Supplementary Data.Xlsx
Total Page:16
File Type:pdf, Size:1020Kb
Load more
Recommended publications
-
KO Kidney.Xlsx
Supplemental Table 18: Dietary Impact on the CGL KO Kidney Sulfhydrome DR/AL Accession Molecular Cysteine Spectral Protein Name Number Alternate ID Weight Residues Count Ratio P‐value Ig gamma‐2A chain C region, A allele P01863 (+1) Ighg 36 kDa 10 C 5.952 0.03767 Heterogeneous nuclear ribonucleoprotein M Q9D0E1 (+1) Hnrnpm 78 kDa 6 C 5.000 0.00595 Phospholipase D3 O35405 Pld3 54 kDa 8 C 4.167 0.04761 Ig kappa chain V‐V region L7 (Fragment) P01642 Gm10881 13 kDa 2 C 2.857 0.01232 UPF0160 protein MYG1, mitochondrial Q9JK81 Myg1 43 kDa 7 C 2.333 0.01613 Copper homeostasis protein cutC homolog Q9D8X1 Cutc 29 kDa 7 C 10.333 0.16419 Corticosteroid‐binding globulin Q06770 Serpina6 45 kDa 3 C 10.333 0.16419 28S ribosomal protein S22, mitochondrial Q9CXW2 Mrps22 41 kDa 2 C 7.333 0.3739 Isoform 3 of Agrin A2ASQ1‐3 Agrn 198 kDa 2 C 7.333 0.3739 3‐oxoacyl‐[acyl‐carrier‐protein] synthase, mitochondrial Q9D404 Oxsm 49 kDa 11 C 7.333 0.3739 Cordon‐bleu protein‐like 1 Q3UMF0 (+3)Cobll1 137 kDa 10 C 5.833 0.10658 ADP‐sugar pyrophosphatase Q9JKX6 Nudt5 24 kDa 5 C 4.167 0.15819 Complement C4‐B P01029 C4b 193 kDa 29 C 3.381 0.23959 Protein‐glutamine gamma‐glutamyltransferase 2 P21981 Tgm2 77 kDa 20 C 3.381 0.23959 Isochorismatase domain‐containing protein 1 Q91V64 Isoc1 32 kDa 5 C 3.333 0.10588 Serpin B8 O08800 Serpinb8 42 kDa 11 C 2.903 0.06902 Heterogeneous nuclear ribonucleoprotein A0 Q9CX86 Hnrnpa0 31 kDa 3 C 2.667 0.5461 Proteasome subunit beta type‐8 P28063 Psmb8 30 kDa 5 C 2.583 0.36848 Ig kappa chain V‐V region MOPC 149 P01636 12 kDa 2 C 2.583 0.36848 -
United States Patent 19 11 Patent Number: 5,780,253 Subramanian Et Al
III USOO5780253A United States Patent 19 11 Patent Number: 5,780,253 Subramanian et al. (45) Date of Patent: Jul. 14, 1998 54 SCREENING METHOD FOR DETECTION OF 4.433.999 2/1984 Hyzak ....................................... 71.03 HERBCDES 4.6–552 2/1987 Anoti et al. if O3. 4,802,912 2/1989 Baker ........................................ 7/103 Inventors: Wenkiteswaran Subramanian Danville: Anne G. Toschi. Burlingame. OTHERTHER PPUBLICATION CATIONS both of Calif. Heim et al. Pesticide Biochem & Physiol; vol. 53, pp. 138-145 (1995). 73) Assignee: Sandoz Ltd., Basel. Switzerland Hatch. MD.: Phytochem. vol. 6... pp. 115 to 119, (1967). Haworth et al. J. Agric. Food Chem, vol. 38, pp. 1271-1273. 21 Appl. No.:752.990 1990. Nishimura et al: Phytochem: vol. 34, pp. 613-615. (1993). 22 Filed: Nov. 21, 1996 Primary Examiner-Louise N. Leary Related U.S. Application Data Attorney, Agent, or Firm-Lynn Marcus-Wyner: Michael P. Morris 63 Continuation of Ser. No. 434.826, May 4, 1995, abandoned. 6 57 ABSTRACT 51 Int. Cl. ............................... C12Q 1/48: C12Q 1/32: C12Q 1/37; C12O 1/00 This invention relates to novel screening methods for iden 52 U.S. Cl. ................................. 435/15:435/18: 435/26: tifying compounds that specifically inhibit a biosynthetic 435/23: 435/4, 536/23.6:536/23.2:536/24.3 pathway in plants. Enzymes which are specifically affected 536/26.11:536/26.12:536/26.13 by the novel screening method include plant purine biosyn 58 Field of Search .................................. 435/15, 8, 26, thetic pathway enzymes and particularly the enzymes 435/23 4: 536/23.6, 23.2, 24.3, 26.1, involved in the conversion of inosine monophosphate to 26.12, 26.13 adenosine monophosphate and inosine monophosphate to guanosine monophosphate. -
Molecular Mechanisms Underlying Noncoding Risk Variations in Psychiatric Genetic Studies
OPEN Molecular Psychiatry (2017) 22, 497–511 www.nature.com/mp REVIEW Molecular mechanisms underlying noncoding risk variations in psychiatric genetic studies X Xiao1,2, H Chang1,2 and M Li1 Recent large-scale genetic approaches such as genome-wide association studies have allowed the identification of common genetic variations that contribute to risk architectures of psychiatric disorders. However, most of these susceptibility variants are located in noncoding genomic regions that usually span multiple genes. As a result, pinpointing the precise variant(s) and biological mechanisms accounting for the risk remains challenging. By reviewing recent progresses in genetics, functional genomics and neurobiology of psychiatric disorders, as well as gene expression analyses of brain tissues, here we propose a roadmap to characterize the roles of noncoding risk loci in the pathogenesis of psychiatric illnesses (that is, identifying the underlying molecular mechanisms explaining the genetic risk conferred by those genomic loci, and recognizing putative functional causative variants). This roadmap involves integration of transcriptomic data, epidemiological and bioinformatic methods, as well as in vitro and in vivo experimental approaches. These tools will promote the translation of genetic discoveries to physiological mechanisms, and ultimately guide the development of preventive, therapeutic and prognostic measures for psychiatric disorders. Molecular Psychiatry (2017) 22, 497–511; doi:10.1038/mp.2016.241; published online 3 January 2017 RECENT GENETIC ANALYSES OF NEUROPSYCHIATRIC neurodevelopment and brain function. For example, GRM3, DISORDERS GRIN2A, SRR and GRIA1 were known to involve in the neuro- Schizophrenia, bipolar disorder, major depressive disorder and transmission mediated by glutamate signaling and synaptic autism are highly prevalent complex neuropsychiatric diseases plasticity. -
Protein Identities in Evs Isolated from U87-MG GBM Cells As Determined by NG LC-MS/MS
Protein identities in EVs isolated from U87-MG GBM cells as determined by NG LC-MS/MS. No. Accession Description Σ Coverage Σ# Proteins Σ# Unique Peptides Σ# Peptides Σ# PSMs # AAs MW [kDa] calc. pI 1 A8MS94 Putative golgin subfamily A member 2-like protein 5 OS=Homo sapiens PE=5 SV=2 - [GG2L5_HUMAN] 100 1 1 7 88 110 12,03704523 5,681152344 2 P60660 Myosin light polypeptide 6 OS=Homo sapiens GN=MYL6 PE=1 SV=2 - [MYL6_HUMAN] 100 3 5 17 173 151 16,91913397 4,652832031 3 Q6ZYL4 General transcription factor IIH subunit 5 OS=Homo sapiens GN=GTF2H5 PE=1 SV=1 - [TF2H5_HUMAN] 98,59 1 1 4 13 71 8,048185945 4,652832031 4 P60709 Actin, cytoplasmic 1 OS=Homo sapiens GN=ACTB PE=1 SV=1 - [ACTB_HUMAN] 97,6 5 5 35 917 375 41,70973209 5,478027344 5 P13489 Ribonuclease inhibitor OS=Homo sapiens GN=RNH1 PE=1 SV=2 - [RINI_HUMAN] 96,75 1 12 37 173 461 49,94108966 4,817871094 6 P09382 Galectin-1 OS=Homo sapiens GN=LGALS1 PE=1 SV=2 - [LEG1_HUMAN] 96,3 1 7 14 283 135 14,70620005 5,503417969 7 P60174 Triosephosphate isomerase OS=Homo sapiens GN=TPI1 PE=1 SV=3 - [TPIS_HUMAN] 95,1 3 16 25 375 286 30,77169764 5,922363281 8 P04406 Glyceraldehyde-3-phosphate dehydrogenase OS=Homo sapiens GN=GAPDH PE=1 SV=3 - [G3P_HUMAN] 94,63 2 13 31 509 335 36,03039959 8,455566406 9 Q15185 Prostaglandin E synthase 3 OS=Homo sapiens GN=PTGES3 PE=1 SV=1 - [TEBP_HUMAN] 93,13 1 5 12 74 160 18,68541938 4,538574219 10 P09417 Dihydropteridine reductase OS=Homo sapiens GN=QDPR PE=1 SV=2 - [DHPR_HUMAN] 93,03 1 1 17 69 244 25,77302971 7,371582031 11 P01911 HLA class II histocompatibility antigen, -
Complete Genome of the Cellyloytic Thermophile Acidothermus Cellulolyticus 11B Provides Insights Into Its Ecophysiological and Evloutionary Adaptations
Lawrence Berkeley National Laboratory Lawrence Berkeley National Laboratory Title Complete genome of the cellyloytic thermophile Acidothermus cellulolyticus 11B provides insights into its ecophysiological and evloutionary adaptations Permalink https://escholarship.org/uc/item/5xg662d7 Author Barabote, Ravi D. Publication Date 2009-08-25 eScholarship.org Powered by the California Digital Library University of California Title: Complete genome of the cellyloytic thermophile Acidothermus cellulolyticus 11B provides insights into its ecophysiological and evolutionary adaptations Author(s): R. Barabote1,†, G. Xie1, D. Leu2, P. Normand3, A. Necsulea4, V. Daubin4, C. Médigue5, W. Adney6, X. Xu2, A. Lapidus7, C. Detter1, P. Pujic3, D. Bruce1, C. Lavire3, J. Challacombe1, T. Brettin1 and Alison M. Berry2. Author Affiliations: 1 DOE Joint Genome Institute, Bioscience Division, Los Alamos National Laboratory, 2 Department of Plant Sciences, University of California, Davis, 3 Centre National de la Recherche Scientifique (CNRS), UMR5557, Écologie Microbienne, Université Lyon I, Villeurbanne, 4 Centre National de la Recherche Scientifique (CNRS), UMR5558, Laboratoire de Biométrie et Biologie Évolutive, Université Lyon I, Villeurbanne, 5 Centre National de la Recherche Scientifique (CNRS), UMR8030 and CEA/DSV/IG/Genoscope, Laboratoire de Génomique Comparative, 6 National Renewable Energy Laboratory 7 DOE Joint Genome Institute Date: 06/10/09 Funding: This work was performed under the auspices of the US Department of Energy's Office of Science, Biological and Environmental Research Program, and by the University of California, Lawrence Berkeley National Laboratory under contract No. DE-AC02- 05CH11231, Lawrence Livermore National Laboratory under Contract No. DE-AC52-07NA27344, and Los Alamos National Laboratory under contract No. DE-AC02-06NA25396. R. D. Barabote Complete genome of the cellulolytic thermophile Acidothermus cellulolyticus 11B provides insights into its ecophysiological and evolutionary adaptations. -
A Little Sugar Goes a Long Way: the Cell Biology of O-Glcnac
Published March 30, 2015 JCB: Review A little sugar goes a long way: The cell biology of O-GlcNAc Michelle R. Bond and John A. Hanover Unlike the complex glycans decorating the cell surface, the to nucleocytoplasmic kinases and phosphatases. In fact, there are O-linked -N-acetyl glucosamine (O-GlcNAc) modifica- many parallels between phosphorylation and O-GlcNAcylation: O-GlcNAc is added to Ser and Thr residues; the modification tion is a simple intracellular Ser/Thr-linked monosaccha- rapidly cycles on and off modified proteins at a rate faster than ride that is important for disease-relevant signaling and protein turnover; and like kinases and phosphatases, OGT and enzyme regulation. O-GlcNAcylation requires uridine OGA are phosphorylated (Fig. 1 B; Butkinaree et al., 2010; diphosphate–GlcNAc, a precursor responsive to nutrient Hanover et al., 2010). Many target proteins are modified by both status and other environmental cues. Alternative splicing O-GlcNAc and phosphate at exposed regions, suggesting the of the genes encoding the O-GlcNAc cycling enzymes presence of shared or coexisting recognition motifs. However, although the sites of protein phosphorylation can often be identified Downloaded from O-GlcNAc transferase (OGT) and O-GlcNAcase (OGA) by primary sequence alone, O-GlcNAcylation is not associated yields isoforms targeted to discrete sites in the nucleus, cy- with a clear consensus motif. toplasm, and mitochondria. OGT and OGA also partner OGT uses UDP-GlcNAc, a nucleotide sugar derived from with cellular effectors and act in tandem with other post- the nutrient-dependent hexosamine biosynthetic pathway (HBP), translational modifications. The enzymes of O-GlcNAc to catalyze O-GlcNAc addition (Fig. -
Recent Advances in Drosophila Models of Charcot-Marie-Tooth Disease
International Journal of Molecular Sciences Review Recent Advances in Drosophila Models of Charcot-Marie-Tooth Disease Fukiko Kitani-Morii 1,2,* and Yu-ichi Noto 2 1 Department of Molecular Pathobiology of Brain Disease, Kyoto Prefectural University of Medicine, Kyoto 6028566, Japan 2 Department of Neurology, Kyoto Prefectural University of Medicine, Kyoto 6028566, Japan; [email protected] * Correspondence: [email protected]; Tel.: +81-75-251-5793 Received: 31 August 2020; Accepted: 6 October 2020; Published: 8 October 2020 Abstract: Charcot-Marie-Tooth disease (CMT) is one of the most common inherited peripheral neuropathies. CMT patients typically show slowly progressive muscle weakness and sensory loss in a distal dominant pattern in childhood. The diagnosis of CMT is based on clinical symptoms, electrophysiological examinations, and genetic testing. Advances in genetic testing technology have revealed the genetic heterogeneity of CMT; more than 100 genes containing the disease causative mutations have been identified. Because a single genetic alteration in CMT leads to progressive neurodegeneration, studies of CMT patients and their respective models revealed the genotype-phenotype relationships of targeted genes. Conventionally, rodents and cell lines have often been used to study the pathogenesis of CMT. Recently, Drosophila has also attracted attention as a CMT model. In this review, we outline the clinical characteristics of CMT, describe the advantages and disadvantages of using Drosophila in CMT studies, and introduce recent advances in CMT research that successfully applied the use of Drosophila, in areas such as molecules associated with mitochondria, endosomes/lysosomes, transfer RNA, axonal transport, and glucose metabolism. -
Table SI. Primer List of Genes Used for Reverse Transcription‑Quantitative PCR Validation
Table SI. Primer list of genes used for reverse transcription‑quantitative PCR validation. Genes Forward (5'‑3') Reverse (5'‑3') Length COL1A1 AGTGGTTTGGATGGTGCCAA GCACCATCATTTCCACGAGC 170 COL6A1 CCCCTCCCCACTCATCACTA CGAATCAGGTTGGTCGGGAA 65 COL2A1 GGTCCTGCAGGTGAACCC CTCTGTCTCCTTGCTTGCCA 181 DCT CTACGAAACCAGGATGACCGT ACCATCATTGGTTTGCCTTTCA 192 PDE4D ATTGCCCACGATAGCTGCTC GCAGATGTGCCATTGTCCAC 181 RP11‑428C19.4 ACGCTAGAAACAGTGGTGCG AATCCCCGGAAAGATCCAGC 179 GPC‑AS2 TCTCAACTCCCCTCCTTCGAG TTACATTTCCCGGCCCATCTC 151 XLOC_110310 AGTGGTAGGGCAAGTCCTCT CGTGGTGGGATTCAAAGGGA 187 COL1A1, collagen type I alpha 1; COL6A1, collagen type VI, alpha 1; COL2A1, collagen type II alpha 1; DCT, dopachrome tautomerase; PDE4D, phosphodiesterase 4D cAMP‑specific. Table SII. The differentially expressed mRNAs in the ParoAF_Control group. Gene ID logFC P‑Value Symbol Description ENSG00000165480 ‑6.4838 8.32E‑12 SKA3 Spindle and kinetochore associated complex subunit 3 ENSG00000165424 ‑6.43924 0.002056 ZCCHC24 Zinc finger, CCHC domain containing 24 ENSG00000182836 ‑6.20215 0.000817 PLCXD3 Phosphatidylinositol‑specific phospholipase C, X domain containing 3 ENSG00000174358 ‑5.79775 0.029093 SLC6A19 Solute carrier family 6 (neutral amino acid transporter), member 19 ENSG00000168916 ‑5.761 0.004046 ZNF608 Zinc finger protein 608 ENSG00000134343 ‑5.56371 0.01356 ANO3 Anoctamin 3 ENSG00000110400 ‑5.48194 0.004123 PVRL1 Poliovirus receptor‑related 1 (herpesvirus entry mediator C) ENSG00000124882 ‑5.45849 0.022164 EREG Epiregulin ENSG00000113448 ‑5.41752 0.000577 PDE4D Phosphodiesterase -
Chronic Exposure of Humans to High Level Natural Background Radiation Leads to Robust Expression of Protective Stress Response Proteins S
www.nature.com/scientificreports OPEN Chronic exposure of humans to high level natural background radiation leads to robust expression of protective stress response proteins S. Nishad1,2, Pankaj Kumar Chauhan3, R. Sowdhamini3 & Anu Ghosh1,2* Understanding exposures to low doses of ionizing radiation are relevant since most environmental, diagnostic radiology and occupational exposures lie in this region. However, the molecular mechanisms that drive cellular responses at these doses, and the subsequent health outcomes, remain unclear. A local monazite-rich high level natural radiation area (HLNRA) in the state of Kerala on the south-west coast of Indian subcontinent show radiation doses extending from ≤ 1 to ≥ 45 mGy/y and thus, serve as a model resource to understand low dose mechanisms directly on healthy humans. We performed quantitative discovery proteomics based on multiplexed isobaric tags (iTRAQ) coupled with LC–MS/MS on human peripheral blood mononuclear cells from HLNRA individuals. Several proteins involved in diverse biological processes such as DNA repair, RNA processing, chromatin modifcations and cytoskeletal organization showed distinct expression in HLNRA individuals, suggestive of both recovery and adaptation to low dose radiation. In protein–protein interaction (PPI) networks, YWHAZ (14-3-3ζ) emerged as the top-most hub protein that may direct phosphorylation driven pro- survival cellular processes against radiation stress. PPI networks also identifed an integral role for the cytoskeletal protein ACTB, signaling protein PRKACA; and the molecular chaperone HSPA8. The data will allow better integration of radiation biology and epidemiology for risk assessment [Data are available via ProteomeXchange with identifer PXD022380]. Te basic principles of low linear energy transfer (LET) ionizing radiation (IR) induced efects on mammalian systems have been broadly explored and there exists comprehensive knowledge on the health efects of high doses of IR delivered at high dose rates. -
Supplementary Table S4. FGA Co-Expressed Gene List in LUAD
Supplementary Table S4. FGA co-expressed gene list in LUAD tumors Symbol R Locus Description FGG 0.919 4q28 fibrinogen gamma chain FGL1 0.635 8p22 fibrinogen-like 1 SLC7A2 0.536 8p22 solute carrier family 7 (cationic amino acid transporter, y+ system), member 2 DUSP4 0.521 8p12-p11 dual specificity phosphatase 4 HAL 0.51 12q22-q24.1histidine ammonia-lyase PDE4D 0.499 5q12 phosphodiesterase 4D, cAMP-specific FURIN 0.497 15q26.1 furin (paired basic amino acid cleaving enzyme) CPS1 0.49 2q35 carbamoyl-phosphate synthase 1, mitochondrial TESC 0.478 12q24.22 tescalcin INHA 0.465 2q35 inhibin, alpha S100P 0.461 4p16 S100 calcium binding protein P VPS37A 0.447 8p22 vacuolar protein sorting 37 homolog A (S. cerevisiae) SLC16A14 0.447 2q36.3 solute carrier family 16, member 14 PPARGC1A 0.443 4p15.1 peroxisome proliferator-activated receptor gamma, coactivator 1 alpha SIK1 0.435 21q22.3 salt-inducible kinase 1 IRS2 0.434 13q34 insulin receptor substrate 2 RND1 0.433 12q12 Rho family GTPase 1 HGD 0.433 3q13.33 homogentisate 1,2-dioxygenase PTP4A1 0.432 6q12 protein tyrosine phosphatase type IVA, member 1 C8orf4 0.428 8p11.2 chromosome 8 open reading frame 4 DDC 0.427 7p12.2 dopa decarboxylase (aromatic L-amino acid decarboxylase) TACC2 0.427 10q26 transforming, acidic coiled-coil containing protein 2 MUC13 0.422 3q21.2 mucin 13, cell surface associated C5 0.412 9q33-q34 complement component 5 NR4A2 0.412 2q22-q23 nuclear receptor subfamily 4, group A, member 2 EYS 0.411 6q12 eyes shut homolog (Drosophila) GPX2 0.406 14q24.1 glutathione peroxidase -
Abstracts from the 50Th European Society of Human Genetics Conference: Electronic Posters
European Journal of Human Genetics (2019) 26:820–1023 https://doi.org/10.1038/s41431-018-0248-6 ABSTRACT Abstracts from the 50th European Society of Human Genetics Conference: Electronic Posters Copenhagen, Denmark, May 27–30, 2017 Published online: 1 October 2018 © European Society of Human Genetics 2018 The ESHG 2017 marks the 50th Anniversary of the first ESHG Conference which took place in Copenhagen in 1967. Additional information about the event may be found on the conference website: https://2017.eshg.org/ Sponsorship: Publication of this supplement is sponsored by the European Society of Human Genetics. All authors were asked to address any potential bias in their abstract and to declare any competing financial interests. These disclosures are listed at the end of each abstract. Contributions of up to EUR 10 000 (ten thousand euros, or equivalent value in kind) per year per company are considered "modest". Contributions above EUR 10 000 per year are considered "significant". 1234567890();,: 1234567890();,: E-P01 Reproductive Genetics/Prenatal and fetal echocardiography. The molecular karyotyping Genetics revealed a gain in 8p11.22-p23.1 region with a size of 27.2 Mb containing 122 OMIM gene and a loss in 8p23.1- E-P01.02 p23.3 region with a size of 6.8 Mb containing 15 OMIM Prenatal diagnosis in a case of 8p inverted gene. The findings were correlated with 8p inverted dupli- duplication deletion syndrome cation deletion syndrome. Conclusion: Our study empha- sizes the importance of using additional molecular O¨. Kırbıyık, K. M. Erdog˘an, O¨.O¨zer Kaya, B. O¨zyılmaz, cytogenetic methods in clinical follow-up of complex Y. -
The Tumor Suppressor Notch Inhibits Head and Neck Squamous Cell
The Texas Medical Center Library DigitalCommons@TMC The University of Texas MD Anderson Cancer Center UTHealth Graduate School of The University of Texas MD Anderson Cancer Biomedical Sciences Dissertations and Theses Center UTHealth Graduate School of (Open Access) Biomedical Sciences 12-2015 THE TUMOR SUPPRESSOR NOTCH INHIBITS HEAD AND NECK SQUAMOUS CELL CARCINOMA (HNSCC) TUMOR GROWTH AND PROGRESSION BY MODULATING PROTO-ONCOGENES AXL AND CTNNAL1 (α-CATULIN) Shhyam Moorthy Shhyam Moorthy Follow this and additional works at: https://digitalcommons.library.tmc.edu/utgsbs_dissertations Part of the Biochemistry, Biophysics, and Structural Biology Commons, Cancer Biology Commons, Cell Biology Commons, and the Medicine and Health Sciences Commons Recommended Citation Moorthy, Shhyam and Moorthy, Shhyam, "THE TUMOR SUPPRESSOR NOTCH INHIBITS HEAD AND NECK SQUAMOUS CELL CARCINOMA (HNSCC) TUMOR GROWTH AND PROGRESSION BY MODULATING PROTO-ONCOGENES AXL AND CTNNAL1 (α-CATULIN)" (2015). The University of Texas MD Anderson Cancer Center UTHealth Graduate School of Biomedical Sciences Dissertations and Theses (Open Access). 638. https://digitalcommons.library.tmc.edu/utgsbs_dissertations/638 This Dissertation (PhD) is brought to you for free and open access by the The University of Texas MD Anderson Cancer Center UTHealth Graduate School of Biomedical Sciences at DigitalCommons@TMC. It has been accepted for inclusion in The University of Texas MD Anderson Cancer Center UTHealth Graduate School of Biomedical Sciences Dissertations and Theses (Open Access) by an authorized administrator of DigitalCommons@TMC. For more information, please contact [email protected]. THE TUMOR SUPPRESSOR NOTCH INHIBITS HEAD AND NECK SQUAMOUS CELL CARCINOMA (HNSCC) TUMOR GROWTH AND PROGRESSION BY MODULATING PROTO-ONCOGENES AXL AND CTNNAL1 (α-CATULIN) by Shhyam Moorthy, B.S.