Classical and Rational Approaches to Antifungal Drug Design

Classical and rational approaches to antifungal drug design

Jessica Louise Chitty BSc (Hons)

A thesis submitted for the degree of Doctor of Philosophy at The University of Queensland in 2017

School of Chemistry and Molecular Biosciences Institute of Molecular Biosciences

Abstract The emergence of human immunodeficiency virus (HIV) in the 1980s has led to an increase in infections from previously rare pathogens. Many of these now cause widespread infection among individuals with compromised immune systems, not just limited to AIDS patients but also to those placed on immunosuppressive medication. The encapsulated yeast Cryptococcus neoformans causes widespread disease in the immunocompromised population, particularly in sub-Saharan Africa where it is a major cause of AIDS-related mortality due in part to limited resources and variable drug availability. Current treatment options are restricted to three out-dated antifungals amphotericin B, flucytosine and fluconazole; where possible they are used in combination as nephrotoxicity and resistance are contributing factors in the unacceptably high mortality rates. Alternative therapeutic agents are urgently required to improve survival rates and combat antifungal drug resistance.

Two main routes of compound development can be taken: classical drug screening or rational drug design. Classical design requires groups of compounds to be screened against pathogens and those identified with high efficacy and low cytotoxicity are pursued. Rational drug design requires a detailed characterization of the proposed target; exploitable differences between the pathogen and human host are sought out as potential druggable targets.

In this thesis both classical and rational methods have been investigated. A classical approach was taken to investigate a class of octapeptin compounds, produced as secondary metabolites by the soil dwelling bacterium, Bacillus circulans. Related compounds, such as the polymxyins, have become last resort drugs against gram-negative bacteria. The physiological target of poylmxyins against gram-negative bacteria is thought to be its charged cell wall surface. Like gram-negative bacteria C. neoformans also has a charged surface; comprised of a polysaccharide capsule and melanin. These features have been investigated as a potential target of octapeptin C4.

The fungal pathogen C. neoformans is commonly associated with bird guano, a particularly purine rich environment. Investigation into novel antifungals targeting enzymes of the purine biosynthetic pathway has been limited. Gertrude Elion’s pivotal work in developing inhibitors of the de novo purine biosynthesis pathway in a rational manner successfully led to the development of anticancer agents still used today. To enable development of such compounds against fungal pathogens, enzymes from the de novo purine biosynthesis pathway have been characterized in C. neoformans.

In this thesis GMP synthase and ADS lyase were be presented. Gene deletion and subsequent complementation of the genes encoding GMP synthase and ADS lyase was performed. The deletion mutants in both showed defects in the production of virulence traits as well as being avirulent in a murine inhalation model of infection. Recombinantly expressed and purified protein was obtained for enzyme kinetics assays and structural studies. These have enabled the first in-depth analysis of these enzymes in fungi for comparison to previously characterized human enzymes.

Collectively, these data highlight the potential of enzymes of the purine biosynthesis pathway to be exploited in the development of new therapeutic agents for the treatment of disseminated, life threatening fungal infections.

iii

Declaration by author This thesis is composed of my original work, and contains no material previously published or written by another person except where due reference has been made in the text. I have clearly stated the contribution by others to jointly-authored works that I have included in my thesis.

I have clearly stated the contribution of others to my thesis as a whole, including statistical assistance, survey design, data analysis, significant technical procedures, professional editorial advice, and any other original research work used or reported in my thesis. The content of my thesis is the result of work I have carried out since the commencement of my research higher degree candidature and does not include a substantial part of work that has been submitted to qualify for the award of any other degree or diploma in any university or other tertiary institution. I have clearly stated which parts of my thesis, if any, have been submitted to qualify for another award.

I acknowledge that an electronic copy of my thesis must be lodged with the University Library and, subject to the policy and procedures of The University of Queensland, the thesis be made available for research and study in accordance with the Copyright Act 1968 unless a period of embargo has been approved by the Dean of the Graduate School.

I acknowledge that copyright of all material contained in my thesis resides with the copyright holder(s) of that material. Where appropriate I have obtained copyright permission from the copyright holder to reproduce material in this thesis.

Publications during candidature

Peer-reviewed journal articles J.L Chitty and J.A Fraser (2015) "Rethinking the targets for antifungal development." Microbiology Australia, 36(2), 88-89

S.D.M Arras, J.L Chitty, K.L Blake, B. Schulz, J.A Fraser (2015) “A genomic safe haven for mutant complementation in Cryptococcus neoformans” PLoS One, 10(4): e0122916.

K.D Beattie, N. Ellwood, R. Kumar, X. Yang, P.C Healy, V. Choomuenwai, R.J Quinn, A.G Elliott, J.X Huang, J.L Chitty, J.A Fraser, M.A Cooper, R.A Davis (2016) “Antibacterial and antifungal screening of natural products sourced from Australian fungi and characterisation of pestalactams D-F” Phytochemistry, Apr; 124:79-85

R.D Blundell, S.J Williams, S.D.M Arras, J.L Chitty, K.L Blake, D.J Ericsson, N. Tibrewal, J. Rohr, Y.Q.A.E Koh, U. Kappler, A.A.B. Robertson, M.S Butler, M.A Cooper, B. Kobe, J.A Fraser (2016) “Disruption of de novo ATP biosynthesis abolishes virulence in Cryptococcus neoformans” ACS Infectious Diseases, Sep 9;2(9):651-663

J.L Chitty, T.L Tatzenko, S.J Williams, Y.Q.A.E Koh, E.C Corfield, M.S Butler, A.A.B Robertson, M.A Cooper, U. Kappler, B. Kobe and J.A Fraser (2017) “GMP synthase is required for virulence factor production and infection by Cryptococcus neoformans” Journal of Biological Chemistry, 292(7): 3049-59

S.D.M Arras, J.L Chitty, B. Schulz, M. Tanurdzic, J.A Fraser (2017) Sirtuins in the phylum Basidiomycota: A role in virulence in Cryptococcus neoformans” Scientific reports, 7, 46567

J.L Chitty, K.L Blake, Y.Q.A.E Koh, R.D Blundell, M. Thompson, M.S Butler, A.A.B Robertson, M.A Cooper, U. Kappler, S.J Williams, B. Kobe and J.A Fraser (2017) “Cryptococcus neoformans ADS lyase in an enzyme essential for virulence whose crystal structure reveals features exploitable in antifungal drug design” Journal of Biological Chemistry, 292(28): 11829-39

J.L. Chitty and J.A. Fraser (2017) “Purine acquisition and synthesis by human fungal pathogens” Microorganisms; 5(2)

Publications included in this thesis

Jessica L. Chitty and James A. Fraser (Accepted 2 June 2017) “Purine acquisition and synthesis by human fungal pathogens” Microorganisms; 5(2) – incorporated as Chapter 1

Contributor Statement of contribution Jessica Chitty (Candidate) Wrote the paper (100%), edited paper (90%) James Fraser Edited the paper (10%)

Contributor Statement of contribution Jessica Chitty (Candidate) Concept and design of experiments (70%), Experimental work (75%), analysis and interpretation of the data (80%), wrote the paper (90%), edited paper (60%) Tayla Tatzenko Concept and design of experiments (10%), experimental work (15%) Simon Williams Concept and design of experiments (10%), analysis and interpretation of the data (5%), edited paper (5%) Y.Q. Andre Koh Experimental work (5%) Elizabeth Corfield Experimental work (5%) Mark Butler Edited paper (5%) Avril Robertson Edited paper (5%) Matthew Cooper Edited paper (5%) Ulrike Kappler Concept and design of experiments (10%), analysis and interpretation of the data (5%), edited paper (5%) Bostjan Kobe Edited paper (5%) James Fraser Concept and design of experiments (10%), analysis and interpretation of the data (10%), wrote and edited paper (10%)

Contributor Statement of contribution Jessica Chitty (Candidate) Concept and design of experiments (60%), Experimental work (75%), analysis and interpretation of the data (70%), wrote the paper (90%), edited paper (60%) Kirsten Blake Concept and design of experiments (10%), experimental work (10%) Y.Q. Andre Koh Experimental work (5%) Ross Blundell Experimental work (5%) Merinda Thompson Experimental work (5%) Mark Butler Edited paper (5%) Avril Robertson Edited paper (5%) Matthew Cooper Edited paper (5%) Ulrike Kappler Concept and design of experiments (10%), analysis and interpretation of the data (10%), edited paper (5%) Simon Williams Concept and design of experiments (10%), analysis and interpretation of the data (10%), edited paper (5%) Bostjan Kobe Edited paper (5%) James Fraser Concept and design of experiments (10%), analysis and interpretation of the data (10%), wrote and edited paper (10%)

vii

Contributions by others to the thesis

Chapter 2: Avril Robertson was responsible for providing the compounds, provided assistance in the analysis and interpretation of the data, James Fraser was responsible for sourcing the cap59 mutant strain; David Edwards was responsible for the analytical chemistry.

Chapter 3: Tayla Tatzenko was responsible for the spotting assays, nematode and murine inhalation model; Andre Koh for the deletion and complementation of GUA1; Elizabeth Corfield for the murine inhalation model; Simon Williams for advice on the model; Ulrike Kappler for advice on enzyme kinetics; James Fraser was responsible for concept and design of experiments, analysis and interpretation of the data.

Chapter 4: Kirsten Blake was responsible for the spotting assays and murine inhalation model; Andre Koh for the deletion and complementation of ADE13, Ross Blundell for the murine inhalation model; Merinda Thompson for small scale expression; Ulrike Kappler for advice on enzyme kinetics, analysis and interpretation of the data;; Simon Williams for assistants with solving the crystal structure; James Fraser was responsible for concept and design of experiments, analysis and interpretation of the data.

Statement of parts of the thesis submitted to qualify for the award of another degree

None

viii

Acknowledgements There are a number of people to thank but it all began with James, Christina and Heather so thank you for your friendship over the years. Doing our degree together at Sussex was great fun and it’s comforting to know that we are still such close friends after all this time.

Thank you to James Fraser for taking me on, the overseas student who came knocking on your door for a PhD. I clearly didn’t understand the correct protocol on doing a PhD but it seems that my enthusiasm was enough for you to give me a chance! I hope I proved it was worth it in the end and I really appreciate the opportunities I have had in your lab. Thank you to my supervisors Bostjan Kobe and Matt Cooper for the free reign of your labs and equipment when I’ve needed it.

To Avril Robertson and Simon Williams, I couldn’t have done this without either of you. Whether it was a shoulder to cry on or the helpful hand that was always there, you both have been so kind and supportive. Simon you taught me so much, I was never officially your PhD student but that never seemed to matter, you came in anyway even at 4 am just to help me with my crystals.

The Fraser lab has evolved over the years but a special thanks goes to lab 2.0, Kate and Sam in particular, you both helped me find my feet at the beginning and made the experience so much more enjoyable with your great friendship, even when you both moved on. To the Kobe lab old and new, thank you for all the fun times. Especially Peter, Adam, Shane and Megan for all the Friday drinks and coffees breaks.

Thank you to my parents, Christiane and Graham, for the financial and emotional support. I especially appreciate all the essays you have proof-read for me since I was at school dad, some of it sunk in I promise!

A final thanks goes to Leif, the last three and a half years have most certainly had their ups and downs due to my PhD but you’ve always been there. When things were rough in the lab there was a glass of wine or some chocolate and a hug waiting at home. It’s the end of one chapter and the start of a fantastic adventure.

Jessica Chitty 2 June 2017

Keywords Purine biosynthesis, Cryptococcus neoformans, drug design, structural biology, enzyme kinetics, drug screening

Australian and New Zealand Standard Research Classifications (ANZSRC) ANZSRC code: 060112 Structural Biology, 40% ANZSRC code: 060107 Enzymes, 30% ANZSRC code: 060505 Mycology, 20%

Fields of Research (FoR) Classification FoR code: 0601, Biochemistry and Cell Biology, 70% FoR code: 0605 Microbiology, 30%

Table of Contents

Abstract ...... ii

Publications during candidature ...... v

Publications included in this thesis ...... vi

Contributions by others to the thesis ...... viii

Statement of parts of the thesis submitted to qualify for the award of another degree viii

Acknowledgements ...... ix

Keywords ...... x

Australian and New Zealand Standard Research Classifications (ANZSRC) ...... x Fields of Research (FoR) Classification ...... x

List of Figures and Tables ...... xiii

List of Abbreviations used in this thesis ...... xv

Chapter 1: Introduction ...... 1 Thesis aims and outline ...... 2 Preface ...... 4 Abstract ...... 5 The diversity of fungi and the environments they inhabit ...... 6 Purines and their role in the cell ...... 9 Salvaging purines ...... 10 Synthesizing purines ...... 11 Purine metabolism in Candida albicans ...... 12 Purine metabolism in Aspergillus fumigatus ...... 15 Purine metabolism in Cryptococcus neoformans ...... 17 Purine biosynthesis as an antifungal drug target ...... 20 Conclusion ...... 21

Chapter 2: Antimicrobial octapeptin C4 analogues active against Cryptococcus species ...... 22 Preface ...... 23 Abstract ...... 24 Introduction ...... 25 Results ...... 27

Discussion ...... 33 Materials & methods ...... 36 Supplementary figures ...... 38 Supplementary table ...... 40

Chapter 3: GMP synthase is required for virulence factor production and infection by Cryptococcus neoformans ...... 43 Preface ...... 44 Abstract ...... 45 Introduction ...... 46 Results ...... 49 Discussion ...... 59 Materials & methods ...... 62 Supplementary figures ...... 68 Supplementary table ...... 70

Chapter 4: Cryptococcus neoformans ADS lyase in an enzyme essential for virulence whose crystal structure reveals features exploitable in antifungal drug design ...... 71 Preface ...... 72 Abstract ...... 73 Introduction ...... 74 Results ...... 77 Discussion ...... 84 Materials & Methods ...... 86 Supplementary figures ...... 91 Supplementary tables ...... 92

Chapter 5: Conclusions and future directions ...... 95 Concluding remarks ...... 96 Classical screening approach ...... 96 Rational drug design approach ...... 96 GMP synthase ...... 97 ADS lyase ...... 98 Future Directions ...... 99

Reference: ...... 102

xii

List of Figures and Tables

Chapter 1

Figure 1. De novo, salvage and degradation purine biosynthesis pathways

Table 1. Concentration of purines (µM unless indicated) from the habitats of C. albicans, A. fumigatus and C. neoformans

Chapter 2

Figure 1. Cationic cyclic lipopeptide antibacterial agents Table 1. Antifungal MIC (µg/mL) of PMB, PME and octapeptin C4 in broth microdilution assays against common fungal pathogens.

Figure 2. Capsule formation enhanced fungicidal effect of PMB but retarded fungicidal activity of octapeptin C4. Figure 3. Octapeptin C4 fungicidal activity is not influenced by melanization of C. neoformans. A, Melanin suppressed C. neoformans. Figure 4. Nine octapeptin C4 alanine scan derivatives. Table 2. MIC of octapeptin C4 and alanine scan derivatives. Table S1. MIC of clinical isolates Table S2. Purity of synthesized compounds Figure S1. In vitro time-course assay of C. neoformans melanisation effect on compound efficacy using strain H99. Figure S2. In vitro time-course assay of C. neoformans capsule effect on compound efficacy using strain H99. Chapter 3

Figure 1. The de novo and salvage purine biosynthesis pathway and GMP synthase role in GTP biosynthesis Figure 2. Loss of GUA1 compromises virulence factor production. Figure 3. Virulence of gua1 mutant in nematode and murine host systems. Figure 4. Solution properties of C. neoformans Gua1. Figure 5. Comparison of GMP synthase from human and C. neoformans in complex with XMP. Table 1. Comparison of kinetic parameters of GMP synthase from different organisms.

xiii

Figure S1. Saturation binding curves for GMP synthase substrates.

Figure S2. IC50 value of 4.4 µM for ECC1385 Table S1. Sequence of oligonucleotides used in this study.

Chapter 4

Figure 1. ADS lyase in the purine biosynthesis pathway. Figure 2. C. neoformans ADE13 role in ATP biosynthesis. Figure 3. Loss of ADE13 influences the production of C. neoformans virulence traits. Figure 4. Virulence of the ade13Δ mutant in mice. Table 1. Comparison of kinetic parameters of ADS lyase from different organisms. Figure 5. Crystal structure of C. neoformans ADS lyase. Figure 6. Active site comparison of human and C. neoformans ADS lyases. Figure S1. Relative capsule diameter C. neoformans strains incubated in RPMI 1640 media, 10% foetal bovine serum and 1 mM adenine at 30 and 37 ˚C. Figure S2. Solution properties of C. neoformans ADS lyase. Table S1. Oligonucleotides used for this study. Table S2. Diffraction and refinement statistics for C. neoformans ADS lyase structures. Table S3. Mutation of ADSL deficiency and their conservation in C. neoformans.

xiv

List of Abbreviations used in this thesis ADS adenylosuccinate ADSL adenylosuccinate lyase AIDS acquired immunodeficiency syndrome AMP adenine monophosphate ATP adenine triphosphate ATP-PPase adenine triphosphate pyrophosphatase BHI brain-heart infusion BSA bovin serum albumin CNS central nervous system CSF cerebral spinal fluid CTP cytidine triphosphate

DON 6-diazo-5-oxo-L-norleucine FBS fetal bovine serum FGAM phosphoribosylformylglycinamidine GATase glutamine amidotransferase GMP guanine monophosphate GTP guanine triphosphate HIV human immunodeficiency virus IMP inosine monophosphate

L-DOPA L-3,4-dihydroxyphenylalanine MALLS multiangle laser light scattering MIC minimum inhibitory concentration NGM nematode growth medium SAICAR Phosphoribosylaminoimidazolesuccinocarboxamide SDS sodium dodecyl sulfate SEC size exclusion chromatography XMP xanthine monophosphate YNB yeast nitrogen broth YPD yeast peptone dextrose

Chapter 1: Introduction

Thesis aims and outline This thesis consists of the characterization of novel antifungal drug design via two methods; classical and rational drug discovery in the fungal pathogen Cryptococcus neoformans, the causative agent of life-threatening Cryptococcal meningoencephalitis. The first aim looks at classical drug discovery by screening octapeptin C4 and its derivatives for antifungal activity. The second two aims of this thesis looks at rational drug discovery by the characterization of two enzymes of the de novo purine biosynthesis pathway. A review paper of this topic has been included as part of the introduction.

Aim 1: Classical drug discovery. Investigating antifungal properties of a class of lipopolypeptides The urgent need for antibiotics is not just restricted to resistant strains of bacteria but also fungi (1). Despite the continuous identification of resistant strains, the treatment for Cryptococcal meningoencephalitis has not significantly changed in over two decades (2-6). Developing an antimycotic to specifically target a eukaryotic pathogen is particularly challenging; by identifying characteristics that are shared by the fungi with other microbes the screening of compounds can be significantly narrowed down. One example of a shared characteristic is the charged surface of C. neoformans, also present in Gram-negative bacteria (7). The positively-charged lipopolypeptide class of compounds, such as polymyxins, target the negatively-charged surfaces of Gram-negative bacteria (8). The lipodecapeptide polymyxin b has been a last resort drug in the clinic for a number of years and has shown some activity against C. neoformans (9, 10). In this aim I have investigated a related class of compounds, the octapeptins and investigated octapeptin C4 for its activity against C. neoformans as well as Candida albicans and Aspergillus fumigatus.

Aim 2: Rational drug discovery. Characterizing GMP synthase as a potential candidate antifungal drug target Alternatively, detailed structural information may be obtained from potential targets and used as the template on which to design a novel compound. In this thesis the primary focus of the novel antifungal targets are from the de novo purine biosynthesis pathway. This pathway is significant to C. neoformans as its environmental niche contains a high concentration of purines whereas the cerebral spinal fluid, to which C. neoformans disseminates once an infection is established in the host, is a purine poor environment (11-13). The characterization

of inosine monophosphate dehydrogenase (IMPDH) and adenylosuccinate synthetase, responsible for the first committed step of either GTP or ATP, has identified these enzymes as being essential for C. neoformans virulence in a murine model of infection (14, 15). GMP synthase is responsible for the conversion of XMP to GMP and showed the lowest sequence identity of all enzymes of the de novo purine biosynthesis pathway. Therefore I sought to characterize the enzyme and determine its viability as a candidate antifungal target.

Aim 3: Rational drug discovery. Characterizing ADS lyase as a potential candidate antifungal drug target Unlike the other enzymes investigated from the de novo purine biosynthesis pathway ADS lyase was unique in that it served as a bifunctional enzyme. The reactions carried out by ADS lyase are the β-elimination of fumarate from the substrates N-succinocarboxyamide-5- aminoimidazole ribonucleotide (SAICAR) and adenylosuccinate producing aminoimidazole- 4-carboxamine ribonucleotide (AICAR) and AMP, respectively. Given its dual role, firstly in the generation of AICAR for the synthesis of IMP and in the generation of AMP, the enzyme is an attractive target for novel antifungal as both ATP and GTP biosynthesis could be disrupted simultaneously. Given its important role in the pathway I sought to characterize this enzyme through biochemical and structural techniques.

Preface This introduction is comprised of a review article submitted as part of a special issue on fungal nutrition assimilation strategies and pathogenicity. The main body of this thesis focuses on the purine biosynthesis in Cryptococcus neoformans and the following publication serves as an introduction to this topic.

My contribution to this publication was as follows: 1. Literature review 2. Writing the manuscript

Publication reference: Jessica L. Chitty and James A. Fraser (2017) “Purine acquisition and synthesis by human fungal pathogens” Microorganisms; 5(2)

Abstract While members of the Kingdom Fungi are found across many of the world’s most hostile environments, only a limited number of species can thrive within the human host. The causative agents of the most common invasive fungal infections are Candida albicans, Aspergillus fumigatus, and Cryptococcus neoformans. During the infection process these fungi must not only combat the host immune system while adapting to dramatic changes in temperature and pH, but also acquire sufficient nutrients to enable growth and dissemination in the host. One class of nutrients required by fungi that is found in varying concentrations in their environmental niches and the human host are the purines. These nitrogen-containing heterocycles are one of the most abundant organic molecules in nature and are required for roles as diverse as signal transduction, energy metabolism and DNA synthesis. The most common life-threatening fungal pathogens can degrade, salvage and synthesize de novo purines through a number of enzymatic steps that are conserved. While these enable them to adapt to the changing purine availability in the environment, only de novo purine biosynthesis is essential during infection and therefore an attractive antimycotic target.

The diversity of fungi and the environments they inhabit Federico Cesi, founder of the Accademia dei Lincei and a keen observer of his local environment, first attempted the scientific classification of organisms. “Imperfect” plants, particularly fungi, fascinated Cesi; his colleague Galileo Galilei constructed a microscope to help him observe these organisms in great detail, and Cesi commissioned hundreds of drawings of mushroom species collected from Rome and southern Umbria until his death in 1630 (16). The Italian priest and botanist Pier Antonio Micheli later continued Cesi’s classification. His most notable work Nova Plantarum Genera documented 1,400 new “plant” species collected from around Europe, of which 900 were fungi or lichens and included the first documented human fungal pathogen (17). A few decades later, Swedish botanist and zoologist Carl Linné made a significant contribution to modern taxonomy by classifying organisms from around the globe in his seminal work Systema Naturae, although fungal species were poorly addressed in this publication (18). Almost 100 years later, mycologists Christian Hendrik Persoon and Elias Magnus Fries addressed these shortcomings by classifying fungi sent by leading scientists from around the world (19-21). Combined, these extensive works that took place over four centuries identified thousands of fungi that expanded well beyond Cesi’s Italian mushrooms to include more diverse species inhabiting a wide range of environments. However, it was not until 1969 that the Fungi were classified as their own kingdom and not a subset of plants (22, 23). With the aid of genomic sequencing, the number of species identified now numbers over one million and these are believed to be just the tip of the iceberg, accounting for an estimated 5-7% of species with many environments largely unsampled (24, 25).

Species from the kingdom Fungi differ greatly in habitat, morphology and nutrient requirements. As heterotrophs these organisms digest organic molecules such as proteins, polysaccharides and nucleotides, and are often found in nutrient rich environments. In contrast, many fungi can survive in extreme conditions. Aspergillus sydowii inhabits deep-sea hydrothermal vents more than 700 meters below sea level where temperatures reach almost boiling point (26). Penicillium chrysogenum can be found in the Atacama Desert, where it has been hyper arid for at least three million years (27). Nadsoniella nigra var. hesuelica survives periodic freezing and thawing in Antarctica (28). Other species survive in a very different extreme environment – the human host, where fungal pathogens must be heat

tolerant, resilient to immune defenses and able to scavenge nutrients that can be difficult to acquire (29).

Of the fungal pathogens affecting humans, three pose the most consistent major threat worldwide: Aspergillus fumigatus, Candida albicans and Cryptococcus neoformans, causing aspergillosis, candidiasis and cryptococcosis, respectively. Even with the best available antifungal treatment in developed countries, low efficacy, toxicity and resistance are major contributors to the high mortality associated with these invasive fungal infections (30, 31). Each preferentially infects specific sites in patients, from the lung in pulmonary aspergillosis to the brain in cryptococcal meningoencephalitis and the blood stream in systemic candidiasis, yet all employ similar mechanisms to acquire sufficient nutrients to survive and establish an infection (32-34).

Unlike C. neoformans and A. fumigatus, which are often found in soil, guano and decaying matter (35-38), C. albicans is a commensal species, commonly found in the gastrointestinal tract and on mucocutaneous surfaces (39, 40). While these environments are vastly different, one important class of biological compounds consistently present are the purines.

To expel excess nitrogen, bird excreta contains high concentrations of the insoluble hetrocyclic compound uric acid, a strategy that reduces water loss compared to the mammalian excretion of nitrogen as its soluble derivative urea (41). Fresh plant matter such as cauliflower has a purine content of approximately 0.4 mg/g (42); when living organisms such as plants decompose, purines become enriched in soil and so are available to fungi such as C. neoformans and A. fumigatus (43). Furthermore, the different tissues of the live human host also vary significantly in the context of purines. The concentrations of purines in the gastrointestinal tract inhabited by C. albicans are dependent on the host’s diet, whereas the cerebral spinal fluid to which C. neoformans disseminates is a particularly purine-poor environment (11-13).

Figure 1. Blue represents enzymes found in C. albicans, A. fumigatus, and C. neoformans. Pink represents an enzyme found in both C. albicans and A. fumigatus. Green represents an enzyme found in A. fumigatus only. Abbreviations: PRP (Phosphoribosylpyrophosphate) amidotransferase, GAR (glycinamide ribotide) synthetase, GAR (phosphoribosyl-glycinamide) transformylase, FGAM (formylglycinamidine-ribonucleotide) synthetase, AIR aminoimidazole ribotide) synthetase, AIR (Phosphoribosylaminoimidazole) carboxylase, SAICAR (N-succinyl-5-aminoimidazole-4- carboxamide ribotide) synthetase, ADS (adenylosuccinate) lyase, AICAR (aminoimidazole-4- carboxamide ribonucleotide) transformylase, IMP (inosine monophosphate) cyclohydrolase, ADS

(adenylosuccinate) synthetase, IMP (inosine monophosphate) dehydrogenase, GMP (guanine monophosphate) synthase.

Purines and their role in the cell Purine, a term coined by Emil Fisher in 1884 after he synthesized a novel compound from “pure urine”, is a molecule composed of one six and one five-membered nitrogen-containing ring fused together. The addition of at least one phosphate to this molecule makes it a nucleotide, a biochemically important component of the cell (44). These molecules are essential to DNA and RNA biosynthesis, energy metabolism and signal transduction, and are the most widely occurring nitrogen-containing heterocycle in nature (45). Purines are also predicted to have been amongst the first organic compounds synthesized by abiotic chemistry on the early earth; adenine, the nucleobase of ATP, is proposed to have formed during the prebiotic era by the condensation of five hydrogen cyanide molecules (46, 47).

Figure 2. Structures of the key intermediates involved in de novo and salvage pathways containing a purine ring (blue) and the resultant non-purine breakdown product urea.

Purines as a nitrogen source Defects in the degradation of purines for the excretion of excess nitrogen were first implicated to play a role in disease in 1848 by Alfred Garrod. However, the biochemical process in a microbe of degrading purines to acquire nitrogen required for growth was not studied until 1853 when Friedrich Wohler investigated this process in an unidentified yeast species. Nitrogen is a major component of a number of molecules, including amino acids,

pyrimidines, and purines, and is essential for life. Fungi are known for their ability to use a wide range of nitrogen sources via a range of catabolic enzymes (48, 49).

The process of utilizing purines as a nitrogen source proceeds via the degradation of xanthine to uric acid by xanthine oxidase. Uric acid can then be sequentially degraded by a further five enzymes to produce ammonia (Figure 1). Depending on the fungal species, the entry point for this degradation pathway varies. For example, during its evolution into a facultative anaerobe Saccharomyces cerevisiae lost oxygen-dependent urate oxidase, but it may still use allantoin or allantoate as a nitrogen source. In contrast, the fungal pathogen C. neoformans can use uric acid (50-52).

The importance of maintaining a fully functional degradation pathway is not true for all fungi; for example the Pneumocystis pneumonia-causing microbe Pneumocystis jirovecii lacks the catabolic enzymes required for the degradation of purines, although this is the only human fungal pathogen known to do so (53). Some plant colonizing species of fungi such as Piriformospora indica also lack this ability (54).

Salvaging purines As well as breaking down the purines obtained from the environment to serve as a nitrogen source, fungi also scavenge these essential nutrients for metabolic processes. Small molecules such as nucleotides are detected by plasma membrane-localized sensors to be transported across the plasma membrane to be used in nucleotide biosynthesis (55). A number of proteins have been identified in fungi that transport purines. Three distinct nucleobase-specific transporter classes exist: nucleobase-ascorbate transporter (NAT) families 1 and 2, the nucleobase cation symporter family 1 (NCS1) and the AzgA-like family. These are all secondary active transporters as they catalyze the transport of two chemical species, a purine and a proton, in the same direction (56). Once scavenged nucleotides are transported into the cell via these dedicated transporters, they are available for incorporation into the salvage pathway. The principal enzymes responsible for the interconversion of purines are hypoxanthine xanthine guanine phosphoribosyltransferase (HXGPT) and adenine phosphoribosyltransferase, enzymes that transfers a 5-phosphoribosyl group to a purine create the corresponding nucleotide.

Synthesizing purines Fungi may not always be able to salvage sufficient purines from the environment; in many cases nucleotides must be synthesized de novo from precursor molecules (Figure 1). Acquiring purines from the environment is energetically favorable compared to de novo biosynthesis which requires 14 enzymatic activities and a number of cofactors for the magnesium-dependent generation of either ATP or GTP from phosphoribosyl pyrophosphate.

IMP biosynthesis requires the ammonia release from two molecules of L-glutamine, ligation of L-aspartate, and hydrolysis of four ATP molecules, and two 10-formyl-THF formyl donors. For the synthesis of ATP from IMP an additional L-aspartate molecule is ligated, and one GTP and two ATP molecules are hydrolyzed. The synthesis of GTP from IMP requires the additional hydrolysis of one L-glutamine, three ATP and the hydride transfer from one NAD+ molecule. In total, in order for de novo synthesis to occur, 10 molecules of ATP are hydrolysed per molecule of AMP synthesized, and 11 for GMP (57, 58). It is estimated that 107 ATP molecules are used per second per S. cerevisiae cell, therefore the steady supply of purine nucleotides is essential for survival. While scavenging these purines is the most energy efficient strategy, having an intact de novo purine synthesis pathway is highly advantageous to fungi that inhabit environments with varying concentrations of purines (58).

Some species of fungi have lost the ability to synthesize purines and rely solely on the salvage of nucleotides from their environment. The Microsporidia have lost a number of enzymatic activities required for the de novo synthesis of purines, meaning this process is no longer possible in these obligate parasites (59, 60). However, the high expression of nucleoside diphosphate kinase required for the phosphorylation of adenosine and guanosine suggests that aspects of purine biosynthesis still plays an important role in the metabolism of these parasites (59). This contrasts starkly with C. albicans, A. fumigatus and C. neoformans where these pathways are not only intact, but in some cases have also been implicated as being essential for the infection process.

Purine metabolism in Candida albicans While records detailing the symptoms of oral candidiasis date back to 400 B.C., for many centuries these were thought to originate from the host rather than an infectious agent (61, 62). In 1771 Rosen von Rosenstein identified an invasive fungal pathogen as the causative agent of this disease and in 1847 the French mycologist Charles Philippe Robin classified it as Oidium albicans (63, 64). Almost a century later Christine Marie Berkhout reclassified it under the current genus Candida (64).

The commensal pathogen C. albicans is a frequent member of the gut microbiota; in healthy individuals it is observed in approximately 40% of the population (40). For those that do not have an intact immune system this pathogen poses a major threat and is the leading cause of hospital-acquired bloodstream infections, with those in intensive care units most at risk (65). The switch from unicellular commensal yeast to pleiomorphic invasive pathogen is driven by multiple environmental cues. In vitro this can be induced by changes in pH, temperature, CO2 concentration, serum and many other factors (66-69).

Table 1. Concentration of purines (µM unless indicated) from the habitats of C. albicans, A. fumigatus and C. neoformans.

Inosine Adenine Guanine Xanthine Reference Hypoxanthine

Average meal (per 0.9 1.0 1.8 0.02 ND (70) gram) Human Blood 0.4 97 20 172 168 (71) serum Human Cerebral 0.2 0.5 2.4 3.9 0.6 (11, 12) spinal fluid Intracellular 1.5 97 ND 370 211 (71) (human cell) Plant matter 0.4 1.3 0.8 1.0 1.2 (72, 73) average μg/mL μg/mL μg/mL μg/mL μg/mL

Soil 19 M % 41 M % ND ND ND (74)

ND for no data. Average meal defined as 100g rice, 75g carrot, 75g peas, 100g chicken (70). Average plant matter concentration from of A. vaginalis, Z. jujuba, Z. jujuba var. spinosa and Z. mauritiana plants (72, 73). An average soil concentration was determined as proportion of purine relative to the g of air-dried soil from different locations (74).

The yeast form of C. albicans commonly found in the gastrointestinal tract has plentiful access to nutrients, including proteins, carbohydrates, fats and nucleotides such as purines. The concentration of available purines varies depending on the diet of the host (Table 1) with foods high in purines such as seaweed containing millimolar concentrations, and foods low in purines such as carrots containing nanomolar concentrations (70). Prior to purine absorption by the host in the small intestine – in particular in the mucosa of the duodenum – these purines are available to be scavenged by the gut microbiota (75). In its pathogenic form, C. albicans is found in the bloodstream where it causes candidemia; the available purines in the blood are in the micromolar concentration range (Table 1) (71).

Enzymes required for the degradation of purines into ammonia have not been well characterized in C. albicans. BLASTp analyses using C. neoformans orthologs revealed that genes predicted to encode the majority of purine degradation components are present in C. albicans. Six enzymes required for the sequential breakdown of xanthine to ammonium were identified: xanthine oxidase (C2_00180C) for the conversion of xanthine to uric acid, 5- hydroxyisourate (HIU) hydrolase (C2_08460C) for the conversion HIU to 2-oxo-4-hydroxy- 4-carboxy-5-ureidoimidazoline (OHCU), OHCU decarboxylase (C3_01620W) for the conversion of OHCU to (S)-allantoin, allantoinase (C3_00180C) for the conversion of allantoin to allantoate, and allantoicase (C2_00630C) converting allantoate to urea. For the final step of hydrolyzing urea to ammonia, C. albicans encodes a urea amidolyase (C1_04660W) that carries out two steps: carboxylation of urea to urea-1-carboxylate, followed by hydrolysis to two molecules of ammonia. In addition, a zinc cluster transcription factor exclusively found in fungi has been identified as playing a role in purine catabolism in C. albicans. Ppr1 regulates uracil degradation in S. cerevisiae but plays a different role in C. albicans where it is involved in the regulation of allantoin degradation (76).

Salvage of nitrogenous compounds by C. albicans from the environment is essential in the production of virulence traits such as adherence to the host tissue, hyphal morphogenesis, and release of ammonia to counteract acidification of the phagolysosome (77). UV microscopy has shown that in vitro, C. albicans actively takes up the purines guanine and adenine within a few hours from the growth medium. The concentrations of purines within the vacuole of the

cell became supersaturated, suggesting that when purines are available, the fungus scavenges all it can (78). The consumption of extracellular nucleotides in C. albicans occurs via their hydrolysis to nucleosides by ecto-enzymes attached to the cell membrane that actively import purines into the cell (79).

While the enzymes of the purine salvage pathway have not been characterized in this species, BLASTp analyses using C. neoformans orthologs revealed the presence of a gene predicted to encode adenine phosphoribosyl transferase (C2_01430W) suggesting that C. albicans can covert adenine to AMP. A likely member of the phosphoribosyl transferase family (C2_02740C) responsible for the conversion of one or more of hypoxanthine, xanthine and/or guanine into their respective phosphorylated nucleotides is also present. Other enzymes involved in the interconversion of purines are anticipated in C. albicans; a BLASTp analysis using S. cerevisiae orthologs identified genes predicted to encoded adenine deaminase (C2_03360W) and guanine deaminase (C7_00670W) for the conversion of adenine to hypoxanthine, and guanine to xanthine.

Only a few of the genes required for de novo purine biosynthesis have been characterized in C. albicans, BLASTp analysis using C. neoformans orthologs reveals genes thought to encode the ten enzymatic activities required for the conversion of phosphoribosyl pyrophosphate to IMP: PRP transferase (C1_07710C), GAR synthetase/AIR synthetase (C1_07890C), GAR transformlyase (C2_03090C), FGAM synthetase (CR_04740C), AIR carboxylase (C3_04520C), SAICAR synthetase (CR_06150C), ADS lyase (CR_06150C) and AICAR transformylase/inosine cyclohydrolase (ATIC) (CR_04090C). Additionally, the four enzymatic activities for synthesis of ATP from IMP (ADS synthetase (C1_09640W), ADS lyase (CR_06150C), adenylate kinase (C6_01910W) and nucleotide diphosphate kinase (C5_02890W)) and the four activities for GTP synthesis from IMP (IMP dehydrogenase (C2_06390C), GMP synthase (C1_09490C), guanylate kinase (C503790W), and nucleoside diphosphate kinase (C5_02890W)) are also predicted to be encoded by genes identified in C. albicans.

Mutation and deletion studies of some of the genes encoding the enzymatic activities required for de novo purine biosynthesis have been carried out in C. albicans. Mutants found to produce red pigmentation were hypothesized to encode AIR carboxylase and SAICAR synthetase based on S. cerevisiae studies identifying the pigmentation as a result of the

accumulation of oxidized and polymerized AIR in the vacuole (80). Subsequent targeted gene disruption of the ade2 gene encoding AIR carboxylase in C. albicans results in reduced virulence in a murine candidiasis model (81). The strain was unable to proliferate in human serum unless supplemented with exogenous adenine, and although not completely avirulent exhibited a 100-fold attenuation of virulence (81).

The deletion of genes encoding other two other enzymes of the de novo purine biosynthesis pathway in C. albicans has also been performed. The genes ADE8 and GUA1 encoding the enzymes GAR transformylase and GMP synthase have been deleted and in vivo growth assays for both strains showed they were unable to grow on media without supplementation of exogenous purines; adenine was required for the ade8 mutant and guanine was required for the gua1 mutant (82-84). Both of these deletion strains were hypersensitive to the purine biosynthesis inhibitors methotrexate and 6-azauracil (83). In a candidiasis model of infection the gua1 strain is avirulent (82).

Purine metabolism in Aspergillus fumigatus Historically, the Aspergillus molds have been recognized as a genus since 1729 (17). They have been attributed to infection since the French revolution, and the species fumigatus known to frequently cause aspergillosis since the early 1900s (85, 86). More recently A. fumigatus has become recognized as the most prevalent airborne fungal pathogen, commonly causing severe or fatal infections in immunocompromised individuals (87-89).

The asexual conidia of A. fumigatus are produced in abundance and inhaled by animals and humans on a regular basis. In healthy individuals these are cleared by the innate immune system, however in an immunodeficient individual they pose a significant risk. Invasive aspergillosis is frequently observed in cancer and transplant patients, accounting for 10-25% of life-threatening opportunistic infections in leukemia treatment centers and 15-25% in transplant units (89-95).

Like many decomposers, A. fumigatus is commonly found in soil where organic matter provides plentiful nutrients. Purine availability varies considerably in this niche depending on a number of factors. Investigation of purine composition of soil has identified that humic acids (the principle component of soil humus) are richer in the purines guanine and adenine

than the pyrimidines cytosine, thymine and uracil. The concentration of purines in dry soils have been shown to range from 21 to 138 µg per gram and the concentration distribution is consistent within soils: guanine is the most abundant, followed by cytosine, adenine, thymine and the least abundant, uracil (74). Purine concentrations also vary greatly in plant life that will eventually become part of the diet of saprobes; the legume Alysicarpus vaginalis and the Jujube fruiting tree species Ziziphus jujube and Ziziphus mauritiana have been determined to have average purine concentrations of 0.005 to 2.6 µg/mL of guanine and 0.002 to 1.2 µg/mL of adenine (Table 1) (72, 73).

Compared to this, the lung of an infected individual is a vastly different environment. The small size of the conidia of A. fumigatus (2-3 µm) allows them to enter the respiratory tract, descend to the aveoli and bind to surfactant proteins to be endocytosed by epithelial cells (90, 96, 97). In the lungs, host-produced extracellular ATP plays a role as an endogenous signaling molecule involved in inflammation (98). Once in the bloodstream A. fumigatus encounters guanine at a concentration of 97 µM and adenine at 0.2 µM (Table 1).

While purine metabolism has not been well characterized in A. fumigatus, more extensive characterization of the pathway in Aspergillus species has been carried out in Aspergillus nidulans, with all enzyme-encoding genes believed to be associated with degradation, salvage, and de novo biosynthesis of purines identified in this species (99-102). BLASTp analysis using A. nidulans orthologs revealed the majority of purine degradation components are also likely present in A. fumigatus. A. nidulans encodes a second enzyme, xanthine α ketoglutarate dependent dioxygenase, for the conversion of xanthine to uric acid; this was not identified in A. fumigatus by BLASTp analysis but the alternative enzyme xanthine oxidase (Afu2g10520) (which is also present in A. nidulans) was.

BLASTp analyses using A. nidulans orthologs revealed the genes predicted to encode enzymes of the salvage pathway in A. fumigatus, including hypoxanthine xanthine guanine phosphoribosyl transferase (Afu4g04550) and adenine phosphoribosyl transferase (Afu7g02310), suggesting that A. fumigatus can convert hypoxanthine to IMP, xanthine to XMP, guanine to GMP, and adenine to AMP, respectively. As well as phosphoribosyl transferase enzymes, A. fumigatus is predicted to encode adenine deaminase (Afu8g02860) and xanthine dehydrogenase (Afu4g11220) for the conversion of adenine to hypoxanthine and hypoxanthine to xanthine. The adenine deaminase enzyme encoded by the nadA gene is

involved in the conversion of AMP to IMP and can be considered as a degradation or a salvage enzyme. In A. nidulans, adenine deaminase is essential for the utilisation of adenine as a sole nitrogen source and unlike other enzyme required for purine degradation its expression is not supressed by ammonium, perhaps reflecting an increase in purine interconversion when grown in favourable conditions (103).

BLASTp analyses of the characterized genes of de novo purine biosynthesis from A. nidulans predicted genes encoding the ten enzymatic activities required for the conversion of phosphoribosyl pyrophosphate to IMP to be present in A. fumigatus, as are the four enzymatic activities for synthesis of ATP from IMP and the four activities for synthesis of GTP from IMP. The deletion of the purine biosynthesis GMP synthase-encoding guaA gene in A. fumigatus has shown that the strain is unable to grow on media lacking exogenous guanine, and in a murine model of infection the guaA deletion mutant was avirulent (82). Computational modeling has supported the hypothesis that these purine biosynthesis enzymes could serve as potential drug targets in A. fumigatus and the related species Aspergillus niger (104).

Purine metabolism in Cryptococcus neoformans The basidiomycete yeast Cryptococcus neoformans was first identified in 1894 by Sanfelice in peach juice and associated with disease shortly after, identified from lesions from the tibia in a 31 year old patient (105, 106). The division of higher fungi or Basidiomycota is important for the effective breakdown of organic compounds in the environment. Their coevolution with woody plants for over 350 million years has given rise to many species possessing ligno-cellulytic enzymes that digest plant cell walls. This digestive process is essential in the formation of soil humus (107-109). The soil humus contains varying levels of purines, highly dependent on the flora of the area (Table 1).

As well as soil, C. neoformans is commonly associated with bird guano. Unlike mammals, some species require excess nitrogen to be converted to uric acid for its excretion rather than urea; the uric acid cycle requires more energy but conserves water, which for many organisms such as birds is more important (110, 111). Bird excreta, or guano, has long been valued for its fertilizing properties. Ancient South American civilizations added this fertilizer

to enrich soil and improve crops, risking their lives to sail 21 km off the coast of Pisco to the guano-rich Chincha Islands (112). This ancient tradition reached Europe through the exploration of Alexander von Humboldt, leading to a time that became known as the guano boom (113). Chemists such as Gustav Magnus analyzed the nitrogen content to determine the prices that guano should be sold. He reported an acid precipitation on the guano material and found a novel compound now known as guanine to be in high concentrations (114). Bird guano is also high in uric acid, the ingredient responsible for the bird guano-associated damage of buildings, particularly limestone. Since the identification of guanine from guano, no quantitative analysis has been done to identify the specific concentration of purines in this substrate.

C. neoformans has been associated with bird guano since the 1960s and has since been identified worldwide from bird droppings in a range of locations (36, 37). Pigeon guano medium supports the growth of C. neoformans and the production of a key virulence trait, melanin. In addition C. neoformans is able to undergo its sexual cycle on pigeon guano, supporting the theory that pigeon guano is the ecological niche of this fungal pathogen as it can complete its life cycle solely in this environment (115).

Unlike Aspergillus species that can use a wide range of nitrogen sources, C. neoformans is more limited and restricted to ammonium, amino acids and purines (49). All genes encoding the predicted enzymes of the purine degradation pathway in C. neoformans have been characterized. Six enzymatic reactions are required for the breakdown of xanthine to ammonium and are as follows: Urate oxidase for oxidation of urate to HIU (CNAG_04307, URO1), HIU hydrolase (CNAG_06694, URO2) hydrolyzing HIU to OHCU, OHCU decarboxylase (CNAG_00639, URO3) converting OHCU to (S) allantoin, allantoinase (CNAG_00934, DAL1) hydrolyzing allantoin to allantoate, allantoicase (CNAG_01108, DAL2) converting allantoate to urea, and finally urease (CNAG_05540, URE1) hydrolyzing urea to ammonium (116). Each of the genes identified to encode these enzymes has been sequentially deleted and characterized (116). None of these deleted genes affected production of the virulence traits capsule or melanin, nor initiation of the C. neoformans sexual cycle (116). In a murine inhalation model of cryptococcosis, only urease, the final enzyme of the pathway for the hydrolysis of urea to ammonia, is required for pathogenesis (117-119).

The salvage pathway in C. neoformans consists of a number of enzymes that can interconvert purine intermediates. The nucleoside hydrolases are required for the hydrolysis of nucleotides to nucleosides; hypoxanthine-xanthine-guanine phosphoribosyltransferase (CNAG_02546, HPT1) (HXGPRT) and adenine phosphoribosyltransferase (CNAG_01390, APH1) phosphorylate the nucleotides hypoxanthine, xanthine, guanine, and adenine to IMP, XMP, GMP and ATP respectively (14, 15). The phosphoribosyltransferases have been studied in this organism, and the deletion of the genes encoding these enzymes did not result in any phenotypic differences from the wild-type, nor affect virulence in a murine model of cryptococcosis suggesting purine salvage is not important during the infection process (14, 15).

Like C. albicans and A. fumigatus, C. neoformans encodes ten enzymatic activities for the conversion of phosphoribosylpyrophosphate to IMP. Additionally, four enzymatic activities are required for IMP to be converted to GMP and four enzymatic activities for its conversion to AMP. Deletion of the gene encoding AIR carboxylase (CNAG_02294, ADE2) showed the identical phenotype to C. albicans and S. cerevisiae of red pigmentation produced and similarly led to the pathway’s investigation as a potential antifungal drug target. The ade2Δ mutant in a murine inhalation model and rabbit cryptococcal meningitis model was avirulent (120, 121). Enzyme kinetic assays using recombinantly purified protein revealed differences in activity between C. neoformans and Gallus gallus AIR carboxylase, suggesting this could be a novel target of inhibition against the fungal pathogen (122).

Analysis of the enzymes from the IMP branchpoint to either adenine or guanine synthesis has been carried out for four enzymes in C. neoformans: adenylosuccinate synthetase (ADSS) (CNAG_02858, ADE12) and inosine monophosphate dehydrogenase (IMPDH) (CNAG_00441, IMD1) (14, 15). Deletion of the genes encoding these enzymes leads to strains that are purine auxotrophs, are attenuated for virulence trait production and are avirulent in a murine inhalation model, contrasting starkly with the salvage mutants and highlighting the importance of de novo purine biosynthesis during infection (14, 15). Biochemical and structural analyses have determined potential differences between these fungal enzymes and their human counterparts that may be exploited in the development of fungal-specific therapeutics (14, 15, 121, 122).

Purine biosynthesis as an antifungal drug target Since the 1940’s the synthesis of purines has been an important biochemical pathway in the discovery of novel drugs (92, 123, 124). The enzymatic activities of the purine biosynthesis pathway have been particularly useful targets in the development or discovery of herbicide, anticancer and immunosuppressive agents, such as hadacidin, mercaptopurine, and mycophenolic acid (MPA) (125-130).

MPA, an inhibitor of the rate-limiting enzyme IMPDH in de novo synthesis of guanosine nucleotides, has been shown to have activity against C. albicans, A. fumigatus and C. neoformans (14, 82, 131, 132). Mode of action studies have determined that MPA binds to the site of the mobile flap of IMPDH and prevents formation of the closed enzyme conformation (133). Studies of C. neoformans IMPDH have shown that while is is inhibited by MPA, unlike mammalian IMPDH this drug is able to bind to all conformations of the fungal IMPDH and not exclusively to the open conformation (14). Interesting, only limited inhibition of A. fumigatus IMPDH by MPA occurs, which is perhaps unsurprising given that MPA is produced by several Penicillium species commonly found in the same environments, and A. fumigatus therefore may have developed some resistance to the compound produced by competing species in its environmental niche (134). Unfortunately, MPA itself cannot be used as an antifungal agent in the clinic against opportunistic pathogens due to its immunosuppressive activity; however, investigating this drug for activity against fungal enzymes is proof of principle that the enzyme of these pathways can be targeted by inhibitors of purine biosynthesis and may be a starting point for fungal specific inhibitor development.

The L-aspartate analog hadacidin has been identified as an antibiotic and anticancer agent that targets ADS synthetase (125, 135). First isolated from Penicillium frequentans, this compound has exhibits 100% inhibition against Eschrichia coli as well as excellent clinical activity against human adenocarcinoma (136). However, in fungi this compound does not show antifungal activity against C. neoformans or A. fumigatus, and whilst there is some inhibition of C. albicans growth, this is limited (15). In enzyme kinetics assays hadacidin cannot fully inhibit C. neoformans ADS synthetase, but again this compound could serve as a basis for the development of antimycotics that act via ADS synthetase (15). While little, if

anything, is known about the antifungal activity of other purine biosynthesis inhibitors such as mercaptopurine (which closely resembles hypoxanthine and adenine and targets the HGPRT enzyme), the known activities of MPA and hadacidin along with the available crystal structures of their targets suggests that purine biosynthesis has the potential to be a valuable target for future antimycotic development.

Conclusion While the salvage of environmental purines, the synthesis of de novo purine nucleotides and the breakdown of purines to their simplest form, ammonia, are common to the fungi that pose the most consistent major threat to humans, these processes are not all essential during the infection process. Scavenging purines from their environmental niche likely confers a selective advantage to A. fumigatus, C. albicans and C. neoformans. However during infection, the de novo biosynthesis pathway is essential, likely due to pressures such as rapid proliferation, host immune defenses, and differences in purine availability. Deletion or disruption of enzymes from the de novo purine pathway in all three species are associated with either avirulence or reduced virulence of strains, making these attractive antifungal drug targets.

Chapter 2: Antimicrobial octapeptin C4 analogues active against Cryptococcus species

Preface The first research chapter of this thesis focuses on classical drug design. In this chapter octapeptin C4 and its analogues are analysed for their antifungal properties. This chapter was submitted as a peer reviewed manuscript to antimicrobial agents and chemotherapy.

My contribution to this publication was as follows: 1. Minimum inhibitory concentration assays of all fungal strains 2. Minimum inhibitory concentration assays of alanine scan compounds 3. Capsule and melanin assays 4. Writing the manuscript

The contributions of others to this manuscript are listed in the preliminary pages of this thesis.

Abstract Resistance to antimicrobials is a growing problem in both developed and developing countries. In the context of nations where AIDS is most prevalent, the human fungal pathogen Cryptococcus neoformans is a significant contributor to mortality, and its growing resistance to current antifungals is an ever-expanding threat therefore new antifungal drugs are urgently needed. We have investigated octapeptin C4 from the cyclic lipopeptide class of antimicrobials as a potential antifungal. We have shown octapeptin C4 to be a potent and selective inhibitor of this fungal pathogen with a minimum inhibitory concentration of 1.56 µg/mL, eight-fold more potent than the related and previously characterized polymyxin B. Further testing of octapeptin C4 against 40 clinical isolates of C. neoformans var. grubii or neoformans showed MIC 1.56-3.13 µg/mL. Clinical isolates of C. neoformans var. gattii displayed more MIC variation 0.78-12.5 µg/mL with octapeptin C4. However MIC of octapeptin C4 was consistently equal to, or more potent than the current antifungal drugs fluconazole and amphotericin B. The polysaccharide capsule of C. neoformans influences the pathogens sensitivity to octapeptin C4, but does not fully explain the potent inhibition. With the aid of octapeptin C4 derivatives from an alanine scan we provided insight into the structure activity relationships of this compound, revealing that while the cationic diaminobutyric acid groups play a role, the lipophilic groups are more important. Octapeptins have promising potential as a new class of anticryptococcal compounds.

Introduction Despite dwindling interest in antimicrobial development from pharmaceutical companies, academia is continuing to refresh a pipeline of research in this area (1, 137). Much of this work is focussed on pathogens that are a significant problem in the first world, particularly nosocomially-acquired infections caused by Staphylococcus aureus and Enterobactereacae, in which drug resistance is a major concern (138). In contrast, important pathogens more prevalent in developing nations tend to be overlooked. One such pathogen is Cryptococcus neoformans, a basidiomycete yeast that is a leading cause of death in HIV/AIDS patients (139). Infection occurs in immunocompromised patients after airborne basidiospores or desicated yeast cells are inhaled, ultimately entering the alveoli. The C. neoformans fungus can cause pneumonia or, more frequently, disseminate to the central nervous system to manifest as meningoencephalitis (140). In total cryptococcal meningoencephalitis accounts for 15% of AIDS related mortality (139). While improved diagnosis due to development of a lateral flow assay, has enhanced clinical outcomes of these patients, effective antifungal drugs are still a limiting factor in combating infection (141).

Treatment for cryptococcosis is reliant on multi-drug therapy (142, 143). Current recommendations are induction therapy with amphotericin B and flucytosine, followed by consolidation and maintenance with fluconazole (6, 144). Fluconazole and amphotericin B exploit the presence of ergosterol in the C. neoformans cell membrane; fluconazole inhibits ergosterol biosynthesis, and amphotericin B binds ergosterol on the cell membrane to cause cell leakage (145, 146). Flucytosine is an antimetabolite prodrug which disrupts nucleic acid metabolism thereby inhibiting both protein and DNA synthesis in fungi (147). Alarmingly, sustained use of these few antifungals has led to emergence of resistant strains (2, 148-154). Although resistance to all three drugs has been observed, cryptococcosis treatment has not significantly altered in over two decades despite unacceptably high mortality rates (142, 143). New therapeutics are urgently needed.

A resource-effective approach to combat C. neoformans is to capitalize on biophysical properties the fungus shares with other infecting microbes, and repurpose drugs that are already in use treating these illnesses; this takes advantage of pharmacology and toxicity information already available. Given the interface between the host and infecting C. neoformans cells is the negatively charged polysaccharide capsule (7), agents whose mode of

action is via interaction with negatively charged surfaces could potentially be exploited to treat cryptococcal meningoencephalitis. A series of such compounds, first discovered in the 1970s, are the octapeptins produced by Bacillus circulans (155-157). Octapeptins are cationic cyclic lipopeptides, with seven amino acids in the cyclic core and an eighth exocyclic amino acid linked to a lipid tail group (158-161). Despite early reports of activity against bacteria, fungi and protozoa, octapeptins remain relatively unexplored with surprisingly few investigations of this family of naturally occurring compounds (160, 162).

Other examples of cyclic lipopeptide molecules are polymyxin B (PMB) and polymyxin E (PME, also known as colistin), broad-spectrum lipodecapeptides used against Gram-negative bacterial infections (8). PMB and PME are secondary metabolites of Paenibacillus polymyxa, a Gram-positive aerobic bacteria abundant in most rhizospheric soils (162, 163). These are particularly relevant in the context of antibiotic resistance as PME, despite its nephrotoxicity, is used as a last line of defence against drug-resistant Gram-negative bacteria (164, 165). In these pathogens binding of PMB or PME occurs primarily via the polycationic cyclic heptapeptide core of the drug displacing calcium and magnesium ion bridges in lipopolysaccharide while the fatty acid of the linear peptide tail interacts with the membrane, leading to permeability changes and cell death (166, 167). PMB has also been shown to have weak activity against C. neoformans, and more potent activity when used in synergy with azoles against this fungal pathogen (9, 10).

Here we report the first detailed in vitro antifungal study of pure synthetic octapeptin C4, and direct comparative data to PMB and PME against a panel of fungal pathogens: Candida albicans, Candida glabrata, Candida parapsilosis, Cryptococcus gattii, Cryptococcus neoformans and one pathogenic mould Aspergillus fumigatus. Furthermore, nine octapeptin C4 analogs, constructed using solid phase peptide synthesis, were used to examine structure- activity relationships (SAR). Activities of compounds were determined by broth microdilution assays as well as time-course assays to determine activity against capsule and melanin induced C. neoformans cells. Understanding the SAR of these compounds is the first step in guiding synthesis of more active and efficacious derivatives for the treatment of life- threatening disseminated fungal diseases.

Results Octapeptin C4 is eight-fold more potent than PMB at inhibiting growth of C. neoformans A broth microdilution assay was initially employed to characterize the antifungal activity of the cyclic lipopeptides (168, 169). Four common pathogenic yeasts, C. albicans, C. glabrata, C. parapsilosis, C. neoformans and C. gattii, and one pathogenic mold, A. fumigatus, were tested to determine the minimum inhibitory concentration (MIC) for each compound (Table 1) using broth microdilution. Similar to previous reports (9, 10), PMB exhibited specificity towards C. neoformans with both strains tested showing a MIC of 12.5 µg/mL, while the C. gattii strain had an MIC of 25 µg/mL. In contrast, C. albicans, C. glabrata, C. parapsilosis and A. fumigatus growth was not inhibited at the highest concentration of test compound (100 µg/mL) (9, 10). The antibiotic of last resort, PME, did not show significant antifungal activity against any of the species analyzed in this assay. The only structural difference between these molecules is the presence of a phenylalanine residue at position 6 in PMB; in PME a d- leucine is present at this location (Fig. 1).

Fig. 1. Cationic cyclic lipopeptide antibacterial agents. Polymyxin B and polymyxin E are produced by P. polymyxa. The related species B. circulans produces octapeptin C4.

Analysis of the antifungal activity of octapeptin C4 revealed a minimum inhibitory concentration of 1.56 µg/mL against both C. neoformans strains and 3.13 µg/mL against C. gattii. As with PMB, the other fungal strains were resistant up to concentrations of 100 µg/mL or above. Octapeptin C4 is therefore not a broad spectrum antifungal, but a specific inhibitor of Cryptococcus; compared to PMB, octapeptin C4 was eight-fold more potent.

Clinical isolates of C. neoformans var. grubii and C. neoformans var. neoformans displayed MIC results between 1.56-3.13 µg/mL in a total of 40 strains. 20 clinical isolates of C. neoformans var. gattii displayed more variation in MIC results between 0.78 µg/mL and 12.5 µg/mL (supplementary Table 1).

Table 1 Antifungal MIC (µg/mL) of PMB, PME and octapeptin C4 in broth microdilution assays against common fungal pathogens. MIC (µg/mL) C. neoformans

Compound

cap59

C. albicans C. glabrata C. parapsilosis fumigatus A. C. gattii H99 ATCC 90113 H99 PMB >100 >100 >100 >100 25.0 12.5 12.5 50

PME >100 >100 >100 >100 - 100 - -

Octapeptin C4 >100 100 >100 >100 3.13 1.56 1.56 6.25

The C. neoformans capsule influences sensitivity to octapeptin C4 The different susceptibility of C. neoformans and C. gattii to PMB in comparison to other pathogenic fungi such as C. albicans and A. fumigatus has been postulated to arise from differences in cell surface composition (10). One key difference is the presence of a negatively charged polysaccharide capsule in Cryptococcus spp. proposed to concentrate the cationic lipopeptides at the cell surface (10). To examine this potential interaction for the octapeptin series, a C. neoformans cap59Δ mutant strain deficient in the secretion of negatively charged glucuronoxylomannan (an α1–3 linked mannan containing β1,2 and β1,4 xylosyl substitutions, as well as β1,2-linked glucuronyl residues) (170, 171) was tested against octapeptin C4 in comparison to PMB. These data suggested the altered capsule of the cap59∆ mutant provides a degree of protection against cationic lipopeptides such as PMB and octapeptin C4.

To further probe the effect of the quantity of wild-type, negatively charged polysaccharide capsule on octapeptin C4 sensitivity, time-course cell viability assays were conducted (Fig. 2).

Fig. 2. Capsule formation enhanced fungicidal effect of PMB but retarded fungicidal activity of octapeptin C4. A, C. neoformans grown on capsule inducing RPMI 1640 agar medium

(without l-glutamine and sodium bicarbonate) and incubation at 37 ˚C in 5% CO2 for 3 days. Scale bar represents 20 µM. B, C. neoformans grown on capsule suppressing media, YPD containing 1 M NaCl at 30 ˚C in ambient air for 3 days. C, The survival of capsule induced or suppressed C. neoformans cells after incubation with PMB at 12.5 µM (p < 0.01*) or D, octapeptin C4 at 1.56 µM (p < 0.01*). The data represents the mean of replicates and the error bars represent SEM.

In the presence of PMB it took only around 1 hour to observe a 50% reduction in viability of the fungal cells with large capsule, whereas it took five times longer to observe an equivalent effect of the capsule suppressed fungal cells. In contrast, it was found that the reciprocal was true for the fungicidal activity of octapeptin C4; in this case, abundant capsule production led to a small but statistically significant increase in survival.

C. neoformans melanization does not affect activity of octapeptin C4 A second key virulence trait of C. neoformans that could interact with cationic lipopeptides is melanin, a negatively charged pigment in the cell wall (172). Melanin granules anchored in the fungal cell wall form ordered concentric layers and are known to contribute to survival and pathogenesis (173). The activity of PMB or octapeptins against melanized C. neoformans has not been previously reported. We used a time course cell viability assay where

melanization was induced by growth on L-DOPA agar medium and suppressed by growth on YPD agar medium. PMB showed no difference in activity relative to degree of melanization whereas fungicidal activity of octapeptin C4 was slightly enhanced with heavily melanized C. neoformans cells.

Figure 3. Octapeptin C4 fungicidal activity is not influenced by melanization of C. neoformans. A, Melanin suppressed C. neoformans. B, Melanin induced C. neoformans. C, D, Graphs show survival of melanized and non-melanized C. neoformans cells after incubation with either C, PMB at 12.5 µM or D, octapeptin C4 at 1.56 µM (p < 0.01*). Samples from each flask were taken at 0, 1, 2, 4, 6 and 8 h after inoculation, spread onto a YPD plate and incubated at 30 ˚C for 3 days at which time colonies were counted. The data represents the mean of replicates and the error bars represent SEM.

SAR studies revealed the lipophilic groups are more important than the diaminobutyric acid residues for the anticryptococcal activity of octapeptin C4 We investigated the functional importance of key residues in octapeptin C4 to antifungal activity by performing an alanine scan, using a published route to synthesise a series of nine octapeptin C4 derivatives that each differ from the parent compound by a single residue converted to an alanine (174). The structure-activity relationships of PMB, octapeptin C4 and the nine alanine scan analogs was explored in MIC assays of the four Cryptococcus strains employed so far in the study (H99, ATCC 90113, MMRL 2651 and the cap59Δ mutant). The cationic nature of octapeptin C4 is a product of its four diaminobutyric acid (Dab) residues; if electrostatic interactions between these cationic Dab groups and the polysaccharide capsule were a key feature of the antifungal activity of octapeptin C4 then altering these to non- cationic amino acids should lead to a reduction in efficacy against the Cryptococcus wild- type strains. The octapeptin C4 Dab residues were therefore sequentially replaced with alanine in compounds P1, P3, P6 and P7.

Figure 4. Nine octapeptin C4 alanine scan derivatives. All amino acids are L-isomers unless otherwise indicated.

A consistent increase in the MIC values was observed from 1.56 µg/mL to 6.5 µg/mL in the H99 and ATCC 90113 strains indicating the Dab residues were all equally important for the antifungal activity of the octapeptins (Table 2). Furthermore, maintaining the D configuration of the natural octapeptin structure at position 1 (P1D) gave a lower MIC than changing it to the L configuration (P1L). These results were mirrored in the MMRL 2651 C. gattii strain but with higher MIC values.

Our SAR studies also probed the effect of the lipophilic moieties, Phe (P4D and L) and Leu (P5) and (P8), by sequentially switching to alanine. These changes showed the lipophilic groups were potentially more important for antifungal activity than the cationic Dab residues as MIC values were even poorer. The stereochemical configuration of the natural analog at position 4 is D and maintaining this in the alanine variant (P4D) gave a better MIC than the L configuration (P4L). Overall, the nine alanine derivatives were all less active than the original octapeptin C4.

Table 2. MIC of octapeptin C4 and alanine scan derivatives.

Cryptococcus strain Compound H99 ATCC 90113 MMRL 2651 cap59Δ

Octapeptin C4 1.56 1.56 3.13 6.25

P1L 12.5 12.5 12.5 25.0

P1D 6.25 6.25 12.5 12.5

P3 6.25 6.25 12.5 12.5

P4L 50.0 25.0 100 100.0

P4D 12.50 12.5 25.0 50.0

P5 12.5 12.5 25.0 50.0

P6 6.25 6.25 6.25 12.5

P7 6.25 6.25 12.5 12.5

P8 50.0 6.25 50.0 100

MICs are given in µg/mL; performed in triplicate; values were consistent across replicates.

Discussion To address the need for new antimicrobials, in particular against fungal pathogens, we can potentially repurpose classes of drugs that have already been studied and characterized against other pathogens by exploiting shared physiologies. PMB has been proposed to target the negatively charged surface of Gram-negative bacteria, a characteristic shared with C. neoformans. In vitro assays of PMB shows a relatively high concentration of PMB is required to exert fungicidal effect most likely precluding monotherapy due to associated toxicity at high doses; however, synergy with the azole class of antifungals suggests it may be clinically useful in treating fungal disease (9, 10). Although there is striking similarity between the structures of polymyxins (PMB and PME) and the octapeptin class of antibiotics, octapeptins are functionally distinct as they retain activity against polymyxin resistant bacteria (174). This led us to explore octapeptins as potential antifungal agents and to study which structural features were key to their antifungal activity.

Antifungal MICs determined in broth microdilution assay (Table 1) showed that octapeptin C4 was Cryptococcus specific MIC 1.56 µg/mL and a promising lead compound. Octapeptin C4 was approximately eight-fold more potent than PMB MIC 12.5 µg/mL and >60 fold more potent than PME. In keeping with these data, clinical isolates of C. neoformans var. grubii and C. neoformans var. neoformans displayed MIC results between 1.56-3.13 µg/mL in a total of 40 strains. 20 clinical isolates of C. neoformans var. gattii displayed more variation in MIC results between 0.78 µg/mL and 12.5 µg/mL (supplementary Table 1). Intriguingly, a phenylalanine residue is present at position 4 in octapeptin C4, an equivalent location to the phenylalanine residue key to the antifungal activity of PMB. In these MIC tests, the clinical compounds fluconazole and amphotericin B were used as comparative controls, octapeptin C4 was equivalent or more potent than either drug in vitro (supplementary Table 1). The differences in membrane composition of bacterial cells versus eukaryotic fungal cells (high levels of sterols, neutral lipids and low membrane potential) (175, 176) are likely responsible for the increased MIC in pathogenic fungi with PMB (9, 10). Octapeptin C4 showed CC50 of 31 µM in human kidney-2 cell line and a similar activity in hRPTEC cells based on lactate dehydrogenase release assay (174). While improvement in this cytotoxicity measure would be desirable, there is a therapeutic window, which maybe improved through chemical modification and SAR studies.

Cryptococcus has a protective, negatively charged, polysaccharide layer of variable thickness which encapsulates the yeast cell. The capsule modulates, and provides protection from, immune responses of the host, and promotes virulence (177, 178). The cap59Δ mutant of C. neoformans H99 is often described as acapsular and was used to further investigate the effect of capsule on PMB, octapeptin C4 and alanine scan analogues on antifungal activity. An increased resistance to PMB was found, in agreement with literature precedent (10), and was also true for the octapeptins. However, the cap59Δ strain is not truly acapsular, it can produce both glucuronoxylomannan and galactoxylomannan but only secretes galactoxylomannan to form its capsule. This altered capsule seems to provide a degree of resistance to penetration by the tested compounds. Capsule of the, physiologically relevant, native C. neoformans H99 strain has glucuronoxylomannan as principal component and this strain is more suited to prediction of capsule influence on drug efficacy. In agreement with literature precedent (10) the presence of this capsule increased susceptibility of C. neoformans to PMB as shown by incubation of fungal cells with capsule production induced (9, 10). In contrast, under the same conditions, octapeptin C4 antifungal activity was slightly suppressed. This may give early indication of divergent mode of action where octapeptin C4 activity cannot be fully explained by ionic interactions with the capsule.

A second negatively charged feature on the surface of C. neoformans is melanin. Melanization can alter susceptibility of C. neoformans to amphotericin B and caspofungin as these antifungal drugs bind to melanin, adversely affecting their antifungal activity and consequently the treatment of patients (179-181). However, other melanin binding agents have been reported to increase susceptibility of the fungal cell to the antifungal agents trifluoperazine and chloroquine (182); this is particularly significant for meningoencephalitis infections where melanization of C. neoformans is highly prevalent (172). Here we observed that the antifungal activity of PMB and octapeptin C4 was not diminished against heavily melanized fungal cells; indeed, octapeptin C4 showed slightly enhanced activity. This was encouraging in considering these compounds as therapeutic agents as they are unlikely to show the altered susceptibility characteristic of amphotericin B and caspofungin.

Comparison of antifungal activity of polymyxin antibiotics to octapeptin C4 led us to explore the structural features of the octapeptins that played a key role in their activity. It is possible that the negatively charged capsule of Cryptococcus attracts and concentrates cationic lipopeptides increasing their antifungal effect, which is supported by the correlation of the

number of positively charged Dab residues with decreased antifungal activity. Despite this apparent importance of the octapeptin Dab groups, it is noteworthy that PMB has 5 cationic Dab groups, yet is less effective against Cryptococcus than the octapeptin alanine scan variants with only three such residues. This further indicates that the charged interactions between the cationic Dabs and the negatively charged capsule do not entirely explain the mode of action for octapeptin C4.

The hypothesis that there is a correlation between Dab residues and a decreased antifungal activity is over simplistic; our SAR studies showed lipophilic moieties of octapeptin C4 are even more important for the fungicidal activity than the Dab residues. Given the polysaccharide capsule is highly hydrophilic and water accounts for 99% of the total volume and weight of the capsule (183), the lipophilic residues of octapeptin C4 are more likely to be critical in binding to the cell membrane.

The potency of octapeptin C4 as an antifungal agent against Cryptococcus laboratory strains and clinical isolates provides an exciting foundation on which to develop future therapeutics. Work is ongoing to investigate octapeptin C4 antifungal mode of action and activity in vivo. We are also studying other members of the octapeptin series and synthesising analogues with improved activity/toxicity window.

Materials & methods Test compounds PMB sulfate, PME (colistin), fluconazole and amphotericin B were purchased from Sigma

Aldrich (Australia). Octapeptin C4 and nine alanine scan derivatives were synthesized using a route reported previously (174). All compounds were solubilized in water, with the exception of fluconazole, which was solubilized in DMSO. For purity data see the supplementary information.

Strains and media Fungal strains were stored in 15% glycerol at -80 ˚C until use. The fungal strains used were H99 (C. neoformans type strain) (184), cap59Δ (an acapsular H99 mutant) (185), ATCC 90113 (C. neoformans), MMRL 2651 (C. gattii), ATCC 90028 (Candida albicans), ATCC 90030 (Candida glabrata), ATCC 22019 (Candida parasilosis), and ATCC MYA 3626 (Aspergillus fumigatus). Yeasts were cultured in liquid (1% yeast extract, 2% bacto-peptone, 2% glucose) or solid (additional 2% agar) YPD media at 30 ˚C, and maintained at 4 ˚C for no longer than two weeks. A. fumigatus was prepared on potato dextrose medium at 30 ˚C and maintained at 4 ˚C for no longer than two weeks.

In vitro assay of drug efficacy The minimum inhibitory concentrations (MIC) of the yeast strains for PMB, PME, octapeptin C4 and its derivatives were determined in accordance with the CLSI M27-A2 guidelines using YNB (Becton Dickinson, USA) medium supplemented with 10 mM ammonium sulfate and 2% glucose, final inoculum concentration of 1.5 – 2.0 × 103 cells/mL and incubation at 35 ˚C for 72 h (168). Test compound concentrations ranged from 0.1 µg/mL to 49 ng/mL; the MIC was defined as the concentration that prevented any discernible visible growth after 48 (C. albicans, C. glabrata, C. parasilosis) or 72 h (C. neoformans). The MIC of A. fumigatus for PMB, PME and octapeptin C4 was determined in accordance with the CLSI M38-A2 guidelines (169) using synthetic RPMI 1640 medium (with glutamine, without bicarbonate and with phenol red) (Life Technologies, USA). Final inoculum concentration of 0.4 × 104 – 5 × 104 cells/mL and incubation at 35 ˚C for 48 h. Test compound concentrations ranged from 0.1 µg/mL to 49 ng/mL; the MIC was defined as the concentration that prevented any

discernible visible growth after 48 h. All assays were completed in triplicate and fluconazole used as positive control. All assays were completed in triplicate and fluconazole used as positive control with no discernible growth observed above 5 µg/mL.

In vitro time-course assay of capsule influence on test compound efficacy Capsule induction of strain H99 was achieved as described by Zhai and colleagues (9) with growth on RPMI 1640 (without L-glutamine and sodium bicarbonate) (Sigma, Australia) agar medium and incubation at 37 ˚C in 5% CO2, and capsule suppression by growth on YPD containing 1 M NaCl at 30 ˚C in ambient air. After 3 days, cells from each culture were collected, washed twice with phosphate buffered saline (PBS) and resuspended in PBS to avoid changes in capsule at a density of 1,500-2,000 cells/mL. Cell suspensions were treated with test compounds at the determined MIC value. The compounds tested were: PMB sulfate, octapeptin C4 and the octapeptin C4 alanine scan derivatives P1L, P1D, P4, P3, P4L, P4D, P5, P6, P7 and P8. At 0, 1, 2, 4, 6 and 8 h after inoculation, samples from each treatment where spread onto a YPD plate and incubated at 30 ˚C for 3 days at which time colonies were counted. The assay was repeated in duplicate and paired sample t-test were performed in GraphPad Prism version 7.0 (GraphPad Software, USA)

In vitro time-course assay of melanization effect on test compound efficacy

Melanization was induced by growth on L-DOPA agar medium at 30 ˚C, and suppressed by growth on YPD agar medium at 30 ˚C. Cells were grown over 3 days and collected, washed twice in PBS, then resuspended in PBS at a density of 1,500-2,000 cells/mL. Aliquots of the cells were treated with PMB sulfate, octapeptin C4 and the octapeptin C4 derivatives P1L, P1D, P4, P3, P4L, P4D, P5, P6, P7 and P8 at the determined MIC concentration. At 0, 1, 2, 4, 6 and 8 h after inoculation, samples of the suspension where spread onto YPD agar and incubated at 30 ˚C for 3 days, and colonies counted. The assay was repeated in duplicate and paired sample t-test were performed in GraphPad Prism version 7.0 (GraphPad Software, USA)

Supplementary figures

Figure S1. In vitro time-course assay of C. neoformans melanisation effect on compound efficacy using strain H99

Figure S2. In vitro time-course assay of C. neoformans capsule effect on compound efficacy using strain H99

Supplementary table Table S1 MIC values of clinical isolates

C. neoformans var. grubii Fluc Amp B Oct C4 Strain Ref Origin (ug/mL) (ug/mL) (ug/mL) H99 XL (9, 10) lab strain 6.25 3.13 1.56 H99 stud (184) lab strain 6.25 3.13 1.56 H99O (184) lab strain 12.50 3.13 1.56 486 USA 25.00 3.13 3.13 488 (186) AIDS+, pre-HAART USA 25.00 3.13 1.56 490 USA 12.50 3.13 1.56 496 USA 12.50 3.13 1.56 500 USA 12.50 3.13 1.56 502 (186) ARR3+ USA 12.50 3.13 3.13 505 India 6.25 3.13 1.56 507 India 12.50 3.13 1.56 510 VNII India 3.13 3.13 1.56 512 India 12.50 3.13 3.13 516 India 12.50 3.13 3.13 518 (187) VNI India 12.50 3.13 1.56 522 India 12.50 3.13 3.13 525 India 25.00 3.13 1.56 1188 (187) Japan lung 12.50 3.13 3.13 1189 (187) USA BAL/HIV 25.00 3.13 1.56 1194 (187) Italy 6.25 3.13 1.56 1197 (187) Botswana CSF/AIDS 12.50 3.13 3.13 1196 (187) Botswana CSF/AIDS 25.00 3.13 3.13 1199 (187) Uganda CSF/HIV+ VNII 12.50 3.13 1.56

C. neoformans var. gattii Fluc Amp B Oct C4 Strain Ref Origin (ug/mL) (ug/mL) (ug/mL) R266 (188) Vancouver Island 12.50 6.25 1.56 R267 (188) Vancouver Island <25 6.25 12.50 R268 (188) Vancouver Island 1.56 6.25 3.13 R269 (188) Vancouver Island 12.50 6.25 3.13 R270 (188) Vancouver Island 6.25 12.50 3.13 B5742 (188) VGIV CSF India 6.25 6.25 3.13 B5748 (188) VGIV HIV India 12.50 6.25 3.13 ATCC 24066 (188) ATCC (NIH 18) 3.13 6.25 1.56 ATCC 32269 (188) ATCC 1.56 3.13 3.13 ATCC 32608 (188) ATCC (NIH 191) 0.78 6.25 0.78 ATCC 32609 (188) ATCC (NIH444) 6.25 3.13 3.13 ATCC 34878 (188) ATCC 6.25 3.13 3.13 ATCC 34882 (188) ATCC 6.25 3.13 6.25

93/980 (188) CSF France 3.13 3.13 3.13 94/943-6 (188) CSF Mexico 6.25 3.13 3.13 94/943-7 (188) CSF Mexico 12.50 6.25 6.25 94/943-8 (188) CSF Mexico 1.56 3.13 1.56 94/943-10 (188) CSF Mexico 6.25 6.25 1.56 96/1120-1 (188) Brain HIV2 France 25.00 6.25 3.13 96/1120-2 (188) CSF HIV2 France 25.00 12.50 3.13

C. neoformans var. neoformans Fluc Amp B Oct C4 Strain Ref Origin (ug/mL) (ug/mL) (ug/mL) WM 01.127 USA 12.50 3.13 1.56 WM 02.142 Russia 12.50 6.25 1.56 WM 02.37 Canada 25.00 3.13 1.56 WM 02.52 Canada 6.25 6.25 1.56 WM 04.168 Chile 12.50 3.13 1.56 WM 04.171 Thailand * 6.25 3.13 1.56 WM 05.467 Brazil * 12.50 3.13 1.56 WM 05.515 Peru 6.25 3.13 1.56 WM 09.109 Italy* 6.25 3.13 1.56 WM 09.112 USA 12.50 3.13 1.56 WM 10.119 Australia 6.25 3.13 1.56 WM 1706 Argentina 12.50 3.13 1.56 WM 1740 Chile 6.25 3.13 3.13 WM 2207 USA*l 25.00 3.13 1.56 WM 2242 USA 3.13 3.13 1.56 WM 2530 USA 6.25 3.13 3.13 WM 629 Australia 6.25 3.13 3.13 WM 02.141 Russia 6.25 3.13 3.13 WM 02.143 Russia 12.50 3.13 3.13 *denotes strains isolated from the environment rather than human clinical strain.

Table S2. Purity of synthesized compounds Compound % Purity by LC-MS

ELSD UV (254 nm)

Octapeptin C4 100 100 P1L 100 100 P1D 100 100 P3 100 100 P4L 100 100 P4D 100 100 P5 100 96 P6 100 100 P7 100 100 P8 100 100

Chapter 3: GMP synthase is required for virulence factor production and infection by Cryptococcus neoformans

Preface The second research chapter of this thesis focuses on the characterization of C. neoformans GMP synthase as a candidate antifungal drug target. This work was published in 2017.

My contribution to this publication was as follows: 1. Cloning, expression and purification of recombinant GMP synthase 2. Enzyme kinetic assays 3. Minimum inhibitory concentration assays 4. Attempted crystallization and subsequent modelling of C. neoformans GMP synthase structure 5. Writing the manuscript

The contributions of others to this manuscript are listed in the preliminary pages of this thesis.

Publication reference: Jessica L. Chitty, Tayla L. Tatzenko, Simon J. Williams, Y. Q. Andre E. Koh, Elizabeth C. Corfield, Mark S. Butler, Avril A. B. Robertson, Matthew A. Cooper, Ulrike Kappler, Bostjan Kobe and James A. Fraser (2017) “GMP synthase is required for virulence trait production and infection by Cryptococcus neoformans” Journal of Biological Chemistry, 292(7): 3049-59

Abstract Over the last four decades the HIV pandemic and advances in medical treatments that also cause immunosuppression have produced an ever-growing cohort of individuals susceptible to opportunistic pathogens. Of these, AIDS patients are particularly vulnerable to infection by the encapsulated yeast Cryptococcus neoformans. Most commonly found in the environment in purine-rich bird guano, C. neoformans experiences a drastic change in nutrient availability during host infection, ultimately disseminating to colonize the purine-poor central nervous system. Investigating the consequences of this challenge, we have characterized C. neoformans GMP synthase, the second enzyme in the guanylate branch of de novo purine biosynthesis. We show that in the absence of GMP synthase, C. neoformans becomes a guanine auxotroph, the production of key virulence traits is compromised, and the ability to infect nematodes and mice is abolished. Activity assays performed using recombinant protein unveiled differences in substrate binding between the C. neoformans and human enzymes, with structural insights into these kinetic differences acquired via homology modelling. Collectively, these data highlight the potential of GMP synthase to be exploited in the development of new therapeutic agents for the treatment of disseminated, life threatening fungal infections.

Introduction In the past four decades there has been a dramatic escalation in the number of immunocompromised individuals (189). While many of these are due to advances in immunosuppressive and chemotherapeutic technologies, the largest cohort is a direct result of the AIDS pandemic. Foreshadowed in 1981 with the occurrence of opportunistic Pneumocystis or Human Herpesvirus 8 infections in previously healthy individuals in Los Angeles (190, 191), Acquired Immunodeficiency Syndrome (AIDS) and the lentivirus causing the disease soon gained broad public awareness (192-194). With the advent of commercial blood testing, national blood bank screening programs were commenced in an effort to slow the spread of this emerging pandemic (195) and in 1987 the first treatment, zidovudine, marked what was thought to be an end to the crisis (196, 197). It was not, as was hoped, a miracle drug; the spread of AIDS continued across the globe and is now believed to have infected over 70 million people and killed 55 million to date (198).

Since the discovery of the very first patients identified with Pneumocystis pneumonia, opportunistic fungal pathogens have been tightly linked with the AIDS pandemic. One of the key fungi often encountered in this context is Cryptococcus neoformans, a basidiomycete yeast responsible for cryptococcosis and a major cause of AIDS-related mortality (143). Most commonly found associated with purine-rich bird guano, spores or desiccated yeast cells from this environmental niche are inhaled into the lungs where, in an immunocompromised individual, the fungus can disseminate to the purine-poor central nervous system to cause meningoencephalitis.

The fundamental treatment for cryptococcosis has not changed significantly in over two decades and consists of induction with amphotericin B and flucytosine followed by consolidation and maintenance phases employing fluconazole (2-6). Each of these therapeutic agents exploit an aspect of fungal physiology that differs from the human host: the presence of ergosterol rather than cholesterol in the cell membrane, the existence of the pyrimidine salvage enzyme cytosine deaminase, or changes in the sterol biosynthetic pathway, respectively. Even so, each of these agents still cause side effects, epitomized by the compromised renal function typical of amphotericin B use.

The similarity in physiology between human host and fungal pathogen means there are few gross differences that can be easily targeted via rational drug design. However, differences such as slight changes in the active site of enzymes in a highly conserved essential pathway may be exploited, as typified by fluconazole. One such potential target is de novo purine biosynthesis, the pathway in which the process of rational drug design was pioneered (92, 123, 124). Proliferating cells require vast quantities of ATP and GTP to meet the demands of replication, transcription and energy metabolism. Purine biosynthesis is therefore essential in rapidly dividing immune cells, cancers, or infecting microbes. The pathway is already a target for anticancer drugs (such as mercaptopurine and lometrexol) and immunosuppressants (such as mycophenolic acid) (126-130). However, the investigation of purine metabolism as an antifungal target has been limited (14, 15, 82).

Purine metabolism is of particular interest in C. neoformans due to the gross disparity in purine concentrations in bird guano compared to the central nervous system of the infected human host (11, 13, 199). The importance of de novo biosynthesis rather than scavenging while the fungus infects this purine-poor environment was highlighted by the discovery that inosine monophosphate (IMP) dehydrogenase, catalyst of the rate-limiting and first committed step in the de novo guanosine triphosphate (GTP) biosynthesis pathway, is essential for C. neoformans virulence in a murine model. Importantly, structural studies of this enzyme revealed potentially exploitable characteristics of the fungal enzyme not shared with the human isoforms (14).

IMP dehydrogenase is not the only enzyme in de novo GTP biosynthesis that has potential as an antimycotic target. Following IMP dehydrogenase in the guanylate branch of de novo purine biosynthesis is guanine monophosphate (GMP) synthase (E.C. 6.3.5.2). Originally identified in ground rabbit bone marrow (200) and pigeon liver (201), the key work that underpins our current understanding of GMP synthase was performed in Escherichia coli (202, 203), and this system continues to be the source for a detailed biochemical understanding of the activity of the enzyme (204-206).

GMP synthase is a monofunctional enzyme in all organisms studied so far, with two catalytic modules working in concert to ensure efficient amination of xanthine monophosphate (XMP) to GMP. The magnesium-dependent ATP pyrophosphatase (ATP-PPase) domain reversibly adenylates XMP to form a covalent O2-adenyl-XMP intermediate; this activates the C2

carbon of XMP for attack by the amide side chain of glutamine, liberated by the class I glutamine amidotransferase (GATase) domain (202, 203, 207).

Crystal structure determination of E. coli GMP synthase identified the enzyme as having three distinct domains – the N-terminal ATP-PPase domain, the GATase domain, and a C- terminal dimerization domain – and supported early sedimentation velocity experiments indicating E. coli GMP synthase forms a homodimer (203, 208). GMP synthase structures are now available for other bacterium (Coxiella burnetii (209) and Thermus thermophiles [PDB ID: 2YWB, 2YWC]), archaea (Pyrococcus horikoshii (210)), and two eukaryotes (Plasmodium falciparum (211), Homo sapiens (212)); all contain ATP-PPase, GATase and dimerization domains.

In contrast, few studies of GMP synthase have been performed in fungi. The GMP synthase gene has been identified and mutated in Saccharomyces cerevisiae, Candida albicans and Aspergillus fumigatus; as expected, these mutants were all guanine auxotrophs (82, 83, 213, 214). Furthermore, the GMP synthase mutants of C. albicans and A. fumigatus were avirulent in murine infection models (82). No kinetics or structural studies of fungal GMP synthases are available.

Here, we describe the characterization of GMP synthase from C. neoformans, showing the potential of the enzyme as a broad-spectrum antifungal target. Using genetic techniques, we demonstrate that GMP synthase is required for C. neoformans virulence trait production and successful infection of the host. With the aid of biochemical analyses and structural modelling, we identify key functional differences between GMP synthase from C. neoformans and humans, thereby delineating its suitability as a potential antifungal drug target.

Results Identification of the GMP synthase-encoding gene in C. neoformans In order to begin our characterization of GMP synthase from C. neoformans, the corresponding gene in the type strain H99 genome was identified via a reciprocal best-hit BLAST analysis employing the S. cerevisiae ortholog GUA1 (213). A single hit was observed, indicating that the gene is present in single copy. Located on chromosome 11, this locus was designated as CNAG_018770 in the published H99 genome (184); subsequently employing CNAG_018770 as the query sequence in a BLAST search of the S. cerevisiae genome identified GUA1 as the only hit in that species. The gene CNAG_018770 has therefore been named GUA1 after the S. cerevisiae ortholog, whose predicted product is 65% identical at the amino acid level. In comparison, Gua1 is 50% identical to GuaA in E. coli, 35% identical to human GuaA isoform 1 and 23% identical to the human GuaA and 23% indentical to human GuaA isoform 2.

Gua1 is essential for guanine protrophy in C. neoformans To verify that the identified gene designated as GUA1 encodes GMP synthase, we performed a biolistic targeted gene deletion in C. neoformans type strain H99. Consistent with our bioinformatic predictions, the gua1Δ strain could not grow on YNB minimal medium, but growth was restored (albeit incompletely) upon the addition of guanine (Figure 1B). The gua1∆ strain was not, however, able to utilize the guanine naturally present in rich YPD medium, nor was growth restored by the addition of exogenous guanine to YPD (data not shown); this unusual phenotype was consistent with that previously reported for the IMP dehydrogenase imd1∆ mutant (14). Reintroducing a wild-type copy of the gene to create strain gua1∆+GUA1 restored growth on both YNB and YPD medium (Figure 1B). Together, these data are consistent with GUA1 encoding GMP synthase.

To gain insight into potential growth defects that may be exhibited during infection independent of guanine starvation, the effect of deleting GUA1 on the growth rate was investigated in RPMI 1640 medium supplemented with 1 mM guanine. Again, even in the presence of guanine, the gua1Δ mutant displayed slower growth compared to both wild-type and the complemented gua1Δ+GUA1 strain due to an extended lag phase (Figure 1C). Furthermore, the mutant reached stationary phase at an optical density lower than the wild- type or complemented strains. The delayed and reduced growth of the mutant, even in the

presence of guanine concentrations far exceeding the limited amounts in mammalian cerebrospinal fluid (~0.5 µM, (11)), suggested the mutant was likely to exhibit severe attenuation or avirulence in infection models.

Figure 1. The de novo and salvage purine biosynthesis pathway and GMP synthase role in GTP biosynthesis. A, IMP dehydrogenase and GMP synthase catalyze the first two steps of the guanylate branch of de novo purine biosynthesis. B, 10-fold serial dilutions of indicated strains were spotted onto YNB medium supplemented with specified purines (1 mM) and incubated for two days at 30 ˚C. C, Strains were grown for six days in RPMI 1640 medium supplemented with 10% serum and 1 mM guanine at 30 ˚C, with OD600 readings collected every 12 hours.

Loss of GMP synthase affects production of C. neoformans virulence determinants During the infection process, C. neoformans relies on a number of key virulence traits that play an important role in protecting the pathogen from host defences, facilitating dissemination and growth. To observe the effects of the gua1∆ mutation on the production of these virulence traits while limiting the confounding influence of guanine starvation influencing growth, in vitro virulence trait production assays were performed in the presence of exogenous guanine. The complex polysaccharide capsule protects the fungal cells against

phagocytosis by immune cells during infection. When grown in guanine-supplemented capsule-inducing RPMI 1640 medium, the gua1Δ mutant produced significantly less capsule than wild-type and the complemented gua1Δ+GUA1 strain after 30 hours at both 30 and 37 ˚C (p < 0.0001; Figure 2A). The virulence trait melanin protects C. neoformans against the effects of oxidants, such as those produced by phagocytic cells. When plated on guanine- supplemented L-DOPA medium, production of melanin was delayed; this delay was more pronounced at 37 ˚C. Production of proteases enables C. neoformans to degrade host tissue and facilitate dissemination, as well as obtain nutrients for growth. On guanine-supplemented protease-inducing medium, protease activity was undetectable in the gua1Δ mutant at either 30 or 37 ˚C (Figure 2).

In summary, loss of GMP synthase was associated with delayed or abolished production of the known virulence traits capsule, melanin and proteases, and this was more pronounced at human body temperature, providing further evidence that the gua1∆ mutant was likely to exhibit impaired virulence.

Figure 2. Loss of GUA1 compromises virulence trait production. A, C. neoformans strains were incubated in RPMI 1640 medium, 10% foetal bovine serum and 1 mM guanine at 30 and 37 ˚C. At 30 hours, cells were stained with India ink. The relative capsule diameter value shows the mean and the error bars represent S.E.M (p < 0.0001****) B, Melanin production was determined on L-DOPA medium with strains incubated at 30 and 37 ˚C for 48 hours. C, Protease production was determined on YNB medium with amino acids and 0.1% bovine serum albumin plates, with strains at 30 and 37 ˚C for 48 hours.

GMP synthase is critical for C. neoformans virulence in both nematode and murine models The compromised growth rate and virulence trait production of the gua1∆ mutant strongly suggested the strain would be unlikely to successfully cause infection. Evaluation of virulence was first performed in the nematode Caenorhabditis elegans, a natural predator of C. neoformans (215). Nematodes were introduced onto a lawn of wild-type, gua1Δ or

gua1Δ+GUA1 cells grown on rich BHI medium, minimal NGM medium and minimal NGM medium supplemented with 1 mM guanine. No difference in virulence was observed between the wild-type, gua1Δ and gua1Δ+GUA1 strains when grown on BHI or NGM supplemented with guanine (p > 0.1; Figure 3A). Given the abundance of guanine in bird guano, this result was consistent with what could be expected in the environmental niche where C. neoformans encounters this predator. However, on NGM lacking guanine supplementation, the gua1Δ mutant was avirulent (p < 0.0001; Figure 3A).

Figure 3. Virulence of gua1Δ mutant in nematode and murine host systems. A, Bristol N2 C. elegans were transferred onto lawns of the indicated C. neoformans strains grown on BHI medium, minimal medium and minimal medium supplemented with 1 mM guanine, and incubated at 28 ˚C, and survival was monitored. For minimal medium, the gua1Δ mutant strain was avirulent, differing from the wild-type or gua1Δ+GUA1 strains (p < 0.0001). No significant difference in virulence was found between strains when grown on rich medium or minimal medium supplemented with guanine (p > 0.1). B, Virulence of the gua1Δ mutant in the murine inhalation model of infection. 6-week old female BALB/c mice were infected with H99, gua1Δ or gua1Δ+GUA1 C. neoformans strains (n = 10), and survival was monitored over 60 days. Survival of mice with wild-type or gua1Δ+GUA1 strains showed no significant difference (p > 0.05), and survival was significantly lower than in those infected with the avirulent gua1Δ mutant strain (p < 0.0001). C, Posthumous organ burden was calculated in colony forming units (CFU) per gram of organ as described.

The nematode data indicated the importance of GMP synthase for virulence was influenced by the abundance of guanine available. Given the low concentrations of available purines in cerebrospinal fluid (11, 13, 199), we investigated the effect of gua1Δ on virulence using a murine inhalation model of crypotococcosis. Mice infected with the wild-type and gua1Δ+GUA1 strains displayed equivalent progression of disease, succumbing to the infection within 20 days (Figure 3B). In contrast, rather than losing weight and displaying

other disease-associated symptoms, all mice infected with the gua1Δ strain gained weight and were healthy until the 60 day endpoint of the experiment (Figure 3B). Furthermore, fungal burden analysis from sacrificed animals showed the infection had been cleared from all mice infected with the gua1Δ mutant, similar to previous observations (14).

C. neoformans GMP synthase enzyme kinetics show differences to the human ortholog in binding cooperativity Given the importance of Gua1 during murine infection, we expanded our analyses to investigate the biochemical function of C. neoformans GMP synthase. To identify possible functional differences between the fungal and human enzymes that could be exploited in therapeutic agent development, His-tagged C. neoformans Gua1 was expressed in E. coli, purified, and the histidine tag was removed prior to use of recombinant Gua1 in steady-state kinetic analysis.

The dual catalytic action of GMP synthase is required for the amination of XMP to GMP and involves two main steps: initially adenyl-XMP is produced by the ATP pyrophosphatase (ATP-PPase) domain in the presence of Mg2+ and this product then reacts with ammonia produced by the hydrolysis of glutamine that is catalysed by the N-terminal glutamine amidotransferase (GATase) (202, 207). The amination of XMP in C. neoformans GMP synthase protein displayed Michaelis-Menten kinetics with a Km of 65.9 ± 13.0 µM and a kcat of 0.4 s-1 for the overall reaction. ATP adenylation also exhibited Michaelis-Menten kinetics 2+ and had a Km of 77.5 ± 6.0 µM. In contrast, kinetic data for Mg which is required as a cofactor for the reaction of XMP to adenyl-XMP, revealed a sigmoidal response to increases in substrate concentration, which is indicative of cooperative binding and was best fitted with a Hill coefficient (n) of 2.2 ± 0.2 and a K0.5 of 1289.0 ± 66.0 µM. The final part of the reaction, hydrolysis of glutamine by the GATase domain in the C. neoformans protein displayed Michaelis-Menten kinetics and had a Km of 1130.0 ± 162.0 µM, showing a low affinity for this substrate.

Table 1. Comparison of kinetic parameters of GMP synthase from different organisms. Assay conditions used for C. neoformans (Tris buffer pH 7.5, 0.15 mM XMP, 1 mM ATP, 5 mM glutamine and 20 mM MgCl2), E. coli (60 mM Hepes buffer pH 8, 0.2 mM XMP, 5 mM ATP, 200 mM glutamine, 20 mM MgCl2), M. tuberculosis (50 mM Tris buffer pH 7.5, 0.15 mM XMP, 1 mM ATP, 5 mM glutamine, 20 mM MgCl2), P. falciparum (90 mM Tris buffer pH 8.5, 0.15 mM XMP, 2 mM ATP, 5 mM glutamine, 20 mM MgCl2), H. sapiens (75 mM Tris buffer pH 7.8, 1 mM XMP, 2 mM ATP, 5 mM glutamine, 10 mM MgCl2).

2+ Species Kcat(XMP) Km(XMP) n Km(ATP) Km(Gln) K0.5(Mg ) Ref (s-1) (μM) (μM) (μM) (μM) C. neoformans 0.41 65.9 ± 13 ND 77.5 ± 6 1130 ± 1289 ± This 162 66 work E. coli ND 166 ± 43 ND 104 ± 44 ND ND (204) M. 2.3 45 ± 1* 2.4 27 ± 2 1240 ± 60 1180 ± (216) tuberculosis 30 P. falciparum 0.43 16.8 ± 2 ND 260 ± 38 472 ± 69 2090 ± (217) 30 1780 ± H. sapiens § 5.4 35.6 ±1.8* 1.48 132 ± 7 406 ± 49 (218) 70 Values are shown ± standard error. § A second variant for humans has been reported, but values between the two were catalytically indistinguishable. * denotes K0.5 (for substrates where cooperativity was observed) instead of Km. ND denotes no data.

Compared to previously identified GMP synthases, the kinetic parameters of the C. neoformans enzyme were most similar to those of the M. tuberculosis GMP synthase, which was reported to have similar binding affinity. For XMP, the binding affinity was only moderately lower between C. neoformans (65.9 ± 13.0 µM) and M. tuberculosis (45.0 ± 1.0 µM) and different between human (35.6 ± 1.8 µM) and C. neoformans, and unlike M. tuberculosis and human enzymes the C. neoformans enzyme did not show cooperative binding of XMP (216, 218). The Km of ATP is moderately higher than reported in M. tuberculosis (27 ± 2 µM) but considerably lower than human GMP synthase (132 ± 7 µM). The affinity for glutamine and Mg2+ in C. neoformans GMP synthase was most like M. tuberculosis (Table 1). However, the magnitude of the positive cooperativity observed for XMP binding in the human enzyme was moderate, with a Hill (n) coefficient of 1.48 (218), while M. tuberculosis GMP synthase had a Hill (n) coefficient of 2.4 (216). Overall, the human GMP synthase protein had a significantly higher (~12×) turnover number than the C. neoformans protein, and the concentration of glutamine required to reach saturation was almost three times higher for C. neoformans (1130 ± 162 µM) compared to human GMP synthase enzyme (406 ± 49 µM) (216, 218), confirming potentially important kinetic differences in these enzymes.

ECC1385 is an inhibitor of C. neoformans GMP synthase Given the biochemical differences uncovered above and the importance of GMP synthase in virulence in C. neoformans, we next investigated the ability to phenocopy the gua1∆ phenotype with a chemical inhibitor. The best-known inhibitor of GMP synthase is 6-diazo-

5-oxo-L-norleucine (DON), a well-characterized glutamine agonist that targets several glutamine binding proteins, in particular FGAM synthetase and CTP synthetase (219-221). In the context of antimycotic development however, a non-specific inhibitor is of little interest as a number of off target effects in the host would be anticipated, and so it was deemed unsuitable for this study. One potentially important lead compound was ECC1385, a synthetic compound that showed potent activity against a number of other fungal pathogens (82). A genetics-based investigation revealed that ECC1385 had potency against the GMP synthases from C. albicans and A. fumigatus and that the compound had a different mode of action to a glutamine agonist (82).

We tested ECC1385 as a direct inhibitor of purified C. neoformans GMP synthase using concentrations between 0 and 200 µM, which revealed an IC50 of 4.4 µM, providing the first biochemical evidence that ECC1385 acts directly on the activity of purified GMP synthase. However, subsequent broth dilution assays to determine the inhibitory action of ECC1385 against C. neoformans failed to inhibit growth, despite employing a concentration range reaching 100 µM, far exceeding the potency determined in the enzyme assay. Importantly, while this compound cannot serve as an antifungal itself, it provides evidence that the activity of GMP synthase can be inhibited without depending on a non-specific agent.

Predicted differences between human and C. neoformans GMP synthase The process of rational drug design can be greatly facilitated by the knowledge of the three- dimensional structure of the target. To this end, we endeavored to solve the crystal structure of C. neoformans GMP synthase; however, despite extensive efforts we were unable to obtain a protein structure due to poor crystal quality.

To gain insight into GMP synthase structure in the absence of a crystal structure, we used size exclusion chromatography (SEC) coupled with multiangle laser light scattering (MALLS) to determine the oligomeric state of GMP synthase in solution. Human GMP synthase is a monomer in solution with a small dimer population; however, in the active form, when all substrates are bound, there is evidence that it forms a dimer (212). In contrast,

E. coli GMP synthase is a homodimer is solution (208, 222). The elution profile for C. neoformans GMP synthase demonstrates that this protein predominantly forms a dimer (120 kDa) in solution, with a small tetramer population (Figure 4). The quaternary structure of C. neoformans GMP synthase is therefore more similar to E. coli than the human protein.

Figure 4. Solution properties of C. neoformans Gua1. A, Blue lines indicate the trace from the refractive index detector (arbitrary units) during size exclusion chromatography. Magenta lines indicate the average molecular weight (y axis) distribution across the peak by MALLS. B, SDS-PAGE confirms the mass of a monomer of GMP synthase at approximately 60 kDa.

To compare potential structural differences between the human and C. neoformans enzymes, a homology model (223) of C. neoformans GMP synthase was generated using the E. coli enzyme as a template; there are no reported fungal GTP synthase structures, and of those species for which a structure has been determined, the E. coli enzyme exhibited the highest protein identity (50%) with C. neoformans (203).

Overall, the structural model of C. neoformans, based on the E. coli structure, has three distinct regions: dimerization, ATP-PPase, and GATase domains (Figure 5). The human GMP synthase has been reported to have two distinct groups of its dimerization domain (D1 and D2) as well as the ATP-PPAse and GATase domains, and in this respect C. neoformans GMP synthase is more closely related to E. coli (Figure 5). Like E. coli, C. neoformans GMP synthase is a dimer in solution (Figure 4), while human GMP synthase is a monomer in solution and believed to dimerize upon substrate binding.

Although lacking two sub-sections, the dimerization domain of E. coli and C. neoformans includes most amino acids required for XMP binding, and the highly conserved dimerization sub-domain with the consensus sequence Val-Gly-Val-x-Gly-Asp-x-Arg-x-Tyr. (Figure S3).

This sub-domain is present in the D1 domain of human GMP synthase rather than D2, which has a high level of identity with C. neoformans and E. coli GMP synthase.

Figure 5. Comparison of GMP synthase from human and C. neoformans in complex with XMP. A, Sequence alignment of human and C. neoformans GMP synthases prepared using the server ESPript - http://espript.ibcp.fr (224). Fuchsia represents XMP, orange the GATase domain, green the ATP-PPase domain, blue the D1 domain, and yellow the D2 (human) or dimerization domain (C. neoformans). Asterisks highlight residues involved in XMP binding. B, The structure of human GMP synthase (PDB ID: 2VXO), colored as for A. The amino acids responsible for XMP binding are identified as sticks. D522 is contributed by the second monomer. C, The structural model of C. neoformans GMP synthase was modelled based on the ortholog from E.coli. When compared to the human GMP synthase, C. neoformans does not have Q610 and shows a single amino acid change at position L544, compared to E694 in the human enzyme.

In the human GATase domain, three key residues are involved in the binding of glutamine: Cys104, His190 and Glu192. These residues form a catalytic triad that is highly conserved among the amidotransferases and it is also conserved in C. neoformans GMP synthase (Figure S3) as well as E. coli (data not shown) (212). The XMP binding site would be a more viable drug target of GMP synthase given that glutamate analogues such as DON target other

enzymes as well. Of the residues that interact with XMP in human GMP synthase, one residue, Gln610, was particularly interesting as it is part of the D1 domain that is absent from C. neoformans GMP synthase (212). Two other residues were not identified in the model but can be seen in the sequence alignment as being conserved. Given the large conformation change believed to occur during XMP amination, and the homology model based on AMP- bound E. coli GMP synthase, the model may not represent the XMP bound state. The D2 domain contains other amino acids, which contribute to XMP binding, and for the most part, these are conserved; however, at position Glu 694 in the human enzyme, C. neoformans GMP synthase has a leucine.

Discussion C. neoformans GMP synthase was identified based on similarity to the S. cerevisiae ortholog GUA1. The mutant phenotype following deletion by biolistic transformation showed the enzyme is essential for fungal growth on minimal medium and required for multiple phenotypes associated with virulence. These virulence traits are key to C. neoformans survival in the human host; defects in production of melanin, capsule, and proteases have been demonstrated to cause attenuated virulence. Furthermore, both capsule and melanin production are regulated via a heterotrimeric G protein that requires GTP to function and, by extension, are dependent on the synthesis of GTP themselves (225).

Given the auxotrophy and lag observed in the production of virulence traits, we investigated the importance of GUA1 during infection. Both the nematode and murine models of infection showed that GUA1 is essential for virulence, mirroring the reports for C. albicans and A. fumigatus (82, 83). Furthermore, in the murine inhalation model, the gua1Δ strain was completely cleared by the host immune system.

Together, the in vitro phenotypic assays and the in vivo virulence models show that GMP synthase could be a useful drug target. Beyond the obvious requirements for GTP in DNA synthesis, transcription and energy metabolism, many cellular processes are dependent on regulation via GTP-binding proteins. Furthermore, the production of the characteristic capsule of C. neoformans, the pathogen’s most well-known virulence trait, requires GDP- mannose for its biosynthesis (226). Inhibition of GMP synthase would prevent these key biological processes and thus be even more detrimental to C. neoformans survival in the hostile host environment.

The biochemistry and the structure of GMP synthase is key information that could enable the exploitation of this enzyme as an antifungal drug target, helping address the urgent need for novel chemotherapeutic agents to combat disseminated mycoses. GMP synthase consists of two active sites, one for the binding of glutamine and the other for XMP and ATP. The homology model and sequence alignment of C. neoformans GMP synthase to the human enzyme shows that the catalytic triad required for glutamine binding is conserved, although kinetic data show C. neoformans GMP synthase protein to have a lower affinity for this substrate, maybe due to other residues hindering binding. The best-known inhibitor of GMP

synthase in other species is DON, a well-characterized glutamine agonist that targets several glutamine binding proteins. However, given the lower affinity of the C. neoformans GMP synthase protein for glutamine as a substrate it is likely an unsuitable target for DON-based inhibition, and additionally be a non-specific target (219-221). In contrast, XMP amination requires interactions with eight residues in human GMP synthase, of which only five are homologous to the C. neoformans enzyme. The human GMP synthase residue Gln610 is not present in its fungal homolog, along with residues around the XMP binding site may make targeting this site in antifungal development worthwhile.

The structural differences between GMP synthase in humans and C. neoformans identified via homology modelling are consistent with this difference potentially arising from marked changes in the dimerization domain that contributes key residues to the human XMP binding site as seen in the solved E. coli structure. These differences in the binding site of XMP may enable the development of selective compounds that do not interact with the human enzyme.

Limited insights into potential starting points for GMP synthase inhibitor development were provided in our study of ECC1385, which demonstrated potent activity against the purified C. neoformans GMP synthase but was unable to show activity in a whole-cell assay. Rodriguez- Suarez and colleagues (82) demonstrated whole-cell activity against C. albicans in vitro but not in vivo, instead finding that increased concentrations lead to toxicity in the murine model. ECC1385 has specificity towards GMP synthase; however, it is not adequately active towards fungi. This could simply be due to an inability to enter the cell.

The mechanism of action of GMP synthase requires all bound substrates to undergo an intermediate reaction before coming together to form GMP (203). How this secondary reaction (whereby the adenyl-XMP and GATase domain product are brought together) occurs is largely unknown, as the catalytic domains are approximately 30 Å apart in the available crystal structures. To enable GMP synthesis to occur, the enzyme must either channel the intermediates or undergo a large conformational change whereby both domains are brought together (203). It has been suggested that this large conformational change could be facilitated by the presence of XMP, ATP and Mg2+. When the substrates are bound, the structure likely transitions into a compact state, creating an ammonia channel that enables the product of the GATase domain to react with adenyl-XMP (203, 205). The ability to undergo

such a large conformational change may have contributed to our inability to acquire high quality diffraction data from our crystallization efforts.

Overall, we have demonstrated that GMP synthase is crucial for virulence trait production and pathogenesis of C. neoformans in both murine and nematode models. Differences between human and C. neoformans in enzymatic activity and amino acids of the XMP binding site make GMP synthase an attractive antifungal drug target. Historically, the de novo purine biosynthesis pathway has been a target for many drugs, in particular against cancer, as they are able to selectively target the demands of rapidly proliferating cells by starving them of essential nucleotides. Similarly, disseminating microbes rapidly proliferate during infection, making this an attractive target for antibiotics. Given the lack of current drugs on the market against fungi, novel targets like GMP synthase are urgently needed.

Materials & methods Bioinformatic analyses The C. neoformans type strain H99 genome sequence was reported by Janbon et al. (184). The GMP synthase-encoding gene was identified in the C. neoformans genome via reciprocal best-hit BLAST analysis querying with the S. cerevisiae Gua1 protein.

Strains and medium C. neoformans strains were cultured in liquid (1% yeast extract, 2% bacto-peptone, 2% glucose) or solid (additional 2% agar) YPD medium at 30 ˚C, and maintained at 4 ˚C for no longer than two weeks. gua1Δ mutants were cultured in liquid YNB (Becton Dickinson, USA) medium supplemented with 2% glucose, 10 mM ammonium sulfate and 1 mM guanine at 30 ˚C, and maintained at 4 ˚C on solid YNB (additional 2% agar) supplemented as before unless otherwise stated. Cloning and plasmid preparation was performed in E. coli strain Mach1 (Life Technologies, USA) cultured at 37 ˚C in lysogeny broth (LB; 1% tryptone, 0.5% yeast extract, 1% sodium chloride) supplemented with antibiotics as indicated, and maintained on solid LB (2% agar) supplemented with antibiotics. For virulence assays, N2 Bristol Caenorhabditis elegans was maintained at 20 ˚C on nematode growth medium (NGM) (227) seeded with E. coli strain OP50. Nematode virulence assays were subsequently performed on brain-heart infusion (BHI) medium (Becton Dickinson, USA), NGM (227) or NGM supplemented with 1 mM guanine.

Molecular techniques The sequences of oligonucleotides used are listed in Table S2. The deletion construct for the GUA1 gene was generated using overlap PCR, employing primers UQ1736 and UQ1739 to join the GUA1 5’ region (primers UQ1736 and UQ1737), the G418 resistance marker NEO (UQ234 and UQ235) and the GUA1 3’ region (UQ1738 and UQ1739). H99 genomic DNA was used as the template for GUA1, and the plasmid pJAF1 for NEO (228). The deletion construct was transformed into type strain H99 via biolistic transformation with a Bio-Rad He-1000 Biolistic device (Bio-Rad, USA) with selection on medium containing 100 µg/mL G418 and 1 mM guanine. For complementation, the GUA1 gene was PCR amplified (primers UQ1736 and UQ1739) from H99 genomic DNA, digested with SpeI and XhoI, and cloned into the nourseothricin resistance vector pCH233 cut with SpeI/XhoI to generate pAK05. The pAK05 GUA1 NAT fragment was subsequently purified as a 6,167 bp SpeI/FspI fragment

and transformed into the gua1∆ mutant, selecting for nourseothricin resistance (100 µg/mL). For strain validation, genomic DNA was prepared using the CTAB protocol of Pitkin et al., digested, electrophoresed on TAE-agarose gels and Southern-blotted onto Hybond-XL membrane (GE Healthcare, UK) using standard procedures (229, 230). Probes (UQ1736 and UQ1739) were generated using the Rediprime II kit and α32P dCTP (PerkinElmer, USA). Blots were hybridized at 65 ˚C and membranes exposed onto Fuji Super RX medical X-ray film (Fujifilm, Japan).

Phenotypic assays

Production of melanin was assayed on L-3,4-dihydroxyphenylalanine (L-DOPA) medium (231) supplemented with 1 mM guanine. Urease assays were performed on Christensen’s agar (232) and protease assays were performed on YNB with amino acids and ammonium sulfate supplemented with 2% glucose, 0.1% bovine serum albumin (BSA) and 1 mM guanine. Images were collected after 24-92 hours at 30 or 37 ˚C. All growth tests were performed in triplicate.

For capsule assays, strains were incubated in RPMI 1640 medium (Life Technologies, USA) supplemented with 2% glucose, 10% foetal bovine serum (Life Technologies, USA) and 1 mM guanine with shaking at 30 or 37 ˚C. At 30 hours, cells were collected and stained with India ink (Becton Dickinson USA) and imaged with a Leica DM2500 microscope and DFC425C camera (Leica, Germany). At least 10 independent images were taken and the relative capsule diameter of 50 cells from each culture determined as described by Zaragoza et al. (233). Experiments were performed in biological triplicate and ANOVA tests were performed in GraphPad Prism version 7.0 (GraphPad Software, USA) to compare variation between replicates.

Growth curves were conducted in RPMI 1640 medium supplemented with 2% glucose, 10% foetal bovine serum and 1 mM guanine at 30 ˚C. Starter cultures were grown overnight, diluted to OD600 0.05 then monitored spectrophotometrically at OD600 every 12 hours for 6 days. Growth curves were performed in triplicate.

Nematode virulence assays H99, gua1Δ and gua1Δ+GUA1 strains were grown at 30 ˚C overnight on BHI, minimal medium and minimal medium supplemented with 1 mM guanine prior to the introduction

of 30-50 synchronized young adult C. elegans worms and incubation at 28 ˚C. Worms were counted every 24 hours for 8 days; individuals that did not respond to touch with a platinum wire pick were considered dead and removed. Experimental conditions were tested in triplicate, with Kaplan-Meier survival curves and Mantel-Cox tests performed in GraphPad Prism version 7.0 (GraphPad Software, USA) to determine significance.

Murine inhalation model of cryptococcosis For murine infection assays, 6-week-old female BALB/c mice (Animal Resources Centre, Australia) were infected by nasal inhalation (119). For each strain, 10 mice were inoculated with a 50 µL drop containing 5 × 105 C. neoformans cells. A maximum of five mice were housed per individually ventilated cage (Tecniplast, USA) with Bed-o’Cobs 1/8” bedding (The Andersons, USA), Crink-l’Nest nesting material (The Andersons, USA), and cardboard as environmental enrichment. Mice were provided Rat and Mouse Cubes (Specialty Feeds, Australia) and water ad libitum. Each mouse was examined and weighed twice daily for the duration of the experiment, with affected mice euthanized via CO2 inhalation once body weight had decreased to 80% of pre-infection weight or they exhibited symptoms consistent with infection. Death after CO2 inhalation was confirmed by pedal reflex prior to dissection. Brain, lungs, liver, spleen and kidneys were collected, homogenized in 1 mL PBS using a TissueLyser II (QIAGEN, Germany), serially diluted and plated on YPD supplemented with 100 µg/mL ampicillin, 50 µg/mL kanamycin and 25 µg/mL chloramphenicol (H99 and gua1Δ+GUA1 infected mice) or YNB supplemented with 1 mM guanine and antibiotics as before (gua1Δ infected mice). Plates were incubated at 30 ˚C, and after 2 days colonies were counted and used to calculate colony-forming units per gram of organ. Kaplan-Meier survival curves were plotted using GraphPad Prism version 7.0 (GraphPad Software, USA). Significance was analyzed using the log-rank test, while organ burden significance was determined using a one-way ANOVA with Tukey’s multiple comparisons test. p-values of < 0.05 were considered significant.

anaesthesia, and all efforts were made to minimize suffering through adherence to the Guidelines to Promote the Wellbeing of Animals Used for Scientific Purposes as put forward by the National Health and Medical Research Council.

Broth microdilution assays MIC susceptibility of C. neoformans to ECC1385 was determined in accordance with the CLSI M27-A2 guidelines, with the following modifications: YNB medium supplemented with ammonium sulfate and 2% glucose, final inoculum concentration of 1.5 – 2.0 × 103 cells/mL and incubation at 35 ˚C for 72 hours (14, 234). Drug concentrations ranged from 100 µM to 49 nM; the MIC was defined as the concentration that prevented any discernible growth after 72 hours. Fluconazole was employed as a control.

Expression and purification of C. neoformans GMP synthase Total RNA was isolated from strain H99 using TRIzol Reagent (Invitrogen, USA), with intron-free cDNA then synthesized using a Bioline cDNA synthesis kit (Bioline, USA). The GUA1 ORF was subsequently PCR amplified (primers UQ2081 and UQ2082), the product inserted via ligation-independent cloning into the SspI site of His-tag vector pMCSG7 (235) to yield pJLC1, and then co-transformed with pLysS into E. coli strain BL21(DE3) (Merck, Germany). Transformed cells were grown at 37 ˚C in LB supplemented with 100 mg/mL ampicillin and 12.5 mg/mL chloramphenicol to an OD600 of ~1 then induced with 1 mM isopropyl β-D-1-thiogalactopyranoside and grown for a further 17 hours at 22 ˚C. Cells were harvested and resuspended in lysis buffer (50 mM HEPES pH 8.0, 300 mM NaCl, 30 mM imidazole, 1 mM DTT and 1 mM PMSF) before disruption with a Sonifier W-450 Digital Ultrasonic Cell Disruptor sonicator (Branson, USA). Following centrifugation, supernatant was loaded onto a 5 mL HisTrap Fast Flow column (GE Healthcare, USA) to purify the histidine tagged protein by immobilized nickel-affinity chromatography (IMAC). The protein was eluted in a linear gradient of 30-500 mM imidazole, with a single elution peak. Peak fractions were pooled, concentrated and incubated overnight with 500 µg tobacco etch virus protease at 4 ˚C to cleave the N-terminal histidine tag. Following a second round of nickel- affinity chromatography, GMP synthase was collected from the flowthrough, concentrated and further purified using a HiLoad 26/600 Superdex 200 size exclusion chromatography (SEC) column (GE Healthcare, USA). Protein was eluted at a rate of 2.5 mL/min with SEC buffer (10 mM HEPES pH 7.5, 150 mM NaCl and 1 mM DTT) using an ÄKTApurifier

FPLC system (GE Healthcare, USA). Peak fractions were combined and concentrated to ~32 mg/mL and flash frozen in liquid nitrogen for storage at -80 ˚C.

Steady-state and inhibitor kinetics GMP synthase activity was monitored spectrophotometrically using a Cary60 UV-Vis spectrophotometer (Agilent, USA). Assays were carried out as described for Mycobacterium tuberculosis by Franco et al. (216) with the exception of 50 mM HEPES pH 7.5 being used instead of 50 mM Tris pH 7.5; optimized reaction conditions were determined as 0.15 mM

XMP, 1 mM ATP, 5 mM glutamine and 20 mM MgCl2. The temperature used was 40 ˚C, consistent with previous assays conducted for the human, E. coli and M. tuberculosis enzymes; this temperature also gave the highest activity in C. neoformans GMP synthase (204, 216, 218). Purified C. neoformans GMP synthase was used at 0.025 mg/mL final concentration in the assay. Assays were performed in triplicate by measuring the decrease of -1 -1 absorbance at 290 nm to follow conversion of XMP (ε290 = 4.080 mM cm ) into GMP (ε290 = 3.066 mM-1 cm-1). Δε = 1.014 mM-1 cm-1 was used to calculate the amount of GMP formed. Data were fitted to the Hill or Michaelis-Menten equations using GraphPad Prism version 7.0 (GraphPad Software, USA) as appropriate. The Hill equation was used to calculate the Hill coefficient (n) (Eq. 1) (236). IC50 values were determined using standard assay conditions with varying concentrations of inhibitor ECC1385 (0 - 100 µM).

! !!"# ! Eq. 1 � = ! ! !!.! ![!]

Multiangle laser light scattering (MALLS) Size exclusion chromatography (SEC) coupled with multiangle laser light scattering (MALLS) was performed using a Dawn Heleos II 18 angle light-scattering detector coupled with an Optilab rEX refractive index detector (Wyatt Technology, USA). 500 µg of GMP synthase was applied to the HiLoad 26/600 Superdex 200 SEC column at a flow rate of 0.5 mL/min in 10 mM HEPES (pH 7.5), 150 mM NaCl and 1 mM DTT. Molecular mass calculations were performed using Astra 5.3 software (Wyatt Techonology, USA). Input of the refractive increment (dn/dc values) was set at 0.186 in molecular mass calculations (237).

Crystallization screens and modelling of GMP synthase

Crystallization experiments of recombinant C. neoformans GMP synthase were performed by hanging drop vapor diffusion at 20 ˚C with the commercial sparse matrix screens JCSG, Morpheus, PACT, ProPlex (Molecular Dimensions, UK), INDEX, PEG/Ion and PEGRx (Hampton Research, USA). Two initial lead conditions (PACT F8 - 20% PEG 3350, 0.2 M sodium sulfate decahydrate and 0.1 M BIS-TRIS propane pH 6.5 and PACT G8- 20% PEG 3350, 0.2 M sodium sulfate decahydrate and 0.1 M BIS-TRIS propane pH 7.5) were chosen for factorial grid screen optimization. Despite significant efforts – co-crystallization with substrates (XMP, AMP-PNP and MgCl2), streak- and micro- seeding, enhanced nucleation (238) and Silver Bullets (Hampton Research, USA) and Additive Screen (Molecular Dimension, UK) – the best resolution diffraction data that could be achieved using the MX2 beamline at the Australian Synchrotron was 6 Å. Subsequently we utilised homology modelling of C. neoformans GMP synthase using the automated webserver Modeller (http://salilab.org/modweb) (223) with the E. coli GMP synthase (50% protein identity) structure as a template (PDB ID: 1GPM) (203).

Supplementary figures

Figure S1. Saturation binding curves for GMP synthase substrates.

Figure S2. IC50 value of 4.4 µM for ECC1385

Figure S3. Multiple sequence alignment of GMP synthase. Sequences obtained from the Broad Institute (C. neoformans), Uniprot (H. sapiens, E. coli, C. albicans, A. fumigatus) and Sacchromyces Genome Database (S. cerevisiae). Aligned using Clustal W (239) and the server ESPript - http://espript.ibcp.fr (224).

Supplementary table

Table S1. Oligonucleotides used for this study. Primer name Purpose Sequence UQ1736 GUA1 5’ KO upper AAAGAGACACCCACGACAACA UQ1737 GUA1 5’ KO lower AGCTCACATCCTCGCAGCTTTGTATGGGGTT ATGGA UQ1738 GUA1 3’ KO upper TGTTAATACAGATAAACCGATTTTTTGTCTTT GCTA UQ1739 GUA1 3’ KO lower AGGGTGAAGAATGGGGTAGTT UQ1828 GUA1 NEO flank TCCATAACCCCATACAAAGCTGCGAGGATGT overlap forward GAGCT UQ1829 GUA1 NEO overlap TAGCAAAGACAAAAAATCGGTTTATCTGTATT reverse AACA UQ1036 Diagnostic NEO TGTGGATGCTGGCGGAGGATA UQ2032 Diagnostic 5’ GUA1 TCTGTATGTTTGCGTTTTGGG UQ2081 H99 GUA1 cDNA upper GAATTCCGTACCGGATCCATGGCCACAGAGG AGATTCATAGC UQ2082 H99 GUA1 cDNA lower ACGCACGCACGCGTCGACTTAAAGCCACTCA ACAGTCCCAGG UQ3306 GUA1 LIC upper TACTTCCAATCCAATGCGATGGCCACAGAGG AGATTCATAGCTTG UQ3307 GUA1 LIC lower TATTCCACTTCCAATGTTAAAGCCACTCAACA GTCCCAGGAGG UQ3543 pMCSG7 sequencing TAATACGACTCACTATAGGG upper UQ3544 pMCSG7 sequencing CAAAAAACCCCTCAAGACCCG lower

Chapter 4: Cryptococcus neoformans ADS lyase is an enzyme essential for virulence whose crystal structure reveals features exploitable in antifungal drug design

Preface The third research chapter of this thesis analyses a second enzyme in the purine biosynthesis pathway. The bifunctional enzyme adenylosuccinate lyase is required for the production of the key intermediate IMP and in the ATP branch of purine biosynthesis. This work was published in 2017.

My contribution to this publication was as follows: 1. Expression and purification of recombinant ADS lyase 2. Enzyme kinetic assays 3. Crystallization and subsequent structure determination of C. neoformans ADS lyase 4. MALLS 5. Writing the manuscript

The contributions of others to this manuscript are listed in the preliminary pages of this thesis.

Publication reference: Jessica L. Chitty, Kirsten L. Blake, Ross D. Blundell, Y. Q. Andre E. Koh, Merinda Thompson, Avril A. B. Robertson, Mark S. Butler, Matthew A. Cooper, Ulrike Kappler, Simon J. Williams, Bostjan Kobe and James A. Fraser (2017) “Cryptococcus neoformans ADS lyase in an enzyme essential for virulence whose crystal structure reveals features exploitable in antifungal drug design” Journal of Biological Chemistry, 292(28): 11829-39

Abstract There is significant clinical need for new antifungal agents to manage infections with pathogenic species such as Cryptococcus neoformans. Because the purine biosynthesis pathway is essential for many metabolic processes, such as synthesis of DNA and RNA and energy generation, it may represent a potential target for developing new antifungals. Within this pathway, the bifunctional enzyme adenylosuccinate (ADS) lyase plays a role in the formation of the key intermediates inosine monophosphate and AMP involved in the synthesis of ATP and GTP, prompting us to investigate ADS lyase in C. neoformans. Here, we report that ADE13 encodes ADS lyase in C. neoformans. We found that an ade13Δ mutant is an adenine auxotroph and is unable to successfully cause infections in a murine model of virulence. Plate assays revealed that production of a number of virulence traits essential for dissemination and survival of C. neoformans in a host environment was compromised even with the addition of exogenous adenine. Purified recombinant C. neoformans ADS lyase shows catalytic activity similar to its human counterpart, and its crystal structure, the first fungal ADS lyase structure determined, shows a high degree of structural similarity to that of human ADS lyase. Two potentially important amino acid differences are identified in the C. neoformans crystal structure, in particular a threonine residue that may serve as an additional point of binding for a fungal enzyme-specific inhibitor. Besides serving as an antimicrobial target, C. neoformans ADS lyase inhibitors may also serve as potential therapeutics for metabolic disease; rather than disrupt ADS lyase, compounds that improve the stability the enzyme may be used to treat ADS Lyase Deficiency disease.

Introduction The link between defects in primary metabolism and disease has been recognized for over a century. The physician Alfred Garrod first associated abnormal metabolism with gout in 1848 (240), and his son Archibald later combined these observations with the concept of Mendelian inheritance to produce his seminal work Inborn Errors of Metabolism in 1909 (241). Since that time, numerous other medical conditions caused by abnormalities in primary metabolism have been identified (242-245). These include defects in the production of the nitrogenous bases that are essential for DNA and RNA synthesis, energy metabolism and signal transduction. At present, over 35 enzyme defects in humans related to purine or pyrimidine biosynthesis have been characterized, and of these at least 17 are associated with serious clinical consequences (246, 247).

One of the first such conditions to be identified was the rare autosomal recessive disease Adenylosuccinate Lyase Deficiency (OMIM 103050) associated with the corresponding purine biosynthetic enzyme (EC 4.3.2.2) (248). Jaeken and van den Berghe identified three patients with psychomotor delay and autism that had high levels of the purine biosynthesis intermediates ADS (adenylosuccinate) and SAICAR (succinylaminoimidazole carboxamide riboside) in their urine, plasma and cerebrospinal fluid (248). These purines were identified in 1956 from Saccharomyces cerevisiae as the substrates of ADS lyase, which converts them into AMP and fumarate (249), and AICAR (aminoimidazole carboxamide riboside) and fumarate, respectively (Figure 1A,B) (250).

ADS lyase belongs to the fumarase C superfamily, a group of enzymes that perform the β- elimination of fumarate from their substrates (251-253). Structures of ADS lyase from nine species of bacteria, one species of archaea and six species of eukaryotes (Homo sapiens, Schistosoma mansoni, Plasmodium vivax, Leishmania donovani, Trypanosoma brucei and Caenorhabditis elegans (254, 255)) have been determined. All form the homotetramer arrangement characteristic of members of the fumarase C superfamily.

The four protomers in the ADS lyase tetramer are oriented such that three contribute to each of the four active sites. In the best-studied ADS lyase structure from humans (PDB ID: 2J91), twelve residues are associated with substrate binding (H86, R85, T111, Q241, R329, L331, S334 and R338 from the fist protomer, R20, R303 and K295 from the second, and T158 from the third) (254). Once the substrate is docked, the flexible C3 loop of the second protomer is hypothesized to close on the active site, allowing the catalytic S289 to come in contact with the substrate and remove its Cβ proton. The catalytic H159 residue from the third protomer then protonates N6 of the substrate, causing the C-N bond to break and release fumarate with the corresponding purine (254, 256).

Figure 1. ADS lyase in the purine biosynthesis pathway. A, ADS lyase is responsible for the β-elimination of fumarate from the substrates SAICAR (succinylaminoimidazole carboxamide riboside) and ADS (adenylosuccinate). B, β-elimination of fumarate from substrates N-succinocarboxyamide-5-aminoimidazole ribonucleotide (SAICAR) and adenylosuccinate by ADS lyase for the production of aminoimidazole-4- carboxamine ribonucleotide and AMP, respectively.

To date, investigation of ADS lyase as a therapeutic target has been limited to Plasmodium falciparum, where it has been proposed as a potential focus for antimalarial agent development (257). Many parasitic protozoa such as P. falciparum lack key enzymes required for the de novo synthesis of the purine intermediate IMP and are dependent on salvaging purine precursors from the host in order to synthesize ATP and GTP. As ADS lyase is a post-IMP enzyme in the pathway, it has been retained in these species – and by extension, so has its pre-IMP ability to produce AICAR from SAICAR, although this does not play a role in P. falciparum metabolism, as this substrate is not naturally present in the parasite. SAICAR analogs could therefore serve as the basis for the development of novel antimalarial agents (257).

In contrast, the possible role of this enzyme as an antifungal target has not yet been investigated, nor has the structure in any member of the Kingdom fungi. Recent studies in the major fungal pathogens have highlighted the potential of purine biosynthetic enzymes as drug targets (14, 15, 82, 83, 258). For example, the encapsulated yeast Cryptococcus neoformans has been shown to require

IMP dehydrogenase, GMP synthase, ADS synthase and AIR carboxylase to successfully infect a mammalian model (14, 15, 120, 121, 258).

There is significant unmet clinical need for new antifungal agents that target species such as C. neoformans. While globally distributed, meningoencephalitis caused by this basidiomycete is particularly prevalent in sub-Saharan Africa where incidence of HIV is high and mortality rates can reach 75% (259); a major contributor to this mortality is the toxicity, high cost, poor availability and limited efficacy of antifungal agents employed in its treatment (142, 147). Even in developed countries, the typical combination therapy composed of amphotericin B, flucytosine and fluconazole has not altered significantly in over two decades despite unacceptably high mortality, patient relapse and antifungal resistance being observed (2, 149, 150).

Here we present an investigation of ADS lyase in C. neoformans. Deletion of the ADS lyase gene ADE13 shows it is essential for C. neoformans survival in a purine poor environment, such as in a murine model of infection. Analysis of enzyme kinetics and crystal structure determination of recombinantly purified ADS lyase protein has highlighted the high degree of similarity between this enzyme and its human ortholog, suggesting that unlike other purine biosynthesis enzymes studied thus far, C. neoformans ADS lyase may facilitate important insights into the function of the human enzyme in addition to serving as an antimicrobial target.

Results Identification of the ADS lyase-encoding gene in C. neoformans To characterize ADS lyase from C. neoformans, the corresponding gene was identified in the genome of type strain H99 using the S. cerevisiae ortholog Ade13 in a reciprocal best-hit BLAST analysis (260). A single hit was observed, indicating that as with other purine biosynthetic genes identified so far, the gene is present in single copy in this clinically important pathogen. Located on chromosome 8, the locus was designated as CNAG_03270 in the published H99 genome (184); subsequently employing CNAG_03270 as the query sequence in a BLAST search of the S. cerevisiae genome identified ADE13 as the only statistically significant hit in that species. As is standard practice in C. neoformans, the gene CNAG_03270 has therefore been named ADE13 after the S. cerevisiae ortholog, whose predicted product is 71.4% identical at the amino acid level. In comparison, C. neoformans Ade13 is 68.4% identical to ADS lyase from humans.

Ade13 is essential for adenine prototrophy in C. neoformans In order to verify the role of the ADE13 product in purine metabolism, we performed targeted gene deletion via biolistic transformation of C. neoformans type strain H99. As predicted for a mutant lacking ADS lyase activity, the ade13∆ mutant was only able to grow on YNB when supplemented with sufficient exogenous adenine; as with S. cerevisiae, the ade13∆ mutant was an adenine auxotroph (Figure 2).

Figure 2. C. neoformans ADE13 role in ATP biosynthesis. Growth of 10-fold serial dilutions of wild-type (WT), ade13Δ and ade13Δ+ADE13 strains of C. neoformans on YNB medium (A); YNB medium supplemented with 1 mM adenine (B); and YNB medium supplemented with 0.2 µM adenine (C).

However, in contrast to in vitro growth assays supplemented with 1 mM adenine, the human central nervous system is extremely purine poor. To verify that the CNS would not provide sufficient salvageable adenine to support growth of C. neoformans cells lacking the biochemical activity encoded by ADE13, we repeated our phenotypic tests using 0.2 µM adenine, the concentration found in human cerebrospinal fluid (11, 13). Growth was not restored, supporting the hypothesis that loss of Ade13 function would abrogate growth during the infection process (Figure 2). In keeping with the observed adenine auxotrophy originating from loss of the ADE13 gene, reintroduction of the wild-type allele into the well-characterized Safe Haven on chromosome 1

(120) to generate the strain ade13∆+ADE13 restored growth on all media tested (Figure 2). Overall, these data indicate that ADE13 encodes ADS lyase.

Loss of Ade13 affects production of C. neoformans virulence traits The ability of C. neoformans to infect a host requires a range of virulence traits that protect against host defences, scavenge nutrients, facilitate dissemination and enable infiltration of a variety of tissue types. We investigated the in vitro production of several of these virulence traits using test media supplemented with 1 mM adenine in order to observe the effects of the ade13∆ mutant independently from adenine auxotrophy-associated growth defects.

Figure 3. Loss of ADE13 influences the production of C. neoformans virulence traits. A, Protease production was determined on YNB medium with amino acids and 0.1% bovine serum albumin plates, with strains at 30 and 37 ˚C for 48 hours. The presence of proteases is observed by the halo ring around the colony. B, Melanin production was determined on L-DOPA medium with strains incubated at 30 and 37 ˚C for 48 hours. Pigmentation is observed by darkening of the colony. C, C. neoformans strains were incubated in RPMI 1640 medium, 10% foetal bovine serum and 1 mM adenine at 30 and 37 ˚C. At 30 hours, cells were stained with India ink. Capsule is observed by the exclusion of ink particles.

The ability to produce proteases is key to enabling C. neoformans to disseminate into host tissues during infection and to cross the blood brain barrier (261). When grown on adenine-supplemented BSA media, the production of proteases by the ade13Δ mutant was compromized at both 30 and 37 ˚C (Figure 3A). The production of the pigment melanin in C. neoformans protects from the oxidants produced by host effector cells (262). When grown on adenine-supplemented L-DOPA media, the ade13Δ mutant exhibited reduced melanin production at 37 ˚C (Figure 3B). A differentiating feature of Cryptococcus from other fungal pathogens is its polysaccharide capsule that serves as a protective barrier against the immune system. Following growth in adenine-supplemented RPMI 1640 media, India ink staining revealed diminished capsule production by the ade13Δ mutant at both 30 and 37 ˚C (Figures 3C, Supp. Fig 1).

Overall, even with the addition of exogenous adenine, key adaptive mechanisms of C. neoformans required for successful infection were severely compromized in the ade13Δ mutant, and these were restored upon reintroduction of the wild-type allele by inserting it at the Safe Haven site (120).

Ade13 is crucial for virulence in a murine inhalation model Given the defect in virulence-associated phenotypes and requirement for adenine concentrations that far exceed those present in the CNS, it was anticipated that the ade13∆ mutant would be unable to establish a wild-type infection in a mammal, such as in the well-established C. neoformans murine inhalation infection model (119). While all mice infected with wild-type C. neoformans or complemented ade13∆+ADE13 strains succumbed to infection within 25 days, the mice infected with the ade13Δ mutant survived and continued to gain weight. The lack of symptoms associated with a C. neoformans infection continued until the endpoint of the experiment (45 days; Figure 4A).

In contrast to mice infected with the wild-type and complemented strains, the organ fungal burden from sacrificed animals infected with the ade13∆ mutant showed that the infection had been cleared (Figures 4B, C).

Figure 4. Virulence of the ade13∆ mutant in mice. A, Virulence of the ade13Δ mutant in a murine model of infection. 6-week-old female BALB/c mice were infected with WT, ade13Δ or ade13Δ+ADE13 C. neoformans strains (n = 10) and survival was monitored over 45 days. Posthumous organ burden was calculated in colony forming units (CFU) per gram of brain (B) and lungs (C).

Comparison of C. neoformans ADS lyase catalytic activity to the enzyme from other species Given that our mutant experiments revealed that the product of the ADE13 gene is essential for successful infection in a mammalian model, and by extension a potential drug target, we next investigated its enzymatic activity. His-tagged C. neoformans Ade13 was expressed in E. coli and purified via immobilized metal affinity chromatography (IMAC) and size exclusion chromatography (SEC) for use in steady-state kinetic assays (Supp. figure 2). ADS lyase activity assays were optimized as part of the investigation, and performed at the optimal temperature of 37 ˚C and pH of 8.

Table 1. Comparison of kinetic parameters of ADS lyase from different organisms. Assay conditions used: C. neoformans (40 mM PPB pH 8, 37 ˚C), S. cerevisiae (50 mM sodium phosphate buffer, pH 7.0, 35 ˚C), E. coli (50 mM HEPES buffer pH 8.5, 25 ˚C), M. tuberculosis and M. smegmatis (succinic acid, sodium dihydrogen phosphate and glycine in ratio 2:7:7, pH 7.6, 37 ˚C), P. falciparum (50 mM PPB pH 7.4, 25 ˚C), L. donovani (20 mM HEPES-KOH, pH 7, 25 ˚C), B. subtilis (50 mM HEPES, pH 7, 25˚C), H. sapiens (150 mM NaCl, pH 7, 25 ˚C).

-1 -1 -1 Species Kcat (s ) Km (μM) Kcat/Km(μM s ) Ref C. neoformans 25.2 22.2 ± 2.9 1.1 This work S. cerevisiae ND 12 ND (249) E. coli ND ND 16.5 (256) M. tuberculosis 0.1 ± 0.0 204.2 ± 48.2 0.0005 (263) M. smegmatis 0.7 ± 0.0 43.7 ± 2.6 0.02 (263) P. falciparum 7.5 ± 0.7 32.0 ± 1.7 0.23 (257) L. donovani 28.0 24.0 ND (264) B. subtilis 1.3 ± 0.2 3.5 ± 0.4 3.8 ×105 (265) H. sapiens 97.0 ± 5.2 1.8 ± 0.3 53.9 (266) Values are shown ± standard error. ND denotes no data.

The β-elimination of fumarate from the substrate adenylosuccinate was measured and exhibited -1 Michaelis-Menten kinetics (Table 1) with a Km of 22.2 ± 2.9 µM and a kcat of 25.2 s . Kinetic data is also available for ADS lyase from a number of other species including humans (266). Here, the -1 elimination of fumarate from adenylosuccinate had a Km of 1.8 ± 0.3 µM and kcat of 97.0 s . These data are also consistent with the kinetic parameters of recombinant ADS lyase from the parasites

Leishmania donovani and P. falciparum, which have been reported to have Km values of 24.0 µM -1 -1 and 32.0 ± 1.7 µM, and kcat values of 28.0 s and 7.5 s , respectively (257, 264). Although assays for different species used different temperatures, all show remarkably similar catalytic profiles (257, 264).

Crystal structure of C. neoformans ADS lyase

Based on size-exclusion chromatography (SEC) coupled with multi-angle laser light scattering (MALLS), C. neoformans ADS lyase is a tetramer (220 kDa) in solution (Supp. Figure 2); this result is consistent with the oligomeric state of the human and E. coli enzymes, which were also reported to be tetramers (254, 256, 267).

To compare the C. neoformans enzyme with its human counterpart, the crystal structure of unliganded C. neoformans ADS lyase was determined (PDB ID: 5V4L). Consistent with the MALLS result and the structures from other species, C. neoformans ADS lyase is a tetramer with four active sites, each containing residues contributed by three of the protomers. Each protomer is 479 residues in length, forming 13 α-helices and two β-strands, resulting in an S-shape overall (Figure 5). The tetramer assembly consists of adjacent subunits arranged antiparallel to each other, with two active sites on one side and two on the other side of the complex.

Figure 5. Crystal structure of C. neoformans ADS lyase. Crystal structure at 2.1 Å resolution, showing the tetramer arrangement of ADS lyase. The inset shows the active site location at protomer interfaces.

Pairwise structural alignment of the C. neoformans and human ADS lyase structures returns a close match, with an overall root-mean-square deviation (RMSD) value of 1.90 Å, similar to that of the Mycobacterium smegmatis enzyme (PDB: 4NLE) which has an RMSD value of 1.84 Å compared to the human ADS lyase structure (PDB: 4FFX). The twelve residues associated with substrate binding in human ADS lyase are identical in C. neoformans. Further analysis of the active site cavity reveals two changes: human Gly116 and Lys35 correspond to Thr118 and Arg35, respectively, in C. neoformans (Figures 6 B, C). Although lysine to arginine is a conservative change, the orientation of the arginine in C. neoformans expands the binding pocket by an additional 2 Å, which may allow for a compound to favor C. neoformans ADS lyase over the

81 human enzyme. The difference between a glycine and a threonine in the active site results in surface differences and can be exploited through the design of specific interactions of the inhibitory compound with the threonine side-chain in the fungal enzyme. A number of antifungal compounds, including fluconazole, exploit tighter binding to the active site of the fungal protein, despite limited differences to the human counterpart (234, 268). These differences could potentially be exploited in the rational design of fungal-specific ADS lyase inhibitors.

Figure 6. Active site comparison of human and C. neoformans ADS lyases. A, Sequence alignment of ADS lyases from human and C. neoformans. Residues corresponding to the active site are boxed represented by colours corresponding to subunit A (green), B (blue) and, C (pink). B, C, Active-site residues from human (H86, R85, T111, Q241, R329, L331, R338, H159, R303, K295, T158) and G116 and K35 underlined in red (B) and C. neoformans (H79, R78, T104, Q234, R322, L324, R331, H152, R3296, K288, T151) and T118 and R35 underlined in red (C) ADS lyases, with side-chains of active-site residues shown in stick representation. The colours correspond to the subunit they belong to. The bound AMP (shown in orange) corresponds to the structure of human ADS lyase:ANP complex (PDB ID: 2J91) and was modeled into the C. neoformans ADS lyase active site for visualization purposes.

Several substitutions that lead to the ADS Lyase Deficiency disease are present outside the substrate pocket, suggesting other differences between the fungal and human enzymes may affect the active site indirectly; studies with substrate analogues will enable a deeper understanding of the mode of action of ADS lyase and consequently identify further strategies to achieve antifungal specificity.

The tetramer interface contains a number of residues that are not conserved between the fungal and the human enzymes. Although protein-protein interfaces are more difficult to target with small- molecule compounds, compared to enzyme active sites, the differences in the interfaces may serve as an alternative foundation for antifungal drug design.

As well as serve as a potential antifungal drug target, C. neoformans may be a useful model organism in which to study the ADS Lyase Deficiency disease in humans; it is still unclear if the symptoms of this disease arise from the accumulation of SAICAR and/or ADS, or from the perturbation of ATP and GTP biosynthesis. Studies of the human enzyme have identified thirty-six mutations associated with ADS Lyase Deficiency disease in humans that can be broadly assigned to four regions (Supplementary Table 2). C. neoformans ADS lyase could therefore be useful in the design of novel antifungals, or in finding new therapeutics that could assist in treatment of the human disease. By finding compounds that bind and stabilize ADS lyase in a genetically tractable model organism such as C. neoformans, a treatment for ADS Lyase Deficiency disease could be found that increases the activity of the defective enzyme, alleviating symptoms. This method of therapeutically stabilising a protein has been previously shown in the development of treatments for amyotrophic lateral sclerosis (269).

In contrast to other purine biosynthetic enzymes studied in this fungal pathogen, which differ more from their human counterparts in activity and structure, C. neoformans ADS lyase shows a high degree of similarity. While this perhaps makes ADS lyase a less attractive target for antifungal design, differences discussed above suggest strategies that can be exploited to find ligands specific to the fungal enzyme. Furthermore, the similarity makes the fungal enzyme an alternative model to understand the molecular basis of the effects of mutations leading to human ADS Lyase Deficiency disease.

Discussion While antifungal agents that target purine biosynthesis have not yet been developed, there is increasing data that suggests this aspect of primary metabolism may be a druggable target for broad spectrum, non-toxic and affordable therapies to treat life-threatening fungal infections. Two GMP biosynthetic enzymes (IMP dehydrogenase and GMP synthase) and one ATP biosynthetic enzyme (ADS synthetase) have already been characterized at the genetic, enzymatic and structural levels in C. neoformans as potential antifungal drug targets, and each have key active site differences compared to their human orthologs that could potentially enable the development of fungus-specific inhibitors (14, 15, 258). In contrast to these, the bifunctional nature of ADS lyase influences not only ATP biosynthesis, but also production of the key purine intermediate IMP (250); by disrupting IMP biosynthesis, the de novo production of both ATP and GTP is lost, suggesting that the inhibition of this enzyme may represent an even more powerful antifungal strategy.

As with the other purine de novo biosynthesis enzymes that have been characterized in C. neoformans, loss of ADS lyase results in auxotrophy and an inability to establish a life-threatening infection in a mouse model. Organ burden analysis revealed that the mutant was cleared from the infected animals, a result consistent with our observations that concentrations of adenine equivalent to that found in the human CNS were insufficient to restore growth of the mutant in vitro.

To gauge the suitability of this enzyme as a drug target, we investigated the biochemical activity and structure and compared them to the ortholog from the human host. In stark contrast to IMP dehydrogenase, GMP synthase and ADS synthetase, C. neoformans ADS lyase exhibits a remarkably similar kinetic profile to its human counterpart - a similarity also shared with the equivalent enzyme from P. falciparum that has been proposed as a antimalarial target (257, 270). However, the protozoan enzyme exhibits only 15% identity to the human enzyme, while the C. neoformans enzyme exhibits 69% identity.

Crystal structure determination revealed that the similarity between the human and fungal enzymes is not limited to their kinetic profiles; the structure of the active site is also highly conserved between C. neoformans and human ADS lyase. Two amino acid changes are found in the active site pocket, and although the corresponding residues are not predicted to be involved in substrate binding, these glycine-to-threonine and lysine-to-arginine differences lead to surface changes in the active site pocket and can be exploited to design fungal enzyme-specific ligands. Substrate analogs have served as useful inhibitors of the purine biosynsthesis pathway in a range of species (126-130)

84 and taking advantage of this difference could enable the development of fungal ADS lyase inhibitors; this change is conserved in other fungi.

Another fungal-specific mode of disruption may be to target the tetramer assembly. Shown to be essential for activity, these regions are also a greater point of difference between C. neoformans and human ADS lyase. Of the three protomer interface residues mutated in ADS Lyase Deficiency only one is identical in C. neoformans. Designing a compound that disrupts tetramer formation based on these differences would likely be more challenging than developing a substrate structural analog, but given the lack of successful novel antifungals in the last 20 years, such an alternative strategy could still be attractive.

Beyond serving as a target in antifungal development, further studies of C. neoformans ADS lyase may facilitate the study of ADS Lyase Deficiency at a genetic level. Structural studies of human ADS lyase have enabled mapping of the mutations that cause ADS Lyase Deficiency in dozens of patients, as well as their biochemical consequences (254, 271). More than two thirds of these residues are identical in C. neoformans. The R246H mutation is the most common cause of disease, present in one third of all patients; this arginine residue is present in C. neoformans. The clinical manifestation resulting from the R426H mutation varies significantly; however, in vitro enzymatic assays of the mutant revealed it to be thermally unstable. The wild-type arginine residue is on the surface of the substrate channel; when mutated, an arginine-mediated interaction with Gln409 and Asp422 residues is disrupted (271-276). These two residues are also present in C. neoformans. While these key mutations associated with this human disease are known, it is still unclear which of their physiological consequences are responsible for disease phenotypes – the impact on purine biosynthesis, or the accumulation of pathway intermediates. A close homolog of the ADS lyase that has similar structural features, such as ADS lyase from C. neoformans in vivo studies and genetic manipulation may determine these underlying causes for the disease.

In addition to its role in ADS Lyase Deficiency, the enzyme has also been shown to have up to three-fold higher activity in tumours compared to healthy cells (277, 278), and increased ADS lyase activity was found to be a reliable indicator of hepatic, prostate and breast tumours (279, 280). Further investigation of this enzyme may therefore not only serve to improve survival rates of ADS Lyase Deficiency patients where activity of the enzyme is low, but also assist in the development of agents to treat cancers where activity of the enzyme is high. A close eukaryotic homolog of the human enzyme with a solved structure and known biochemistry, such as from C. neoformans, could be employed to better understand these roles of ADS lyase.

Materials & Methods Bioinformatic analyses The C. neoformans type strain H99 genome sequence used in this study was reported by Janbon and colleagues (184). The gene encoding ADS lyase was identified in the C. neoformans genome by reciprocal best-hit BLAST analysis querying with the Saccharomyces cerevisiae Ade13 protein.

Strains and media Strains were stored in 15% glycerol at -80 ˚C until needed, and once grown were used for no longer than two weeks. Non-auxotrophic C. neoformans strains were cultured in liquid yeast peptone dextrose (YPD) media (1% yeast extract, 2% bacto-peptone, 2% glucose) at 30 ˚C and maintained on solidified YPD (additional 2% agar) at 4 ˚C unless stated otherwise. The adenine auxotrophic ade13Δ mutant was cultured in liquid yeast nitrogen base (YNB) media (Becton Dickinson, USA) supplemented with 2% glucose, 10 mM ammonium sulfate and 1 mM adenine at 30 ˚C and maintained at 4 ˚C on solidified YNB (additional 2% agar) supplemented as before unless otherwise stated. E. coli was cultured at 37 ˚C in either lysogeny broth (LB) (1% tryptone, 0.5% yeast extract, 1% sodium chloride) or terrific broth (TB) (1.2% tryptone, 2.4% yeast extract, 0.4% glycerol) supplemented with 100 µg/mL ampicillin and 50 µg/mL kanamycin and maintained on solidified LB (additional 2% agar) supplemented with antibiotics as described above.

Molecular techniques The sequence of oligonucleotides used are given in Table S1. The ADE13 deletion construct was generated using overlap PCR, using primers UQ1746 and UQ1749 to join the ADE13 5’ region (UQ1746 and UQ1747) to the G418 resistance marker NEO (UQ1832 and UQ1833) and the ADE13 3’ region (UQ1748 and UQ1749). H99 genomic DNA was used as the ADE13 template and plasmid pJAF1 as the template for the NEO cassette (228). The overlap construct was transformed into type strain H99 via biolistic transformation using a Bio-Rad He-1000 Biolistic device (Bio-Rad, USA) and media containing 100 µg/mL G418 and 1 mM adenine to select for the ade13Δ mutant strain. For complementation, the ADE13 gene was PCR amplified (primers UQ1746 and UQ1749) from H99 genomic DNA, digested with NheI and XhoI and cloned into the Safe Haven nourseothricin resistance vector pSDMA25 (120) cut with SpeI and XhoI to generate pKLB02. pKLB02 was subsequently linearized with BaeI and transformed into the ade13Δ mutant strain, selecting for nourseothricin resistance (100 µg/mL). Gene deletion and complemented strain validation was carried out on genomic DNA prepared by the CTAB protocol (229), digested, electrophoresed on 1% TAE-agarose gels and Southern-blotted onto Hybond-XL membrane (GE Healthcare, USA) using standard procedures (229, 230). Probes were generated from H99 using primers UQ1746 and

UQ1749 with the Rediprime II kit and α32P dCTP (PerkinElmer, USA). Blots were hybridized at 65 ˚C and membranes exposed onto Fuji Super RX medical X-ray film (Fujifilm, Japan).

Phenotypic assays

Production of melanin was assayed on L-3,4-dihydroxyphenylalanine (L-DOPA) medium containing 1 mM adenine (231). Urease assays were performed on Christensen’s agar plus 1 mM adenine (232) and protease assays were performed on YNB with amino acids and ammonium sulfate supplemented with 2% glucose, 0.1% bovine serum albumin (BSA) and 1 mM adenine (Sigma-Aldrich). Strains were spotted at least 3 cm apart to prevent phenotypic cross-talk. Images were collected after 24-92 hours incubation at 30 or 37 ˚C. Assays were performed in biological triplicate.

For capsule assays, strains were incubated in RPMI 1640 media (Life Technologies, USA) supplemented with 2% glucose, 10% foetal bovine serum (Life Technologies, USA) and 1 mM adenine with shaking at 30 or 37 ˚C. At 30 and 96 hours, cells were stained with India ink (BD Diagnostics, USA) and imaged with a Leica DM2500 microscope and DFC425C camera (Leica, Germany). At least 10 independent images were taken and the relative capsule diameter of 50 cells from each culture was determined as described by Zaragoza and colleagues (233). Assays were performed in biological triplicate and one-way ANOVA tests with Sidak’s post-test were employed in GraphPad Prism Version 7.0 (GraphPad Software, USA) to compare replicates to identify significant differences.

87 chloramphenicol. Plates were incubated at 30 ˚C, and after 48 hours colonies were counted and used to calculate colony-forming units per gram of organ. Kaplan-Meier survival curves were plotted using GraphPad Prism 7.0 (GraphPad Software, USA). Significance was analysed using the log-rank test, while organ burden significance was determined using a one-way ANOVA with Tukey’s multiple comparisons test. p-values of < 0.05 were considered significant.

Ethics statement This study was carried out in strict accordance with the recommendations in the Australian Code of Practice for the Care and Use of Animals for Scientific Purposes by the National Health and Medical Research Council. The protocol was approved by the Molecular Biosciences Animal Ethics Committee of The University of Queensland (AEC approval number: SCMB/008/11/UQ/NHMRC). Infection was performed under methoxyflurane anaesthesia, and all efforts were made to minimize suffering through adherence to the Guidelines to Promote the Wellbeing of Animals Used for Scientific Purposes as put forward by the National Health and Medical Research Council.

Expression and purification of C. neoformans ADSL Total RNA from YPD-grown C. neoformans strain H99 was extracted using TRIzol (Invitrogen, USA). Intron-free cDNA was synthesized using the SuperScript III First Strand Synthesis System (Invitrogen, USA). The ADE13 ORF was PCR-amplified using primers designed to introduce SspI and XhoI restriction sites (UQ2085 and UQ2086) and the amplicon cloned into the pCRII-TOPO vector (Invitrogen, USA) to give pCAM123. The SspI/XhoI fragment from pCAM123 was then subcloned into the E. coli expression vector pQE-30 (Qiagen, Germany) cut with SspI/XhoI to introduce an N-terminal 6× His-tag (MRGSHHHHHHGS) to give pCAM126. pCAM126 was subsequently transformed into E. coli strain BL21 (DE3) pLysS (Novagen, Japan) and grown in LB supplemented with 100 mg/mL ampicillin and 35 mg/mL kanamycin at 37 ˚C to an OD600 of ~1. Cultures were then induced with 1 mM isopropyl β-D-1-thiogalactopyranoside (IPTG) and grown for a further 5 hours at 37 ˚C. Cells were harvested and resuspended in lysis buffer (50 mM HEPES pH 8.0, 300 mM NaCl, 30 mM imidazole, 1 mM DTT and 1 mM PMSF) before disruption with a Sonifier W-450 Digital Ultrasonic Cell Disruptor sonicator (Branson, USA). Following centrifugation, the supernatant was loaded onto a 5 mL HisTrap Fast Flow column (GE Healthcare, USA) to purify the His-tagged protein by immobilized nickel-affinity chromatography. The protein was eluted in a linear gradient of 30-500 mM imidazole, showing a single elution peak. Peak fractions were pooled, concentrated and further purified using a Superdex 200 size exclusion chromatography (SEC) column (GE Healthcare, USA). Protein was eluted at a rate of 2.5 mL/min with SEC buffer (10 mM HEPES pH 7.5, 150 mM NaCl and 1 mM DTT) using an ÄKTApurifier

FPLC system. Peak fractions were combined and concentrated to ~11 mg/mL and flash-frozen in liquid nitrogen for storage at -80 ˚C.

Steady-state kinetics ADS lyase activity was monitored spectrophotometrically using a Cary60 UV-Vis spectrophotometer (Agilent, USA). The ADS-to-AMP reaction was monitored by the decrease in absorbance at 280 nm as described for the P. falciparum enzyme (257). Following optimization for the C. neoformans enzyme (pH range tested: 6-10; temperature range tested: 20-45 ˚C), 40 mM potassium phosphate buffer (PPB) pH 8.0 was used. Assays were performed in triplicate at 37 ˚C with purified, recombinant C. neoformans ADS lyase used at 2 nM final concentration. A differential extinction coefficient (Δε) 100 mM-1cm-1 was used to calculate the specific activity of the enzyme in units (U) per milligram of ADS lyase (254). As previous studies of ADS lyase from B. subtilis and human revealed that correct quaternary structure formation of the protein required incubation at 25 ˚C for 2 hours prior to assays, to ensure restoration of enzymatic activity following freezing, the same protocol was followed (254, 281). Data for the ADS-to-AMP reaction were fitted to the Michaelis-Menten equation using GraphPad Prism 7.0 (GraphPad Software, USA).

Size-exclusion chromatography (SEC)-coupled multi-angle laser light scattering (MALLS) MALLS was coupled with SEC using a Superdex 75 5/150 size exclusion column (GE Healthcare, USA) and performed using a Dawn Heleos II 18-angle light-scattering detector coupled with an Optilab rEX refractive index detector (Wyatt Technology, USA). Measurements were performed at room temperature with a flow rate of 0.5 mL/min in 10 mM HEPES (pH 7.5), 150 mM NaCl and 1 mM DTT. The sample volume was 30 µL with a protein concentration of 5 mg/mL. Molecular mass calculations were performed using the Astra 5.3 software (Wyatt Technology, USA). Input of the refractive increment (dn/dc values) was set at 0.186 in molecular mass calculations (237).

Crystallization Initial crystal hits were obtained by sparse matrix screening using Index and PEG/Ion screens (Hampton Research, USA) and optimized by Additive Screen (Hampton Research, USA), The crystals used for diffraction experiments were obtained via hanging-drop vapour diffusion after 2 days by mixing 1 µL of protein solution at 11 mg/mL with 1 µL of well solution containing 0.1 M Bis-Tris/citric acid pH 6.5, 17% PEG 3350 and 0.12 M sodium chloride at 20 ˚C. X-ray diffraction data were collected on the MX1 beamline of the Australian Synchrotron, Melbourne, Australia using Blu-Ice (282) and processed and scaled using XDS (283) and Scala (284). The C. neoformans ADS lyase structure was solved by molecular replacement using Phaser (285) in the PHENIX suite

Version 1.1.4 (286), with the human ADS lyase structure (PDB: 4FFX) as a template. The resulting model was refined with data between 20 to 2.1 Å resolution and model building between rounds of refinement was performed with Coot version 0.8.1 (287). Structure validation was performed using MolProbity version 4.3 (288).

Supplementary figures

Figure S1. Relative capsule diameter C. neoformans strains incubated in RPMI 1640 media, 10% foetal bovine serum and 1 mM adenine at 30 and 37 ˚C. At 30 hours, cells were stained with India ink to observe capsule. The relative capsule diameter value shows the mean and the error bars represent S.E.M (p < 0.0001****)

Figure S2. Solution properties of C. neoformans ADS lyase. Blue lines indicate the trace from the refractive index detector (arbitrary units) during size exclusion chromatography. Magenta lines indicate the average molecular weight (y axis) distribution across the peak by MALLS and the SDS-PAGE (insert) confirms the mass of ADS lyase monomer at 55 kDa.

Supplementary tables Table S1. Oligonucleotides used for this study. Primer name Purpose Sequence UQ1746 ADE13 5’ KO upper GCGTGAAGCAGTCAACTTTAG UQ1747 ADE13 5’ KO lower CCAGCTCACATCCTCGCAGCGTTGGTG ATTGCTGG UQ1748 ADE13 3’ KO upper TGTTAATACAGATAAACCAAAGTTTCCT GAATAAT UQ1749 ADE13 3’ KO lower AAGCCTGAATATCACCCTGAG UQ1832 ADE13 NEO flank CCAGCAATCACCAACGCTGCGAGGATG overlap forward TGAGCTGGA UQ1833 ADE13 NEO overlap AATTATTCAGGAAACTTTGGTTTATCTG reverse TATTAACA UQ1036 Diagnostic NEO TGTGGATGCTGGCGGAGGATA UQ2034 Diagnostic 5’ ADE13 AAATGCCCCAAACAAAATCTG UQ2085 H99 ADE13 cDNA GAATTCCGTACCGGATCCATGGATAGC upper TACCAAACTCCCCTT UQ2086 H99 ADE13 cDNA ACGCACGCACGCGTCGACTTACACCGA lower CAACTCGGCAGTCTT

Table S2. Diffraction and refinement statistics for C. neoformans ADS lyase structures Diffraction data statistics ADS lyase

Space group P 1 21 1 Unit cell parameters 78.11 93.50 159.25 90.00 97.54 a, b, c (Å); α=β=γ (°) 90.00 Molecules per asymmetric unit 4 Resolution range (Å) 39.44-2.10 (39.47-2.10) No. unique observations 130,683 Completeness (%) 98.60 (95.07) Multiplicity 1.9 (1.9) Average I/σ(I) (%) 8.79 (2.33) R-mergea (%) 7.429 (36.97) R-measb (%) 10.51 (69.5) c CC1/2 0.993 (0.732)

Refinement statistics Resolution (Å) 2.10 No. of reflections work set 130662 No. of reflections test set 6479 (4.96%) d Rwork (%) 15.67 Rfree (%) 21.14 No. of amino acids 1829 No. of water molecules 15999 Overall B factor (Å2) 27.70 RMS deviations from ideal valuese Bonds (Å) 0.007 Angles (º) 1.02 Ramachadran plot Favoured (%) 99 Disallowed (%) 0.2 NB: Values within parentheses indicate the highest resolution bin. a Rmerge = Σhkl(Σi(|I hkl,I − |))/Σhkl,i , where I hkl,i is the intensity of an individual measurement of the reflection with Miller indices h, k, and l, and is the mean intensity of that reflection. Calculated for I > −3σ(I). b Rmeas = Σhkl{N(hkl)/[N(hkl)-1]}1/2 Σi|Ii(hkl)- |/ ΣhklΣiIi(hkl), where Ii(hkl) is the intensity of the ith measurement of an equivalent reflection with indices hkl. c Calculated with the program Aimless . d Rwork= Σhkl(||Fobshkl| − |Fcalchkl||)/|Fobshkl|, where |Fobshkl| and |Fcalc hkl| represent the observed and calculated structure factor amplitudes. e As calculated by MolProbity .

Table S2. Mutation of ADSL deficiency and their conservation in C. neoformans Mutation Differences in Location Phenotype Reference C. neoformans E80D - Active site Mild (289, 290) D87E - Active site Mild (289, 290) Y114H - Active site Mild (267) T242I - Active site Neonatal (274) D268N/H - Active site Mild-severe (267) N297S - Active site Mild-severe (275) R303C - Active site Mild-severe (272, 275, 291-294) E376D - Active site/ Neonatal (295) subunit interface I369L - Active Severe (296) site/substrate channel I72V A Substrate channel Severe (272) P100A - Substrate channel Severe (295) D215H - Substrate channel Severe (274) M225T R Substrate channel Severe (297) R374W S Substrate channel Severe (298) M389V I Substrate channel Severe (299) S395R D Substrate channel Neonatal (272, 300) R396H - Substrate channel Severe (292, 294, 295) D422Y - Substrate channel Severe (295) L423V - Substrate channel Moderate (295) R426H - Substrate channel Severe (267, 272-275, 291, 292, 295, 301-303) D430N - Substrate channel Mild (267) S438P G Substrate channel Severe (248, 304) S447P R Substrate channel Severe (301) T450S V Substrate channel Moderate (291) R452P - Substrate channel Severe (294) S23R - Central helical Severe (274) region/active site M26L - Central helical Severe (272, 291, 305) region/active site R190Q - Central helical Mild (267) region L311V - Central helical Severe (294) region P318L N Central helical Severe (289, 301) region I351T L Central helical Severe (274) region V364M - Central helical Severe (294) region/substrate channel P467R - Central helical Severe (292) region R194C G Subunit interface Severe (272, 306) K246E - Subunit interface Moderate (272, 306) M1L - Surface Severe (298)

Chapter 5: Conclusions and future directions

Concluding remarks To improve our current arsenal of antifungals, continual efforts in both classical and rational drug design are needed. This thesis focuses on investigating novel targets against the opportunistic fungal pathogen Cryptococcus neoformans; an encapsulated yeast found in soil, decay and bird guano (36- 38). Desiccated C. neoformans cells or spores from the environment pose a major threat to the immunocompromised population. The current recommended treatment consisting of amphotericin B, flucyotosine and fluconazole are limited by efficacy, nephrotoxicity, and in some cases, their availably (6, 34). Sub-Saharan Africa accounts for the largest cohort of individuals suffering from cryptococcal menginoencephalitis; incidences of HIV/AIDS and limited resources account for the high mortality rate due to C. neoformans infections in the region. To combat such unacceptable mortality rates and resistance, novel antifungals are needed.

Classical screening approach Fungal pathogens such as C. neoformans and Aspergillus fumigatus are commonly found in soils and decaying plant matter; a niche shared with a number of other organisms that the opportunistic fungal pathogens must compete against to scavenge available nutrients. Some microbes have developed adaptive mechanisms in order to outcompete other species. In this thesis I have investigated an example of these adaptive mechanisms, the secretion of secondary metabolites. A secreted lipopeptide produced by Bacillus circulans has activity against Gram-negative bacteria thought to have a similar mode of action to the last resort drug polymyxin b despite its eight rather than ten amino acid ring structure (155-157).

This work highlights the octapeptins as a promising series of Cryptococcus specific antifungal agents with more potent activity in vitro than the polymyxins PMB and PME. Early SAR of octapeptin C4 has shown the relative importance of key structural features to antifungal activity. However, further work is required to establish why octapeptins have much more potent antifungal activity than PMB and PME, and to fully elucidate their mode(s) of action.

Rational drug design approach Due to the limited number of gross differences between fungi and humans other options must be explored. One solution to this problem is to characterised a conserved pathway and investigate targetable difference. In this thesis the enzymes of the de novo purine biosynthesis pathway have been characterised. By obtaining detailed biochemical and structural analysis I have been able to

96 determine more subtle differences that may be targeted for the development of fungal specific antimicrobials. Given the differences in purine availability C. neoformans experiences, the purine riche pigeon guano it is commonly isolated from and the purine poor cerebral spinal fluid where it is found in a disseminated infection, I hypothesized that enzymes of the de novo purine biosynthesis pathway would be essential for infection and a potential target for novel therapeutics.

The purine biosynthesis pathway has been successfully inhibited in a number of different diseases, in particular for the treatment of cancer (92, 123, 124). Structural analogues of the pathways substrates block the rapid synthesis of DNA that highly proliferating cells rely on. Like cancer cells, C. neoformans must rapidly proliferate in the host to disseminate from the lungs to the brain. Previously our group had identified two genes encoding enzymes of the de novo biosynthesis, IMP dehydrogenase and ADS synthetase that are essential for infection in a mammalian model. Two genes encoding the salvage enzymes, HGXPT and adenine phosphoribsyl transferase, are not (14, 15). Aims two and three of this thesis present two additional enzymes of the de novo purine biosynthesis pathway that have been characterized.

GMP synthase The amination of XMP to GMP is carried out by GMP synthase, an enzyme containing an ATPP- ase domain and GATase domain (202, 203, 207). Of the de novo purine biosynthetic enzymes from C. neoformans, GMP synthase (encoded by GUA1) has the least sequence similarity to its human counterpart. This low homology between the enzymes makes it an attractive target for antimicrobial development, as there are likely more structural differences that can be exploited. To investigate the viability of this enzyme as a target therapeutic intervention, the GUA1 gene was deleted and subsequently complemented. The gua1Δ deletion mutant resulted in the defects of virulence traits, avirulence in nematode and murine models of infection. Media to test for virulence traits was supplemented with exogenous guanine but was insufficient to fully restore the phenotypes observed. This is perhaps due to guanine being insoluble in water. Plates exhibit a grainy appearance, to resolve this guanine would need to be solubilised in DSMO or a weak acid in concentrations far lower than tested. Alternatively, the salvage pathway alone is not sufficient to maintain the turnover of guanine into GTP and therefore cells are able to grow but in a compromised state.

The recombinantly expressed and purified protein obtained for enzyme kinetic assays showed differences in substrate binding. This feature is important for the discovery of novel targets and therefore more detailed structural information was required to determine structural features that play a role in the binding differences. Many attempts were made to crystallize GMP synthase from C. neoformans; however, these were unsuccessful at producing diffraction data suitable for determining a detailed structure. Alternatively, a homology model was constructed and although not as detailed as a crystal structure this did highlight structural differences involved in XMP binding. To date no analogues of XMP as inhibitors of GMP synthase have been developed; however, this could be an avenue for the inhibition of this enzyme in the fungal pathogen C. neoformans.

The compound ECC1385 showed inhibition of the recombinantly purified GMP synthase from C. neoformans. This supports GMP synthase as a viable target for antifungal drug design (82). However, in a whole cell assay this compound was not active. C. neoformans deploys a number of virulence traits to defend against the immune system of the human host, one such example is its polysaccharide capsule, this is particularly problematic in the context of therapeutics as they must penetrate this network of glucuronoxylomannan and galactoxylomannan in order to reach the cell membrane (170, 171). Overall, this chapter demonstrated that GMP synthase may be inhibited in C. neoformans, of particular interest would be the inhibition of the XMP binding.

ADS lyase The β-elimination of fumarate from the non-sequential substrates N-succinocarboxyamide-5- aminoimidazole ribonucleotide (SAICAR) and adenylosuccinate to produce aminoimidazole-4- carboxamine ribonucleotide (AICAR) and AMP is carried out by a single enzyme adenylosuccinate lyase (249, 250). Required for the eighth committed step of IMP synthesis and the second committed step of ATP synthesis, this enzyme is an attractive antifungal target. Investigation of the ADE13 gene encoding ADS lyase began with its deletion and subsequent complementation. The ade13Δ deletion mutant was defective in a number of virulence traits required for evasion of the host immune defences, in addition to being avirulent in a murine model of cryptococcosis. Media to test for virulence traits was supplemented with exogenous adenine and similar to GMP synthase this was insufficient to fully restore the phenotypes observed. Adenine is soluable in water and so the likely explanation is that salvage pathway alone is not able to produce ATP from adenine. This

98 suggests that although C. neoformans has an intact salvage pathway it must also have a de novo pathway.

Generation of an expression vector containing the ORF of ADE13 meant recombinant protein could be expressed and purified. The purified ADS lyase obtain was used for enzyme kinetics assays and showed little difference in activity when compared to ADS lyase obtained from other species including humans. Further characterisation was required to determine more subtle differences between human and C. neoformans ADS lyase. Successful crystals and subsequent diffraction at 2.1 Å made structure determination possible. Molecular replacement using the human ADS lyase structure (254) was employed and determined a few features that could be potentially exploited by inhibitors.

This work suggests that ADS lyase may be a potential antifungal drug target; the structural differences in this enzyme are not as striking as GMP synthase but may still serve as the basis of a rational drug design initiative. As no ADS lyase inhibitors have been investigated to date a screening of compound libraries against the C. neoformans ADS lyase enzyme would determine if this enzyme is a druggable target.

Future Directions Treatment for HIV/AIDS has vastly improved since the development of zidovudine in the 1980s; however, those in sub-Saharan Africa or other cohorts of immunosuppressed individuals, for example transplant recipients and those receiving invasive surgeries, still remain at risk from fungal pathogens such as C. neoformans. Therefore development of novel antifungals is essential (196, 197). This thesis investigates classical and rational drug design methods of characterising compounds or targets for the development of novel antifungals. My work found octapeptin C4 had potent activity specifically against C. neoformans, a homology model demonstrated GMP synthase and the crystal structure ADS lyase have some subtle differences with their human counterparts and therefore may serve as targets for the development of antimycotics.

To determine the mode of action of octapeptin C4, a screen of the compound against the deletion library of Saccharomyces cerevisiae would suggest which genes were associated with activity and therefore be investigated in C. neoformans. In addition the compound could be investigated in an in

99 vivo assay, for example in the well-established murine cryptococcosis model of infection. A combination of the understanding of the compounds mode of action and in an animal model would allow for the potential for compound optimisation. At this stage I believe the octapeptin C4 is a promising antifungal compound, the use of polymyxins in the clinic as last resort antibacterial as well as the preliminary in vitro and cytotoxicity data is encouraging; however a lot more data would need to carry this compound into clinical trials. Given the lack of lead antifungals that exist I hope that further work to explore the octapeptins is continued.

To pursue GMP synthase as a potential antifungal drug target a more detailed understanding of the structure and compound’s specificity toward the enzyme could be investigated. Methods that could be employed are: truncation of GMP synthase from C. neoformans for crystallization, compound screening for the identification of GMP synthase specific inhibitors and mode of action studies of ECC1385 followed by subsequent chemistry to improve its ability to penetrate the cell. At this stage I believe that GMP synthase is a promising target; it is the most different enzyme of the pathway from its human counterpart and therefore is likely to have the most exploitable differences. Crystallography cannot solve every protein structure, but in recent years huge advances have been made in electron microscopy – this may be a promising method to elucidate the structure of C. neoformans GMP synthase.

Although ADS lyase had fewer points of difference in comparison to GMP synthase, its structure still had some points of difference from the human counterpart, albeit subtle differences. The difference of a glycine and a threonine residue in the active site is not a striking difference but does results in surface differences. Other antifungals such as fluconazole target differences in what is a conserved enzyme, so it is feasible that a compound exploiting this point of difference may enable tighter binding to the C. neoformans ADS lyase rather than human ADSL. To date no ADS lyase inhibitors have been reported; the mutations that occur in human disease would not make it an appropriate anti-cancer drug target like many other enzymes in the pathway. In silico modelling and fragment based drug design could be employed to overcome the lack of lead drugs that exists to target ADS lyase.

Although many structures of the de novo purine biosynthesis have been solved in a number of different systems, very little is still known if or how the enzymes interact and how substrates are transferred between what is likely to be a tight-knit enzyme pathway. Understanding the dynamic interactions between the enzymes would be key to determining where drugs could be appropriately designed to target and maximise disruption in fungal de novo biosynthesis. The methodologies used

100 in this manuscript do not investigate these potential enzymatic interactions. I believe that a multidisciplinary approach to investigating the possibility of transient interactions between enzymes of the de novo purine biosynthesis pathway is essential in this drug discovery program.

101

Reference: 1. Cooper MA. A community-based approach to new antibiotic discovery. Nat Rev Drug Discov. 2015;14(9):587-8. 2. Bicanic T, Harrison T, Niepieklo A, Dyakopu N, Meintjes G. Symptomatic relapse of HIV- associated cryptococcal meningitis after initial fluconazole monotherapy: the role of fluconazole resistance and immune reconstitution. Clin Infect Dis. 2006;43(8):1069-73. 3. Jongwutiwes U, Sungkanuparph S, Kiertiburanakul S. Comparison of clinical features and survival between cryptococcosis in human immunodeficiency virus (HIV)-positive and HIV- negative patients. Jpn J Infect Dis. 2008;61(2):111-5. 4. Li M, Liao Y, Chen M, Pan W, Weng L. Antifungal susceptibilities of Cryptococcus species complex isolates from AIDS and non-AIDS patients in Southeast China. Braz J Infect Dis. 2012;16(2):175-9. 5. Vermes A, Guchelaar HJ, Dankert J. Flucytosine: a review of its pharmacology, clinical indications, pharmacokinetics, toxicity and drug interactions. J Antimicrob Chemother. 2000;46(2):171-9. 6. WHO. Rapid advice: diagnosis, prevention and management of cryptococcal disease in HIV-infected adults, adolescents and children: World Health Organisation; December 2011 [Available from: http://www.who.int/hiv/pub/cryptococcal_disease2011/en/index.html. 7. Nosanchuk JD, Casadevall A. Cellular charge of Cryptococcus neoformans: contributions from the capsular polysaccharide, melanin, and monoclonal antibody binding. Infect Immun. 1997;65(5):1836-41. 8. Zavascki AP, Goldani LZ, Li J, Nation RL. Polymyxin B for the treatment of multidrug- resistant pathogens: a critical review. J Antimicrob Chemother. 2007;60(6):1206-15. 9. Zhai B, Zhou H, Yang L, Zhang J, Jung K, Giam CZ, et al. Polymyxin B, in combination with fluconazole, exerts a potent fungicidal effect. J Antimicrob Chemother. 2010;65(5):931-8. 10. Zhai B, Lin X. Evaluation of the anticryptococcal activity of the antibiotic polymyxin B in vitro and in vivo. Int J Antimicrob Agents. 2013;41(3):250-4. 11. Rodriguez-Nunez A, Camina F, Lojo S, Rodriguez-Segade S, Castro-Gago M. Concentrations of nucleotides, nucleosides, purine bases and urate in cerebrospinal fluid of children with meningitis. Acta paediatrica. 1993;82(10):849-52. 12. Fairbanks LD, Harris JC, Duley JA, Simmonds HA. Nucleotide degradation products in cerebrospinal fluid (CSF) in inherited and acquired pathologies. Nucleosides Nucleotides Nucleic Acids. 2004;23(8-9):1185-7. 13. Eells JT, Spector R. Purine and pyrimidine base and nucleoside concentrations in human cerebrospinal fluid and plasma. Neurochem Res. 1983;8(11):1451-7.

102

14. Morrow CA, Valkov E, Stamp A, Chow EW, Lee IR, Wronski A, et al. De novo GTP biosynthesis is critical for virulence of the fungal pathogen Cryptococcus neoformans. PLoS Pathog. 2012;8(10):e1002957. 15. Blundell RD, Williams SJ, Arras SDM, Chitty JL, Blake KL, Ericsson DJ, et al. Disruption of de novo Adenosine Triphosphate (ATP) biosynthesis abolishes virulence in Cryptococcus neoformans. Acs Infectious Diseases. 2016;2(9):651-63. 16. Clayton M. Three newly published albums of seventeenth-century mycological drawings. Mycologist. 2006;20(4):163-9. 17. Micheli PA. Nova plantarum genera 1729. 18. Linné C. Systema naturæ per regna tria naturæ, secundum classes, ordines, genera, species, cum characteribus, differentiis, synonymis, locis. Ed. 10.,reformata. ed. Holmiæ: impensis L. Salvii; 1758. 19. Persoon CH, Lünemann GH. Synopsis methodica fungorum. Gottingae: Apud H. Dieterich; 1801. 20. Fries EM. Systema mycologicum, sistens fungorum ordines, genera et species, huc usque cognitas. Lundæ,: ex officina Berlingiana; 1821. 21. Petersen RH, Knudsen H. The mycological legacy of Elias Magnus Fries. IMA Fungus. 2015;6(1):99-114. 22. Whittaker RH. New concepts of kingdoms or organisms. Evolutionary relations are better represented by new classifications than by the traditional two kingdoms. Science. 1969;163(3863):150-60. 23. Hawksworth DL. Recent changes in the international rules affecting the nomenclature of fungi. Microbiol Sci. 1984;1(1):18-21. 24. Hawksworth DL. The Fungal Dimension of Biodiversity - Magnitude, Significance, and Conservation. Mycol Res. 1991;95:641-55. 25. Blackwell M. The Fungi: 1, 2, 3 ... 5.1 Million Species? Am J Bot. 2011;98(3):426-38. 26. Burgaud G, Le Calvez T, Arzur D, Vandenkoornhuyse P, Barbier G. Diversity of culturable marine filamentous fungi from deep-sea hydrothermal vents. Environ Microbiol. 2009;11(6):1588- 600. 27. Goncalves VN, Cantrell CL, Wedge DE, Ferreira MC, Soares MA, Jacob MR, et al. Fungi associated with rocks of the Atacama Desert: taxonomy, distribution, diversity, ecology and bioprospection for bioactive compounds. Environ Microbiol. 2016;18(1):232-45. 28. Lyakh SP, Kozlova TM, Salivonik SM. Effect of periodic freezing and thawing on cells of the antarctic black yeast Nadsoniella-Nigra var. hesuelica. Microbiology. 1983;52(4):486-91.

103

29. Badiee P, Hashemizadeh Z. Opportunistic invasive fungal infections: diagnosis & clinical management. Indian J Med Res. 2014;139(2):195-204. 30. Drgona L, Khachatryan A, Stephens J, Charbonneau C, Kantecki M, Haider S, et al. Clinical and economic burden of invasive fungal diseases in Europe: focus on pre-emptive and empirical treatment of Aspergillus and Candida species. Eur J Clin Microbiol Infect 2014;33(1):7-21. 31. Zilberberg MD, Shorr AF, Kollef MH. Secular trends in candidemia-related hospitalization in the United States, 2000-2005. Infect Control Hosp Epidemiol. 2008;29(10):978-80. 32. Wenzel RP, Gennings C. Bloodstream infections due to Candida species in the intensive care unit: identifying especially high-risk patients to determine prevention strategies. Clin Infect Dis. 2005;41(11):1694-. 33. Kosmidis C, Denning DW. The clinical spectrum of pulmonary aspergillosis. Thorax. 2015;70(3):270-7. 34. Perfect JR, Dismukes WE, Dromer F, Goldman DL, Graybill JR, Hamill RJ, et al. Clinical practice guidelines for the management of cryptococcal disease: 2010 update by the infectious diseases society of america. Clin Infect Dis. 2010;50(3):291-322. 35. Rénon L. Étude sur l'aspergillose chez les animaux et chez l'homme: Masson; 1897. 36. Staib F. Vogelkot, Ein Nahrsubstrat Fur Die Gattung Cryptococcus. Zbl Bakt Parasit. 1962;186(2):233. 37. Staib F, Seeliger HP. [A new selective medium for the isolation of C. neoformans from fecal material and from soil]. Ann Inst Pasteur (Paris). 1966;110(5):792-3. 38. Emmons CW. Saprophytic sources of Cryptococcus neoformans associated with the pigeon (Columba livia). Am J Hyg. 1955;62(3):227-32. 39. Badiee P, Kordbacheh P, Alborzi A, Zeini F, Mirhendy H, Mahmoody M. Fungal infections in solid organ recipients. Exp Clin Transplant. 2005;3(2):385-9. 40. Nucci M, Anaissie E. Revisiting the source of candidemia: skin or gut? Clin Infect Dis. 2001;33(12):1959-67. 41. Braun EJ. Integration of organ systems in avian osmoregulation. J Exp Zool. 1999;283(7):702-7. 42. Yamaoka N, Kaneko K, Kudo Y, Aoki M, Yasuda M, Mawatari K, et al. Analysis of purine in purine-rich cauliflower. Nucleosides Nucleotides Nucleic Acids. 2010;29(4-6):518-21. 43. Schreiner O, Shorey EC. Pyrimidine derivatives and purine bases in soils. J Biol Chem. 1910;8(5):385-93. 44. Fischer E. Neue Synthese der Harnsäure und ihrer Methylderivate. Berichte der deutschen chemischen Gesellschaft. 1895;28(3):7.

104

45. Rosemeyer H. The chemodiversity of purine as a constituent of natural products. Chem Biodivers. 2004;1(3):361-401. 46. Oparin AI, Morgulis S. The origin of life. New York,: The Macmillan Company; 1938. viii, 2l, 270 47. Miller SL, Urey HC. Organic compound synthesis on the primitive earth. Science. 1959;130(3370):245-51. 48. Marzluf GA. Genetic regulation of nitrogen metabolism in the fungi. Microbiol Mol Biol Rev. 1997;61(1):17-32. 49. Lee IR, Chow EW, Morrow CA, Djordjevic JT, Fraser JA. Nitrogen metabolite repression of metabolism and virulence in the human fungal pathogen Cryptococcus neoformans. Genetics. 2011;188(2):309-23. 50. Griffin DH. Fungal physiology. 2nd ed. New York: Wiley-Liss; 1994. X, 458 51. Vogels GD, Van der Drift C. Degradation of purines and pyrimidines by microorganisms. Bacteriol Rev. 1976;40(2):403-68. 52. Sumrada R, Cooper TG. Allantoin transport in Saccharomyces cerevisiae. J Bacteriol. 1977;131(3):839-47. 53. Cisse OH, Pagni M, Hauser PM. Comparative Genomics Suggests That the Human Pathogenic Fungus Pneumocystis jirovecii Acquired Obligate Biotrophy through Gene Loss. Genome Biol Evol. 2014;6(8):1938-48. 54. Spanu PD. The genomics of obligate (and nonobligate) biotrophs. Annu Rev Phytopathol. 2012;50:91-109. 55. Ljungdahl PO, Daignan-Fornier B. Regulation of Amino Acid, Nucleotide, and Phosphate Metabolism in Saccharomyces cerevisiae. Genetics. 2012;190(3):885-929. 56. Pantazopoulou A, Diallinas G. Fungal nucleobase transporters. Fems Microbiol Rev. 2007;31(6):657-75. 57. Stouthamer AH. A theoretical study on the amount of ATP required for synthesis of microbial cell material. Antonie Van Leeuwenhoek. 1973;39(3):545-65. 58. Phillips R, Milo R. A feeling for the numbers in biology. P Natl Acad Sci USA. 2009;106(51):21465-71. 59. Dean P, Hirt RP, Embley TM. Microsporidia: Why Make Nucleotides if You Can Steal Them? Plos Pathogens. 2016;12(11). 60. Hirt RP, Logsdon JM, Jr., Healy B, Dorey MW, Doolittle WF, Embley TM. Microsporidia are related to Fungi: evidence from the largest subunit of RNA polymerase II and other proteins. Proc Natl Acad Sci U S A. 1999;96(2):580-5.

105

61. Galen, Vagelpohl U, Galen, Galen. Commentary on Hippocrates' Epidemics book I, parts I- III. Berlin: De Gruyter Akademie Forschung; 2014. 736 pages p. 62. Galen, Vagelpohl U, Swain S, Galen, Galen. Commentary on Hippocrates' Epidemics book II. Parts I-VI. Berlin: De Gruyter, Akademie Forschung, Walter De Guyter; 2016. 2 volumes (1143 pages) p. 63. Knoke M, Bernhardt H. The first description of an oesophageal candidosis by Bernhard von Langenbeck in 1839. Mycoses. 2006;49(4):283-7. 64. Barnett JA. A history of research on yeasts 8: taxonomy. Yeast. 2004;21(14):1141-93. 65. Magill SS, Edwards JR, Bamberg W, Beldavs ZG, Dumyati G, Kainer MA, et al. Multistate point-prevalence survey of health care-associated infections. N Engl J Med. 2014;370(13):1198- 208. 66. Buffo J, Herman MA, Soll DR. A characterization of pH-regulated dimorphism in Candida albicans. Mycopathologia. 1984;85(1-2):21-30. 67. Lu Y, Su C, Wang A, Liu H. Hyphal development in Candida albicans requires two temporally linked changes in promoter chromatin for initiation and maintenance. PLoS Biol. 2011;9(7):e1001105. 68. Klengel T, Liang WJ, Chaloupka J, Ruoff C, Schroppel K, Naglik JR, et al. Fungal adenylyl cyclase integrates CO2 sensing with cAMP signaling and virulence. Curr Biol. 2005;15(22):2021-6. 69. Lu Y, Su C, Liu H. Candida albicans hyphal initiation and elongation. Trends Microbiol. 2014;22(12):707-14. 70. Kaneko K, Aoyagi Y, Fukuuchi T, Inazawa K, Yamaoka N. Total purine and purine base content of common foodstuffs for facilitating nutritional therapy for gout and hyperuricemia. Biol Pharm Bull. 2014;37(5):709-21. 71. Traut TW. Physiological concentrations of purines and pyrimidines. Mol Cell Biochem. 1994;140(1):1-22. 72. Liu H, Lei M, Liang X, Jiang Z, Guo X. Simultaneous determination of three purines in Alysicarpus vaginalis (L.) DC. by hollow fiber-based liquid-phase microextraction combined with high-performance liquid chromatography. Biomed Chromatogr. 2014;28(2):311-6. 73. Guo S, Duan JA, Qian D, Wang H, Tang Y, Qian Y, et al. Hydrophilic interaction ultra-high performance liquid chromatography coupled with triple quadrupole mass spectrometry for determination of nucleotides, nucleosides and nucleobases in Ziziphus plants. J Chromatogr A. 2013;1301:147-55. 74. Cortez J, Schnitzer M. Purines and Pyrimidines in Soils and Humic Substances. Soil Sci Soc Am J. 1979;43(5):958-61.

106

75. Karasawa Y, Ishi IT, Kubota T. Absorption and metabolism of purines by the small intestine of the chicken. Comp Biochem Physiol A Comp Physiol. 1991;99(1-2):235-40. 76. Tebung WA, Choudhury BI, Tebbji F, Morschhauser J, Whiteway M. Rewiring of the Ppr1 Zinc Cluster Transcription Factor from Purine Catabolism to Pyrimidine Biogenesis in the Saccharomycetaceae. Curr Biol. 2016;26(13):1677-87. 77. Vylkova S, Lorenz MC. Phagosomal Neutralization by the Fungal Pathogen Candida albicans Induces Macrophage Pyroptosis. Infect Immun. 2017;85(2). 78. Balish E, Svihla G. Ultraviolet microscopy of purines and amino acids in the vacuole of Candida albicans. J Bacteriol. 1968;96(1):259-65. 79. Rodrigues L, Russo-Abrahao T, Cunha RA, Goncalves T, Meyer-Fernandes JR. Characterization of extracellular nucleotide metabolism in Candida albicans. FEMS Microbiol Lett. 2016;363(1):fnv212. 80. Poulter RT, Rikkerink EH. Genetic analysis of red, adenine-requiring mutants of Candida albicans. J Bacteriol. 1983;156(3):1066-77. 81. Donovan M, Schumuke JJ, Fonzi WA, Bonar SL, Gheesling-Mullis K, Jacob GS, et al. Virulence of a phosphoribosylaminoimidazole carboxylase-deficient Candida albicans strain in an immunosuppressed murine model of systemic candidiasis. Infect Immun. 2001;69(4):2542-8. 82. Rodriguez-Suarez R, Xu D, Veillette K, Davison J, Sillaots S, Kauffman S, et al. Mechanism-of-action determination of GMP synthase inhibitors and target validation in Candida albicans and Aspergillus fumigatus. Chem Biol. 2007;14(10):1163-75. 83. Jiang L, Zhao J, Guo R, Li J, Yu L, Xu D. Functional characterization and virulence study of ADE8 and GUA1 genes involved in the de novo purine biosynthesis in Candida albicans. FEMS Yeast Res. 2010;10(2):199-208. 84. Banerjee D, Burkard L, Panepinto JC. Inhibition of nucleotide biosynthesis potentiates the antifungal activity of amphotericin B. PLoS One. 2014;9(1):e87246. 85. Plaignaud M. Observation sur un fongus du sinus maxillaire. Journal de médecine, chirurgie et pharmacie. 1791;87:244-51. 86. Schmidt A, Schmidt DI. J.B. Georg W. Fresenius and the description of the species Aspergillus fumigatus in 1863. Contrib Microbiol. 1999;2:1-4. 87. Ruchlemer R, Yinnon AM, Hershko C. Changes in the natural history of invasive pulmonary aspergillosis in neutropenic leukemic patients. Isr J Med Sci. 1996;32(11):1089-92. 88. Cohen J, Denning DW, Viviani MA. Epidemiology of invasive aspergillosis in European cancer centres. EORTC Invasive Fungal Infections Cooperative Group. Eur J Clin Microbiol Infect Dis. 1993;12(5):392-3.

107

89. Groll AH, Shah PM, Mentzel C, Schneider M, Just-Nuebling G, Huebner K. Trends in the postmortem epidemiology of invasive fungal infections at a university hospital. J Infect. 1996;33(1):23-32. 90. Latge JP. Aspergillus fumigatus and aspergillosis. Clin Microbiol Rev. 1999;12(2):310-50. 91. Bodey G, Bueltmann B, Duguid W, Gibbs D, Hanak H, Hotchi M, et al. Fungal infections in cancer patients: an international autopsy survey. Eur J Clin Microbiol Infect Dis. 1992;11(2):99- 109. 92. Elion GB. An Overview of the Role of Nucleosides in Chemotherapy. Advances in Enzyme Regulation. 1985;24:323-34. 93. Patel R, Paya CV. Infections in solid-organ transplant recipients. Clin Microbiol Rev. 1997;10(1):86-124. 94. Denning DW. Issues in the management of invasive aspergillosis. Ann Med Interne (Paris). 1995;146(2):106-10. 95. Denning DW. Therapeutic outcome in invasive aspergillosis. Clin Infect Dis. 1996;23(3):608-15. 96. Dagenais TR, Keller NP. Pathogenesis of Aspergillus fumigatus in Invasive Aspergillosis. Clin Microbiol Rev. 2009;22(3):447-65. 97. Kwon-Chung KJ, Sugui JA. Aspergillus fumigatus--what makes the species a ubiquitous human fungal pathogen? PLoS Pathog. 2013;9(12):e1003743. 98. Matsuyama H, Amaya F, Hashimoto S, Ueno H, Beppu S, Mizuta M, et al. Acute lung inflammation and ventilator-induced lung injury caused by ATP via the P2Y receptors: an experimental study. Respiratory Research. 2008;9(1). 99. Gournas C, Oestreicher N, Amillis S, Diallinas G, Scazzocchio C. Completing the purine utilisation pathway of Aspergillus nidulans. Fungal Genet Biol. 2011;48(8):840-8. 100. Scazzocchio C. The purine degradation pathway, genetics, biochemistry and regulation. Prog Ind Microbiol. 1994;29:221-57. 101. Scazzocchio C, Darlington AJ. The genetic control of xanthine dehydrogenase and urate oxidase synthess in Aspergillus nidulans. Bull Soc Chim Biol (Paris). 1967;49(11):1503-8. 102. Scazzocchio C, Sdrin N, Ong G. Positive regulation in a eukaryote, a study of the uaY gene of Aspergillus nidulans: I. Characterization of alleles, dominance and complementation studies, and a fine structure map of the uaY--oxpA cluster. Genetics. 1982;100(2):185-208. 103. Oestreicher N, Ribard C, Scazzocchio C. The nadA gene of Aspergillus nidulans, encoding adenine deaminase, is subject to a unique regulatory pattern. Fungal Genet Biol. 2008;45(5):760-75. 104. Thykaer J, Andersen MR, Baker SE. Essential pathway identification: from in silico analysis to potential antifungal targets in Aspergillus fumigatus. Med Mycol. 2009;47 Suppl 1:S80-7.

108

105. Sanfelice F. Sull’azione patogena dei bastomiceti [On the action of pathogenic bastomiceti]. Ann Isto Igiene R Univ Roma. 1895;5:239–62. 106. Knoke M, Schwesinger G. One hundred years ago: the history of cryptococcosis in Greifswald. Medical mycology in the nineteenth century. Mycoses. 1994;37(7-8):229-33. 107. Dix NJ, Webster J. Fungal ecology. London: Chapman & Hall; 1995. viii,549: ill; 24 108. Baldrian P, Valaskova V. Degradation of cellulose by basidiomycetous fungi. Fems Microbiol Rev. 2008;32(3):501-21. 109. Stubblefield SP, Taylor TN, Beck CB. Studies of Paleozoic Fungi .4. Wood-Decaying Fungi in Callixylon-Newberryi from the Upper Devonian. Amer J Bot. 1985;72(11):1765-74. 110. Rao KP, Gopalakrishnareddy T. Nitrogen excretion in arachnids. Comp Biochem Physiol. 1962;7:175-8. 111. Schmidt G, Liss M, Thannhauser SJ. Guanine, the Principal Nitrogenous Component of the Excrements of Certain Spiders. Biochimica et biophysica acta. 1955;16(4):533-5. 112. Quilter J. Moche politics, religion, and warfare. J World Prehist. 2002;16(2):145-95. 113. Republics BotIUotA. Bulletin of the International Union of the American Republics. Washington; 1909. 114. Magnus. Ueber das Vorkommen von Xanthicoxyd im Guano. Annalen der Chemie und Pharmacie. 1844;51(3):395-7. 115. Nielsen K, De Obaldia AL, Heitman J. Cryptococcus neoformans mates on pigeon guano: implications for the realized ecological niche and globalization. Eukaryot Cell. 2007;6(6):949-59. 116. Lee IR, Yang L, Sebetso G, Allen R, Doan TH, Blundell R, et al. Characterization of the complete uric acid degradation pathway in the fungal pathogen Cryptococcus neoformans. PLoS One. 2013;8(5):e64292. 117. Shi M, Li SS, Zheng C, Jones GJ, Kim KS, Zhou H, et al. Real-time imaging of trapping and urease-dependent transmigration of Cryptococcus neoformans in mouse brain. J Clin Invest. 2010;120(5):1683-93. 118. Olszewski MA, Noverr MC, Chen GH, Toews GB, Cox GM, Perfect JR, et al. Urease expression by Cryptococcus neoformans promotes microvascular sequestration, thereby enhancing central nervous system invasion. Am J Pathol. 2004;164(5):1761-71. 119. Cox GM, Mukherjee J, Cole GT, Casadevall A, Perfect JR. Urease as a virulence factor in experimental cryptococcosis. Infect Immun. 2000;68(2):443-8. 120. Arras SD, Chitty JL, Blake KL, Schulz BL, Fraser JA. A Genomic Safe Haven for Mutant Complementation in Cryptococcus neoformans. PLoS One. 2015;10(4):e0122916.

109

121. Perfect JR, Toffaletti DL, Rude TH. The gene encoding phosphoribosylaminoimidazole carboxylase (ADE2) is essential for growth of Cryptococcus neoformans in cerebrospinal fluid. Infect Immun. 1993;61(10):4446-51. 122. Firestine SM, Misialek S, Toffaletti DL, Klem TJ, Perfect JR, Davisson VJ. Biochemical role of the Cryptococcus neoformans ADE2 protein in fungal de novo purine biosynthesis. Arch Biochem Biophys. 1998;351(1):123-34. 123. Hitchings GH, Elion GB, Vanderwerff H. 2-Aminopurine as a purine antagonist. Fed Proc. 1948;7:160. 124. Elion GB. Nobel Lecture. The purine path to chemotherapy. Biosci Rep. 1989;9(5):509-29. 125. Shigeura HT, Gordon CN. Hadacidin, a new inhibitor of purine biosynthesis. J Biol Chem. 1962;237:1932-6. 126. Christopherson RI, Lyons SD, Wilson PK. Inhibitors of de novo nucleotide biosynthesis as drugs. Acc Chem Res. 2002;35(11):961-71. 127. Skipper HE, Thomson JR, Elion GB, Hitchings GH. Observations on the anticancer activity of 6-mercaptopurine. Cancer Res. 1954;14(4):294-8. 128. Mendelsohn LG, Shih C, Schultz RM, Worzalla JF. Biochemistry and pharmacology of glycinamide ribonucleotide formyltransferase inhibitors: LY309887 and lometrexol. Invest New Drugs. 1996;14(3):287-94. 129. Franklin TJ, Cook JM. The inhibition of nucleic acid synthesis by mycophenolic acid. Biochem J. 1969;113(3):515-24. 130. Sweeney MJ, Hoffman DH, Esterman MA. Metabolism and biochemistry of mycophenolic acid. Cancer Res. 1972;32(9):1803-9. 131. Kohler GA, Gong X, Bentink S, Theiss S, Pagani GM, Agabian N, et al. The functional basis of mycophenolic acid resistance in Candida albicans IMP dehydrogenase. J Biol Chem. 2005;280(12):11295-302. 132. Mezger M, Wozniok I, Blockhaus C, Kurzai O, Hebart H, Einsele H, et al. Impact of mycophenolic acid on the functionality of human polymorphonuclear neutrophils and dendritic cells during interaction with Aspergillus fumigatus. Antimicrob Agents Chemother. 2008;52(7):2644-6. 133. Guillen Schlippe YV, Riera TV, Seyedsayamdost MR, Hedstrom L. Substitution of the conserved Arg-Tyr dyad selectively disrupts the hydrolysis phase of the IMP dehydrogenase reaction. Biochemistry. 2004;43(15):4511-21. 134. Schneweis I, Meyer K, Hormansdorfer S, Bauer J. Mycophenolic acid in silage. Appl environ microbiol. 2000;66(8):3639-41. 135. Demain AL. Mode of action of hadacidin in the growing bacterial cell. Nature. 1966;212(5057):93-4.

110

136. Tibrewal N, Elliott GI. Evaluation of hadacidin analogues. Bioorg Med Chem Lett. 2011;21(1):517-9. 137. Kirby T. Europe to boost development of new antimicrobial drugs. Lancet. 2012;379(9833):2229-30. 138. Weiner LM, Webb AK, Limbago B, Dudeck MA, Patel J, Kallen AJ, et al. Antimicrobial- Resistant Pathogens Associated With Healthcare-Associated Infections: Summary of Data Reported to the National Healthcare Safety Network at the Centers for Disease Control and Prevention, 2011- 2014. Infect Control Hosp Epidemiol. 2016;37(11):1288-301. 139. Rajasingham R, Smith RM, Park BJ, Jarvis JN, Govender NP, Chiller TM, et al. Global burden of disease of HIV-associated cryptococcal meningitis: an updated analysis. Lancet Infect Dis. 2017;17(8):873-81. 140. Assogba K, Belo M, Wateba MI, Gnonlonfoun DD, Ossou-Nguiet PM, Tsanga BB, et al. Neuromeningeal cryptococcosis in sub-Saharan Africa: Killer disease with sparse data. J Neurosci Rural Pract. 2015;6(2):221-4. 141. Hansen J, Slechta ES, Gates-Hollingsworth MA, Neary B, Barker AP, Bauman S, et al. Large-scale evaluation of the immuno-mycologics lateral flow and enzyme-linked immunoassays for detection of cryptococcal antigen in serum and cerebrospinal fluid. Clin Vaccine Immunol. 2013;20(1):52-5. 142. Loyse A, Thangaraj H, Easterbrook P, Ford N, Roy M, Chiller T, et al. Cryptococcal meningitis: improving access to essential antifungal medicines in resource-poor countries. Lancet Infect Dis. 2013;13(7):629-37. 143. Perfect JR. Cryptococcosis: a model for the understanding of infectious diseases. J Clin Invest. 2014;124(5):1893-5. 144. Bratton EW, El Husseini N, Chastain CA, Lee MS, Poole C, Sturmer T, et al. Comparison and temporal trends of three groups with cryptococcosis: HIV-infected, solid organ transplant, and HIV-negative/non-transplant. PLoS One. 2012;7(8):e43582. 145. Anderson TM, Clay MC, Cioffi AG, Diaz KA, Hisao GS, Tuttle MD, et al. Amphotericin forms an extramembranous and fungicidal sterol sponge. Nat Chem Biol. 2014;10(5):400-6. 146. Pasko MT, Piscitelli SC, Van Slooten AD. Fluconazole: a new triazole antifungal agent. DICP. 1990;24(9):860-7. 147. Loyse A, Dromer F, Day J, Lortholary O, Harrison TS. Flucytosine and cryptococcosis: time to urgently address the worldwide accessibility of a 50-year-old antifungal. J Antimicrob Chemother. 2013;68(11):2435-44. 148. Shadomy S. In vitro studies with 5-fluorocytosine. Appl Microbiol. 1969;17(6):871-7.

111

149. Friese G, Discher T, Fussle R, Schmalreck A, Lohmeyer J. Development of azole resistance during fluconazole maintenance therapy for AIDS-associated cryptococcal disease. AIDS. 2001;15(17):2344-5. 150. Perlin DS. Resistance to echinocandin-class antifungal drugs. Drug Resist Updat. 2007;10(3):121-30. 151. Peetermans W, Bobbaers H, Verhaegen J, Vandepitte J. Fluconazole-resistant Cryptococcus neoformans var gattii in an AIDS patient. Acta Clin Belg. 1993;48(6):405-9. 152. Paugam A, Dupouy-Camet J, Blanche P, Gangneux JP, Tourte-Schaefer C, Sicard D. Increased fluconazole resistance of Cryptococcus neoformans isolated from a patient with AIDS and recurrent meningitis. Clin Infect Dis. 1994;19(5):975-6. 153. Smith KD, Achan B, Hullsiek KH, McDonald TR, Okagaki LH, Alhadab AA, et al. Increased antifungal drug resistance in clinical isolates of Cryptococcus neoformans in Uganda. Antimicrob Agents Chemother. 2015;59(12):7197-204. 154. Kelly SL, Lamb DC, Taylor M, Corran AJ, Baldwin BC, Powderly WG. Resistance to amphotericin B associated with defective sterol delta 8->7 isomerase in a Cryptococcus neoformans strain from an AIDS patient. FEMS Microbiol Lett. 1994;122(1-2):39-42. 155. Velkov T, Roberts KD, Li J. Rediscovering the octapeptins. Nat Prod Rep. 2017;34(3):295- 309. 156. Ash C, Priest FG, Collins MD. Molecular identification of rRNA group 3 bacilli (Ash, Farrow, Wallbanks and Collins) using a PCR probe test. Proposal for the creation of a new genus Paenibacillus. Antonie Van Leeuwenhoek. 1993;64(3-4):253-60. 157. Meehan C, Bjourson AJ, McMullan G. Paenibacillus azoreducens sp. nov., a synthetic azo dye decolorizing bacterium from industrial wastewater. Int J Syst Evol Microbiol. 2001;51(Pt 5):1681-5. 158. Meyers E, Pansy FE, Basch HI, McRipley RJ, Slusarchyk DS, Graham SF, et al. EM49, a new peptide antibiotic. 3. biological characterization in vitro and in vivo. J Antibiot (Tokyo). 1973;26(8):457-62. 159. Meyers E, Brown WE, Principe PA, Rathnum ML, Parker WL. EM49, a new peptide antibiotic. I. Fermentation, isolation, and preliminary characterization. J Antibiot (Tokyo). 1973;26(8):444-8. 160. Konishi M, Sugawara K, Tomita K, Matsumoto K, Miyaki T, Fujisawa K, et al. Bu-2470, a new peptide antibiotic complex. I. Production, isolation and properties of Bu-2470 A, B1 and B2. J Antibiot (Tokyo). 1983;36(6):625-33.

112

161. Qian CD, Wu XC, Teng Y, Zhao WP, Li O, Fang SG, et al. Battacin (Octapeptin B5), a new cyclic lipopeptide antibiotic from Paenibacillus tianmuensis active against multidrug-resistant Gram-negative bacteria. Antimicrob Agents Chemother. 2012;56(3):1458-65. 162. Cochrane SA, Vederas JC. Lipopeptides from Bacillus and Paenibacillus spp.: A Gold Mine of Antibiotic Candidates. Med Res Rev. 2016;36(1):4-31. 163. Benedict RG, Langlykke AF. Antibiotic activity of Bacillus polymyxa. J Bacteriol. 1947;54(1):24. 164. Li J, Nation RL, Milne RW, Turnidge JD, Coulthard K. Evaluation of colistin as an agent against multi-resistant in Gram-negative bacteria. Int J Antimicrob Agents. 2005;25(1):11-25. 165. Falagas ME, Kasiakou SK. Colistin: the revival of polymyxins for the management of multidrug-resistant gram-negative bacterial infections. Clinical Infectious Diseases. 2006;42(12):1819-. 166. Storm DR, Rosenthal KS, Swanson PE. Polymyxin and related peptide antibiotics. Annu Rev Biochem. 1977;46:723-63. 167. Evans ME, Feola DJ, Rapp RP. Polymyxin B sulfate and colistin: old antibiotics for emerging multiresistant gram-negative bacteria. Ann Pharmacother. 1999;33(9):960-7. 168. CLSI. Reference method for broth dilution antifungal susceptibility testing of yeasts; approved Standard-second edition. Clinical and Laboratory Standards Institute. 2002. 169. CLSI. Reference method for broth dilution antifungal susceptibility testing of filamentous fungi; approved standard-second edition. Clinical and Laboratory Standards Institute. 2002. 170. McFadden DC, De Jesus M, Casadevall A. The physical properties of the capsular polysaccharides from Cryptococcus neoformans suggest features for capsule construction. J Biol Chem. 2006;281(4):1868-75. 171. Grijpstra J, Gerwig GJ, Wosten H, Kamerling JP, de Cock H. Production of Extracellular Polysaccharides by CAP Mutants of Cryptococcus neoformans. Eukaryot Cell. 2009;8(8):1165-73. 172. Nosanchuk JD, Rosas AL, Lee SC, Casadevall A. Melanisation of Cryptococcus neoformans in human brain tissue. Lancet. 2000;355(9220):2049-50. 173. Eisenman HC, Nosanchuk JD, Webber JBW, Emerson RJ, Camesano TA, Casadevall A. Microstructure of cell wall-associated melanin in the human pathogenic fungus Cryptococcus neoformans. Biochemistry. 2005;44(10):3683-93. 174. Becker B, Butler MS, Hansford KA, Gallardo-Godoy A, Elliott AG, Huang JX, et al. Synthesis of octapeptin C4 and biological profiling against NDM-1 and polymyxin-resistant bacteria. Bioorg Med Chem Lett. 2017. 175. HsuChen CC, Feingold DS. The mechanism of polymyxin B action and selectivity toward biologic membranes. Biochemistry. 1973;12(11):2105-11.

113

176. Teuber M, Miller IR. Selective binding of polymyxin B to negatively charged lipid monolayers. Biochim. Biophys. Acta. 1977;467(3):280-9. 177. Ellerbroek PM, Ulfman LH, Hoepelman AI, Coenjaerts FE. Cryptococcal glucuronoxylomannan interferes with neutrophil rolling on the endothelium. Cell Microbiol. 2004;6(6):581-92. 178. Bose I, Reese AJ, Ory JJ, Janbon G, Doering TL. A yeast under cover: the capsule of Cryptococcus neoformans. Eukaryot Cell. 2003;2(4):655-63. 179. Ikeda R, Sugita T, Jacobson ES, Shinoda T. Effects of melanin upon susceptibility of Cryptococcus to antifungals. Microbiol Immunol. 2003;47(4):271-7. 180. Nosanchuk JD, Casadevall A. Impact of melanin on microbial virulence and clinical resistance to antimicrobial compounds. Antimicrob Agents Chemother. 2006;50(11):3519-28. 181. Zuger A, Louie E, Holzman RS, Simberkoff MS, Rahal JJ. Cryptococcal disease in patients with the acquired immunodeficiency syndrome. Diagnostic features and outcome of treatment. Ann Intern Med. 1986;104(2):234-40. 182. Wang Y, Casadevall A. Susceptibility of melanized and nonmelanized Cryptococcus neoformans to the melanin-binding compounds trifluoperazine and chloroquine. Antimicrob Agents Chemother. 1996;40(3):541-5. 183. Maxson ME, Cook E, Casadevall A, Zaragoza O. The volume and hydration of the Cryptococcus neoformans polysaccharide capsule. Fungal Genet Biol. 2007;44(3):180-6. 184. Janbon G, Ormerod KL, Paulet D, Byrnes EJ, 3rd, Yadav V, Chatterjee G, et al. Analysis of the genome and transcriptome of Cryptococcus neoformans var. grubii reveals complex RNA expression and microevolution leading to virulence attenuation. PLoS Genet. 2014;10(4):e1004261. 185. Chang YC, Kwon-Chung KJ. Complementation of a capsule-deficient mutation of Cryptococcus neoformans restores its virulence. Mol Cell Biol. 1994;14(7):4912-9. 186. Ormerod KL, Morrow CA, Chow EW, Lee IR, Arras SD, Schirra HJ, et al. Comparative genomics of serial isolates of Cryptococcus neoformans reveals gene associated with carbon utilization and virulence. G3. 2013; Apr 9;3(4):675-686 187. Litvintseva AP, Thakur R, Vilgalys R, Mitchell TG. Multilocus sequence typing reveals three genetic subpopulations of Cryptococcus neoformans var. grubii (serotype A), including a unique population in Botswana. Genetics. 2006;172(4):2223-38. 188. Fraser JA, Giles SS, Wenink EC, Geunes-Boyer SG, Wright JR, Diezmann S, et al. Same- sex mating and the origin of the Vancouver Island Cryptococcus gattii outbreak. Nature. 2005;437(7063):1360-4.

114

189. Doyle KE, Pereira DM. GBD 2015 HIV Collaborators. Estimates of global, regional, and national incidence, prevalence, and mortality of HIV, 1980-2015: the Global Burden of Disease Study 2015. Lancet Hiv. 2016;3(9):E408-E. 190. Hymes KB, Cheung T, Greene JB, Prose NS, Marcus A, Ballard H, et al. Kaposi's sarcoma in homosexual men-a report of eight cases. Lancet. 1981;2(8247):598-600. 191. Centers for Disease C. Kaposi's sarcoma and Pneumocystis pneumonia among homosexual men--New York City and California. MMWR Morb Mortal Wkly Rep. 1981;30(25):305-8. 192. Centers for Disease C. Update on acquired immune deficiency syndrome (AIDS)--United States. MMWR Morb Mortal Wkly Rep. 1982;31(37):507-8, 13-4. 193. Centers for Disease C. Update: acquired immunodeficiency syndrome (AIDS)--United States. MMWR Morb Mortal Wkly Rep. 1983;32(35):465-7. 194. Marx JL. Strong new candidate for AIDS agent. Science. 1984;224(4648):475-7. 195. Roberts BD. HIV antibody testing methods: 1985-1988. J Insur Med. 1994;26(1):13-4. 196. Yarchoan R, Klecker RW, Weinhold KJ, Markham PD, Lyerly HK, Durack DT, et al. Administration of 3'-azido-3'-deoxythymidine, an inhibitor of HTLV-III/LAV replication, to patients with AIDS or AIDS-related complex. Lancet. 1986;1(8481):575-80. 197. Riesenberg DE, Marwick C. Anti-AIDS agents show varying early results in vitro and in vivo. JAMA. 1985;254(18):2521, 7, 9. 198. WHO. Global Health Observatory (GHO) data http://www.who.int/gho/hiv/en/; 2016 199. Kuracka L, Kalnovicova T, Kucharska J, Turcani P. Multiple sclerosis: evaluation of purine nucleotide metabolism in central nervous system in association with serum levels of selected fat- soluble antioxidants. Mult Scler Int. 2014;2014:759808. 200. Abrams R, Bentley M. Biosynthesis of nucleic acid purines. I. Formation of guanine from adenine compounds in bone marrow extracts. Arch Biochem Biophys. 1955;56(1):184-95. 201. Lagerkvist U. Biosynthesis of guanosine 5'-phosphate. II. Amination of xanthosine 5'- phosphate by purified enzyme from pigeon liver. J Biol Chem. 1958;233(1):143-9. 202. Fukuyama TT. Formation of an adenyl xanthosine monophosphate intermediate by xanthosine 5'-phosphate aminase and its inhibition by psicofuranine. J Biol Chem. 1966;241(20):4745-9. 203. Tesmer JJ, Klem TJ, Deras ML, Davisson VJ, Smith JL. The crystal structure of GMP synthetase reveals a novel catalytic triad and is a structural paradigm for two enzyme families. Nat Struct Biol. 1996;3(1):74-86. 204. Abbott JL, Newell JM, Lightcap CM, Olanich ME, Loughlin DT, Weller MA, et al. The effects of removing the GAT domain from E. coli GMP synthetase. Protein J. 2006;25(7-8):483-91.

115

205. Oliver JC, Linger RS, Chittur SV, Davisson VJ. Substrate activation and conformational dynamics of guanosine 5'-monophosphate synthetase. Biochemistry. 2013;52(31):5225-35. 206. Oliver JC, Gudihal R, Burgner JW, Pedley AM, Zwierko AT, Davisson VJ, et al. Conformational changes involving ammonia tunnel formation and allosteric control in GMP synthetase. Arch Biochem Biophys. 2014;545:22-32. 207. von der Saal W, Crysler CS, Villafranca JJ. Positional isotope exchange and kinetic experiments with Escherichia coli guanosine-5'-monophosphate synthetase. Biochemistry. 1985;24(20):5343-50. 208. Lee BH, Hartman SC. Preferential utilization of glutamine for amination of xanthosine 5'- phosphate to guanosine 5'-phosphate by purified enzymes from Escherichia coli. Biochem Biophys Res Commun. 1974;60(3):918-25. 209. Franklin MC, Cheung J, Rudolph MJ, Burshteyn F, Cassidy M, Gary E, et al. Structural genomics for drug design against the pathogen Coxiella burnetii. Proteins. 2015;83(12):2124-36. 210. Maruoka S, Horita S, Lee WC, Nagata K, Tanokura M. Crystal structure of the ATPPase subunit and its substrate-dependent association with the GATase subunit: a novel regulatory mechanism for a two-subunit-type GMP synthetase from Pyrococcus horikoshii OT3. J Mol Biol. 2010;395(2):417-29. 211. Ballut L, Violot S, Shivakumaraswamy S, Thota LP, Sathya M, Kunala J, et al. Active site coupling in Plasmodium falciparum GMP synthetase is triggered by domain rotation. Nat Commun. 2015;6. 212. Welin M, Lehtio L, Johansson A, Flodin S, Nyman T, Tresaugues L, et al. Substrate specificity and oligomerization of human GMP synthetase. J Mol Biol. 2013;425(22):4323-33. 213. Gardner WJ, Woods RA. Isolation and characterisation of guanine auxotrophs in Saccharomyces cerevisiae. Can J Microbiol. 1979;25(3):380-9. 214. Dujardin G, Kermorgant M, Slonimski PP, Boucherie H. Cloning and sequencing of the GMP synthetase-encoding gene of Saccharomyces cerevisiae. Gene. 1994;139(1):127-32. 215. Mylonakis E, Ausubel FM, Perfect JR, Heitman J, Calderwood SB. Killing of Caenorhabditis elegans by Cryptococcus neoformans as a model of yeast pathogenesis. Proc Natl Acad Sci U S A. 2002;99(24):15675-80. 216. Franco TM, Rostirolla DC, Ducati RG, Lorenzini DM, Basso LA, Santos DS. Biochemical characterization of recombinant guaA-encoded guanosine monophosphate synthetase (EC 6.3.5.2) from Mycobacterium tuberculosis H37Rv strain. Arch Biochem Biophys. 2012;517(1):1-11. 217. Bhat JY, Shastri BG, Balaram H. Kinetic and biochemical characterization of Plasmodium falciparum GMP synthetase. Biochem J. 2008;409(1):263-73.

116

218. Nakamura J, Lou L. Biochemical characterization of human GMP synthetase. J Biol Chem. 1995;270(13):7347-53. 219. Rahman A, Smith FP, Luc PT, Woolley PV. Phase I study and clinical pharmacology of 6- diazo-5-oxo-L-norleucine (DON). Invest New Drugs. 1985;3(4):369-74. 220. Cervantes-Madrid D, Romero Y, Duenas-Gonzalez A. Reviving Lonidamine and 6-Diazo-5- oxo-L-norleucine to Be Used in Combination for Metabolic Cancer Therapy. Biomed Res Int. 2015;2015:690492. 221. Coggin JH, Jr., Martin WR. 6-Diazo-5-Oxo-L-Norleucine Inhibition of Escherichia Coli. J Bacteriol. 1965;89:1348-53. 222. Sakamoto N, Hatfield GW, Moyed HS. Physical properties and subunit structure of xanthosine 5'-phosphate aminase. J Biol Chem. 1972;247(18):5880-7. 223. Sali A, Blundell TL. Comparative protein modelling by satisfaction of spatial restraints. J Mol Biol. 1993;234(3):779-815. 224. Robert X, Gouet P. Deciphering key features in protein structures with the new ENDscript server. Nucleic Acids Res. 2014;42(Web Server issue):W320-4. 225. Alspaugh JA, Perfect JR, Heitman J. Cryptococcus neoformans mating and virulence are regulated by the G-protein alpha subunit GPA1 and cAMP. Genes Dev. 1997;11(23):3206-17. 226. Zaragoza O, Rodrigues ML, De Jesus M, Frases S, Dadachova E, Casadevall A. The capsule of the fungal pathogen Cryptococcus neoformans. Adv Appl Microbiol. 2009;68:133-216. 227. Brenner S. The genetics of Caenorhabditis elegans. Genetics. 1974;77(1):71-94. 228. Fraser JA, Subaran RL, Nichols CB, Heitman J. Recapitulation of the sexual cycle of the primary fungal pathogen Cryptococcus neoformans var. gattii: implications for an outbreak on Vancouver Island, Canada. Eukaryot Cell. 2003;2(5):1036-45. 229. Pitkin JW, Panaccione DG, Walton JD. A putative cyclic peptide efflux pump encoded by the TOXA gene of the plant-pathogenic fungus Cochliobolus carbonum. Microbiology. 1996;142 ( Pt 6):1557-65. 230. Sambrook J FE, Maniatis T. Molecular Cloning: A Laboratory Manual. 2nd edition ed. Cold Spring Harbor (New York): Cold Spring Harbor Laboratory Press; 1989. 231. Chaskes S, Tyndall RL. Pigment production by Cryptococcus neoformans from para- and ortho-Diphenols: effect of the nitrogen source. J Clin Microbiol. 1975;1(6):509-14. 232. Christensen WB. Urea decomposition as a means of differentiating Proteus and Paracolon cultures from each other and from Salmonella and Shigella types. J Bacteriol. 1946;52(4):461-6. 233. Zaragoza O, Fries BC, Casadevall A. Induction of capsule growth in Cryptococcus neoformans by mammalian serum and CO2. Infect Immun. 2003;71(11):6155-64.

117

234. Ghannoum MA, Rice LB. Antifungal agents: mode of action, mechanisms of resistance, and correlation of these mechanisms with bacterial resistance. Clin Microbiol Rev. 1999;12(4):501-17. 235. Stols L, Gu M, Dieckman L, Raffen R, Collart FR, Donnelly MI. A new vector for high- throughput, ligation-independent cloning encoding a tobacco etch virus protease cleavage site. Protein Expr Purif. 2002;25(1):8-15. 236. Hill AV. The possible effects of the aggregation of the molecules of hemoglobin on its dissociation curves. J Physiol. 1910;40:4-7. 237. Wen J, Arakawa T, Philo JS. Size-exclusion chromatography with on-line light-scattering, absorbance, and refractive index detectors for studying proteins and their interactions. Anal Biochem. 1996;240(2):155-66. 238. Thakur AS, Robin G, Guncar G, Saunders NF, Newman J, Martin JL, et al. Improved success of sparse matrix protein crystallization screening with heterogeneous nucleating agents. PLoS One. 2007;2(10):e1091. 239. Larkin MA, Blackshields G, Brown NP, Chenna R, McGettigan PA, McWilliam H, et al. Clustal W and Clustal X version 2.0. Bioinformatics. 2007;23(21):2947-8. 240. Garrod AB. Observations on certain pathological conditions of the blood and urine, in gout, rheumatism, and Bright's disease. Med Chir Trans. 1848;31:83-97. 241. Garrod AES. Inborn errors of metabolism. London: H. Frowde and Hodder & Stoughton; 1909. vii, 168: ill; 19 242. Lesch M, Nyhan WL. A familial disorder of uric acid metabolism and central nervous system function. Am J Med. 1964;36:561-70. 243. Mackenzie DY, Woolf LI. Maple syrup urine disease; an inborn error of the metabolism of valine, leucine, and isoleucine associated with gross mental deficiency. Br Med J. 1959;1(5114):90- 1. 244. Carlyll HB, Mott FW. Seven Cases of Amaurotic Idiocy (Tay-Sachs Disease). Proc R Soc Med. 1911;4(Pathol Sect):147-98. 245. Lanpher B, Brunetti-Pierri N, Lee B. Inborn errors of metabolism: the flux from Mendelian to complex diseases. Nat Rev Genet. 2006;7(6):449-60. 246. Kelley RE, Andersson HC. Disorders of purines and pyrimidines. Handb Clin Neurol. 2014;120:827-38. 247. Simmonds HA, Duley JA, Fairbanks LD, McBride MB. When to investigate for purine and pyrimidine disorders. Introduction and review of clinical and laboratory indications. J Inherit Metab Dis. 1997;20(2):214-26. 248. Jaeken J, Van den Berghe G. An infantile autistic syndrome characterised by the presence of succinylpurines in body fluids. Lancet. 1984;2(8411):1058-61.

118

249. Carter CE, Cohen LH. The preparation and properties of adenylosuccinase and adenylosuccinic acid. J Biol Chem. 1956;222(1):17-30. 250. Miller RW, Lukens LN, Buchanan JM. Biosynthesis of the purines. XXV. The enzymatic cleavage of N-(5-amino-1-ribosyl-4-imidazolylcarbonyl)-L-aspartic acid 5'-phosphate. J Biol Chem. 1959;234(7):1806-11. 251. Weaver T, Banaszak L. Crystallographic studies of the catalytic and a second site in fumarase C from Escherichia coli. Biochemistry. 1996;35(44):13955-65. 252. Simpson A, Bateman O, Driessen H, Lindley P, Moss D, Mylvaganam S, et al. The structure of avian eye lens delta-crystallin reveals a new fold for a superfamily of oligomeric enzymes. Nat Struct Biol. 1994;1(10):724-34. 253. Shi W, Dunbar J, Jayasekera MM, Viola RE, Farber GK. The structure of L-aspartate ammonia-lyase from Escherichia coli. Biochemistry. 1997;36(30):9136-44. 254. Ray SP, Deaton MK, Capodagli GC, Calkins LA, Sawle L, Ghosh K, et al. Structural and biochemical characterization of human adenylosuccinate lyase (ADSL) and the R303C ADSL deficiency-associated mutation. Biochemistry. 2012;51(33):6701-13. 255. Vedadi M, Lew J, Artz J, Amani M, Zhao Y, Dong A, et al. Genome-scale protein expression and structural biology of Plasmodium falciparum and related Apicomplexan organisms. Mol Biochem Parasitol. 2007;151(1):100-10. 256. Tsai M, Koo J, Yip P, Colman RF, Segall ML, Howell PL. Substrate and product complexes of Escherichia coli adenylosuccinate lyase provide new insights into the enzymatic mechanism. J Mol Biol. 2007;370(3):541-54. 257. Bulusu V, Srinivasan B, Bopanna MP, Balaram H. Elucidation of the substrate specificity, kinetic and catalytic mechanism of adenylosuccinate lyase from Plasmodium falciparum. Biochimica et biophysica acta. 2009;1794(4):642-54. 258. Chitty JL, Tatzenko TL, Williams SJ, Koh YQ, Corfield EC, Butler MS, et al. GMP Synthase Is Required for Virulence Factor Production and Infection by Cryptococcus neoformans. J Biol Chem. 2017;292(7):3049-59. 259. Park J, Rajasingham R, Smith R, Boulware D, editors. Update on the global burden of cryptococcosis. Mycoses; 2014: Wiley-Blackwell. 260. Dorfman BZ. The isolation of adenylosuccinate synthetase mutants in yeast by selection for constitutive behavior in pigmented strains. Genetics. 1969;61(2):377-89. 261. Xu CY, Zhu HM, Wu JH, Wen H, Liu CJ. Increased permeability of blood-brain barrier is mediated by serine protease during Cryptococcus meningitis. J Int Med Res. 2014;42(1):85-92. 262. Salas SD, Bennett JE, Kwon-Chung KJ, Perfect JR, Williamson PR. Effect of the laccase gene CNLAC1, on virulence of Cryptococcus neoformans. J Exp Med. 1996;184(2):377-86.

119

263. Banerjee S, Agrawal MJ, Mishra D, Sharan S, Balaram H, Savithri HS, et al. Structural and kinetic studies on adenylosuccinate lyase from Mycobacterium smegmatis and Mycobacterium tuberculosis provide new insights on the catalytic residues of the enzyme. FEBS J. 2014;281(6):1642-58. 264. Boitz JM, Strasser R, Yates PA, Jardim A, Ullman B. Adenylosuccinate synthetase and adenylosuccinate lyase deficiencies trigger growth and infectivity deficits in Leishmania donovani. J Biol Chem. 2013;288(13):8977-90. 265. Brosius JL, Colman RF. A key role in catalysis for His89 of adenylosuccinate lyase of Bacillus subtilis. Biochemistry. 2000;39(44):13336-43. 266. Stone RL, Zalkin H, Dixon JE. Expression, purification, and kinetic characterization of recombinant human adenylosuccinate lyase. J Biol Chem. 1993;268(26):19710-6. 267. Kmoch S, Hartmannova H, Stiburkova B, Krijt J, Zikanova M, Sebesta I. Human adenylosuccinate lyase (ADSL), cloning and characterization of full-length cDNA and its isoform, gene structure and molecular basis for ADSL deficiency in six patients. Hum Mol Genet. 2000;9(10):1501-13. 268. Hitchcock CA, Dickinson K, Brown SB, Evans EG, Adams DJ. Interaction of azole antifungal antibiotics with cytochrome P-450-dependent 14 alpha-sterol demethylase purified from Candida albicans. Biochem J. 1990;266(2):475-80. 269. Auclair JR, Boggio KJ, Petsko GA, Ringe D, Agar JN. Strategies for stabilizing superoxide dismutase (SOD1), the protein destabilized in the most common form of familial amyotrophic lateral sclerosis. Proc Natl Acad Sci U S A. 2010;107(50):21394-9. 270. Marshall VM, Coppel RL. Characterisation of the gene encoding adenylosuccinate lyase of Plasmodium falciparum. Mol Biochem Parasitol. 1997;88(1-2):237-41. 271. Zikanova M, Skopova V, Hnizda A, Krijt J, Kmoch S. Biochemical and structural analysis of 14 mutant adsl enzyme complexes and correlation to phenotypic heterogeneity of adenylosuccinate lyase deficiency. Hum Mutat. 2010;31(4):445-55. 272. Marie S, Cuppens H, Heuterspreute M, Jaspers M, Tola EZ, Gu XX, et al. Mutation analysis in adenylosuccinate lyase deficiency: eight novel mutations in the re-evaluated full ADSL coding sequence. Hum Mutat. 1999;13(3):197-202. 273. Edery P, Chabrier S, Ceballos-Picot I, Marie S, Vincent MF, Tardieu M. Intrafamilial variability in the phenotypic expression of adenylosuccinate lyase deficiency: a report on three patients. Am J Med Genet A. 2003;120A(2):185-90. 274. Jurecka A, Zikanova M, Tylki-Szymanska A, Krijt J, Bogdanska A, Gradowska W, et al. Clinical, biochemical and molecular findings in seven Polish patients with adenylosuccinate lyase deficiency. Mol Genet Metab. 2008;94(4):435-42.

120

275. Henneke M, Dreha-Kulaczewski S, Brockmann K, van der Graaf M, Willemsen MA, Engelke U, et al. In vivo proton MR spectroscopy findings specific for adenylosuccinate lyase deficiency. NMR Biomed. 2010;23(5):441-5. 276. Donti TR, Cappuccio G, Hubert L, Neira J, Atwal PS, Miller MJ, et al. Diagnosis of adenylosuccinate lyase deficiency by metabolomic profiling in plasma reveals a phenotypic spectrum. Mol Genet Metab Rep. 2016;8:61-6. 277. Jackson RC, Morris HP, Weber G. Increased adenylosuccinase activity in hepatomas and kidney tumors. Life Sci. 1976;18(10):1043-8. 278. Jackson RC, Morris HP, Weber G. Enzymes of the purine ribonucleotide cycle in rat hepatomas and kidney tumors. Cancer Res. 1977;37(9):3057-65. 279. Mack DO, Lewis EM, Butler EM, Archer WH, Smith LD. A comparison of succinyladenylate lyase activity and serum sialic acid as markers of malignancy. Biochem Med. 1985;34(3):327-34. 280. Reed VL, Mack DO, Smith LD. Adenylosuccinate lyase as an indicator of breast and prostate malignancies: a preliminary report. Clin Biochem. 1987;20(5):349-51. 281. De Zoysa Ariyananda L, Colman RF. Evaluation of types of interactions in subunit association in Bacillus subtilis adenylosuccinate lyase. Biochemistry. 2008;47(9):2923-34. 282. McPhillips TM, McPhillips SE, Chiu HJ, Cohen AE, Deacon AM, Ellis PJ, et al. Blu-Ice and the Distributed Control System: software for data acquisition and instrument control at macromolecular crystallography beamlines. J Synchrotron Radiat. 2002;9(Pt 6):401-6. 283. Kabsch W. Xds. Acta Crystallogr D Biol Crystallogr. 2010;66(Pt 2):125-32. 284. Winn MD. An overview of the CCP4 project in protein crystallography: an example of a collaborative project. J Synchrotron Radiat. 2003;10(Pt 1):23-5. 285. McCoy AJ, Grosse-Kunstleve RW, Adams PD, Winn MD, Storoni LC, Read RJ. Phaser crystallographic software. J Appl Crystallogr. 2007;40(Pt 4):658-74. 286. Adams PD, Afonine PV, Bunkoczi G, Chen VB, Davis IW, Echols N, et al. PHENIX: a comprehensive Python-based system for macromolecular structure solution. Acta Crystallogr D Biol Crystallogr. 2010;66(Pt 2):213-21. 287. Emsley P, Cowtan K. Coot: model-building tools for molecular graphics. Acta Crystallogr D Biol Crystallogr. 2004;60:2126-32. 288. Chen VB, Arendall WB, 3rd, Headd JJ, Keedy DA, Immormino RM, Kapral GJ, et al. MolProbity: all-atom structure validation for macromolecular crystallography. Acta Crystallogr D Biol Crystallogr. 2010;66(Pt 1):12-21. 289. Stathis SL, Cowley DM, Broe D. Autism and adenylosuccinase deficiency. J Am Acad Child Adolesc Psychiatry. 2000;39(3):274-5.

121

290. Sivendran S, Patterson D, Spiegel E, McGown I, Cowley D, Colman RF. Two novel mutant human adenylosuccinate lyases (ASLs) associated with autism and characterization of the equivalent mutant Bacillus subtilis ASL. J Biol Chem. 2004;279(51):53789-97. 291. Race V, Marie S, Vincent MF, Van den Berghe G. Clinical, biochemical and molecular genetic correlations in adenylosuccinate lyase deficiency. Hum Mol Genet. 2000;9(14):2159-65. 292. Spiegel EK, Colman RF, Patterson D. Adenylosuccinate lyase deficiency. Mol Genet Metab. 2006;89(1-2):19-31. 293. Jaeken J, Wadman SK, Duran M, van Sprang FJ, Beemer FA, Holl RA, et al. Adenylosuccinase deficiency: an inborn error of purine nucleotide synthesis. Eur J Pediatr. 1988;148(2):126-31. 294. Castro M, Perez-Cerda C, Merinero B, Garcia MJ, Bernar J, Gil Nagel A, et al. Screening for adenylosuccinate lyase deficiency: clinical, biochemical and molecular findings in four patients. Neuropediatrics. 2002;33(4):186-9. 295. Mouchegh K, Zikanova M, Hoffmann GF, Kretzschmar B, Kuhn T, Mildenberger E, et al. Lethal fetal and early neonatal presentation of adenylosuccinate lyase deficiency: observation of 6 patients in 4 families. J Pediatr. 2007;150(1):57-61 e2. 296. Perez-Duenas B, Sempere A, Campistol J, Alonso-Colmenero I, Diez M, Gonzalez V, et al. Novel features in the evolution of adenylosuccinate lyase deficiency. Eur J Paediatr Neurol. 2012;16(4):343-8. 297. Gitiaux C, Ceballos-Picot I, Marie S, Valayannopoulos V, Rio M, Verrieres S, et al. Misleading behavioural phenotype with adenylosuccinate lyase deficiency. Eur J Hum Genet. 2009;17(1):133-6. 298. Holder-Espinasse M, Marie S, Bourrouillou G, Ceballos-Picot I, Nassogne MC, Faivre L, et al. Towards a suggestive facial dysmorphism in adenylosuccinate lyase deficiency? J Med Genet. 2002;39(6):440-2. 299. Lundy CT, Jungbluth H, Pohl KR, Siddiqui A, Marinaki AM, Mundy H, et al. Adenylosuccinate lyase deficiency in the United Kingdom pediatric population: first three cases. Pediatr Neurol. 2010;43(5):351-4. 300. van den Bergh FA, Bosschaart AN, Hageman G, Duran M, Tien Poll-The B. Adenylosuccinase deficiency with neonatal onset severe epileptic seizures and sudden death. Neuropediatrics. 1998;29(1):51-3. 301. Marie S, Race V, Nassogne MC, Vincent MF, Van den Berghe G. Mutation of a nuclear respiratory factor 2 binding site in the 5' untranslated region of the ADSL gene in three patients with adenylosuccinate lyase deficiency. Am J Hum Genet. 2002;71(1):14-21.

122

302. Nassogne M, Henrot B, Aubert G, Bonnier C, Marie S, Saint-Martin C, et al. Adenylosuccinase deficiency: an unusual cause of early-onset epilepsy associated with acquired microcephaly. Brain Dev. 2000;22(6):383-6. 303. Maaswinkel-Mooij PD, Laan LA, Onkenhout W, Brouwer OF, Jaeken J, Poorthuis BJ. Adenylosuccinase deficiency presenting with epilepsy in early infancy. J Inherit Metab Dis. 1997;20(4):606-7. 304. Stone RL, Aimi J, Barshop BA, Jaeken J, Van den Berghe G, Zalkin H, et al. A mutation in adenylosuccinate lyase associated with mental retardation and autistic features. Nat Genet. 1992;1(1):59-63. 305. Kohler M, Assmann B, Brautigam C, Storm W, Marie S, Vincent MF, et al. Adenylosuccinase deficiency: possibly underdiagnosed encephalopathy with variable clinical features. Eur J Paediatr Neurol. 1999;3(1):3-6. 306. Jaeken J, Van den Bergh F, Vincent MF, Casaer P, Van den Berghe G. Adenylosuccinase deficiency: a newly recognized variant. J Inherit Metab Dis. 1992;15(3):416-8.

123