DOCSLIB.ORG

Imported Scrub Typhus: First Case in South America and Review of The

Total Page：16

File Type：pdf, Size：1020Kb

Download full-text PDF Read full-text
Imported Scrub Typhus: First Case in South America and Review of The Weitzel et al. Tropical Diseases, Travel Medicine and Vaccines (2018) 4:10 https://doi.org/10.1186/s40794-018-0070-8 CASEREPORT Open Access Imported scrub typhus: first case in South America and review of the literature Thomas Weitzel1,2* , Mabel Aylwin2, Constanza Martínez-Valdebenito3, Ju Jiang4, Jose Manuel Munita2, Luis Thompson2, Katia Abarca3 and Allen L. Richards4,5 Abstract Background: Scrub typhus is a neglected vector-borne zoonosis causing life-threatening illnesses, endemic in the Asian-Pacific region and, as recently discovered, in southern Chile. Scrub typhus is rarely reported in travelers, most probably due to the lack of clinical experience and diagnostic tests in non-endemic countries. We report the first case of imported scrub typhus in South America. Case presentation: A 62-year-old tourist from South Korea presented severely ill with fever, rash, and eschar in Santiago, Chile. Laboratory exams showed thrombocytopenia and elevated inflammation parameters, hepatic enzymes, and LDH. With the clinical suspicion of scrub typhus, empirical treatment with doxycycline was initiated and the patient recovered rapidly and without complications. The diagnosis was confirmed by IgM serology and by real-time PCR, which demonstrated infection with Orientia tsutsugamushi (Kawasaki clade). Conclusions: Only due to the emerging clinical experience with endemic South American scrub typhus and the recent implementation of appropriate diagnostic techniques in Chile, were we able to firstly identify and adequately manage a severe case of imported scrub typhus in South America. Physicians attending febrile travelers need to be aware of this rickettsiosis, since it requires prompt treatment with doxycycline to avoid complications. Keywords: Arthropod-borne diseases, Scrub typhus, Orientia tsutsugamushi, Travel, Imported infection Background with substantial mortality [2]. Until recently, scrub ty- Scrub typhus is a vector-borne zoonosis caused by phus was associated with a single species, O. tsutsuga- Orientia species that manifests as an acute febrile mushi, which exclusively occurred within the so-called disease and has a potentially severe outcome [1]. It is ‘Tsutsugamushi Triangle’ ranging from Pakistan in the transmitted by the larval stage of trombiculid mites West, far-eastern Russia in the East to northern called ‘chiggers’. After the bite of an infective chigger, a Australia in the South. However, recent reports of characteristic necrotic inoculation lesion termed eschar autochthonous cases in the Middle East and southern might develop, which typically contains high bacterial Chile have reshaped this epidemiological paradigm, loads. The microorganism then spreads via lymphatics suggesting a wider geographical distribution [3, 4]. and blood, causing systemic manifestations and labora- Scrub typhus is very rarely diagnosed in travelers, with tory abnormalities such as elevated C-reactive protein a total of < 40 cases reported in the medical literature. (CRP) and liver enzymes [1]. Although widely under-rec- Still, the problem might be under-recognized, since the ognized, scrub typhus is considered the most important initial clinical suspicion relies on the physicians’ experi- rickettsial infection worldwide threatening over a billion ence, routine laboratory tests are largely unavailable, and people and causing more than a million cases per year only few reference laboratories permit a definite diagno- sis by molecular methods and/or culture. Here we report * Correspondence: [email protected] an Orientia tsutsugamushi infection in a traveler from 1Laboratorio Clínico, Clínica Alemana de Santiago, Facultad de Medicina South Korea visiting Chile, which was confirmed by Clínica Alemana, Universidad del Desarrollo, Av. Vitacura, 5951 Santiago, Chile molecular methods and serology. 2Servicio de Infectología, Clínica Alemana de Santiago, Facultad de Medicina Clínica Alemana, Universidad del Desarrollo, Santiago, Chile Full list of author information is available at the end of the article © The Author(s). 2018 Open Access This article is distributed under the terms of the Creative Commons Attribution 4.0 International License (http://creativecommons.org/licenses/by/4.0/), which permits unrestricted use, distribution, and reproduction in any medium, provided you give appropriate credit to the original author(s) and the source, provide a link to the Creative Commons license, and indicate if changes were made. The Creative Commons Public Domain Dedication waiver (http://creativecommons.org/publicdomain/zero/1.0/) applies to the data made available in this article, unless otherwise stated. Weitzel et al. Tropical Diseases, Travel Medicine and Vaccines (2018) 4:10 Page 2 of 5 Case presentation USA) as well as serological assays (IgM) for EBV, CMV, A 62-year-old South Korean tourist presented with fever, and Parvovirus B19 were all negative. rash, and severe malaise two days after arrival in Chile. Oral treatment with doxycycline (100 mg bid) was He reported flu-like symptoms with chills, headache, initiated in response to clinical suspicion of scrub and myalgia, which had begun five days earlier. The typhus. Blood samples were drawn, the necrotic eschar patient was from Seoul, but had recently visited a farm was removed and placed in 70% alcohol, and a dry swab south of Seoul. At presentation, the patient suffered sample was taken from the base of the unroofed lesion. intense headache and felt severely unwell. He was tachy- The following day, examination of serum by commercial cardic (108 bpm), had an axillar temperature of 38.8 C, ELISA (Scrub Typhus Detect, InBios International Inc., and a generalized, non-pruritic maculopapular rash, Seattle, WA, USA) was positive for IgM and negative for more pronounced on the trunk and sparing palms, soles, IgG antibodies. A commercial indirect IgG immuno- and mucosa (Fig. 1, A and B). On his left posterior thigh, fluorescence test (Fuller Laboratories, Fullerton, CA, there was a painless necrotic lesion with a diameter of USA) utilizing acetone-fixed O. tsutsugamushi strains 6 mm and a surrounding red halo (Fig. 1, C). Complete (Gilliam, Karp, Kato, Boryong) was positive at a dilution blood count showed mild thrombocytopenia (91,000/ of 1:64 for the Karp antigen. DNA preparations from μL), low hemoglobin (13.0 g/dL), and normal leukocytes buffy coat as well as eschar material and swab samples with a left shift (bands, 20%), toxic granulation, and were positive by quantitative real-time PCR (Otsu47) atypical (reactive) lymphocytes. Other laboratory exams targeting the O. tsutsugamushi-specific 47kD protein revealed elevated inflammation parameters (ESR, gene (htrA) using primers and probe described previ- 32 mm/h; CRP, 3.6 mg/dL), slight hyponatremia ously [5]. From the eschar sample, rrs, htrA and 56 kDa (134 mEq/L), elevated hepatic enzymes (AST, 180 U/L; type specific antigen (tsa56) gene fragments were ALT, 161 U/L; GGT 327 U/L; AP, 208 U/L) and LDH successfully amplified using semi-nested PCR assays (718 U/L). A molecular respiratory panel (xTAG® Re- (Table 1). Amplicons were purified and sequenced by spiratory Viral Panel FAST v2; Luminex, Austin, TX, 3500 Genetic Analyzer (Thermo Fisher Scientific, Waltham, MA, USA), the sequences from each primer were assembled with CodonCode Aligner (CodonCode Corporation, Centerville, MA, USA), and the consensus sequence of 1045, 1456 and 1302 bp fragments were obtained for rrs, htrA, and tsa56, respectively. Sequences were deposited in GenBank (accession numbers MG844362 [rrs], MG844360 [htrA], and MG844361 [tsa56]). Blast search (https://blast.ncbi.nlm.nih.gov/ Blast.cgi) revealed that the pathogen was closest to O. tsutsugamushi Kawasaki type strain, with 100% identity for rrs (O. tsutsugamushi Kawasaki) and tsa56, including isolates from Korea (CBNU-2 and IIOC1217) [6] and Japan (Taguchi) [7]. Phylogenetic analysis also showed that the isolate clustered with Kawasaki type strains for both rrs and tsa56, but was not related with the Orientia sp. Chiloe Island isolate recently discovered from Chile (Fig. 2). With antibiotic treatment, fever subsided within 36 h and the patient was discharged after three days. Discussion Although scrub typhus represents an important public health issue in the Asia-Pacific region and is one of the most severe rickettsial infections, it is almost unrecognized in travelers and poorly covered in web- based information platforms and textbooks of Travel Medicine. A review from 2004 includes ~ 20 cases in Fig. 1 Coarse maculopapular rash of South Korean patient, travelers [8]; since then, < 15 additional patients have predominantly affecting the trunk (a, b), accompanied by been published, all as single case reports or small case characteristic necrotic eschar on the dorsal face of the left thigh (c) series [9–19]. The GeoSentinel network reported only Weitzel et al. Tropical Diseases, Travel Medicine and Vaccines (2018) 4:10 Page 3 of 5 Table 1 Primers and probes used for diagnostic and phylogenetic analysis Primer ID Sequence Annealing temp. PCR Reference 16sU17F AGAGTTTGATCCTGGCTCAG 56 °C First [30] 16sOR1198R TTTCCTATAGTTCCCGGCATT 56 °C First & second 16sO79F ATTAATGCTGAGCTTGCTTAGCAT 56 °C Second Otr47_263F GTGCTAAGAAARGATGATACTTC 54 °C First [31] Otr1780R AAATCGCCTTTAAACTAGATTTACTTATTA 54 °C First & second Otr47F TAAAGGTTAAGTTTATGAAAAAGGCATTT 54 °C Second Otr56_498F AATTAGTTTAGAATGGTTACCAC 54 °C First r56_585F AATGTCTGCGTTGTCGTTGC 54 °C Second r56_2057 TCCACATACACACCTTCAGC 54 °C First & second [32] OtsuFP630
Load more

Recommended publications
  • Case Report: Coinfection with Rickettsia Monacensis and Orientia Tsutsugamushi
    Am. J. Trop. Med. Hyg., 101(2), 2019, pp. 332–335 doi:10.4269/ajtmh.18-0631 Copyright © 2019 by The American Society of Tropical Medicine and Hygiene Case Report: Coinfection with Rickettsia monacensis and Orientia tsutsugamushi Seok Won Kim,1† Choon-Mee Kim,2† Dong-Min Kim,3* and Na Ra Yun3 1Department of Neurosurgery, College of Medicine, Chosun University, Gwangju, Republic of Korea; 2Premedical Science, College of Medicine, Chosun University, Gwangju, Republic of Korea; 3Department of Internal Medicine, College of Medicine, Chosun University, Gwangju, Republic of Korea Abstract. Rickettsia monacensis and Orientia tsutsugamushi are bacteria of the family Rickettsiaceae, which causes fever, rash, and eschar formation; outdoor activities are a risk factor for Rickettsiaceae infection. A 75-year-old woman presented with fever, rash, and eschar and was confirmed as being scrub typhus based on a nested-polymerase chain reaction (N-PCR) test for a 56-kDa gene of O. tsutsugamushi; the genome was identified as the Boryong genotype. In addition, a pan-Rickettsia real-time PCR test was positive and a N-PCR test using a Rickettsia-specific partial outer membrane protein A (rOmpA) confirmed R. monacensis. This is the first case wherein a patient suspected of having scrub typhus owing to the presence of rash and eschar was also found to be coinfected with O. tsutsugamushi and R. monacensis based on molecular testing. INTRODUCTION leukocyte count, 7,200/mm3; hemoglobin, 11.6 g/dL; platelet count, 232,000/mm3; and erythrocyte sedimentation rate, 31 Rickettsia monacensis is a pathogen that causes spotted mm/hours. C-reactive protein and procalcitonin levels were fever group rickettsial infection; the main symptoms of in- elevated at 9.26 mg/dL and 0.836 ng/mL (0–0.5 ng/mL), re- fection include fever, headache, and myalgia, as well as es- 1 spectively.
    [Show full text]
  • Expansion of Tick-Borne Rickettsioses in the World
    microorganisms Review Expansion of Tick-Borne Rickettsioses in the World Mariusz Piotrowski * and Anna Rymaszewska Institute of Biology, University of Szczecin, 70-453 Szczecin, Poland; [email protected] * Correspondence: [email protected] Received: 24 September 2020; Accepted: 25 November 2020; Published: 30 November 2020 Abstract: Tick-borne rickettsioses are caused by obligate intracellular bacteria belonging to the spotted fever group of the genus Rickettsia. These infections are among the oldest known diseases transmitted by vectors. In the last three decades there has been a rapid increase in the recognition of this disease complex. This unusual expansion of information was mainly caused by the development of molecular diagnostic techniques that have facilitated the identification of new and previously recognized rickettsiae. A lot of currently known bacteria of the genus Rickettsia have been considered nonpathogenic for years, and moreover, many new species have been identified with unknown pathogenicity. The genus Rickettsia is distributed all over the world. Many Rickettsia species are present on several continents. The geographical distribution of rickettsiae is related to their vectors. New cases of rickettsioses and new locations, where the presence of these bacteria is recognized, are still being identified. The variety and rapid evolution of the distribution and density of ticks and diseases which they transmit shows us the scale of the problem. This review article presents a comparison of the current understanding of the geographic distribution of pathogenic Rickettsia species to that of the beginning of the century. Keywords: Tick-borne rickettsioses; Tick-borne diseases; Rickettsiales 1. Introduction Tick-borne rickettsioses are caused by obligate intracellular Gram-negative bacteria belonging to the spotted fever group (SFG) of the genus Rickettsia.
    [Show full text]
  • Rickettsia Monacensis As a Cause of a Tick Bite
    a nonpruritic, disseminated maculopapular rash, with no Rickettsia inoculation eschar, of the trunk and lower extremities, in- cluding palms and soles. Other than a slightly low plate- monacensis let count (82,000/mm3), examination fi ndings were within normal limits. MSF was diagnosed, and serum and defi - and Human brinated blood samples were taken before a course of oral doxycycline (100 mg/12 h for 10 d) was initiated. Three Disease, Spain days later, fever and rash were gone without sequelae. Ad- Isabel Jado,* José A. Oteo,† Mikel Aldámiz,‡ ditional serial serum samples were taken during weeks 4, Horacio Gil,* Raquel Escudero,* 13, and 26 after onset and reserved for serologic analysis Valvanera Ibarra,† Joseba Portu,‡ (Table). Aranzazu Portillo,† María J. Lezaun,‡ Patient 2 was a 59-year-old woman from Basque Cristina García-Amil,* Isabel Rodríguez-Moreno,* Country, who sought medical attention on September 20, and Pedro Anda* 2003, 4 days after onset of fever (38ºC), headache, and an erythematous rash, with no inoculation eschar, at the site of We identifi ed Rickettsia monacensis as a cause of a tick bite. The patient reported a history of tick bites, most acute tickborne rickettsiosis in 2 humans. Its pathogenic recently 1 week before symptom onset. Blood cell counts role was assessed by culture and detection of the organism and other blood chemistry values were normal. MSF was in patients’ blood samples. This fi nding increases the num- ber of recognized human rickettsial pathogens and expands diagnosed, and oral doxycycline (100 mg/12 h for 10 d) the known geographic distribution of Mediterranean spotted was prescribed.
    [Show full text]
  • Molecular Detection and Identification of Rickettsiales Pathogens in Dog Ticks from Costa Rica
    Accepted Manuscript Title: Molecular detection and identification of Rickettsiales pathogens in dog ticks from Costa Rica Author: Liliana Campos-Calderon´ Leyda Abrego-S´ anchez´ Antony Solorzano-Morales´ Alberto Alberti Gessica Tore Rosanna Zobba Ana E. Jimenez-Rocha´ Gaby Dolz PII: S1877-959X(16)30120-0 DOI: http://dx.doi.org/doi:10.1016/j.ttbdis.2016.07.015 Reference: TTBDIS 700 To appear in: Received date: 29-2-2016 Revised date: 1-7-2016 Accepted date: 24-7-2016 Please cite this article as: Campos-Calderon,´ Liliana, Abrego-S´ anchez,´ Leyda, Solorzano-Morales,´ Antony, Alberti, Alberto, Tore, Gessica, Zobba, Rosanna, Jimenez-Rocha,´ Ana E., Dolz, Gaby, Molecular detection and identification of Rickettsiales pathogens in dog ticks from Costa Rica.Ticks and Tick-borne Diseases http://dx.doi.org/10.1016/j.ttbdis.2016.07.015 This is a PDF file of an unedited manuscript that has been accepted for publication. As a service to our customers we are providing this early version of the manuscript. The manuscript will undergo copyediting, typesetting, and review of the resulting proof before it is published in its final form. Please note that during the production process errors may be discovered which could affect the content, and all legal disclaimers that apply to the journal pertain. Molecular detection and identification of Rickettsiales pathogens in dog ticks from Costa Rica Liliana Campos-Calderóna, Leyda Ábrego-Sánchezb, Antony Solórzano- Moralesa, Alberto Albertic, Gessica Torec, Rosanna Zobbac, Ana E. Jiménez- Rochaa, Gaby Dolza,b,* aEscuela de Medicina Veterinaria, Universidad Nacional, Campus Benjamín Núñez, Barreal de Heredia, Costa Rica ([email protected], [email protected], [email protected]).
    [Show full text]
  • Rickettsia Spp. in Bats of Romania: High Prevalence of Rickettsia Monacensis in Two Insectivorous Bat Species Ioana A
    Matei et al. Parasites Vectors (2021) 14:107 https://doi.org/10.1186/s13071-021-04592-x Parasites & Vectors RESEARCH Open Access Rickettsia spp. in bats of Romania: high prevalence of Rickettsia monacensis in two insectivorous bat species Ioana A. Matei1*† , Alexandra Corduneanu2†, Attila D. Sándor2,3, Angela Monica Ionica2,4, Luciana Panait2, Zsuzsa Kalmár2, Talida Ivan5, Ionel Papuc5, Cosmina Bouari1, Nicodim Fit1 and Andrei Daniel Mihalca2 Abstract Background: Spotted fever group rickettsiae represent one of the most diverse groups of vector-borne bacteria, with several human pathogenic species showing an emerging trend worldwide. Most species are vectored by ticks (Ixodidae), with many zoonotic reservoir species among most terrestrial vertebrate groups. While the reservoir compe- tence of many diferent vertebrate species is well known (e.g. birds, rodents and dogs), studies on insectivorous bats have been rarely performed despite their high species diversity, ubiquitous urban presence and importance in har- boring zoonotic disease agents. Romania has a high diversity and ubiquity of bats. Moreover, seven out of eight SFG rickettsiae species with zoonotic potential were previously reported in Romania. Based on this, the aim of this study was to detect Rickettsia species in tissue samples in bats. Methods: Here we report a large-scale study (322 bats belonging to 20 species) on the presence of Rickettsia spp. in Romanian bat species. Tissue samples from insectivorous bats were tested for the presence of Rickettsia DNA using PCR detection amplifying a 381 bp fragment of the gltA gene. Positive results were sequenced to confrm the results. The obtained results were statistically analyzed by chi-squared independence test.
    [Show full text]
  • Detection of Tick-Borne Pathogens of the Genera Rickettsia, Anaplasma and Francisella in Ixodes Ricinus Ticks in Pomerania (Poland)
    pathogens Article Detection of Tick-Borne Pathogens of the Genera Rickettsia, Anaplasma and Francisella in Ixodes ricinus Ticks in Pomerania (Poland) Lucyna Kirczuk 1 , Mariusz Piotrowski 2 and Anna Rymaszewska 2,* 1 Department of Hydrobiology, Faculty of Biology, Institute of Biology, University of Szczecin, Felczaka 3c Street, 71-412 Szczecin, Poland; [email protected] 2 Department of Genetics and Genomics, Faculty of Biology, Institute of Biology, University of Szczecin, Felczaka 3c Street, 71-412 Szczecin, Poland; [email protected] * Correspondence: [email protected] Abstract: Tick-borne pathogens are an important medical and veterinary issue worldwide. Environ- mental monitoring in relation to not only climate change but also globalization is currently essential. The present study aimed to detect tick-borne pathogens of the genera Anaplasma, Rickettsia and Francisella in Ixodes ricinus ticks collected from the natural environment, i.e., recreational areas and pastures used for livestock grazing. A total of 1619 specimens of I. ricinus were collected, including ticks of all life stages (adults, nymphs and larvae). The study was performed using the PCR technique. Diagnostic gene fragments msp2 for Anaplasma, gltA for Rickettsia and tul4 for Francisella were ampli- fied. No Francisella spp. DNA was detected in I. ricinus. DNA of A. phagocytophilum was detected in 0.54% of ticks and Rickettsia spp. in 3.69%. Nucleotide sequence analysis revealed that only one species of Rickettsia, R. helvetica, was present in the studied tick population. The present results are a Citation: Kirczuk, L.; Piotrowski, M.; part of a large-scale analysis aimed at monitoring the level of tick infestation in Northwest Poland.
    [Show full text]
  • Intraspecies Comparative Genomics of Rickettsia
    AIX ͲMARSEILLE UNIVERSITÉ FACULTÉ DE MÉDECINE DE MARSEILLE ÉCOLE DOCTORALE DES SCIENCES DE LA VIE ET DE LA SANTÉ T H È S E Présentée et publiquement soutenue devant LA FACULTÉ DE MÉDECINE DE MARSEILLE Le 13 décembre 2013 Par M. Erwin SENTAUSA Né le 16 décembre 1979 àMalang, Indonésie INTRASPECIES COMPARATIVE GENOMICS OF RICKETTSIA Pour obtenir le grade de DOCTORAT d’AIX ͲMARSEILLE UNIVERSITÉ SPÉCIALITÉ :PATHOLOGIE HUMAINE Ͳ MALADIES INFECTIEUSES Membres du Jury de la Thèse : Dr. Patricia RENESTO Rapporteur Pr. Max MAURIN Rapporteur Dr. Florence FENOLLAR Membre du Jury Pr. Pierre ͲEdouard FOURNIER Directeur de thèse Unité de Recherche sur les Maladies Infectieuses et Tropicales Émergentes UM63, CNRS 7278, IRD 198, Inserm 1095 Avant Propos Le format de présentation de cette thèse correspond à une recommandation de la spécialité Maladies Infectieuses et Microbiologie, à l’intérieur du Master de Sciences de la Vie et de la Santé qui dépend de l’Ecole Doctorale des Sciences de la Vie de Marseille. Le candidat est amené àrespecter des règles qui lui sont imposées et qui comportent un format de thèse utilisé dans le Nord de l’Europe permettant un meilleur rangement que les thèses traditionnelles. Par ailleurs, la partie introduction et bibliographie est remplacée par une revue envoyée dans un journal afin de permettre une évaluation extérieure de la qualité de la revue et de permettre àl’étudiant de le commencer le plus tôt possible une bibliographie exhaustive sur le domaine de cette thèse. Par ailleurs, la thèse est présentée sur article publié, accepté ou soumis associé d’un bref commentaire donnant le sens général du travail.
    [Show full text]
  • Tick-Borne Pathogens in Removed Ticks Veneto, Northeastern Italy
    Tick-borne pathogens in removed ticks Veneto, northeastern Italy: A cross-sectional investigation Anna Beltrame, Maureen Laroche, Monica Degani, Francesca Perandin, Zeno Bisoffi, Didier Raoult, Philippe Parola To cite this version: Anna Beltrame, Maureen Laroche, Monica Degani, Francesca Perandin, Zeno Bisoffi, et al.. Tick- borne pathogens in removed ticks Veneto, northeastern Italy: A cross-sectional investigation. Travel Medicine and Infectious Disease, Elsevier, 2018, 26, pp.58-61. 10.1016/j.tmaid.2018.08.008. hal- 01970220 HAL Id: hal-01970220 https://hal.archives-ouvertes.fr/hal-01970220 Submitted on 10 Apr 2019 HAL is a multi-disciplinary open access L’archive ouverte pluridisciplinaire HAL, est archive for the deposit and dissemination of sci- destinée au dépôt et à la diffusion de documents entific research documents, whether they are pub- scientifiques de niveau recherche, publiés ou non, lished or not. The documents may come from émanant des établissements d’enseignement et de teaching and research institutions in France or recherche français ou étrangers, des laboratoires abroad, or from public or private research centers. publics ou privés. Travel Medicine and Infectious Disease 26 (2018) 58–61 Contents lists available at ScienceDirect Travel Medicine and Infectious Disease journal homepage: www.elsevier.com/locate/tmaid Tick-borne pathogens in removed ticks Veneto, northeastern Italy: A cross- sectional investigation T ∗ Anna Beltramea, , Maureen Larocheb, Monica Degania, Francesca Perandina, Zeno Bisoffia, Didier Raoultc, Philippe Parolab a Centre for Tropical Diseases, IRCCS Sacro Cuore Don Calabria Hospital, Via Sempreboni 5, 37024, Negrar, Italy b Aix Marseille Univ, AP-HM, SSA, VITROME, IHU-Méditerranée Infection, 19-21 Bd Jean Moulin, 13005, Marseille, France c Aix Marseille Univ, AP-HM, MEPHI, IHU-Méditerranée Infection, 19-21 Bd Jean Moulin, 13005, Marseille, France ARTICLE INFO ABSTRACT Keywords: Background: In Italy, the incidence of tick-borne diseases in humans is underestimated, as they are not ob- Tick-borne diseases ligatorily notifiable.
    [Show full text]
  • Paradoxical Evolution of Rickettsial Genomes
    Ticks and Tick-borne Diseases 10 (2019) 462–469 Contents lists available at ScienceDirect Ticks and Tick-borne Diseases journal homepage: www.elsevier.com/locate/ttbdis Paradoxical evolution of rickettsial genomes T ⁎ Awa Diopa, Didier Raoultb, Pierre-Edouard Fourniera, a UMR VITROME, Aix-Marseille University, IRD, Service de Santé des Armées, Assistance Publique-Hôpitaux de Marseille, Institut Hospitalo-Uuniversitaire Méditerranée Infection, 19-21 Boulevard Jean Moulin, 13005, Marseille, France b UMR MEPHI, Aix-Marseille University, IRD, Assistance Publique-Hôpitaux de Marseille, Institut Hospitalo-Uuniversitaire Méditerranée Infection, Marseille, France ARTICLE INFO ABSTRACT Keywords: Rickettsia species are strictly intracellular bacteria that evolved approximately 150 million years ago from a Rickettsia presumably free-living common ancestor from the order Rickettsiales that followed a transition to an obligate Genomics intracellular lifestyle. Rickettsiae are best known as human pathogens vectored by various arthropods causing a Evolution range of mild to severe human diseases. As part of their obligate intracellular lifestyle, rickettsial genomes have Virulence undergone a convergent evolution that includes a strong genomic reduction resulting from progressive gene Genome rearrangement degradation, genomic rearrangements as well as a paradoxical expansion of various genetic elements, notably Non-coding DNA Gene loss small RNAs and short palindromic elements whose role remains unknown. This reductive evolutionary process is DNA repeats not unique to members of the Rickettsia genus but is common to several human pathogenic bacteria. Gene loss, gene duplication, DNA repeat duplication and horizontal gene transfer all have shaped rickettsial genome evolution. Gene loss mostly involved amino-acid, ATP, LPS and cell wall component biosynthesis and tran- scriptional regulators, but with a high preservation of toxin-antitoxin (TA) modules, recombination and DNA repair proteins.
    [Show full text]
  • This Thesis Has Been Submitted in Fulfilment of the Requirements for a Postgraduate Degree (E.G
    This thesis has been submitted in fulfilment of the requirements for a postgraduate degree (e.g. PhD, MPhil, DClinPsychol) at the University of Edinburgh. Please note the following terms and conditions of use: This work is protected by copyright and other intellectual property rights, which are retained by the thesis author, unless otherwise stated. A copy can be downloaded for personal non-commercial research or study, without prior permission or charge. This thesis cannot be reproduced or quoted extensively from without first obtaining permission in writing from the author. The content must not be changed in any way or sold commercially in any format or medium without the formal permission of the author. When referring to this work, full bibliographic details including the author, title, awarding institution and date of the thesis must be given. Epidemiology and Control of cattle ticks and tick-borne infections in Central Nigeria Vincenzo Lorusso Submitted in fulfilment of the requirements of the degree of Doctor of Philosophy The University of Edinburgh 2014 Ph.D. – The University of Edinburgh – 2014 Cattle ticks and tick-borne infections, Central Nigeria 2014 Declaration I declare that the research described within this thesis is my own work and that this thesis is my own composition and I certify that it has never been submitted for any other degree or professional qualification. Vincenzo Lorusso Edinburgh 2014 Ph.D. – The University of Edinburgh – 2014 i Cattle ticks and tick -borne infections, Central Nigeria 2014 Abstract Cattle ticks and tick-borne infections (TBIs) undermine cattle health and productivity in the whole of sub-Saharan Africa (SSA) including Nigeria.
    [Show full text]
  • Diversity of Spotted Fever Group Rickettsiae and Their Association
    www.nature.com/scientificreports OPEN Diversity of spotted fever group rickettsiae and their association with host ticks in Japan Received: 31 July 2018 May June Thu1,2, Yongjin Qiu3, Keita Matsuno 4,5, Masahiro Kajihara6, Akina Mori-Kajihara6, Accepted: 14 December 2018 Ryosuke Omori7,8, Naota Monma9, Kazuki Chiba10, Junji Seto11, Mutsuyo Gokuden12, Published: xx xx xxxx Masako Andoh13, Hideo Oosako14, Ken Katakura2, Ayato Takada5,6, Chihiro Sugimoto5,15, Norikazu Isoda1,5 & Ryo Nakao2 Spotted fever group (SFG) rickettsiae are obligate intracellular Gram-negative bacteria mainly associated with ticks. In Japan, several hundred cases of Japanese spotted fever, caused by Rickettsia japonica, are reported annually. Other Rickettsia species are also known to exist in ixodid ticks; however, their phylogenetic position and pathogenic potential are poorly understood. We conducted a nationwide cross-sectional survey on questing ticks to understand the overall diversity of SFG rickettsiae in Japan. Out of 2,189 individuals (19 tick species in 4 genera), 373 (17.0%) samples were positive for Rickettsia spp. as ascertained by real-time PCR amplifcation of the citrate synthase gene (gltA). Conventional PCR and sequencing analyses of gltA indicated the presence of 15 diferent genotypes of SFG rickettsiae. Based on the analysis of fve additional genes, we characterised fve Rickettsia species; R. asiatica, R. helvetica, R. monacensis (formerly reported as Rickettsia sp. In56 in Japan), R. tamurae, and Candidatus R. tarasevichiae and several unclassifed SFG rickettsiae. We also found a strong association between rickettsial genotypes and their host tick species, while there was little association between rickettsial genotypes and their geographical origins.
    [Show full text]
  • Using Core Genome Alignments to Assign Bacterial Species 2
    bioRxiv preprint doi: https://doi.org/10.1101/328021; this version posted May 22, 2018. The copyright holder for this preprint (which was not certified by peer review) is the author/funder, who has granted bioRxiv a license to display the preprint in perpetuity. It is made available under aCC-BY-ND 4.0 International license. 1 Using Core Genome Alignments to Assign Bacterial Species 2 3 Matthew Chunga,b, James B. Munroa, Julie C. Dunning Hotoppa,b,c,# 4 a Institute for Genome Sciences, University of Maryland Baltimore, Baltimore, MD 21201, USA 5 b Department of Microbiology and Immunology, University of Maryland Baltimore, Baltimore, MD 6 21201, USA 7 c Greenebaum Comprehensive Cancer Center, University of Maryland Baltimore, Baltimore, MD 21201, 8 USA 9 10 Running Title: Core Genome Alignments to Assign Bacterial Species 11 12 #Address correspondence to Julie C. Dunning Hotopp, [email protected]. 13 14 Word count Abstract: 371 words 15 Word count Text: 4,833 words 16 1 bioRxiv preprint doi: https://doi.org/10.1101/328021; this version posted May 22, 2018. The copyright holder for this preprint (which was not certified by peer review) is the author/funder, who has granted bioRxiv a license to display the preprint in perpetuity. It is made available under aCC-BY-ND 4.0 International license. 17 ABSTRACT 18 With the exponential increase in the number of bacterial taxa with genome sequence data, a new 19 standardized method is needed to assign bacterial species designations using genomic data that is 20 consistent with the classically-obtained taxonomy.
    [Show full text]