenicity of Y. enterocolitica strains is tightly related to the corresponding biotype - nonpathogenic biotype 1A, highly pathogenic biotype 1B, and mildly pathogenic biotypes 2 to 5 (Aleksic and Bockemuhl, 1984; Wauters et al., 1987, 1991). Y. enterocolitica is often found in aquatic environments and in various animal reservoirs, taking a swine as a major reservoir of human pathogenic strains. Y. enterocolitica causes human gastrointestinal infections characterized by a broad spectrum of clinical manifestations such as diarrhea, enteritis, enterocolitis, and mesenteric lymphadenitis. Although most of the clinical conditions caused by Y. enterocolitica are self-limiting, yersiniosis can also result in serious complications including reactive arthritis. The most frequently isolated human strains of

67 Y. enterocolitica belong to bioserotypes 1B/O:8, 2/O:5,27, 2/O:9, and 4/O:3. Strains with bioserotype 4/O:3 are the most common and also typical for Europe (Bottone, 1997, 1999; Fredriksson-Ahomaa and Korkeala, 2003; Fredriksson-Ahomaa et al., 2001; Zheng et al., 2008a). In the European Union, yersiniosis is the third most common human alimentary infection, after campylobacteriosis and sal- monellosis. In 2010, EU confirmed 6776 human cases of yersiniosis and 91% of them were caused by Y. enterocolitica (European Food Safety Authority, European Centre for Disease Prevention and Control, 2012).

Pilot analysis of the activity spectrum of colicin FY showed that Y. enterocolitica is broadly suscep-

tible to colicin FY, as all 19 tested strains were susceptible to colicin FY. To exclude clonal character of 19 yersinia isolates and to confirm this remarkable susceptibility of Y. enterocolitica strains to

colicin FY, a comprehensive set of Y. enterocolitica isolates was analyzed for susceptibility to colicin FY.

4.8.1. Characterization of Y. enterocolitica isolates

One hundred and ten isolates of Y. enterocolitica were collected from different geographical areas with the majority of isolates coming from Europe. Several other strains were originally isolated in other parts of the world (e.g. Japan, China, New Zealand, Australia, South Africa, Brazil, and USA). Although Y. enterocolitica isolates originated mainly from human clinical material, veterinary and environmental samples were also included (Table S2). To exclude the possibility that the tested Y. enterocolitica strains represented multiple identical strains, further characterization of these isolates was performed including analysis of the 16S rRNA genes, serotyping, biotyping, restriction profiling of genomic DNA, detection of virulence markers, and susceptibility to antibiotics (Table S2). Sequence analysis of the 16S rRNA coding DNA confirmed that all 110 tested isolates belonged to Y. enterocolitica species. Moreover, sequencing was used to classify yersinia isolates into subspecies; 108 isolates were identified as Y. enterocolitica subsp. palearctica and 2 isolates as Y. enterocolitica subsp. enterocolitica (Figure 22a). Within the yersinia isolates, 7 serogroups and all six biotypes were present (Figure 22b,c). Sero- types O:3, O:5,27, O:8, and O:9, which are common serotypes for human pathogenic strains, were also included in our strain collection. In addition, several atypical serotypes (e.g. O:6,30 and O:36) were present. Y. enterocolitica subsp. palearctica bioserotype 4/O:3 was the most frequent type (77% of isolates), which is in accordance with its worldwide distribution (Batzilla et al., 2011; Bissett et al., 1990; Bottone, 1999; European Food Safety Authority, European Centre for Disease Prevention and Control, 2012; Rahman et al., 2011). Genetic variability of Y. enterocolitica isolates was determined based on their restriction profiles. At the 85% similarity level, 41 various pulsotypes were identified. Moreover, 24 different pulsotypes were found within the most abundant bioserotype 4/O:3 subgroup (Figure 23). Altogether, restriction analysis of the genomic DNA confirmed a high genetic variability of nonhuman isolates and a relatively subtle variability within the 4/O:3 subgroup. Similar results have also been described by other authors (Asplund et al., 1998; Iteman et al., 1996; Najdenski et al., 1994; Saken et al., 1994). Using PCR detection of three virulence markers, the pathogenic potential of yersinia isolates was analyzed (Table S2; Figure 22d). Two virulence markers (ail and ystA) are coded chromosomally and one is a plasmid-encoded virulence marker (virF). All three determinants were identified in 52 isolates (47%) and only four isolates were negative for all tested markers. In contrast to the chromosomal genes, which were detected in more than 90% of isolates (91% and 96% for ail and ystA, respectively), virF was found in only 50% of Y. enterocolitica isolates. The lower frequency of virF was probably related to previous laboratory maintenance of Y. enterocolitica isolates. The virulence

68 FIGURE 22. Characterization of 110 Y. enterocolitica isolates

(A) Analysis of 16S rRNA. The incidence of subspecies palearctica was significantly higher than of the subspecies enterocolitica. (B) Serotyping. Four pathogenic serotypes were found among the isolates, with the highest incidence of serotype O:3. (C) Bioserotyping. All six known biotypes were found among the isolates, with the highest incidence of biotype 4. (D) Detection of three virulence markers. Isolates could be considered to be potentially pathogenic. (E) Antibiotic susceptibility of isolates to 14 antibiotics. With the exception of ampicilin and cephalo- tin, isolates were susceptible to antibiotics.

69 TABLE 7. Antibiotic susceptibility of Y. enterocolitica isolates Intermediate Susceptibility No. of iso- Antibiogram Resistance susceptibility lates DO, CXM, CIP, SXT, OA, CN, CTX, CAZ, A1 AMP, KF - 51 AMC, ATM, C, CT DO, CIP, SXT, OA, CN, CTX, CAZ, AMC, A2 AMP, KF CXM 16 ATM, C, CT DO, CXM, CIP, SXT, OA, CN, CTX, CAZ, A3 AMP, KF AMC 13 ATM, C, CT DO, CXM, CIP, SXT, OA, CN, CTX, CAZ, A4 AMP, KF, AMC - 5 ATM, C, CT DO, CXM, CIP, SXT, OA, CN, CTX, CAZ, A5 AMP KF 4 AMC, ATM, C, CT CXM, CIP, SXT, OA, CN, CTX, CAZ, A6 AMP, KF, DO - 2 AMC, ATM, C, CT DO, CIP, SXT, OA, CN, CTX, CAZ, ATM, A7 AMP, KF, AMC CXM 2 C, CT DO, CIP, SXT, OA, CN, CTX, CAZ, ATM, A8 AMP, KF AMC, CXM 2 C, CT DO, CXM, CIP, CN, CTX, CAZ, AMC, A9 AMP, KF, OA, C SXT 2 ATM, CT DO, CXM, CIP, SXT, CN, CTX, CAZ, A10 AMP, KF, OA, C - 2 AMC, ATM, CT DO, CXM, CIP, SXT, OA, CTX, CAZ, A11 AMP, KF CN 2 AMC, ATM, C, CT CXM, CIP, CN, CTX, CAZ, AMC, ATM, A12 AMP, KF, OA, C DO, SXT 1 CT DO, CIP, SXT, OA, CN, CTX, CAZ, AMC, A13 AMP, KF, C CXM 1 ATM, CT DO, CIP, SXT, OA, CTX, CAZ, AMC, A14 AMP, KF CXM, CN 1 ATM, C, CT DO, CXM, CIP, SXT, OA, CN, CTX, CAZ, A15 - AMP, KF 1 AMC, ATM, C, CT KF, DO, CXM, CIP, SXT, OA, CN, CTX, A16 AMP - 1 CAZ, AMC, ATM, C, CT DO, CXM, CIP, SXT, OA, CN, CTX, CAZ, A17 KF AMP, AMC 1 ATM, C, CT AMP, KF, DO, CXM, CIP, SXT, OA, CN, A18 - - 1 CTX, CAZ, AMC, ATM, C, CT AMP, DO, CXM, CIP, SXT, OA, CN, CTX, A19 KF - 1 CAZ, AMC, ATM, C, CT DO, CXM, CIP, OA, CN, CTX, CAZ, A20 AMP, KF, C SXT 1 AMC, ATM, CT

Isolates belonging to individual antibiograms are shown in Figure 23 and Table S2. Antibiotic abbreviations: ampicillin (AMP), cephalothin (KF), doxycycline (DO), cefuroxime (CXM), ciprofloxacin (CIP), sulfamethoxazole-trimethoprim (SXT), oxolinic acid (OA), gentamicin (CN), cefotaxime (CTX), ceftazidime (CAZ), amoxicillin with clavulanic acid (AMC), aztreonam (ATM), chloramphenicol (C), and colistin sulphate (CT)

70 FIGURE 23. Dendrogram of 110 Y. enterocolitica isolates

Similarities (%) between the restriction patterns (left) were calculated using the Dice’s index and are shown as the numbers close to the nodes. The data were sorted using the UPGMA method. Susceptibility to colicin YF is shown in the right panel, followed by additional strain characteristics. Colicin FY titers (middle) are shown as the exponent of the highest four-fold dilution causing clear (light grey) and turbid (dark grey) zones of inhibition. *Serotypes O:1 and O:2 were combined to O:3 serotype according to Aleksic and Bockemuhl (1984). The lines on the right side show isolates with the same characteristics, being presumably identical strains. 71 plasmid encoding virF gene (pYV) is unstable and therefore, a repeated transfer of Y. enterocolitica cultures, extended storage at 4 °C, other laboratory manipulations, as well as subcultivation at 37 °C could have resulted in the plasmid loss (Bhaduri and Smith, 2011). Taken together, almost all tested isolates can be considered to be potentially pathogenic isolates of Y. enterocolitica (Fàbrega and Vila, 2012; Simonova et al., 2007; Zheng et al., 2008b). Since the analyzed isolates were considered as potentially pathogenic, susceptibility of isolates to antibiotics was determined. Moreover, yersiniae were classified to various ATBtypes based on the obtained antibiograms. All tested isolates were susceptible to ciprofloxacin, cefotaxime, ceftazidime, aztreonam, and colistin sulphate. In addition to these antibiotics, more than 90% of isolates were susceptible to doxycycline, sulfamethoxazole-trimethoprim, oxolinic acid, gentamicin, and chloramphenicol. In many isolates, partial resistance to cefuroxime and amoxicillin with clavulanic acid was found. Less than 10% of strains were susceptible to ampicillin and cephalothin. With the exception of two beta-lactams, Y. enterocolitica isolates were susceptible to the tested antibiotics (Figure 22e), a situation that has been described many times (Stock and Wiedemann, 1999; Zheng et al., 2008b). In addition, the antibiogram A1 was the most frequent, as it was identified in 46% of isolates. Altogether, twenty different antibiograms were found (Table 7). Thus, additional heterogeneity of Y. enterocolitica isolates was observed. Using the above described typing techniques (i.e. determination of subspecies, serotypes, biotypes, pulsotypes, potential pathogenicity, and ATBtypes), 77 different Y. enterocolitica strains were identified in our collection, from which 59 strains were represented by a single isolate, while the other 18 strains contained more than one isolate with identical characteristics (Figure 23). The clonal character was observed mainly in isolates collected from the University Hospital Brno (Czech Republic).

4.8.2. Susceptibility of Y. enterocolitica to colicin FY

Colicin FY producers, Y. frederiksenii Y27601 and the recombinant strain of E. coli producing coli-

cin FY, inhibited growth of all tested Y. enterocolitica isolates. Moreover, all Y. enterocolitica isolates were also susceptible to purified His-tagged colicin YF . Four-fold serial dilutions of the purified colicin were used for quantification of susceptibility. The susceptibility of individual isolates (shown as a colicin titer in A.U.) varied from 64 to 1,024 and from 256 to 65,536 for clear and turbid zones

of growth inhibition, respectively (Table S2). Distribution of the colicin FY susceptibility among

Y. enterocolitica is shown in Figure 24. The susceptibility of Y. enterocolitica isolates to colicin FY

resembled normal distribution. No obvious association between colicin FY susceptibility and other strain parameters was found, which indicates that colicin susceptibility is independent of other strain

characteristics. Slightly higher colicin FY susceptibility of subsp. enterocolitica compared to subsp. palearctica could be explained by 20 amino acid differences in the sequences of YiuR between both subspecies of Y. enterocolitica (data not shown). However, other explanations for the difference of susceptibility (e.g. differences in proteins of translocation system) cannot be excluded.

The activity of colicin FY against all 110 isolates is unique in terms of the universal inhibition of a broad spectrum of Y. enterocolitica strains. In fact, bacterial resistance to bacteriocins is considered to be a successful strategy in antimicrobial competition (Kerr et al., 2002; Nahum et al., 2011; Riley and Gordon, 1999). It has been shown that around 75% of E. coli strains isolated from different source populations are resistant to one or more bacteriocin types (Feldgarden and Riley, 1998; Gordon et al., 1998). In case of Y. enterocolitica resistance to bacteriocins, a well-characterized bacteriocin produced by Y. enterocolitica (enterocoliticin) inhibited pathogenic serotypes O:3, O:5,27, and O:9, but not serotype O:8 and various nonpathogenic strains (biotype 1A) (Strauch et al., 2001). In addition,

72 FIGURE 24. Distribution of the colicin FY susceptibility among Y. enterocolitica isolates

Colicin FY susceptibility is shown as colicin titer representing the highest dilution causing a detectable growth inhibition (last turbid zone). The susceptibility to colicin FY ranged from 256 to 65,536 A.U. Half of the Y. enterocolitica isolates showed susceptibility corresponding to titer of 4,096 A.U. resistance to bacteriocin-like substances produced by yersiniae was also found among Y. enterocolitica strains (Calvo et al., 1986). On the other hand, an uncharacterized bacteriocin from Y. kristensenii inhibited all 35 tested strains of Y. enterocolitica (Toora, 1995a, 1995b; Toora et al., 1994); however, it is not known whether this uncharacterized bacteriocin is in fact colicin FY.

Although the reason for the universal susceptibility of Y. enterocolitica to colicin FY is unknown, it can be speculated that this could be a result of a clonal character of isolates and/or the essential character of the YiuR receptor for yersiniae. However, both explanations appear unlikely, since clonality of Y. enterocolitica is obvious only in pathogenic isolates of serotype O:3, while nonpathogenic isolates of biotype 1A are heterogeneous (Bhaduri et al., 2009; Sihvonen et al., 2012). Furthermore, yersiniae possess several iron uptake systems, from which yiu-mediated transport is not the first in iron uptake hierarchy (Kirillina et al., 2006). Another possible explanation for the universal activity of colicin FY against Y. enterocolitica involves the close relationship between Y. enterocolitica and colicin

FY producers, with little or no contact between them. A phylogenetic analysis indicated that Y. enterocolitica was clearly related to other environmental enterocolitica-like species including Y. frederiksenii (Chen et al., 2010; Reuter et al., 2012). In addition, contact between the two bacterial species appears to be quite rare despite the sporadic co-occurrence of both species (Greenwood and Hooper, 1987; Shayegani et al., 1981; Soltan-Dallal and Moezardalan, 2004). The separation of Y. enterocolitica strains from the environmental colicin FY-producers could explain the absence of colicin FY resistant mutants among Y. enterocolitica strains. In addition, environmental yersiniae (e.g. Y. frederiksenii and Y. kristensenii) that live in the same environment as colicin producers contain both colicin FY resistant and susceptible strains (Figure 11b). Colicin FY resistant Y. enterocolitica colonies were indeed induced in the presence of colicin FY in laboratory conditions (data not shown).

73 TABLE 8: Inhibitory spectrum of eleven pore-forming colicins

Colicin activitya Species U Y K L A B Ia E1 S4 5 FY Escherichia coli 5K (control) 4 4 4 2 2 5 1 5 4 5 4b Escherichia coli B688 1 1 - - - - 4 1 - - - Escherichia fergusonii 17 2 2 - - - 3 3 5 - 2 - Escherichia hermanii 110 8 1 1 1 ------Escherichia vulneris 113 3 0 0 - - - - - 2 - - - Yersinia enterocolitica YE1 ------4 Yersinia kristensenii Y276 ------4 Yersinia pseudotuberculosis YP11 ------Citrobacter youngae 479 ------Citrobacter braakii B718 ------Citrobacter freundii B607 ------Shigella sonnei 17 2 2 3 1 1 3 3 3 2 4 - Shigella flexneri Brazilie 1 1 ------Shigella boydii U1 - - - - - 0 - - 2 0 - Enterobacter cloaceae B604 ------Enterobacter aerogenes 1382 ------Klebsiella pneumonie B615 ------Klebsiella oxytoca B632 ------Budvicia aquatica 24510 ------Leclercia adecarboxylata 2666 ------Kluywera ascorbata B792 ------Morganella morganii B619 ------Pragia fontium 24613 ------Proteus vulgaris B635 ------Salmonella serovar 1 B753 ------Serratia ficaria B779 ------0 - - -

a Numbers indicate the highest colicin dilution causing a turbid zone, e.g. 2 = 102. - = non susceptible b Y. enterocolitica was used as a positive control for the colicin FY activity.

4.9. Colicin FY activity spectrum outside the genus Yersinia

After a detailed characterization of colicin FY activity spectrum among yersiniae, colicin FY susceptibility was further analyzed outside the genus Yersinia. A single strain from each of 25 different bacterial species belonging to 14 genera (including Yersinia sp.) of the family Enterobacteriaceae were tested by colicin activity assay. For comparison of the colicin activity spectra, susceptibility to several other pore-forming colicins (i.e. colicin A, B, E1, Ia, S4, K, L, 5, U, and Y) was also tested (Table 8).

All strains outside the genus Yersinia were unsusceptible to colicin FY, which confirmed our sugges-

74 Figure 25. Susceptibility of genus Escherichia to pore-forming colicins

118 strains from the genus Escherichia was tested for susceptibility to eleven pore-forming colicins using colicin activity assay. No strain was inhibited by colicin FY (*).

tion that colicin FY is strictly a yersinia-specific toxin. In contrast, most of the other colicins were active only against strains belonging to the genera Escherichia or Shigella. Colicin E1 was active also against a strain of the genus Serratia. The widest activity spectra were found for colicins U, Y, and E1. Escherichia coli is an important part of the human gut microbiota, thus the observed nonsusceptibility of genus Escherichia to colicin FY was analyzed on a greater set of strains including E. coli (39 strains), E. fergusonii (10 strains), E. vulneris (27 strains), and E. hermanii (42 strains) (Table S3). Not a single strain out of 118 tested escherichiae was susceptible to colicin FY (Figure 25). On the other hand, susceptibility to other colicin ranged up to 80% of isolates, which supports the idea of the bacteriocin resistance being a common bacterial strategy (see part 3.9). The obtained data are in agreement with the hypothesis classifying E. fergusonii as a subgroup of E. coli and that two other species (E. hermanii and E. vulneris) are more related to Citrobacter sp. or Enterobacter sp. than the

Escherichia sp. (Lawrence et al., 1991). Taken together, the activity spectrum of colicin FY outside the genus Yersinia is an additional example of the uniqueness of colicin FY among other colicins, since all 136 strains, from which 118 were from the genus Escherichia, were not susceptible to colicin FY.

4.10. Therapeutic potential of colicin FY Infections caused by Y. enterocolitica range from self-limited enteritis to life‑threatening systemic infections. The most frequent manifestation of yersiniosis is diarrhea, mainly affecting children. In young people and adults, yersiniosis can be misdiagnosed as appendicitis because of right-sided abdominal pain and fever (Antonopoulos et al., 2008; Bottone, 1997; Center for Disease Control and Prevention, 2010; Gray et al., 2001; Lee et al., 1990, 1991; Marks et al., 1980; Marriott et al., 1985; Ray et al., 2004). Although antibiotic treatment is recommended for serious cases, the benefits of antibiotic therapy in uncomplicated cases is not well established (Abdel-Haq et al., 2000; Bottone, 1999;

75 Hoogkamp-Korstanje and Stolk-Engelaar, 1995; Pai et al., 1984). Instead, rehydration and use of probiotics are often suggested for simple diarrheal cases. There is an increasing interest in nonpathogenic microorganisms and their antimicrobial substances that naturally antagonize pathogenic agents. To date, several nonpathogenic E. coli strains have been used as probiotics (e.g. E. coli Nissle 1917; (Lodinová-Žádníková and Sonnenborn, 1997)). Although the role of bacteriocin synthesis in strains of probiotic bacteria is not known, production of bacteriocins is a common feature of many probiotic strains (Cursino et al., 2006; Patzer et al., 2003;

Wooley et al., 1999). It is therefore tempting to speculate that synthesis of colicin FY could represent an important feature of recombinant probiotic E. coli strains used in cases of diarrhea caused by yer-

siniae. However, the effect of colicin YF synthesis should be tested using in vivo experiments to see whether colicin FY has therapeutic potential relative to intestinal yersiniosis. The universal suscepti-

bility of Y. enterocolitica to colicin FY together with absence of activity on strains outside the genus

Yersinia suggests a potential therapeutic application of colicin FY.

76 5. SUMMARY

In a set of Yersinia strains, a novel bacteriocin - colicin FY - produced by Yersinia frederiksenii 27601 was identified. The colicinogenic plasmid pYF27601 (5574 bp) was sequenced and two colicin genes were identified: the colicin YF activity gene (cfyA) and the immunity gene (cfyI). The analysis of deduced amino acid sequence of colicin FY revealed high similarity to colicin Ib. Colicin FY (54 kDa) was purified and was shown to form a distinct voltage-dependent pore. Transposon mutagenesis of susceptible strain Yersinia kristensenii Y276 revealed yiuR gene

(ykris0001_4440) as the colicin FY receptor molecule. YiuR, an outer membrane protein with predicted siderophore binding function, is similar to Cir protein of Escherichia coli, which is a receptor for colicin Ib. The receptor specificity was confirmed by a successful complementation of resistant strains. Moreover, complementation in E. coli showed importance of TonB protein for the colicin activity; thus, colicin FY belongs to group B colicins - colicins that use TonB, ExbB, and ExbD proteins to translocate through the bacterial envelope.

Colicin FY activity spectrum comprises strains of the genus Yersinia, especially strains of Y. enterocolitica. In fact, a single resistant strain was not found among a broad spectrum of tested Y. enterocolitica strains. The universal susceptibility of Y. enterocolitica to colicin FY together with absence of activity on strains outside the genus Yersinia suggests a potential therapeutic application of colicin

FY. The future follow-up of this study will therefore focus on the probiotic potential of colicin FY in vivo.

77 78 6. BIBLIOGRAPHY

Abbott, J.D., and Graham, J.M. (1961). Colicine typing of Shigella sonnei. Mon. Bull. Minist. Health Public Health Lab. Serv. 20, 51–58.

Abdel-Haq, N.M., Asmar, B.I., Abuhammour, W.M., and Brown, W.J. (2000). Yersinia enterocolitica infection in children. Pediatr. Infect. Dis. J. 19, 954–958.

Abergel, C., Bouveret, E., Claverie, J.M., Brown, K., Rigal, A., Lazdunski, C., and Benedetti, H. (1999). Structure of the Escherichia coli TolB protein determined by MAD methods at 1.95 A resolution. Struct. Lond. Engl. 1993 7, 1291– 1300.

Akutsu, A., Masaki, H., and Ohta, T. (1989). Molecular structure and immunity specificity of colicin E6, an evolutionary intermediate between E-group colicins and cloacin DF13. J. Bacteriol. 171, 6430–6436.

Aleksic, S., and Bockemuhl, J. (1984). Proposed revision of the Wauters et al. antigenic scheme for serotyping of Yersinia enterocolitica. J. Clin. Microbiol. 20, 99–102.

Altieri, M., Suit, J.L., Fan, M.L., and Luria, S.E. (1986). Expression of the cloned ColE1 kil gene in normal and Kilr Escherichia coli. J. Bacteriol. 168, 648–654.

Antonopoulos, P., Constantinidis, F., Charalampopoulos, G., Dalamarinis, K., Karanicas, I., and Kokkini, G. (2008). An emergency diagnostic dilemma: a case of Yersinia enterocolitica colitis mimicking acute appendicitis in a beta- thalassemia major patient: the role of CT and literature review. Emerg. Radiol. 15, 123–126.

Arnold, T., Zeth, K., and Linke, D. (2009). Structure and Function of Colicin S4, a Colicin with a Duplicated Receptor- binding Domain. J. Biol. Chem. 284, 6403–6413.

Asplund, K., Johansson, T., and Siitonen, A. (1998). Evaluation of pulsed-field gel electrophoresis of genomic restriction fragments in the discrimination of Yersinia enterocolitica O:3. Epidemiol. Infect. 121, 579–586.

Baboolal, T.G., Conroy, M.J., Gill, K., Ridley, H., Visudtiphole, V., Bullough, P.A., and Lakey, J.H. (2008). Colicin N binds to the periphery of its receptor and translocator, outer membrane protein F. Struct. Lond. Engl. 1993 16, 371–379.

Bagos, P.G., Liakopoulos, T.D., Spyropoulos, I.C., and Hamodrakas, S.J. (2004a). A Hidden Markov Model method, capable of predicting and discriminating beta-barrel outer membrane proteins. BMC Bioinformatics 5, 29.

Bagos, P.G., Liakopoulos, T.D., Spyropoulos, I.C., and Hamodrakas, S.J. (2004b). A Hidden Markov Model method, capable of predicting and discriminating beta-barrel outer membrane proteins. BMC Bioinformatics 5, 29.

Barnéoud-Arnoulet, A., Gavioli, M., Lloubès, R., and Cascales, E. (2010). Interaction of the colicin K bactericidal toxin with components of its import machinery in the periplasm of Escherichia coli. J. Bacteriol. 192, 5934–5942.

Baty, D., Lakey, J., Pattus, F., and Lazdunski, C. (1990). A 136-amino-acid-residue COOH-terminal fragment of colicin A is endowed with ionophoric activity. Eur. J. Biochem. FEBS 189, 409–413.

79 Batzilla, J., Antonenka, U., Höper, D., Heesemann, J., and Rakin, A. (2011). Yersinia enterocolitica palearctica serobiotype O:3/4 - a successful group of emerging zoonotic pathogens. BMC Genomics 12, 348.

Bazaral, M., and Helinski, D.R. (1968). Circular DNA forms of colicinogenic factors E1, E2 and E3 from Escherichia coli. J. Mol. Biol. 36, 185–194.

Bell, P.E., Nau, C.D., Brown, J.T., Konisky, J., and Kadner, R.J. (1990). Genetic suppression demonstrates interaction of TonB protein with outer membrane transport proteins in Escherichia coli. J. Bacteriol. 172, 3826–3829.

Benedetti, H., Frenette, M., Baty, D., Knibiehler, M., Pattus, F., and Lazdunski, C. (1991). Individual domains of colicins confer specificity in colicin uptake, in pore-properties and in immunity requirement. J. Mol. Biol. 217, 429–439.

Benedetti, H., Lloubès, R., Lazdunski, C., and Letellier, L. (1992). Colicin A unfolds during its translocation in Escherichia coli cells and spans the whole cell envelope when its pore has formed. EMBO J. 11, 441–447.

Bhaduri, S., and Smith, J.L. (2011). Virulence Plasmid (pYV)-Associated Expression of Phenotypic Virulent Determinants in Pathogenic Yersinia Species: A Convenient Method for Monitoring the Presence of pYV under Culture Conditions and Its Application for Isolation/Detection of Yersinia pestis in Food. J. Pathog. 2011, 727313.

Bhaduri, S., Wesley, I., Richards, H., Draughon, A., and Wallace, M. (2009). Clonality and antibiotic susceptibility of Yersinia enterocolitica isolated from U.S. market weight hogs. Foodborne Pathog. Dis. 6, 351–356.

Bissett, M.L., Powers, C., Abbott, S.L., and Janda, J.M. (1990). Epidemiologic investigations of Yersinia enterocolitica and related species: sources, frequency, and serogroup distribution. J. Clin. Microbiol. 28, 910–912.

Bonsor, D.A., Grishkovskaya, I., Dodson, E.J., and Kleanthous, C. (2007). Molecular mimicry enables competitive recruitment by a natively disordered protein. J. Am. Chem. Soc. 129, 4800–4807.

Bonsor, D.A., Hecht, O., Vankemmelbeke, M., Sharma, A., Krachler, A.M., Housden, N.G., Lilly, K.J., James, R., Moore, G.R., and Kleanthous, C. (2009). Allosteric beta-propeller signalling in TolB and its manipulation by translocating colicins. EMBO J. 28, 2846–2857.

Bottone, E.J. (1997). Yersinia enterocolitica: the charisma continues. Clin. Microbiol. Rev. 10, 257–276.

Bottone, E.J. (1999). Yersinia enterocolitica: overview and epidemiologic correlates. Microbes Infect. Inst. Pasteur 1, 323–333.

Bottone, E.J., Sandhu, K.K., and Pisano, M.A. (1979). Yersinia intermedia: temperature-dependent bacteriocin production. J. Clin. Microbiol. 10, 433–436.

Bouveret, E., Derouiche, R., Rigal, A., Lloubès, R., Lazdunski, C., and Benedetti, H. (1995). Peptidoglycan-associated lipoprotein-TolB interaction. A possible key to explaining the formation of contact sites between the inner and outer membranes of Escherichia coli. J. Biol. Chem. 270, 11071–11077.

Bouveret, E., Rigal, A., Lazdunski, C., and Benedetti, H. (1997). The N-terminal domain of colicin E3 interacts with TolB which is involved in the colicin translocation step. Mol. Microbiol. 23, 909–920.

80 Bouveret, E., Rigal, A., Lazdunski, C., and Benedetti, H. (1998). Distinct regions of the colicin A translocation domain are involved in the interaction with TolA and TolB proteins upon import into Escherichia coli. Mol. Microbiol. 27, 143– 157.

Bowman, C.M., Dahlberg, J.E., Ikemura, T., Konisky, J., and Nomura, M. (1971). Specific inactivation of 16S ribosomal RNA induced by colicin E3 in vivo. Proc. Natl. Acad. Sci. U. S. A. 68, 964–968.

Braun, V., and Herrmann, C. (1993a). Evolutionary relationship of uptake systems for biopolymers in Escherichia coli: cross-complementation between the TonB-ExbB-ExbD and the TolA-TolQ-TolR proteins. Mol. Microbiol. 8, 261–268.

Braun, V., and Herrmann, C. (1993b). Evolutionary relationship of uptake systems for biopolymers in Escherichia coli: cross-complementation between the TonB-ExbB-ExbD and the TolA-TolQ-TolR proteins. Mol. Microbiol. 8, 261–268.

Braun, V., Günter, K., and Hantke, K. (1991). Transport of iron across the outer membrane. Biol. Met. 4, 14–22.

Braun, V., Patzer, S.I., and Hantke, K. (2002). Ton-dependent colicins and microcins: modular design and evolution. Biochimie 84, 365–380.

Brewer, S., Tolley, M., Trayer, I.P., Barr, G.C., Dorman, C.J., Hannavy, K., Higgins, C.F., Evans, J.S., Levine, B.A., and Wormald, M.R. (1990). Structure and function of X-Pro dipeptide repeats in the TonB proteins of Salmonella typhimurium and Escherichia coli. J. Mol. Biol. 216, 883–895.

Bruske, A.K., and Heller, K.J. (1993). Molecular characterization of the Enterobacter aerogenes tonB gene: identification of a novel type of tonB box suppressor mutant. J. Bacteriol. 175, 6158–6168.

Buchanan, S.K., Lukacik, P., Grizot, S., Ghirlando, R., Ali, M.M.U., Barnard, T.J., Jakes, K.S., Kienker, P.K., and Esser, L. (2007). Structure of colicin I receptor bound to the R-domain of colicin Ia: implications for protein import. EMBO J. 26, 2594–2604.

Bullock, J.O., Kolen, E.R., and Shear, J.L. (1992). Ion selectivity of colicin E1: II. Permeability to organic cations. J. Membr. Biol. 128, 1–16.

Butala, M., Zgur-Bertok, D., and Busby, S.J.W. (2009). The bacterial LexA transcriptional repressor. Cell. Mol. Life Sci. CMLS 66, 82–93.

Cadieux, N., and Kadner, R.J. (1999). Site-directed disulfide bonding reveals an interaction site between energy-coupling protein TonB and BtuB, the outer membrane cobalamin transporter. Proc. Natl. Acad. Sci. U. S. A. 96, 10673–10678.

Cadieux, N., Bradbeer, C., and Kadner, R.J. (2000). Sequence Changes in the Ton Box Region of BtuB Affect Its Transport Activities and Interaction with TonB Protein. J. Bacteriol. 182, 5954–5961.

Cadieux, N., Phan, P.G., Cafiso, D.S., and Kadner, R.J. (2003). Differential substrate-induced signaling through the TonB-dependent transporter BtuB. Proc. Natl. Acad. Sci. U. S. A. 100, 10688–10693.

Calvo, C., Brault, J., Ramos-Cormenzana, A., and Mollaret, H.H. (1986). Production of bacteriocin-like substances by Yersinia frederiksenii, Y. kristensenii, and Y. intermedia strains. Folia Microbiol. (Praha) 31, 177–186.

81 Cao, Z., and Klebba, P.E. (2002). Mechanisms of colicin binding and transport through outer membrane porins. Biochimie 84, 399–412.

Cascales, E., Lloubès, R., and Sturgis, J.N. (2001). The TolQ-TolR proteins energize TolA and share homologies with the flagellar motor proteins MotA-MotB. Mol. Microbiol. 42, 795–807.

Cascales, E., Buchanan, S.K., Duché, D., Kleanthous, C., Lloubès, R., Postle, K., Riley, M., Slatin, S., and Cavard, D. (2007). Colicin biology. Microbiol. Mol. Biol. Rev. MMBR 71, 158–229.

Cavard, D. (2004). Role of Cal, the colicin A lysis protein, in two steps of colicin A release and in the interaction with colicin A-porin complexes. Microbiol. Read. Engl. 150, 3867–3875.

Cavard, D., Lloubès, R., Morlon, J., Chartier, M., and Lazdunski, C. (1985). Lysis protein encoded by plasmid ColA- CA31. Gene sequence and export. Mol. Gen. Genet. MGG 199, 95–100.

Cavard, D., Baty, D., Howard, S.P., Verheij, H.M., and Lazdunski, C. (1987). Lipoprotein nature of the colicin A lysis protein: effect of amino acid substitutions at the site of modification and processing. J. Bacteriol. 169, 2187–2194.

Center for Disease Control and Prevention (2010). Preliminary FoodNet data on the incidence of infection with pathogens transmitted commonly through food - 10 states, 2009. MMWR Morb. Mortal. Wkly. Rep. 59, 418–422.

Chak, K.F., and James, R. (1986). Characterization of the ColE9-J plasmid and analysis of its genetic organization. J. Gen. Microbiol. 132, 61–70.

Chak, K.F., Kuo, W.S., Lu, F.M., and James, R. (1991). Cloning and characterization of the ColE7 plasmid. J. Gen. Microbiol. 137, 91–100.

Chan, P.T., Ohmori, H., Tomizawa, J., and Lebowitz, J. (1985). Nucleotide sequence and gene organization of ColE1 DNA. J. Biol. Chem. 260, 8925–8935.

Chauleau, M., Mora, L., Serba, J., and de Zamaroczy, M. (2011). FtsH-dependent processing of RNase colicins D and E3 means that only the cytotoxic domains are imported into the cytoplasm. J. Biol. Chem. 286, 29397–29407.

Chen, P.E., Cook, C., Stewart, A.C., Nagarajan, N., Sommer, D.D., Pop, M., Thomason, B., Thomason, M.P., Lentz, S., Nolan, N., et al. (2010). Genomic characterization of the Yersinia genus. Genome Biol. 11, R1.

Chimento, D.P., Kadner, R.J., and Wiener, M.C. (2005). Comparative structural analysis of TonB-dependent outer membrane transporters: implications for the transport cycle. Proteins 59, 240–251.

Christenson, J.K., and Gordon, D.M. (2009). Evolution of colicin BM plasmids: the loss of the colicin B activity gene. Microbiol. Read. Engl. 155, 1645–1655.

Clifton, L.A., Johnson, C.L., Solovyova, A.S., Callow, P., Weiss, K.L., Ridley, H., Le Brun, A.P., Kinane, C.J., Webster, J.R.P., Holt, S.A., et al. (2012). Low resolution structure and dynamics of a colicin-receptor complex determined by neutron scattering. J. Biol. Chem. 287, 337–346.

82 Clinical and Laboratory Standards Institute (2012). Performance standards for antimicrobial disk susceptibility tests; Approved standard - Eleventh edition. (Wayne, Pa: Clinical and Laboratory Standards Institute),.

Cole, S.T., Saint-Joanis, B., and Pugsley, A.P. (1985). Molecular characterisation of the colicin E2 operon and identification of its products. Mol. Gen. Genet. MGG 198, 465–472.

Confer, A.W., and Ayalew, S. (2013). The OmpA family of proteins: roles in bacterial pathogenesis and immunity. Vet. Microbiol. 163, 207–222.

Cooper, P.C., and James, R. (1984). Two new E colicins, E8 and E9, produced by a strain of Escherichia coli. J. Gen. Microbiol. 130, 209–215.

Cotter, P.D., Hill, C., and Ross, R.P. (2005). Bacterial lantibiotics: strategies to improve therapeutic potential. Curr. Protein Pept. Sci. 6, 61–75.

Cowan, S.W., Schirmer, T., Rummel, G., Steiert, M., Ghosh, R., Pauptit, R.A., Jansonius, J.N., and Rosenbusch, J.P. (1992). Crystal structures explain functional properties of two E. coli porins. Nature 358, 727–733.

Cukrowska, B., Lodinová-Žádníková, R., Enders, C., Sonnenborn, U., Schulze, J., and Tlaskalová-Hogenová, H. (2002). Specific proliferative and antibody responses of premature infants to intestinal colonization with nonpathogenic probiotic E. coli strain Nissle 1917. Scand. J. Immunol. 55, 204–209.

Cursino, L., Šmajs, D., Šmarda, J., Nardi, R.M.D., Nicoli, J.R., Chartone-Souza, E., and Nascimento, A.M.A. (2006). Exoproducts of the Escherichia coli strain H22 inhibiting some enteric pathogens both in vitro and in vivo. J. Appl. Microbiol. 100, 821–829.

Darby, A.C., Choi, J.-H., Wilkes, T., Hughes, M.A., Werren, J.H., Hurst, G.D.D., and Colbourne, J.K. (2010). Characteristics of the genome of Arsenophonus nasoniae, son-killer bacterium of the wasp Nasonia. Insect Mol. Biol. 19 Suppl 1, 75–89.

Davies, J.K., and Reeves, P. (1975a). Genetics of resistance to colicins in Escherichia coli K-12: cross-resistance among colicins of group B. J. Bacteriol. 123, 96–101.

Davies, J.K., and Reeves, P. (1975b). Genetics of resistance to colicins in Escherichia coli K-12: cross-resistance among colicins of group A. J. Bacteriol. 123, 102–117.

Del Solar, G., Giraldo, R., Ruiz-Echevarría, M.J., Espinosa, M., and Díaz-Orejas, R. (1998). Replication and control of circular bacterial plasmids. Microbiol. Mol. Biol. Rev. MMBR 62, 434–464.

Delcher, A.L., Harmon, D., Kasif, S., White, O., and Salzberg, S.L. (1999). Improved microbial gene identification with GLIMMER. Nucleic Acids Res. 27, 4636–4641.

Demeshkina, N., Jenner, L., Westhof, E., Yusupov, M., and Yusupova, G. (2012). A new understanding of the decoding principle on the ribosome. Nature 484, 256–259.

Derouiche, R., Bénédetti, H., Lazzaroni, J.C., Lazdunski, C., and Lloubès, R. (1995). Protein complex within

83 Escherichia coli inner membrane. TolA N-terminal domain interacts with TolQ and TolR proteins. J. Biol. Chem. 270, 11078–11084.

Devanathan, S., and Postle, K. (2007). Studies on colicin B translocation: FepA is gated by TonB. Mol. Microbiol. 65, 441–453.

DeWitt, W., and Helinski, D.R. (1965). Characterization of colicinogenic factor E1 from a non-induced and a mitomycin C-induced Proteus strain. J. Mol. Biol. 13, 692–703.

Dougan, G., Saul, M., Warren, G., and Sherratt, D. (1978). A functional map of plasmid ColE1. Mol. Gen. Genet. MGG 158, 325–327.

Dover, L.G., Evans, L.J., Fridd, S.L., Bainbridge, G., Raggett, E.M., and Lakey, J.H. (2000). Colicin pore-forming domains bind to Escherichia coli trimeric porins. Biochemistry (Mosc.) 39, 8632–8637.

Duché, D. (2007). Colicin E2 is still in contact with its receptor and import machinery when its nuclease domain enters the cytoplasm. J. Bacteriol. 189, 4217–4222.

Duché, D., Letellier, L., Géli, V., Benedetti, H., and Baty, D. (1995). Quantification of group A colicin import sites. J. Bacteriol. 177, 4935–4939.

Duché, D., Frenkian, A., Prima, V., and Lloubès, R. (2006). Release of immunity protein requires functional endonuclease colicin import machinery. J. Bacteriol. 188, 8593–8600.

Duché, D., Issouf, M., and Lloubès, R. (2009). Immunity protein protects colicin E2 from OmpT protease. J. Biochem. (Tokyo) 145, 95–101.

Duquesne, S., Destoumieux-Garzón, D., Peduzzi, J., and Rebuffat, S. (2007). Microcins, gene-encoded antibacterial peptides from enterobacteria. Nat. Prod. Rep. 24, 708–734.

Duron, O., Bouchon, D., Boutin, S., Bellamy, L., Zhou, L., Engelstädter, J., and Hurst, G.D. (2008). The diversity of reproductive parasites among arthropods: Wolbachia do not walk alone. BMC Biol. 6, 27.

Efremov, R.G., and Sazanov, L.A. (2012). Structure of Escherichia coli OmpF porin from lipidic mesophase. J. Struct. Biol. 178, 311–318.

Eick-Helmerich, K., and Braun, V. (1989). Import of biopolymers into Escherichia coli: nucleotide sequences of the exbB and exbD genes are homologous to those of the tolQ and tolR genes, respectively. J. Bacteriol. 171, 5117–5126.

El Ghachi, M., Bouhss, A., Barreteau, H., Touzé, T., Auger, G., Blanot, D., and Mengin-Lecreulx, D. (2006). Colicin M exerts its bacteriolytic effect via enzymatic degradation of undecaprenyl phosphate-linked peptidoglycan precursors. J. Biol. Chem. 281, 22761–22772.

Elkins, P., Bunker, A., Cramer, W.A., and Stauffacher, C.V. (1997). A mechanism for toxin insertion into membranes is suggested by the crystal structure of the channel-forming domain of colicin E1. Struct. Lond. Engl. 1993 5, 443–458.

84 Erill, I., Escribano, M., Campoy, S., and Barbé, J. (2003). In silico analysis reveals substantial variability in the gene contents of the gamma proteobacteria LexA-regulon. Bioinforma. Oxf. Engl. 19, 2225–2236.

European Food Safety Authority, European Centre for Disease Prevention and Control (2012). The European Union summary report on trends and sources of zoonoses, zoonotic agents and food-borne outbreaks in 2010. EFSA J e2597.

Fàbrega, A., and Vila, J. (2012). Yersinia enterocolitica: pathogenesis, virulence and antimicrobial resistance. Enfermedades Infecc. Microbiol. Clínica 30, 24–32.

Feldgarden, M., and Riley, M.A. (1998). High levels of colicin resistance in Escherichia coli. Evolution 52, 1270–1276.

Ferber, D.M., and Brubaker, R.R. (1979). Mode of action of pesticin: N-acetylglucosaminidase activity. J. Bacteriol. 139, 495–501.

Ferber, D.M., Fowler, J.M., and Brubaker, R.R. (1981). Mutations to tolerance and resistance to pesticin and colicins in Escherichia coli phi. J. Bacteriol. 146, 506–511.

Ferguson, A.D., and Deisenhofer, J. (2004). Metal import through microbial membranes. Cell 116, 15–24.

Florey, H.W., Heatley, N.G., Jenning, M.A., Sanders, A.G., Abraham, E.P., and Florey, M.E. (1946). Antibiotics from bacteria. In The Antibiotics, (London: Oxford University Press), pp. 417–565.Cited in: Cascales, E., Buchanan, S.K., Duché, D., Kleanthous, C., Lloubès, R., Postle, K., Riley, M., Slatin, S., and Cavard, D. (2007). Colicin biology. Microbiol. Mol. Biol. Rev. MMBR 71, 158–229.

Foulds, J. (1972). Purification and Partial Characterization of a Bacteriocin from Serratia marcescens. J. Bacteriol. 110, 1001–1009.

Fredericq, P. (1946). Sur la pluralite des recepteurs d’antibiose de E. coli. C. R. Soc. Biol. 140, 1189–1194. Cited in: Cascales, E., Buchanan, S.K., Duché, D., Kleanthous, C., Lloubès, R., Postle, K., Riley, M., Slatin, S., and Cavard, D. (2007). Colicin biology. Microbiol. Mol. Biol. Rev. MMBR 71, 158–229.

Fredericq, P., and Betz-Bareau, M. (1953). Genetic transfer of colicinogenic property in E. coli. Comptes Rendus Séances Société Biol. Ses Fil. 147, 1110–1112. Cited in: Cascales, E., Buchanan, S.K., Duché, D., Kleanthous, C., Lloubès, R., Postle, K., Riley, M., Slatin, S., and Cavard, D. (2007). Colicin biology. Microbiol. Mol. Biol. Rev. MMBR 71, 158–229.

Fredericq P. (1965). A note on the classifications of colicins. Zentbl Bakteriol Hyg A. 140–142. Cited in: Cascales, E., Buchanan, S.K., Duché, D., Kleanthous, C., Lloubès, R., Postle, K., Riley, M., Slatin, S., and Cavard, D. (2007). Colicin biology. Microbiol. Mol. Biol. Rev. MMBR 71, 158–229.

Fredriksson-Ahomaa, M., and Korkeala, H. (2003). Low occurrence of pathogenic Yersinia enterocolitica in clinical, food, and environmental samples: a methodological problem. Clin. Microbiol. Rev. 16, 220–229.

Fredriksson-Ahomaa, M., Hallanvuo, S., Korte, T., Siitonen, A., and Korkeala, H. (2001). Correspondence of genotypes of sporadic Yersinia enterocolitica bioserotype 4/O:3 strains from human and porcine sources. Epidemiol. Infect. 127, 37–47.

85 Frey, J., Ghersa, P., Palacios, P.G., and Belet, M. (1986). Physical and genetic analysis of the ColD plasmid. J. Bacteriol. 166, 15–19.

Fsihi, H., Kottwitz, B., and Bremer, E. (1993). Single amino acid substitutions affecting the substrate specificity of the Escherichia coli K-12 nucleoside-specific Tsx channel. J. Biol. Chem. 268, 17495–17503.

Gaisser, S., and Braun, V. (1991). The tonB gene of Serratia marcescens: sequence, activity and partial complementation of Escherichia coli tonB mutants. Mol. Microbiol. 5, 2777–2787.

Galburt, E.A., and Stoddard, B.L. (2002). Catalytic mechanisms of restriction and homing endonucleases. Biochemistry (Mosc.) 41, 13851–13860.

Gebhart, D., Williams, S.R., Bishop-Lilly, K.A., Govoni, G.R., Willner, K.M., Butani, A., Sozhamannan, S., Martin, D., Fortier, L.-C., and Scholl, D. (2012). Novel high-molecular-weight, R-type bacteriocins of Clostridium difficile. J. Bacteriol. 194, 6240–6247.

Geli, V., Baty, D., and Lazdunski, C. (1988). Use of a foreign epitope as a “tag” for the localization of minor proteins within a cell: the case of the immunity protein to colicin A. Proc. Natl. Acad. Sci. U. S. A. 85, 689–693.

Geli, V., Baty, D., Pattus, F., and Lazdunski, C. (1989). Topology and function of the integral membrane protein conferring immunity to colicin A. Mol. Microbiol. 3, 679–687.

Gerding, M.A., Ogata, Y., Pecora, N.D., Niki, H., and de Boer, P.A.J. (2007). The trans-envelope Tol-Pal complex is part of the cell division machinery and required for proper outer-membrane invagination during cell constriction in E. coli. Mol. Microbiol. 63, 1008–1025.

Ghosh, J., and Postle, K. (2004). Evidence for dynamic clustering of carboxy-terminal aromatic amino acids in TonB- dependent energy transduction. Mol. Microbiol. 51, 203–213.

Gil, F., Hernández-Lucas, I., Polanco, R., Pacheco, N., Collao, B., Villarreal, J.M., Nardocci, G., Calva, E., and Saavedra, C.P. (2009). SoxS regulates the expression of the Salmonella enterica serovar Typhimurium ompW gene. Microbiology 155, 2490–2497.

Gillor, O., Kirkup, B.C., and Riley, M.A. (2004). Colicins and microcins: the next generation antimicrobials. Adv. Appl. Microbiol. 54, 129–146.

Gillor, O., Vriezen, J.A.C., and Riley, M.A. (2008). The role of SOS boxes in enteric bacteriocin regulation. Microbiol. Read. Engl. 154, 1783–1792.

Gokce, I., Raggett, E.M., Hong, Q., Virden, R., Cooper, A., and Lakey, J.H. (2000). The TolA-recognition site of colicin N. ITC, SPR and stopped-flow fluorescence define a crucial 27-residue segment. J. Mol. Biol. 304, 621–632.

Goldman, K., Suit, J.L., and Kayalar, C. (1985). Identification of the plasmid-encoded immunity protein for colicin E1 in the inner membrane of Escherichia coli. FEBS Lett. 190, 319–323.

Gorbacheva, V.Y., Faundez, G., Godfrey, H.P., and Cabello, F.C. (2001). Restricted growth of ent(-) and tonB mutants

86 of Salmonella enterica serovar Typhi in human Mono Mac 6 monocytic cells. FEMS Microbiol. Lett. 196, 7–11.

Gordon, D.M., and O’Brien, C.L. (2006). Bacteriocin diversity and the frequency of multiple bacteriocin production in Escherichia coli. Microbiol. Read. Engl. 152, 3239–3244.

Gordon, D.M., Riley, M.A., and Pinou, T. (1998). Temporal changes in the frequency of colicinogeny in Escherichia coli from house mice. Microbiol. Read. Engl. 144 ( Pt 8), 2233–2240.

Gould, J.M., and Cramer, W.A. (1977). Studies on the depolarization of the Escherichia coli cell membrane by colicin E1. J. Biol. Chem. 252, 5491–5497.

Graille, M., Mora, L., Buckingham, R.H., van Tilbeurgh, H., and de Zamaroczy, M. (2004). Structural inhibition of the colicin D tRNase by the tRNA-mimicking immunity protein. EMBO J. 23, 1474–1482.

Gratia, A. (1925). Sur un remarquable exemple d’antagonisme entre deux souches de colibacille. C. R. Soc. Biol. 93, 1040–1041. Cited in: Cascales, E., Buchanan, S.K., Duché, D., Kleanthous, C., Lloubès, R., Postle, K., Riley, M., Slatin, S., and Cavard, D. (2007). Colicin biology. Microbiol. Mol. Biol. Rev. MMBR 71, 158–229.

Gratia, A., and Fredericq, P. (1946). Diversité des souches antibiotiques de Bacterium coli et étendue variable de leur champ d’action. C. R. Soc. Biol. 140, 1032–1033. Cited in: Cascales, E., Buchanan, S.K., Duché, D., Kleanthous, C., Lloubès, R., Postle, K., Riley, M., Slatin, S., and Cavard, D. (2007). Colicin biology. Microbiol. Mol. Biol. Rev. MMBR 71, 158–229.

Gray, J.T., WaKabongo, M., Campos, F.E., Diallo, A.A., Tyndal, C., and Tucker, C.A. (2001). Recognition of Yersinia enterocolitica multiple strain infection in twin infants using PCR-based DNA fingerprinting. J. Appl. Microbiol. 90, 358– 364.

Greenwood, M., and Hooper, W.L. (1987). Human carriage of Yersinia spp. J. Med. Microbiol. 23, 345–348.

Gresock, M.G., Savenkova, M.I., Larsen, R.A., Ollis, A.A., and Postle, K. (2011). Death of the TonB shuttle hypothesis. Front. Microbiol. 2, 206.

Gross, P., and Braun, V. (1996). Colicin M is inactivated during import by its immunity protein. Mol. Gen. Genet. MGG 251, 388–396.

Guasch, J.F., Enfedaque, J., Ferrer, S., Gargallo, D., and Regué, M. (1995). Bacteriocin 28b, a chromosomally encoded bacteriocin produced by most Serratia marcescens biotypes. Res. Microbiol. 146, 477–483.

Ben-Gurion, R., and Hertman, I. (1958). Bacteriocin-like material produced by Pasteurella pestis. J. Gen. Microbiol. 19, 289–297.

Hammami, R., Zouhir, A., Ben Hamida, J., and Fliss, I. (2007). BACTIBASE: a new web-accessible database for bacteriocin characterization. BMC Microbiol. 7, 89.

Hands, S.L., Holland, L.E., Vankemmelbeke, M., Fraser, L., Macdonald, C.J., Moore, G.R., James, R., and Penfold, C.N. (2005). Interactions of TolB with the translocation domain of colicin E9 require an extended TolB box. J. Bacteriol. 187, 6733–6741.

87 Hardy, K.G., Meynell, G.G., Dowman, J.E., and Spratt, B.G. (1973). Two major groups of colicin factors: Their evolutionary significance. Mol. Gen. Genet. MGG 125, 217–230.

Harkness, R.E., and Braun, V. (1989). Colicin M inhibits peptidoglycan biosynthesis by interfering with lipid carrier recycling. J. Biol. Chem. 264, 6177–6182.

Harnett, N., Lin, Y.P., and Krishnan, C. (1996). Detection of pathogenic Yersinia enterocolitica using the multiplex polymerase chain reaction. Epidemiol. Infect. 117, 59–67.

Hashimoto-Gotoh, T., and Inselburg, J. (1979). ColE1 plasmid incompatibility: localization and analysis of mutations affecting incompatibility. J. Bacteriol. 139, 608–619.

Helbig, S., Patzer, S.I., Schiene-Fischer, C., Zeth, K., and Braun, V. (2011). Activation of colicin M by the FkpA prolyl cis-trans isomerase/chaperone. J. Biol. Chem. 286, 6280–6290.

Heller, K.B., and Wilson, T.H. (1981). Selectivity of the Escherichia coli outer membrane porins OmpC and OmpF. FEBS Lett. 129, 253–255.

Heller, K.J., Kadner, R.J., and Günther, K. (1988). Suppression of the btuB451 mutation by mutations in the tonB gene suggests a direct interaction between TonB and TonB-dependent receptor proteins in the outer membrane of Escherichia coli. Gene 64, 147–153.

Hilsenbeck, J.L., Park, H., Chen, G., Youn, B., Postle, K., and Kang, C. (2004). Crystal structure of the cytotoxic bacterial protein colicin B at 2.5 A resolution. Mol. Microbiol. 51, 711–720.

Hong, H., Patel, D.R., Tamm, L.K., and van den Berg, B. (2006). The outer membrane protein OmpW forms an eight- stranded beta-barrel with a hydrophobic channel. J. Biol. Chem. 281, 7568–7577.

Hoogkamp-Korstanje, J.A., and Stolk-Engelaar, V.M. (1995). Yersinia enterocolitica infection in children. Pediatr. Infect. Dis. J. 14, 771–775.

Horák, V. (1994). Seventy colicin types of Shigella sonnei and an indicator system for their determination. Zentralblatt Für Bakteriol. Int. J. Med. Microbiol. 281, 24–29.

Housden, N.G., Loftus, S.R., Moore, G.R., James, R., and Kleanthous, C. (2005). Cell entry mechanism of enzymatic bacterial colicins: porin recruitment and the thermodynamics of receptor binding. Proc. Natl. Acad. Sci. U. S. A. 102, 13849–13854.

Housden, N.G., Wojdyla, J.A., Korczynska, J., Grishkovskaya, I., Kirkpatrick, N., Brzozowski, A.M., and Kleanthous, C. (2010). Directed epitope delivery across the Escherichia coli outer membrane through the porin OmpF. Proc. Natl. Acad. Sci. U. S. A. 107, 21412–21417.

Housden, N.G., Hopper, J.T.S., Lukoyanova, N., Rodriguez-Larrea, D., Wojdyla, J.A., Klein, A., Kaminska, R., Bayley, H., Saibil, H.R., Robinson, C.V., et al. (2013). Intrinsically disordered protein threads through the bacterial outer-membrane porin OmpF. Science 340, 1570–1574.

88 Howard, S.P., Cavard, D., and Lazdunski, C. (1991). Phospholipase-A-independent damage caused by the colicin A lysis protein during its assembly into the inner and outer membranes of Escherichia coli. J. Gen. Microbiol. 137, 81–89.

Hu, P.C., and Brubaker, R.R. (1974). Characterization of pesticin. Separation of antibacterial activities. J. Biol. Chem. 249, 4749–4753.

Hullmann, J., Patzer, S.I., Römer, C., Hantke, K., and Braun, V. (2008). Periplasmic chaperone FkpA is essential for imported colicin M toxicity. Mol. Microbiol. 69, 926–937.

Hypsa, V., and Dale, C. (1997). In vitro culture and phylogenetic analysis of “Candidatus Arsenophonus triatominarum,” an intracellular bacterium from the triatomine bug, Triatoma infestans. Int. J. Syst. Bacteriol. 47, 1140–1144.

Iteman, I., Guiyoule, A., and Carniel, E. (1996). Comparison of three molecular methods for typing and subtyping pathogenic Yersinia enterocolitica strains. J. Med. Microbiol. 45, 48–56.

Ito, K., and Akiyama, Y. (2005). Cellular functions, mechanism of action, and regulation of FtsH protease. Annu. Rev. Microbiol. 59, 211–231.

Jabrane, A., Sabri, A., Compère, P., Jacques, P., Vandenberghe, I., Van Beeumen, J., and Thonart, P. (2002). Characterization of serracin P, a phage-tail-like bacteriocin, and its activity against Erwinia amylovora, the fire blight pathogen. Appl. Environ. Microbiol. 68, 5704–5710.

Jack, R.W., Tagg, J.R., and Ray, B. (1995). Bacteriocins of Gram-positive bacteria. Microbiol. Rev. 59, 171–200.

Jacob, F., Siminovitch, L., and Wollman, E. (1952). Biosynthesis of a colicin and its mode of action. Ann. Inst. Pasteur 83, 295–315. Cited in: Cascales, E., Buchanan, S.K., Duché, D., Kleanthous, C., Lloubès, R., Postle, K., Riley, M., Slatin, S., and Cavard, D. (2007). Colicin biology. Microbiol. Mol. Biol. Rev. MMBR 71, 158–229.

Jacob, F., Lwoff, A., Siminovitch, A., and Wollman, E. (1953). Definition of some terms relative to lysogeny. Ann. Inst. Pasteur 84, 222–224. Cited in: Cascales, E., Buchanan, S.K., Duché, D., Kleanthous, C., Lloubès, R., Postle, K., Riley, M., Slatin, S., and Cavard, D. (2007). Colicin biology. Microbiol. Mol. Biol. Rev. MMBR 71, 158–229.

Jakes, K.S. (2012). Translocation trumps receptor binding in colicin entry into Escherichia coli. Biochem. Soc. Trans. 40, 1443–1448.

Jakes, K.S., and Cramer, W.A. (2012). Border Crossings: Colicins and Transporters. Annu. Rev. Genet. 46, 209–231.

Jakes, K.S., and Finkelstein, A. (2010). The colicin Ia receptor, Cir, is also the translocator for colicin Ia. Mol. Microbiol. 75, 567–578.

Jakes, K.S., and Zinder, N.D. (1984). Plasmid ColE3 specifies a lysis protein. J. Bacteriol. 157, 582–590.

James, R., Penfold, C.N., Moore, G.R., and Kleanthous, C. (2002). Killing of E. coli cells by E group nuclease colicins. Biochimie 84, 381–389.

Jeanteur, D., Schirmer, T., Fourel, D., Simonet, V., Rummel, G., Widmer, C., Rosenbusch, J.P., Pattus, F., and Pagès,

89 J.M. (1994). Structural and functional alterations of a colicin-resistant mutant of OmpF porin from Escherichia coli. Proc. Natl. Acad. Sci. U. S. A. 91, 10675–10679.

Jeziorowski, A., and Gordon, D.M. (2007). Evolution of microcin V and colicin Ia plasmids in Escherichia coli. J. Bacteriol. 189, 7045–7052.

Johnson, C.L., Ridley, H., Pengelly, R.J., Salleh, M.Z., and Lakey, J.H. (2013). The unstructured domain of colicin N kills Escherichia coli. Mol. Microbiol. 89, 84–95.

Johnson, T.J., Johnson, S.J., and Nolan, L.K. (2006). Complete DNA sequence of a ColBM plasmid from avian pathogenic Escherichia coli suggests that it evolved from closely related ColV virulence plasmids. J. Bacteriol. 188, 5975–5983.

Jones, D.T., Taylor, W.R., and Thornton, J.M. (1992). The rapid generation of mutation data matrices from protein sequences. Comput. Appl. Biosci. CABIOS 8, 275–282.

Journet, L., Bouveret, E., Rigal, A., Lloubes, R., Lazdunski, C., and Benedetti, H. (2001). Import of colicins across the outer membrane of Escherichia coli involves multiple protein interactions in the periplasm. Mol. Microbiol. 42, 331–344.

Kageyama, M. (1964). Studies on pyocin. I. Physical and chemical properties. J. Biochem. (Tokyo) 55, 49–53.

Kerr, B., Riley, M.A., Feldman, M.W., and Bohannan, B.J.M. (2002). Local dispersal promotes biodiversity in a real-life game of rock-paper-scissors. Nature 418, 171–174.

Kienker, P.K., Qiu, X., Slatin, S.L., Finkelstein, A., and Jakes, K.S. (1997). Transmembrane insertion of the colicin Ia hydrophobic hairpin. J. Membr. Biol. 157, 27–37.

Killmann, H., Herrmann, C., Torun, A., Jung, G., and Braun, V. (2002). TonB of Escherichia coli activates FhuA through interaction with the beta-barrel. Microbiol. Read. Engl. 148, 3497–3509.

Kirillina, O., Bobrov, A.G., Fetherston, J.D., and Perry, R.D. (2006). Hierarchy of iron uptake systems: Yfu and Yiu are functional in Yersinia pestis. Infect. Immun. 74, 6171–6178.

Kleanthous, C., Kühlmann, U.C., Pommer, A.J., Ferguson, N., Radford, S.E., Moore, G.R., James, R., and Hemmings, A.M. (1999). Structural and mechanistic basis of immunity toward endonuclease colicins. Nat. Struct. Biol. 6, 243–252.

Koebnik, R., Bäumler, A.J., Heesemann, J., Braun, V., and Hantke, K. (1993). The TonB protein of Yersinia enterocolitica and its interactions with TonB-box proteins. Mol. Gen. Genet. MGG 237, 152–160.

Konisky, J., and Cowell, B.S. (1972). Interaction of colicin Ia with bacterial cells. Direct measurement of Ia-receptor interaction. J. Biol. Chem. 247, 6524–6529.

Koronakis, V. (2003). TolC – the bacterial exit duct for proteins and drugs. FEBS Lett. 555, 66–71.

Koronakis, V., Eswaran, J., and Hughes, C. (2004). Structure and function of TolC: The bacterial exit duct for proteins and drugs. Annu. Rev. Biochem. 73, 467–489.

90 Kotetishvili, M., Kreger, A., Wauters, G., Morris, J.G., Sulakvelidze, A., and Stine, O.C. (2005). Multilocus sequence typing for studying genetic relationships among Yersinia species. J. Clin. Microbiol. 43, 2674–2684.

Krasilnikov, O.V., Yuldasheva, L.N., Nogueira, R.A., and Rodrigues, C.G. (1995). The diameter of water pores formed by colicin Ia in planar lipid bilayers. Braz. J. Med. Biol. Res. Rev. Bras. Pesqui. Médicas E Biológicas Soc. Bras. Biofísica Al 28, 693–698.

Krasilnikov, O.V., Da Cruz, J.B., Yuldasheva, L.N., Varanda, W.A., and Nogueira, R.A. (1998). A novel approach to study the geometry of the water lumen of ion channels: colicin Ia channels in planar lipid bilayers. J. Membr. Biol. 161, 83–92.

Krewulak, K.D., and Vogel, H.J. (2011). TonB or not TonB: is that the question? Biochem. Cell Biol. Biochim. Biol. Cell. 89, 87–97.

Krieger-Brauer, H.J., and Braun, V. (1980). Functions related to the receptor protein specified by the tsx gene of Escherichia coli. Arch. Microbiol. 124, 233–242.

Krishnan, S., and Prasadarao, N.V. (2012). Outer membrane protein A and OprF: versatile roles in Gram-negative bacterial infections. FEBS J. 279, 919–931.

Kühlmann, U.C., Pommer, A.J., Moore, G.R., James, R., and Kleanthous, C. (2000). Specificity in protein-protein interactions: the structural basis for dual recognition in endonuclease colicin-immunity protein complexes. J. Mol. Biol. 301, 1163–1178.

Kurisu, G., Zakharov, S.D., Zhalnina, M.V., Bano, S., Eroukova, V.Y., Rokitskaya, T.I., Antonenko, Y.N., Wiener, M.C., and Cramer, W.A. (2003). The structure of BtuB with bound colicin E3 R-domain implies a translocon. Nat. Struct. Biol. 10, 948–954.

Lancaster, L.E., Savelsbergh, A., Kleanthous, C., Wintermeyer, W., and Rodnina, M.V. (2008). Colicin E3 cleavage of 16S rRNA impairs decoding and accelerates tRNA translocation on Escherichia coli ribosomes. Mol. Microbiol. 69, 390–401.

Lau, P.C., and Condie, J.A. (1989). Nucleotide sequences from the colicin E5, E6 and E9 operons: presence of a degenerate transposon-like structure in the ColE9-J plasmid. Mol. Gen. Genet. MGG 217, 269–277.

Lawrence, J.G., Ochman, H., and Hartl, D.L. (1991). Molecular and evolutionary relationships among enteric bacteria. J. Gen. Microbiol. 137, 1911–1921.

Lazdunski, C.J., Bouveret, E., Rigal, A., Journet, L., Lloubès, R., and Benedetti, H. (1998). Colicin import into Escherichia coli cells. J. Bacteriol. 180, 4993–5002.

Lazzaroni, J.C., and Portalier, R.C. (1981). Genetic and biochemical characterization of periplasmic-leaky mutants of Escherichia coli K-12. J. Bacteriol. 145, 1351–1358.

Lazzaroni, J.-C., Dubuisson, J.-F., and Vianney, A. (2002). The Tol proteins of Escherichia coli and their involvement in the translocation of group A colicins. Biochimie 84, 391–397.

91 Lee, L.A., Gerber, A.R., Lonsway, D.R., Smith, J.D., Carter, G.P., Puhr, N.D., Parrish, C.M., Sikes, R.K., Finton, R.J., and Tauxe, R.V. (1990). Yersinia enterocolitica O:3 infections in infants and children, associated with the household preparation of chitterlings. N. Engl. J. Med. 322, 984–987.

Lee, L.A., Taylor, J., Carter, G.P., Quinn, B., Farmer, J.J., 3rd, and Tauxe, R.V. (1991). Yersinia enterocolitica O:3: an emerging cause of pediatric gastroenteritis in the United States. The Yersinia enterocolitica collaborative study group. J. Infect. Dis. 163, 660–663.

Lin, Y.-L., Elias, Y., and Huang, R.H. (2005). Structural and mutational studies of the catalytic domain of colicin E5: a tRNA-specific ribonuclease. Biochemistry (Mosc.) 44, 10494–10500.

Lindeberg, M., and Cramer, W.A. (2001). Identification of specific residues in colicin E1 involved in immunity protein recognition. J. Bacteriol. 183, 2132–2136.

Lindeberg, M., Zakharov, S.D., and Cramer, W.A. (2000). Unfolding pathway of the colicin E1 channel protein on a membrane surface. J. Mol. Biol. 295, 679–692.

Little, J.W., and Mount, D.W. (1982). The SOS regulatory system of Escherichia coli. Cell 29, 11–22.

Lloubès, R., Cascales, E., Walburger, A., Bouveret, E., Lazdunski, C., Bernadac, A., and Journet, L. (2001). The Tol-Pal proteins of the Escherichia coli cell envelope: an energized system required for outer membrane integrity? Res. Microbiol. 152, 523–529.

Lloubès, R., Goemaere, E., Zhang, X., Cascales, E., and Duché, D. (2012). Energetics of colicin import revealed by genetic cross-complementation between the Tol and Ton systems. Biochem. Soc. Trans. 40, 1480–1485.

Lodinová-Žádníková, R., and Sonnenborn, U. (1997). Effect of preventive administration of a nonpathogenic Escherichia coli strain on the colonization of the intestine with microbial pathogens in newborn infants. Biol. Neonate 71, 224–232.

Lodinová-Žádníková, R., Sonnenborn, U., and Tlaskalová, H. (1998). Probiotics and E. coli infections in man. Vet. Q. 20 Suppl 3, S78–81.

Lodinová-Žádníková, R., Prokesová, L., Kocourková, I., Hrdý, J., and Zizka, J. (2010). Prevention of allergy in infants of allergic mothers by probiotic Escherichia coli. Int. Arch. Allergy Immunol. 153, 201–206.

Loftus, S.R., Walker, D., Maté, M.J., Bonsor, D.A., James, R., Moore, G.R., and Kleanthous, C. (2006). Competitive recruitment of the periplasmic translocation portal TolB by a natively disordered domain of colicin E9. Proc. Natl. Acad. Sci. U. S. A. 103, 12353–12358.

Lu, F.M., and Chak, K.F. (1996). Two overlapping SOS-boxes in ColE operons are responsible for the viability of cells harboring the Col plasmid. Mol. Gen. Genet. MGG 251, 407–411.

Lukashin, A.V., and Borodovsky, M. (1998). GeneMark.hmm: new solutions for gene finding. Nucleic Acids Res. 26, 1107–1115.

92 Marks, M.I., Pai, C.H., Lafleur, L., Lackman, L., and Hammerberg, O.(1980). Yersinia enterocolitica gastroenteritis: a prospective study of clinical, bacteriologic, and epidemiologic features. J. Pediatr. 96, 26–31.

Marriott, D.J., Taylor, S., and Dorman, D.C. (1985). Yersinia enterocolitica infection in children. Med. J. Aust. 143, 489–492.

Masaki, H., and Ohta, T. (1985). Colicin E3 and its immunity genes. J. Mol. Biol. 182, 217–227.

Masi, M., and Pagès, J.M. (2013). Structure, function and regulation of outer membrane proteins involved in drug transport in Enterobactericeae: the OmpF/C - TolC case. Open Microbiol. J. 7, 22–33.

Masi, M., Vuong, P., Humbard, M., Malone, K., and Misra, R. (2007). Initial steps of colicin E1 import across the outer membrane of Escherichia coli. J. Bacteriol. 189, 2667–2676.

Mende, J., and Braun, V. (1990). Import-defective colicin B derivatives mutated in the TonB box. Mol. Microbiol. 4, 1523–1533.

Michel-Briand, Y., and Baysse, C. (2002). The pyocins of Pseudomonas aeruginosa. Biochimie 84, 499–510.

Mingrone, M.G., Fantasia, M., Figura, N., and Guglielmetti, P. (1987). Characteristics of Yersinia enterocolitica isolated from children with diarrhea in Italy. J. Clin. Microbiol. 25, 1301–1304.

Mora, L., Diaz, N., Buckingham, R.H., and de Zamaroczy, M. (2005). Import of the transfer RNase colicin D requires site-specific interaction with the energy-transducing protein TonB. J. Bacteriol. 187, 2693–2697.

Morlon, J., Lloubès, R., Varenne, S., Chartier, M., and Lazdunski, C. (1983). Complete nucleotide sequence of the structural gene for colicin A, a gene translated at non-uniform rate. J. Mol. Biol. 170, 271–285.

Mosbahi, K., Walker, D., Lea, E., Moore, G.R., James, R., and Kleanthous, C. (2004). Destabilization of the colicin E9 Endonuclease domain by interaction with negatively charged phospholipids: implications for colicin translocation into bacteria. J. Biol. Chem. 279, 22145–22151.

Mosbahi, K., Walker, D., James, R., Moore, G.R., and Kleanthous, C. (2006). Global structural rearrangement of the cell penetrating ribonuclease colicin E3 on interaction with phospholipid membranes. Protein Sci. Publ. Protein Soc. 15, 620–627.

Muga, A., Gonzalez-Manas, J.M., Lakey, J.H., Pattus, F., and Surewicz, W.K. (1993). pH-dependent stability and membrane interaction of the pore-forming domain of colicin A. J. Biol. Chem. 268, 1553–1557.

Munch-Petersen, A., Mygind, B., Nicolaisen, A., and Pihl, N.J. (1979). Nucleoside transport in cells and membrane vesicles from Escherichia coli K12. J. Biol. Chem. 254, 3730–3737.

Nagel de Zwaig, R. (1969). Mode of action of colicin A. J. Bacteriol. 99, 913–914.

Nagel de Zwaig, R., and Luria, S.E. (1967). Genetics and physiology of colicin-tolerant mutants of Escherichia coli. J. Bacteriol. 94, 1112–1123.

93 Nahum, J.R., Harding, B.N., and Kerr, B. (2011). Evolution of restraint in a structured rock–paper–scissors community. Proc. Natl. Acad. Sci. 108 Suppl 2:10831-10838

Najdenski, H., Iteman, I., and Carniel, E. (1994). Efficient subtyping of pathogenic Yersinia enterocolitica strains by pulsed-field gel electrophoresis. J. Clin. Microbiol. 32, 2913–2920.

Narberhaus, F., Obrist, M., Führer, F., and Langklotz, S. (2009). Degradation of cytoplasmic substrates by FtsH, a membrane-anchored protease with many talents. Res. Microbiol. 160, 652–659.

Nardi, A., Slatin, S.L., Baty, D., and Duché, D. (2001a). The C-terminal half of the colicin A pore-forming domain is active in vivo and in vitro. J. Mol. Biol. 307, 1293–1303.

Nardi, A., Corda, Y., Baty, D., and Duché, D. (2001b). Colicin A immunity protein interacts with the hydrophobic helical hairpin of the colicin A channel domain in the Escherichia coli inner membrane. J. Bacteriol. 183, 6721–6725.

Nascimento, J.S., Ceotto, H., Nascimento, S.B., Giambiagi-Demarval, M., Santos, K.R.N., and Bastos, M.C.F. (2006). Bacteriocins as alternative agents for control of multiresistant staphylococcal strains. Lett. Appl. Microbiol. 42, 215–221.

Neubauer, H., Aleksic, S., Hensel, A., Finke, E.-J., and Meyer, H. (2000). Yersinia enterocolitica 16S rRNA gene types belong to the same genospecies but form three homology groups. Int. J. Med. Microbiol. 290, 61–64.

Ng, C.L., Lang, K., Meenan, N.A.G., Sharma, A., Kelley, A.C., Kleanthous, C., and Ramakrishnan, V. (2010). Structural basis for 16S ribosomal RNA cleavage by the cytotoxic domain of colicin E3. Nat. Struct. Mol. Biol. 17, 1241–1246.

Nguyen, A.H., Tomita, T., Hirota, M., Sato, T., and Kamio, Y. (1999). A simple purification method and morphology and component analyses for carotovoricin Er, a phage-tail-like bacteriocin from the plant pathogen Erwinia carotovora Er. Biosci. Biotechnol. Biochem. 63, 1360–1369.

Nikaido, H. (1994). Porins and specific diffusion channels in bacterial outer membranes. J. Biol. Chem. 269, 3905–3908.

Nikaido, H. (2003). Molecular basis of bacterial outer membrane permeability revisited. Microbiol. Mol. Biol. Rev. MMBR 67, 593–656.

Noinaj, N., Guillier, M., Barnard, T.J., and Buchanan, S.K. (2010). TonB-dependent transporters: regulation, structure, and function. Annu. Rev. Microbiol. 64, 43–60.

Ogawa, T., Tomita, K., Ueda, T., Watanabe, K., Uozumi, T., and Masaki, H. (1999). A cytotoxic ribonuclease targeting specific transfer RNA anticodons. Science 283, 2097–2100.

Ogierman, M., and Braun, V. (2003). Interactions between the outer membrane ferric citrate transporter FecA and TonB: studies of the FecA TonB box. J. Bacteriol. 185, 1870–1885.

Ogle, J.M., Carter, A.P., and Ramakrishnan, V. (2003). Insights into the decoding mechanism from recent ribosome structures. Trends Biochem. Sci. 28, 259–266.

Ollis, A.A., and Postle, K. (2011). The same periplasmic ExbD residues mediate in vivo interactions between ExbD

94 homodimers and ExbD-TonB heterodimers. J. Bacteriol. 193, 6852–6863.

Ollis, A.A., and Postle, K. (2012). ExbD mutants define initial stages in TonB energization. J. Mol. Biol. 415, 237–247.

Olschläger, T., and Braun, V. (1987). Sequence, expression, and localization of the immunity protein for colicin M. J. Bacteriol. 169, 4765–4769.

Olschläger, T., Schramm, E., and Braun, V. (1984). Cloning and expression of the activity and immunity genes of colicins B and M on ColBM plasmids. Mol. Gen. Genet. MGG 196, 482–487.

Olschläger, T., Turba, A., and Braun, V. (1991). Binding of the immunity protein inactivates colicin M. Mol. Microbiol. 5, 1105–1111.

Pai, C.H., Gillis, F., Tuomanen, E., and Marks, M.I. (1984). Placebo-controlled double-blind evaluation of trimethoprim- sulfamethoxazole treatment of Yersinia enterocolitica gastroenteritis. J. Pediatr. 104, 308–311.

Pan, L., Leung, P.C., and Gu, J.-D. (2010). A new ColE1-like plasmid group revealed by comparative analysis of the replication proficient fragments of Vibrionaceae plasmids. J. Microbiol. Biotechnol. 20, 1163–1178.

Papadakos, G., Housden, N.G., Lilly, K.J., Kaminska, R., and Kleanthous, C. (2012a). Kinetic basis for the competitive recruitment of TolB by the intrinsically disordered translocation domain of colicin E9. J. Mol. Biol. 418, 269–280.

Papadakos, G., Wojdyla, J.A., and Kleanthous, C. (2012b). Nuclease colicins and their immunity proteins. Q. Rev. Biophys. 45, 57–103.

Parker, M.W., Pattus, F., Tucker, A.D., and Tsernoglou, D. (1989). Structure of the membrane-pore-forming fragment of colicin A. Nature 337, 93–96.

Patzer, S.I., Baquero, M.R., Bravo, D., Moreno, F., and Hantke, K. (2003). The colicin G, H and X determinants encode microcins M and H47, which might utilize the catecholate siderophore receptors FepA, Cir, Fiu and IroN. Microbiol. Read. Engl. 149, 2557–2570.

Patzer, S.I., Albrecht, R., Braun, V., and Zeth, K. (2012). Structural and mechanistic studies of pesticin, a bacterial homolog of phage lysozymes. J. Biol. Chem. 287, 23381–23396.

Pautsch, A., and Schulz, G.E. (2000). High-resolution structure of the OmpA membrane domain. J. Mol. Biol. 298, 273–282.

Penfold, C.N., Garinot-Schneider, C., Hemmings, A.M., Moore, G.R., Kleanthous, C., and James, R. (2000). A 76-residue polypeptide of colicin E9 confers receptor specificity and inhibits the growth of vitamin B12-dependent Escherichia coli 113/3 cells. Mol. Microbiol. 38, 639–649.

Phang-Cheng-Tai, and Davis, B.D. (1974). Activity of colicin E3-treated ribosomes in initiation and in chain elongation. Proc. Natl. Acad. Sci. U. S. A. 71, 1021–1025.

Pieper, R., Huang, S.-T., Parmar, P.P., Clark, D.J., Alami, H., Fleischmann, R.D., Perry, R.D., and Peterson, S.N.

95 (2010). Proteomic analysis of iron acquisition, metabolic and regulatory responses of Yersinia pestis to iron starvation. BMC Microbiol. 10, 30.

Pilsl, H., and Braun, V. (1995a). Novel colicin 10: assignment of four domains to TonB- and TolC-dependent uptake via the Tsx receptor and to pore formation. Mol. Microbiol. 16, 57–67.

Pilsl, H., and Braun, V. (1995b). Strong function-related homology between the pore-forming colicins K and 5. J. Bacteriol. 177, 6973–6977.

Pilsl, H., Killmann, H., Hantke, K., and Braun, V. (1996). Periplasmic location of the pesticin immunity protein suggests inactivation of pesticin in the periplasm. J. Bacteriol. 178, 2431–2435.

Pilsl, H., Smajs, D., and Braun, V. (1998). The tip of the hydrophobic hairpin of colicin U is dispensable for colicin U activity but is important for interaction with the immunity protein. J. Bacteriol. 180, 4111–4115.

Plate, C.A., Suit, J.L., Jetten, A.M., and Luria, S.E. (1974). Effects of colicin K on a mutant of Escherichia coli deficient in Ca 2+, Mg 2+-activated adenosine triphosphatase. J. Biol. Chem. 249, 6138–6143.

Pommer, A.J., Wallis, R., Moore, G.R., James, R., and Kleanthous, C. (1998). Enzymological characterization of the nuclease domain from the bacterial toxin colicin E9 from Escherichia coli. Biochem. J. 334, 387–392.

Postle, K., and Kadner, R.J. (2003). Touch and go: tying TonB to transport. Mol. Microbiol. 49, 869–882.

Pugsley, A.P. (1985). Escherichia coli K12 strains for use in the identification and characterization of colicins. J. Gen. Microbiol. 131, 369–376.

Pugsley, A.P., and Rosenbusch, J.P. (1981). Release of colicin E2 from Escherichia coli. J. Bacteriol. 147, 186–192.

Pugsley, A.P., and Schwartz, M. (1983). Expression of a gene in a 400-base-pair fragment of colicin plasmid ColE2-P9 is sufficient to cause host cell lysis. J. Bacteriol. 156, 109–114.

Pugsley, A.P., and Schwartz, M. (1984). Colicin E2 release: lysis, leakage or secretion? Possible role of a phospholipase. EMBO J. 3, 2393–2397.

Raggett, E.M., Bainbridge, G., Evans, L.J., Cooper, A., and Lakey, J.H. (1998). Discovery of critical Tol A-binding residues in the bactericidal toxin colicin N: a biophysical approach. Mol. Microbiol. 28, 1335–1343.

Rahman, A., Bonny, T.S., Stonsaovapak, S., and Ananchaipattana, C. (2011). Yersinia enterocolitica: Epidemiological studies and outbreaks. J. Pathog. 2011.

Rakin, A., Saken, E., Harmsen, D., and Heesemann, J. (1994). The pesticin receptor of Yersinia enterocolitica: a novel virulence factor with dual function. Mol. Microbiol. 13, 253–263.

Rakin, A., Boolgakowa, E., and Heesemann, J. (1996). Structural and functional organization of the Yersinia pestis bacteriocin pesticin gene cluster. Microbiol. Read. Engl. 142 ( Pt 12), 3415–3424.

96 Ray, S.M., Ahuja, S.D., Blake, P.A., Farley, M.M., Samuel, M., Fiorentino, T., Swanson, E., Cassidy, M., Lay, J.C., Van Gilder, T., et al. (2004). Population-based surveillance for Yersinia enterocolitica infections in FoodNet sites, 1996-1999: higher risk of disease in infants and minority populations. Clin. Infect. Dis. Off. Publ. Infect. Dis. Soc. Am. 38 Suppl 3, S181–189.

Raymond, L., Slatin, S.L., and Finkelstein, A. (1985). Channels formed by colicin E1 in planar lipid bilayers are large and exhibit pH-dependent ion selectivity. J. Membr. Biol. 84, 173–181.

Reusch, R.N. (2012). Insights into the structure and assembly of Escherichia coli outer membrane protein A. FEBS J. 279, 894–909.

Reuter, S., Thomson, N.R., and McNally, A. (2012). Evolutionary Dynamics of the Yersinia enterocolitica Complex. In Advances in Yersinia Research, A.M.P. de Almeida, and N.C. Leal, eds. (Springer New York), pp. 15–22.

Riley, M.A. (1993a). Molecular mechanisms of colicin evolution. Mol. Biol. Evol. 10, 1380–1395.

Riley, M.A. (1993b). Positive selection for colicin diversity in bacteria. Mol. Biol. Evol. 10, 1048–1059.

Riley, M.A., and Gordon, D.M. (1992). A survey of Col plasmids in natural isolates of Escherichia coli and an investigation into the stability of Col-plasmid lineages. J. Gen. Microbiol. 138, 1345–1352.

Riley, M.A., and Gordon, D.M. (1999). The ecological role of bacteriocins in bacterial competition. Trends Microbiol. 7, 129–133.

Riley, M.A., Cadavid, L., Collett, M.S., Neely, M.N., Adams, M.D., Phillips, C.M., Neel, J.V., and Friedman, D. (2000). The newly characterized colicin Y provides evidence of positive selection in pore-former colicin diversification. Microbiology 146, 1671–1677.

Rogers, L.A., and Whittier, E.O. (1928). Limiting factors in the lactic fermetnation. J. Bacteriol. 16, 211–229.

Roos, U., Harkness, R.E., and Braun, V. (1989). Assembly of colicin genes from a few DNA fragments. Nucleotide sequence of colicin D. Mol. Microbiol. 3, 891–902.

Rossignol, M., Basset, A., Espéli, O., and Boccard, F. (2001). NKBOR, a mini-Tn10-based transposon for random insertion in the chromosome of Gram-negative bacteria and the rapid recovery of sequences flanking the insertion sites in Escherichia coli. Res. Microbiol. 152, 481–485.

Rozen, S., and Skaletsky, H. (2000). Primer3 on the WWW for general users and for biologist programmers. Methods Mol. Biol. Clifton NJ 132, 365–386.

Sabik, J.F., Suit, J.L., and Luria, S.E. (1983). cea-kil operon of the ColE1 plasmid. J. Bacteriol. 153, 1479–1485.

Saken, E., Roggenkamp, A., Aleksic, S., and Heesemann, J. (1994). Characterisation of pathogenic Yersinia enterocolitica serogroups by pulsed-field gel electrophoresis of genomic NotI restriction fragments. J. Med. Microbiol. 41, 329–338.

Sambrook, and Russell (2001). Molecular cloning: a laboratory manual 3rd. ed (Cold Spring Harbor, N.Y.: Cold Spring

97 Harbor Laboratory).

Sander, G. (1977). Mechanism of action of colicin E3. Effect on ribosomal elongation-factor-dependent reactions. Eur. J. Biochem. FEBS 75, 523–531.

Sandhu, K.K., Bottone, E.J., and Pisano, M.A. (1983). Partial characterization of Yersinia intermedia bacteriocin. J. Clin. Microbiol. 17, 511–515.

Săsărman, A., Massie, B., Zollinger, M., Gagne-Tellier, H., Shareck, F., Garzon, S., and Morisset, R. (1980). Naturally occurring R.ColBM plasmids belonging to the IncFIII incompatibility group. J. Gen. Microbiol. 119, 475–483.

Sauter, A., Howard, S.P., and Braun, V. (2003). In vivo evidence for TonB dimerization. J. Bacteriol. 185, 5747–5754.

Sharma, O., and Cramer, W.A. (2007). Minimum length requirement of the flexible N-terminal translocation subdomain of colicin E3. J. Bacteriol. 189, 363–368.

Sharma, O., Yamashita, E., Zhalnina, M.V., Zakharov, S.D., Datsenko, K.A., Wanner, B.L., and Cramer, W.A. (2007). Structure of the complex of the colicin E2 R-domain and its BtuB receptor. The outer membrane colicin translocon. J. Biol. Chem. 282, 23163–23170.

Sharma, O., Datsenko, K.A., Ess, S.C., Zhalnina, M.V., Wanner, B.L., and Cramer, W.A. (2009). Genome-wide screens: novel mechanisms in colicin import and cytotoxicity. Mol. Microbiol. 73, 571–585.

Shayegani, M., DeForge, I., McGlynn, D.M., and Root, T. (1981). Characteristics of Yersinia enterocolitica and related species isolated from human, animal, and environmental sources. J. Clin. Microbiol. 14, 304–312.

Schaller, K., and Nomura, M. (1976). Colicin E2 is DNA endonuclease. Proc. Natl. Acad. Sci. U. S. A. 73, 3989–3993.

Schein, S.J., Kagan, B.L., and Finkelstein, A. (1978). Colicin K acts by forming voltage-dependent channels in phospholipid bilayer membranes. Nature 276, 159–163.

Schendel, S.L., Click, E.M., Webster, R.E., and Cramer, W.A. (1997). The TolA protein interacts with colicin E1 differently than with other group A colicins. J. Bacteriol. 179, 3683–3690.

Schramm, E., Mende, J., Braun, V., and Kamp, R.M. (1987). Nucleotide sequence of the colicin B activity gene cba: consensus pentapeptide among TonB-dependent colicins and receptors. J. Bacteriol. 169, 3350–3357.

Sihvonen, L.M., Jalkanen, K., Huovinen, E., Toivonen, S., Corander, J., Kuusi, M., Skurnik, M., Siitonen, A., and Haukka, K. (2012). Clinical isolates of Yersinia enterocolitica Biotype 1A represent two phylogenetic lineages with differing pathogenicity-related properties. BMC Microbiol. 12, 208.

Simonova, J., Vazlerova, M., and Steinhauserova, I. (2007). Detection of pathogenic Yersinia enterocolitica serotype O:3 by biochemical, serological, and PCR methods. Czech J. Food Sci. - UZPI v. 25(4) p. 214-220.

Skurnik, M., and Strauch, E. (2006). Phage therapy: facts and fiction. Int. J. Med. Microbiol. IJMM 296, 5–14.

98 Slatin, S.L., Duché, D., Kienker, P.K., and Baty, D. (2004). Gating movements of colicin A and colicin Ia are different. J. Membr. Biol. 202, 73–83.

Smallwood, C.R., Marco, A.G., Xiao, Q., Trinh, V., Newton, S.M.C., and Klebba, P.E. (2009). Fluoresceination of FepA during colicin B killing: effects of temperature, toxin and TonB. Mol. Microbiol. 72, 1171–1180.

Smith, S.G.J., Mahon, V., Lambert, M.A., and Fagan, R.P. (2007). A molecular Swiss army knife: OmpA structure, function and expression. FEMS Microbiol. Lett. 273, 1–11.

Sobko, A.A., Kotova, E.A., Antonenko, Y.N., Zakharov, S.D., and Cramer, W.A. (2006). Lipid dependence of the channel properties of a colicin E1-lipid toroidal pore. J. Biol. Chem. 281, 14408–14416.

Soelaiman, S., Jakes, K., Wu, N., Li, C., and Shoham, M. (2001). Crystal structure of colicin E3: implications for cell entry and ribosome inactivation. Mol. Cell 8, 1053–1062.

Soltan-Dallal, M.M., and Moezardalan, K. (2004). Frequency of Yersinia species infection in paediatric acute diarrhoea in Tehran. East. Mediterr. Heal. J. Rev. Santé Méditerranée Orient. Al-Majallah Al-Ṣiḥḥīyah Li-Sharq Al-Mutawassiṭ 10, 152–158.

Song, H.Y., and Cramer, W.A. (1991). Membrane topography of ColE1 gene products: the immunity protein. J. Bacteriol. 173, 2935–2943.

Spector, J., Zakharov, S., Lill, Y., Sharma, O., Cramer, W.A., and Ritchie, K. (2010). Mobility of BtuB and OmpF in the Escherichia coli outer membrane: implications for dynamic formation of a translocon complex. Biophys. J. 99, 3880–3886.

Stock, I., and Wiedemann, B. (1999). An in-vitro study of the antimicrobial susceptibilities of Yersinia enterocolitica and the definition of a database. J. Antimicrob. Chemother. 43, 37–45.

Stouthamer, A.H., and Tieze, G.A. (1966). Bacteriocin production by members of the genus Klebsiella. Antonie Van Leeuwenhoek 32, 171–182.

Strauch, E., Kaspar, H., Schaudinn, C., Dersch, P., Madela, K., Gewinner, C., Hertwig, S., Wecke, J., and Appel, B. (2001). Characterization of enterocoliticin, a phage tail-like bacteriocin, and its effect on pathogenic Yersinia enterocolitica strains. Appl. Environ. Microbiol. 67, 5634–5642.

Striebel, F., Kress, W., and Weber-Ban, E. (2009). Controlled destruction: AAA+ ATPases in protein degradation from bacteria to eukaryotes. Curr. Opin. Struct. Biol. 19, 209–217.

Suit, J.L., Fan, M.L., Sabik, J.F., Labarre, R., and Luria, S.E. (1983). Alternative forms of lethality in mitomycin C-induced bacteria carrying ColE1 plasmids. Proc. Natl. Acad. Sci. U. S. A. 80, 579–583.

Suno, R., Niwa, H., Tsuchiya, D., Zhang, X., Yoshida, M., and Morikawa, K. (2006). Structure of the whole cytosolic region of ATP-dependent protease FtsH. Mol. Cell 22, 575–585.

Šmajs, D., and Weinstock, G.M. (2001a). The iron- and temperature-regulated cjrBC genes of Shigella and enteroinvasive Escherichia coli strains code for colicin Js uptake. J. Bacteriol. 183, 3958–3966.

99 Šmajs, D., and Weinstock, G.M. (2001b). Genetic organization of plasmid ColJs, encoding colicin Js activity, immunity, and release genes. J. Bacteriol. 183, 3949–3957.

Šmajs, D., Pilsl, H., and Braun, V. (1997). Colicin U, a novel colicin produced by Shigella boydii. J. Bacteriol. 179, 4919– 4928.

Šmajs, D., Matějková, P., and Weinstock, G.M. (2006). Recognition of pore-forming colicin Y by its cognate immunity protein. FEMS Microbiol. Lett. 258, 108–113.

Šmajs, D., Micenková, L., Smarda, J., Vrba, M., Sevčíková, A., Vališová, Z., and Woznicová, V. (2010). Bacteriocin synthesis in uropathogenic and commensal Escherichia coli: colicin E1 is a potential virulence factor. BMC Microbiol. 10, 288.

Šmarda, J., and Benada, O. (2005). Phage tail-like (high-molecular-weight) bacteriocins of Budvicia aquatica and Pragia fontium (Enterobacteriaceae). Appl. Environ. Microbiol. 71, 8970–8973.

Šmarda, J., and Damborský, J. (1991). A Quantitative assay of group E colicins. Scr Med 111–118.

Šmarda, J., and Šmajs, D. (1998). Colicins--exocellular lethal proteins of Escherichia coli. Folia Microbiol. (Praha) 43, 563–582.

Takeya, K., Minamishima, Y., Amako, K., and Ohnishi, Y. (1967). A small rod-shaped pyocin. Virology 31, 166–168.

Tamura, K., Peterson, D., Peterson, N., Stecher, G., Nei, M., and Kumar, S. (2011). MEGA5: molecular evolutionary genetics analysis using maximum likelihood, evolutionary distance, and maximum parsimony methods. Mol. Biol. Evol. 28, 2731–2739.

Thanassi, D.G., and Hultgren, S.J. (2000). Multiple pathways allow protein secretion across the bacterial outer membrane. Curr. Opin. Cell Biol. 12, 420–430.

Thomas C.M. (2000). The horizontal gene pool — Bacterial plasmids and gene spread. (Amsterdam: Harwood Academic Publishers.).

Thomson, N.R., Howard, S., Wren, B.W., Holden, M.T., Crossman, L., Challis, G.L., Churcher, C., Mungall, K., Brooks, K., Chillingworth, T., et al. (2006). The complete genome sequence and comparative genome analysis of the high pathogenicity Yersinia enterocolitica strain 8081. PLoS Genet. 2: e206.

Toba, M., Masaki, H., and Ohta, T. (1988). Colicin E8, a DNase which indicates an evolutionary relationship between colicins E2 and E3. J. Bacteriol. 170, 3237–3242.

Tokuda, H., and Konisky, J. (1978). Mode of action of colicin Ia: effect of colicin on the Escherichia coli proton electrochemical gradient. Proc. Natl. Acad. Sci. U. S. A. 75, 2579–2583.

Tomita, K., Ogawa, T., Uozumi, T., Watanabe, K., and Masaki, H. (2000). A cytotoxic ribonuclease which specifically cleaves four isoaccepting arginine tRNAs at their anticodon loops. Proc. Natl. Acad. Sci. U. S. A. 97, 8278–8283.

Tomizawa, J., and Itoh, T. (1981). Plasmid ColE1 incompatibility determined by interaction of RNA I with primer

100 transcript. Proc. Natl. Acad. Sci. U. S. A. 78, 6096–6100.

Toora, S. (1995a). Application of Yersinia kristensenii bacteriocin as a specific marker for the rapid identification of suspected isolates of Yersinia enterocolitica. Lett. Appl. Microbiol. 20, 171–174.

Toora, S. (1995b). Partial purification and characterization of bacteriocin from Yersinia kristensenii. J. Appl. Bacteriol. 78, 224–228.

Toora, S., Budu-Amoako, E., Ablett, R. f., and Smith, J. (1994). Inhibition and inactivation of pathogenic serogroups of Yersinia enterocolitica by a bacteriocin produced by Yersinia kristensenii. Lett. Appl. Microbiol. 19, 40–43.

Traub, I., and Braun, V. (1994). Energy-coupled colicin transport through the outer membrane of Escherichia coli K-12: mutated TonB proteins alter receptor activities and colicin uptake. FEMS Microbiol. Lett. 119, 65–70.

Vakharia-Rao, H., Kastead, K.A., Savenkova, M.I., Bulathsinghala, C.M., and Postle, K. (2007). Deletion and substitution analysis of the Escherichia coli TonB Q160 region. J. Bacteriol. 189, 4662–4670.

Vankemmelbeke, M., Zhang, Y., Moore, G.R., Kleanthous, C., Penfold, C.N., and James, R. (2009). Energy-dependent immunity protein release during tol-dependent nuclease colicin translocation. J. Biol. Chem. 284, 18932–18941.

Vetter, I.R., Parker, M.W., Tucker, A.D., Lakey, J.H., Pattus, F., and Tsernoglou, D. (1998). Crystal structure of a colicin N fragment suggests a model for toxicity. Struct. Lond. Engl. 1993 6, 863–874.

Viejo, M.B., Gargallo, D., Ferrer, S., Enfedaque, J., and Regué, M. (1992). Cloning and DNA sequence analysis of a bacteriocin gene of Serratia marcescens. J. Gen. Microbiol. 138 Pt 8, 1737–1743.

Vollmer, W., Pilsl, H., Hantke, K., Höltje, J.V., and Braun, V. (1997). Pesticin displays muramidase activity. J. Bacteriol. 179, 1580–1583.

Van der Wal, F.J., Luirink, J., and Oudega, B. (1995). Bacteriocin release proteins: mode of action, structure, and biotechnological application. FEMS Microbiol. Rev. 17, 381–399.

Walker, G.C. (1977). Plasmid (pKM101)-mediated enhancement of repair and mutagenesis: dependence on chromosomal genes in Escherichia coli K-12. Mol. Gen. Genet. MGG 152, 93–103.

Walker, G.C. (1995). SOS-regulated proteins in translesion DNA synthesis and mutagenesis. Trends Biochem. Sci. 20, 416–420.

Walker, D., Mosbahi, K., Vankemmelbeke, M., James, R., and Kleanthous, C. (2007). The role of electrostatics in colicin nuclease domain translocation into bacterial cells. J. Biol. Chem. 282, 31389–31397.

Walker, D.C., Georgiou, T., Pommer, A.J., Walker, D., Moore, G.R., Kleanthous, C., and James, R. (2002). Mutagenic scan of the H-N-H motif of colicin E9: implications for the mechanistic enzymology of colicins, homing enzymes and apoptotic endonucleases. Nucleic Acids Res. 30, 3225–3234.

Wauters, G., Kandolo, K., and Janssens, M. (1987). Revised biogrouping scheme of Yersinia enterocolitica. Contrib.

101 Microbiol. Immunol. 9, 14–21.

Wauters, G., Aleksić, S., Charlier, J., and Schulze, G. (1991). Somatic and flagellar antigens of Yersinia enterocolitica and related species. Contrib. Microbiol. Immunol. 12, 239–243.

Werren, J.H., Skinner, S.W., and Huger, A.M. (1986). Male-killing bacteria in a parasitic wasp. Science 231, 990–992.

Wertz, J.E., and Riley, M.A. (2004). Chimeric nature of two plasmids of Hafnia alvei encoding the bacteriocins alveicins A and B. J. Bacteriol. 186, 1598–1605.

Wiener, M. (2005). TonB-dependent outer membrane transport: going for Baroque? Curr. Opin. Struct. Biol. 15, 394–400.

Wiener, M., Freymann, D., Ghosh, P., and Stroud, R.M. (1997). Crystal structure of colicin Ia. Nature 385, 461–464.

Wilkes, T.E., Darby, A.C., Choi, J.-H., Colbourne, J.K., Werren, J.H., and Hurst, G.D.D. (2010). The draft genome sequence of Arsenophonus nasoniae, son-killer bacterium of Nasonia vitripennis, reveals genes associated with virulence and symbiosis. Insect Mol. Biol. 19 Suppl 1, 59–73.

Wooley, R.E., Gibbs, P.S., and Shotts, E.B., Jr (1999). Inhibition of Salmonella typhimurium in the chicken intestinal tract by a transformed avirulent avian Escherichia coli. Avian Dis. 43, 245–250.

Xu, C., Wang, S., Ren, H., Lin, X., Wu, L., and Peng, X. (2005). Proteomic analysis on the expression of outer membrane proteins of Vibrio alginolyticus at different sodium concentrations. Proteomics 5, 3142–3152.

Yamada, M., Ebina, Y., Miyata, T., Nakazawa, T., and Nakazawa, A. (1982). Nucleotide sequence of the structural gene for colicin E1 and predicted structure of the protein. Proc. Natl. Acad. Sci. U. S. A. 79, 2827–2831.

Yamashita, E., Zhalnina, M.V., Zakharov, S.D., Sharma, O., and Cramer, W.A. (2008). Crystal structures of the OmpF porin: function in a colicin translocon. EMBO J. 27, 2171–2180.

Yang, H., Wan, L., Li, X., Cai, H., Chen, L., Li, S., Li, Y., Cheng, J., and Lu, X. (2007). High level expression of His- tagged colicin 5 in E. coli and characterization of its narrow-spectrum bactericidal activity and pore-forming action. Protein Expr. Purif. 54, 309–317.

Ye, J., and van den Berg, B. (2004). Crystal structure of the bacterial nucleoside transporter Tsx. EMBO J. 23, 3187–3195.

Yokota, N., Kuroda, T., Matsuyama, S., and Tokuda, H. (1999). Characterization of the LolA-LolB system as the general lipoprotein localization mechanism of Escherichia coli. J. Biol. Chem. 274, 30995–30999.

Zakharov, S.D., and Cramer, W.A. (2004). On the mechanism and pathway of colicin import across the E. coli outer membrane. Front. Biosci. J. Virtual Libr. 9, 1311–1317.

Zakharov, S.D., Eroukova, V.Y., Rokitskaya, T.I., Zhalnina, M.V., Sharma, O., Loll, P.J., Zgurskaya, H.I., Antonenko, Y.N., and Cramer, W.A. (2004a). Colicin occlusion of OmpF and TolC channels: outer membrane translocons for colicin import. Biophys. J. 87, 3901–3911.

102 Zakharov, S.D., Kotova, E.A., Antonenko, Y.N., and Cramer, W.A. (2004b). On the role of lipid in colicin pore formation. Biochim. Biophys. Acta 1666, 239–249.

Zakharov, S.D., Zhalnina, M.V., Sharma, O., and Cramer, W.A. (2006). The colicin E3 outer membrane translocon: immunity protein release allows interaction of the cytotoxic domain with OmpF porin. Biochemistry (Mosc.) 45, 10199– 10207. de Zamaroczy, M., Mora, L., Lecuyer, A., Géli, V., and Buckingham, R.H. (2001). Cleavage of colicin D is necessary for cell killing and requires the inner membrane peptidase LepB. Mol. Cell 8, 159–168.

Zarivach, R., Ben-Zeev, E., Wu, N., Auerbach, T., Bashan, A., Jakes, K., Dickman, K., Kosmidis, A., Schluenzen, F., Yonath, A., et al. (2002). On the interaction of colicin E3 with the ribosome. Biochimie 84, 447–454.

Zeth, K. (2012). Structure and uptake mechanism of bacteriocins targeting peptidoglycan renewal. Biochem. Soc. Trans. 40, 1560–1565.

Zeth, K., Römer, C., Patzer, S.I., and Braun, V. (2008). Crystal structure of colicin M, a novel phosphatase specifically imported by Escherichia coli. J. Biol. Chem. 283, 25324–25331.

Zhang, Y.L., and Cramer, W.A. (1993). Intramembrane helix-helix interactions as the basis of inhibition of the colicin E1 ion channel by its immunity protein. J. Biol. Chem. 268, 10176–10184.

Zhang, Y., Li, C., Vankemmelbeke, M.N., Bardelang, P., Paoli, M., Penfold, C.N., and James, R. (2010). The crystal structure of the TolB box of colicin A in complex with TolB reveals important differences in the recruitment of the common TolB translocation portal used by group A colicins. Mol. Microbiol. 75, 623–636.

Zheng, H., Sun, Y., Lin, S., Mao, Z., and Jiang, B. (2008a). Yersinia enterocolitica infection in diarrheal patients. Eur. J. Clin. Microbiol. Infect. Dis. Off. Publ. Eur. Soc. Clin. Microbiol. 27, 741–752.

Zheng, H., Sun, Y., Mao, Z., and Jiang, B. (2008b). Investigation of virulence genes in clinical isolates of Yersinia enterocolitica. FEMS Immunol. Med. Microbiol. 53, 368–374.

103

III. SUPPLEMENTS

7. SUPPLEMENTS

7.1. Acronyms and abbreviations

A.U. - arbitrary unit AMC - amoxicillin with clavulanic acid AMP - ampicillin ATM - aztreonam BAC - bacterial artificial chromosome BLAST - basic local aligment search tool C - chloramphenicol CAZ - ceftazidime CCM - The Czech Collection of Microorganisms C-domain - colicin cytotoxic domain CIP - ciprofloxacin CN - gentamicin Col-plasmid - colicinogenic plasmid CT - colistin sulphate CTAB - cetyltrimethylammonium bromide CTX - cefotaxime CXM - cefuroxime DO - doxycycline EDTA - ethylenediaminetetraacetic acid GRAS - generally recognized as save; compounds for food industry H/H hairpin - helix/helix hairpin H-N-H motif - histidine-asparagine-histidine motif inc - plasmid incompatibility region KF - cephalothin LMU - The Ludwig-Maximilians University of Munich LPS - lipolisacharide Ni-NTA - nickel-nitriloacetic acid NIPH - The National Institut of Public Health NKBOR - Tn10 minitranspozon OA - oxolinic acid ORF - open reading frame ori - plasmid origin of replication pCol - colicinogenic plasmid pNKBOR - R6K origin -based suicide vector R-domain - colicin receptor binding domain SDS - sodium dodecyl sulfate SOC medium - Super optimal broth with catabolite repression SXT - sulfamethoxazole-trimethoprim TBTDs - TonB-dependent transporters T-domain – colicin translocation domain TE - Tris-EDTA buffer

107 TrisHCl - tris(hydroxymethyl)aminomethane hydrochloride TY - trypton-yeast UHB - The University Hospital Brno UPGMA - unweighted pair group method with arithmetic mean

108 7.2. Supplementary data TABLE S1. NKBOR insertions of clones obtained from in vivo mutagenesis

a b Strain Susceptibility to FY Target sequence Method Y. kristensennii R1 - YiuR SEQ Y. kristensennii R2 - YiuR RE Y. kristensennii R3 - YiuR SEQ Y. kristensennii R4 - YiuR RE Y. kristensennii R5 - YiuR SEQ Y. kristensennii R6 - YiuR SEQ Y. kristensennii R7 - YiuR SEQ Y. kristensennii R8 - YiuR PCR Y. kristensennii R9 - YiuR SEQ Y. kristensennii R10 - YiuR SEQ Y. kristensennii R 11 - YiuR SEQ Y. kristensennii R12 1 YiuC SEQ Y. kristensennii R13 - YiuR RE Y. kristensennii R14 - YiuR SEQ Y. kristensennii R15 - YiuR SEQ Y. kristensennii R16 - YiuR RE Y. kristensennii R17 1 YiuC SEQ Y. kristensennii R18 1 YiuC SEQ Y. kristensennii R19 - YiuR RE Y. kristensennii R20 - YiuR RE Y. kristensennii R21 2 Ferritin (YE1795) SEQ Y. kristensennii R22 - YiuR RE Y. kristensennii R23 - YiuR RE Y. kristensennii R24 - YiuR SEQ Y. kristensennii R25 - YiuR SEQ Y. kristensennii R26 0 YiuB SEQ Y. kristensennii R27 - YiuR SEQ Y. kristensennii R28 - YiuR PCR Y. kristensennii R29 - YiuR RE Y. kristensennii R30 - YiuR RE Y. kristensennii R31 - YiuR PCR Y. kristensennii R32 - YiuR SEQ Y. kristensennii R33 - YiuR PCR Y. kristensennii R34 - YiuR PCR Y. kristensennii R35 0 Outside of gene yiuR PCR Y. kristensennii R36 - YE1461 PCR Y. kristensennii R37 2 Ferritin (YE1795) SEQ

109 a b Strain Susceptibility to FY Target sequence Method Y. kristensennii R38 - YiuR SEQ Y. kristensennii R39 - YiuR SEQ Y. kristensennii R40 - YiuR SEQ Y. kristensennii R41 - YiuR PCR Y. kristensennii R42 - YiuR SEQ Y. kristensennii R43 - YiuR RE Y. kristensennii R44 - YiuR PCR Y. kristensennii R45 - YiuR SEQ Y. kristensennii R46 - YiuR PCR Y. kristensennii R47 2 Rotamase (YE3130) SEQ Y. kristensennii R48 - YiuR PCR Y. kristensennii R49 - YiuR PCR Y. kristensennii R50 - YiuR PCR a Numbers indicate the highest colicin dilution causing an inhibition zone, e.g. 2 = 102. Control strain Y. kristensenii 276 showed susceptibility 2. - = non susceptible b Method used for identification of the sequence with NKBOR insertion. SEQ – sequencing; RE – restriction pattern of ligation mixture; PCR – length of the PCR product after specific amplification of yiuR.

110 TABLE S2. Collection of Y. enterocolitica isolates and their detailed characterization

Virulence Sero- Bio ATB markers Titer of Geographical e Strain Subspecies a b c d Source Note type type type colicin FY origin ail ystA virF YE 1 palearctica O:3 4 A13 + + - 256/4096 Czech Republic Human 5Ye03 YE 2 palearctica O:3 4 A2 + + - 256/4096 Czech Republic Human 15Ye03 YE 3 palearctica O:3 4 A2 + + - 256/4096 Czech Republic Human 1Ye06 YE 4 palearctica O:3 4 A1 + + - 64/4096 Czech Republic Human 3Ye07 YE 5 palearctica O:3 4 A2 + + - 64/4096 Czech Republic Human 6Ye07 YE 6 palearctica O:3 4 A1 + + - 64/1024 Czech Republic Human 7Ye07 YE 7 palearctica O:3 4 A1 + + - 256/4096 Czech Republic Human 1Ye08 YE 8 palearctica O:3 4 A1 + + - 64/1024 Czech Republic Human 2Ye08 YE 9 palearctica O:3 4 A 11 + + - 64/4096 Czech Republic Human 3Ye08 YE 10 palearctica O:3 4 A1 + + - 64/1024 Czech Republic Human 7Ye08 YE 11 palearctica O:9 1/2 A1 - - - 64/1024 Unknown Unknown - YE 12 palearctica O:3 4 A1 + + - 256/4096 Czech Republic Human 1Ye10 YE 13 palearctica O:3 4 A2 + + - 64/4096 Czech Republic Human 4Ye09 YE 14 palearctica O:3 4 A1 + + - 64/4096 Czech Republic Human 7Ye09 YE 15 palearctica O:3 4 A1 + + - 256/16384 Czech Republic Human 8Ye08 YE 16 palearctica O:3 4 A14 + + - 256/4096 Czech Republic Human 7Ye06 YE 17 palearctica O:8 1A A3 - - - 64/16384 Czech Republic Human 5Ye06 YE 18 palearctica O:9 1/2 A1 + + - 256/4096 Unknown Unknown - YE 19 palearctica O:5 1A A4 - - - 64/1024 Czech Republic Human 1Ye03 YE 20 palearctica O:3 4 A2 + + - 64/1024 Czech Republic Human 7578 YE 21 palearctica O:3 4 A2 + + + 256/4096 Czech Republic Human 7782 YE 22 palearctica O:3 4 A2 + + - 256/4096 Czech Republic Human 8008 YE 23 palearctica O:3 4 A2 + + - 256/1024 Czech Republic Human 7886 YE 24 palearctica O:3 4 A2 + + + 64/1024 Czech Republic Human 8472 YE 25 palearctica O:3 4 A1 + + + 256/4096 Czech Republic Human 8773 YE 26 palearctica O:3 4 A1 + + + 64/1024 Czech Republic Human 8703 YE 27 palearctica O:3 4 A1 + + - 64/4096 Czech Republic Human 8886 YE 28 palearctica O:3 4 A2 + + + 256/4096 Czech Republic Human 9081 YE 29 palearctica O:3 4 A12 + + + 64/4096 Czech Republic Human 9102 YE 30 palearctica O:3 4 A1 + + + 256/4096 Czech Republic Human 9464 YE 31 palearctica O:3 4 A1 + + + 64/1024 Czech Republic Human 10141 YE 32 palearctica O:3 4 A1 + + + 64/1024 Czech Republic Human 9953 YE 33 palearctica O:3 4 A2 + + - 64/4096 Czech Republic Human 9949 YE 34 palearctica O:3 4 A1 + + - 64/4096 Czech Republic Human 2209 YE 35 palearctica O:3 4 A1 + + + 64/4096 Czech Republic Human 3033 YE 36 palearctica O:3 4 A1 + + - 64/1024 Czech Republic Human 3316 YE 37 palearctica O:3 4 A1 + + + 256/4096 Czech Republic Human 7392 YE 38 palearctica O:3 4 A9 + + - 256/4096 Czech Republic Human 7250 YE 39 palearctica O:3 4 A9 - + + 256/16384 Czech Republic Human 4749 YE 40 palearctica O:3 4 A1 + + + 64/4096 Czech Republic Human 5258 YE 41 palearctica O:3 4 A1 + + - 256/16384 Czech Republic Human 4466 YE 42 palearctica O:3 4 A6 + + - 256/16384 Czech Republic Human 6050

111 Virulence Sero- Bio ATB markers Titer of Geographical e Strain Subspecies a b c d Source Note type type type colicin FY origin ail ystA virF YE 43 palearctica O:3 4 A6 + + - 256/16384 Czech Republic Human 7668 YE 44 palearctica O:3 4 A1 + + + 64/4096 Czech Republic Human 7563 YE 45 palearctica O:3 4 A2 + + + 64/1024 Czech Republic Human 7731 YE 46 palearctica O:3 4 A2 + + + 64/16384 Czech Republic Human 7852 YE 47 palearctica O:3 4 A10 - + - 256/4096 Czech Republic Human 9105 YE 48 palearctica O:3 4 A2 + + + 256/16384 Czech Republic Human 7852b YE 49 palearctica O:3 4 A20 + + + 256/4096 Czech Republic Human 9400 YE 50 palearctica O:3 4 A1 + + - 256/16384 Czech Republic Human 146 YE 51 palearctica O:3 4 A1 + + - 64/4096 Czech Republic Human 8523 YE 52 palearctica O:3 4 A3 + + - 64/1024 Czech Republic Human 8381 YE 53 palearctica O:3 4 A1 + + + 64/4096 Czech Republic Human 823 YE 54 palearctica O:3 4 A1 + + + 64/4096 Czech Republic Human 1541 YE 55 palearctica O:3 4 A1 + + + 64/1024 Czech Republic Human 3504 YE 56 palearctica O:3 4 A2 + + + 64/1024 Czech Republic Human 4364 YE 57 palearctica O:3 4 A3 + + + 64/4096 Czech Republic Human 7825 YE 58 palearctica O:3 4 A 11 + + + 256/4096 Czech Republic Human 8264 YE 59 palearctica O:3 4 A1 + + + 64/4096 Czech Republic Human 8282 YE 60 palearctica O:3 4 A10 + + + 64/4096 Czech Republic Human 9375 YE 61 palearctica O:36 1A A4 + + + 64/256 Japan Water IP2222 YE 62 palearctica O:3 * 2/3 A4 + + - 256/16384 Unknown Unknown gk132 YE 63 palearctica O:3 * 5 A3 + + + 256/1024 Unknown Hare gk1142 YE 64 palearctica O:3 * 5 A1 + + + 256/4096 Unknown Unknown gk2943 YE 65 palearctica O:3 * 2/3 A8 + + - 256/16384 Unknown Human JDE029 YE 66 palearctica O:36 1A A4 - - - 64/256 Unknown Unknown Y101 YE 67 palearctica O:3 4 A1 + + - 64/256 Unknown Pig Y141 YE 68 palearctica O:3 4 A1 + + - 256/1024 Unknown Pig Y142 YE 69 palearctica O:3 4 A1 + + + 64/256 Poland Human 40/97 YE 70 palearctica O:3 4 A1 + + + 256/4096 Poland Human 146/97 YE 71 palearctica O:3 4 A1 + + + 256/1024 Poland Human 241/97 YE 72 palearctica O:3 4 A1 + + + 256/1024 Poland Human 120/98 YE 73 palearctica O:3 4 A1 + + + 64/256 Poland Human 683/98 YE 74 palearctica O:3 4 A1 + + + 256/4096 Poland Human 910/98 YE 75 palearctica O:3 4 A1 + + + 64/256 Poland Human 120/99 YE 76 palearctica O:3 4 A3 + + + 64/1024 Poland Human 128/99 YE 77 palearctica O:3 4 A1 + + + 64/1024 Poland Human 627/99 YE 78 palearctica O:3 4 A1 + + + 64/1024 Poland Human 99/96 YE 79 palearctica O:3 4 A1 + + + 256/4096 Poland Human 243/96 YE 80 palearctica O:3 4 A3 + + + 256/4096 Poland Human 252/96 YE 81 palearctica O:3 4 A1 + + + 64/256 Poland Human 353/96 YE 82 palearctica O:3 4 A5 + + + 256/16384 Poland Human 159/97 YE 83 palearctica O:3 4 A1 + + + 64/1024 Poland Human 184/97 YE 84 enterocolitica O:8 1B A5 - + - 1024/65536 USA Unknown IP636 YE 85 enterocolitica O:8 1B A15 + + - 256/4096 USA Unknown IP19049

112 Virulence Sero- Bio ATB markers Titer of Geographical e Strain Subspecies a b c d Source Note type type type colicin FY origin ail ystA virF YE 86 palearctica O:9 2 A3 + + - 64/256 France Human IP22393 YE 87 palearctica O:9 2 A3 + + - 256/4096 France Unknown IP22394 YE 88 palearctica O:5,27 2 A3 + + - 256/1024 USA Human IP199 YE 89 palearctica O:5,27 2 A7 + + - 256/4096 Great Britain Human IP885 YE 90 palearctica O:5,27 2 A17 + + - 256/1024 Japan Unknown IP1607 YE 91 palearctica O:5,27 2 A4 + + + 64/1024 Australia Human IP22460 YE 92 palearctica O:3 * 2/3 A3 + + - 256/1024 Netherlands Chinchilla IP135 YE 93 palearctica O:3 3 A7 + + + 1024/4096 Japan Human IP24231 YE 94 palearctica O:3 3 A8 + + + 256/4096 Japan Human IP24232 YE 95 palearctica O:3 4 A1 + + - 64/1024 Sweden Human Y244 YE 96 palearctica O:3 4 A1 + + + 256/4096 France Human IP21981 YE 97 palearctica O:3 4 A1 + + - 1024/4096 Japan Human IP1601 YE 98 palearctica O:3 4 A1 + + - 64/4096 China Human IP19718 YE 99 palearctica O:3 4 A3 + + + 256/16384 Great Britain Human IP23222 YE 100 palearctica O:3 4 A2 + + + 64/4096 Brazil Human IP23357 YE 101 palearctica O:3 4 A19 + + + 256/4096 New Caledonia Human IP24309 YE 102 palearctica O:3 4 A1 + + + 64/1024 South Africa Human IP7032 YE 103 palearctica O:3 4 A1 + + - 64/4096 Hungary Human IP3692 YE 104 palearctica O:3 4 A1 + + - 64/1024 Canada Human IP4115 YE 105 palearctica O:3 4 A18 + + - 256/16384 Australia Human IP25728 YE 106 palearctica O:3 4 A5 + + + 64/1024 New Zealand Human IP23230 YE 107 palearctica O:3 * 5 A5 + + - 64/4096 France Hare IP1 YE 108 palearctica O:3 * 5 A16 - + - 256/4096 Great Britain Hare IP178 YE 109 palearctica O:6,30 1A A3 - + + 64/4096 Denmark Human IP102 YE 110 palearctica O:5 1A A3 - + + 64/1024 France Pony IP124 a Serotypes O:1 and O:2 were combined to O:3 serotype according to Aleksic and Bockemuhl (1984). b Five isolates could not be assigned to a single biotype based on the variability of the used tests. Further biotype differ- entiations of these isolates were not performed. c ATBtypes (antibiograms) described in detail are shown in Table 7. d Numbers indicate the highest colicin dilution causing a clear/turbid zone. e Original designation of the strain.

113 TABLE S3. Susceptibility of Escherichia strains to pore-forming colicins

Colicin activitya

Strain U Y K L B E1 Ia 5 A S4 FY E. coli 5K (control) 4 4 4 3 5 5 3 4 1 4 3b E. coli B1 - - - - - 0 - - - - - E. coli B2 2 2 2 0 3 4 2 3 1 3 - E. coli B6 2 2 2 - 1 2 0 2 - 2 - E. coli B8 3 3 1 - - 2 - 1 - - - E. coli B9 1 1 - - - 0 - - - 0 - E. coli B10 3 2 1 - 0 1 0 1 - 1 - E. coli B14 3 3 1 - 0 2 - 1 - - - E. coli B15 3 3 2 0 2 3 - 3 1 3 - E. coli B17 4 3 2 - 3 2 2 2 1 3 - E. coli B21 4 3 2 - 3 4 3 3 1 3 - E. coli B50 1 2 0 - - 1 - 0 - 1 - E. coli B53 1 2 - - - 1 - - - - - E. coli B57 2 2 0 - - 2 0 0 - - - E. coli B61 2 2 1 1 - 1 0 1 - 1 - E. coli B63 2 2 - - - 0 - - - - - E. coli B64 1 1 - - - 1 - 0 - 0 - E. coli B66 3 3 1 - - 2 - 1 - - - E. coli B71 2 2 2 0 - 1 - 1 - 2 - E. coli B73 2 2 - 1 - 1 0 0 - 1 - E. coli B74 1 0 - - - 1 - - - - - E. coli B685 1 0 ------0 - E. coli B688 1 1 - - - 1 1 - - 0 - E. coli B692 - - - 1 - 0 - - - 2 - E. coli B705 1 2 - - - 2 2 - - - - E. coli B710 1 2 - - - 0 - - - 0 - E. coli B714 0 1 ------E. coli B716 - - - 0 - 2 2 - - 0 - E. coli B721 1 2 - - - 1 1 - - - - E. coli B 1191 ------E. coli B 1194 - - - 1 ------E. coli B1805 2 2 0 - - 0 1 - - - - E. coli B1830 2 3 1 - - 2 - 0 - 1 - E. coli B1835 1 2 - - - - 0 - - 0 - E. coli B1842 1 1 - - - 1 - 0 - - - E. coli B1846 0 1 - - - 0 0 - - 1 - E. coli B1862 ------E. coli B1864 2 2 0 - - 2 - - - - -

114 Colicin activitya

Strain U Y K L B E1 Ia 5 A S4 FY E. coli B1899 2 2 0 - - 1 - 0 - - - E. coli B1900 ------E. fergusonii 873 - - - 3 - - - 2 - - - E. fergusonii 1430 - - - 3 ------E. fergusonii 1211 - - - 3 - - - 2 - - - E. fergusonii 1799 2 2 - - 3 5 1 2 - - - E. fergusonii 1082 2 3 - - 5 5 - 2 - - - E. fergusonii 1667 2 2 - - 2 5 0 2 - - - E. fergusonii 28525 3 3 0 0 5 5 2 3 - - - E. fergusonii 2042 3 3 0 0 5 5 1 3 - - - E. fergusonii 2195 1 1 - - 1 2 0 0 - - - E. fergusonii B339 ------E. hermanii 2098 ------E. hermanii 2123 ------E. hermanii 2129 ------E. hermanii 2457 ------E. hermanii 2446 ------E. hermanii 2423 ------E. hermanii 2419 ------E. hermanii 2400 ------E. hermanii 2399 ------E. hermanii 2295 ------E. hermanii 2475 ------E. hermanii 2487 ------E. hermanii 2497 ------E. hermanii 2512 ------E. hermanii 2517 ------E. hermanii 2519 2 2 1 ------E. hermanii 2520 ------E. hermanii 2527 ------E. hermanii 2531 ------E. hermanii 2 611 ------E. hermanii 2698 ------E. hermanii 2704 ------E. hermanii 2701 ------E. hermanii 2683 ------E. hermanii 2654 ------E. hermanii 2645 ------E. hermanii 2640 ------

115 Colicin activitya

Strain U Y K L B E1 Ia 5 A S4 FY E. hermanii 2724 ------E. hermanii 10/K02 ------E. hermanii 45/E04 ------E. hermanii 48/E05 ------E. hermanii 17/E05 ------E. hermanii 14/E06 ------E. hermanii 59/K06 ------E. hermanii 61/E06 ------E. hermanii 62/E06 ------E. hermanii 63/E06 ------E. hermanii 27/E07 ------E. hermanii 3666 ------E. hermanii 3667 2 1 0 ------E. hermanii 3668 ------E. hermanii 4037 ------E. vulneris 2728 - - - - - 1 - - - - - E. vulneris 2682 - - - - - 0 - - - - - E. vulneris 2663 - - - - - 1 - - - - - E. vulneris 2165 0 0 - - - 1 - - - - - E. vulneris 2161 0 0 - - - 2 - - - - - E. vulneris 2136 - - - - - 0 - - - - - E. vulneris 2131 - - - - - 0 - - - - - E. vulneris 1549 0 0 - - - 1 1 - - - - E. vulneris 1587 - - - - - 1 - - - - - E. vulneris 1645 - - - - - 1 - - - - - E. vulneris 1650 - - - 1 ------E. vulneris 1566 - - - - - 0 - - - - - E. vulneris 30056 0 0 - - - 1 - - - - - E. vulneris 2150 - - - - - 0 - - - - - E. vulneris 2493 0 0 - - - 2 - - - - - E. vulneris 1723 ------E. vulneris 2481 0 0 - - - 1 - - - - - E. vulneris 19/E05 - - - - - 1 - - - - - E. vulneris 24/E05 - - - - - 2 - - - - - E. vulneris 13/E06 0 0 - - - 2 - - - - - E. vulneris 90/03K - - - - - 1 - - - - - E. vulneris 13/E07 ------E. vulneris 12/E07 - - - - - 1 - - - - - E. vulneris 6381 - - - - - 1 - - - - - E. vulneris 6382 1 1 0 - - 3 - - - - -

116 E. vulneris 6383 0 0 - - - 2 - - - - - E. vulneris 4038 - - - - - 0 - - - - - a Numbers indicate the highest colicin dilution causing a inhibition zone, e.g. 2 = 102. - = non susceptible b Y. enterocolitica was used as a positive control for colicin FY activity.

117 7.3. List of publications and meeting contributions

Publications in impacted journals

MICENKOVÁ, Lenka, Barbora ŠTAUDOVÁ, Juraj BOSÁK, LENKA MIKALOVÁ, Simona LITTNEROVÁ, Martin VRBA, Alena ŠEVČÍKOVÁ, Vladana WOZNICOVÁ, and David ŠMAJS (2013) Prevalence of bacteriocin-encoding genes positively correlates with the prevalence of E. coli virulence determinants. BMC Microbiology [submitted]

BOSÁK, Juraj, Lenka MICENKOVÁ, Martin VRBA, Alena ŠEVČÍKOVÁ, Daniela DĚDIČOVÁ,

Debora GARZETTI, and David ŠMAJS (2013) Unique activity spectrum of colicin FY: all 110 char-

acterized Yersinia enterocolitica isolates were colicin FY susceptible. PLOS ONE [submitted] BOSÁK, Juraj, Petra LAIBLOVA, Jan ŠMARDA, Daniela DĚDIČOVÁ, and David ŠMAJS (2012)

Novel colicin FY of Yersinia frederiksenii inhibits pathogenic Yersinia strains via YiuR-mediated reception, TonB import, and cell membrane pore formation. Journal of Bacteriology, 194 (8):1950-1959.

Publications in nonimpacted journals

BOSÁK, Juraj (2013) Obří viry – dlouho utajovaná část světa virů. Bulletin Československé společnosti mikrobiologické, 54 (1): 11-16. BOSÁK, Juraj. (2012) Jak objev obrovských virů ovlivnil definici živého organizmu. Universitas, 3:3-11.

Meeting contributions - oral presentation

BOSÁK, Juraj and David ŠMAJS. Kolicin FY inhibuje růst kmenů Yersinia enterocolitica. 26. Kongres Československé společnosti mikrobiologické. 2013

BOSÁK, Juraj and David ŠMAJS. Účinek kolicinu FY na kmeny Yersinia enterocolitica. Čo nového v mikrobiológii. 2013

BOSÁK, Juraj Produkce kolicinu FY – nová vlastnost probiotických kmenů? 57. Studentská vědecká konference LF MU. 2013 BOSÁK, Juraj and David ŠMAJS. Bakteriociny čeledi Enterobacteriaceae účinkující na patogenní bakterie. Aktuality v mikrobiologii. 2012

BOSÁK, Juraj and David ŠMAJS. Identifikácia receptoru nového kolicínu YF . 54. Studentská vědecká konference LF MU. 2010 BOSÁK, Juraj and David ŠMAJS. Playing with OmpA: identification of colicin-recognizing epitope of OmpA receptor. The student scientific conference of genetically modified organisms. 2010 BOSÁK, Juraj, Petra KOTRSALOVÁ, and David ŠMAJS. Bakteriocín kmeňa Yersinia frederiksenii 27601. XIII. Setkání biochemiků a molekulárních biologů. 2009

BOSÁK, Juraj, Petra KOTRSALOVÁ, David ŠMAJS, and Jan ŠMARDA. Kolicin FY - nový bakteri- ocín rodu Yersinia. XVIII. Tomáškovy dny. 2009 BOSÁK, Juraj and David ŠMAJS. Nový bakteriocín rodu Yersinia. 53. Studentská vědecká konference LF MU. 2009 BOSÁK, Juraj and David ŠMAJS. Interakcie kolicínov U a Y s receptorom OmpA. 52. Studentská vědecká konference LF MU. 2008 BOSÁK, Juraj and David ŠMAJS. Rozdiely v interakcii kolicínov U a Y s receptorom OmpA. Setkání biochemiků a molekulárních biologů. 2008

118 BOSÁK, Juraj and David ŠMAJS. Molekulárne mapovanie interakcií kolicinov U a Y s receptorom OmpA. 51. Studentská vědecká konference. 2007 BOSÁK, Juraj and David ŠMAJS. Zmapovanie interakcií kolicínov U a Y s receptorom OmpA. Tomáškovy dny. 2006

Meeting contributions - poster presentation

BOSÁK, Juraj, Lenka MICENKOVÁ, and David ŠMAJS Colicin FY inhibits a broad spectrum of Y. enterocolitica isolates. BioMicroWorld. 2013 BOSÁK, Juraj, Petra LAIBLOVÁ, Daniela DĚDIČOVÁ, Jan ŠMARDA, and David ŠMAJS. Colicin

FY – a bacteriocin specifically killing pathogenic strains of Y. enterocolitica. 22nd European Congress of Clinical Microbiology and Infectious Diseases. 2012 BOSÁK, Juraj, Radovan FIŠER, Ivo KONOPÁSEK, and David ŠMAJS. Novel pore-forming colicin

FY identified in the genus Yersinia. How bugs kill bugs: progress and challenges in bacteriocin research. 2012

BOSÁK, Juraj, Petra KOTRSALOVÁ, Jan ŠMARDA, and David ŠMAJS. Colicin FY – a novel bacteriocin of Yersinia frederiksenii. 15th European Workshop on Bacterial Protein Toxins. 2011 BOSÁK, Juraj, Petra KOTRSALOVÁ, D. DĚDIČOVÁ, Jan ŠMARDA, and David ŠMAJS. Nový kolicín rodu Yersinia. Genetická konference GSGM. 2011 BOSÁK, Juraj, Petra KOTRSALOVÁ, D. DĚDIČOVÁ, Jan ŠMARDA, and David ŠMAJS. Nový kolicín rodu Yersinia. 25. Kongres Československé společnosti mikrobiologické. 2010

Meeting contributions - co-authorship

OLEJNICKOVA Katarína, Eva CHALOUPKOVA, Juraj BOSÁK and David Šmajs. Identification of genes encoding phage tail-like bacteriocins in Pragia fontium, 5th Congress of European Microbiolo- gists (FEMS). 2013 DOLEJŠOVÁ, Tereza, Radovan FIŠER, Juraj BOSÁK, David ŠMAJS and Ivo KONOPÁSEK. Newly

Described Colicin FY from Yersinia frederiksenii Forms Cation Selective Voltage-activated Pores. The 2nd Prato Conference on Pore Forming Proteins. 2012

119