University of Pennsylvania ScholarlyCommons

Publicly Accessible Penn Dissertations

2014

Role of Ceramide Kinase in Breast Cancer Progression

Ania Warczyk Payne University of Pennsylvania, [email protected]

Follow this and additional works at: https://repository.upenn.edu/edissertations

Part of the Cell Biology Commons, Molecular Biology Commons, and the Pharmacology Commons

Recommended Citation Payne, Ania Warczyk, "Role of Ceramide Kinase in Breast Cancer Progression" (2014). Publicly Accessible Penn Dissertations. 1402. https://repository.upenn.edu/edissertations/1402

This paper is posted at ScholarlyCommons. https://repository.upenn.edu/edissertations/1402 For more information, please contact [email protected]. Role of Ceramide Kinase in Breast Cancer Progression

Abstract Recurrent breast cancer is typically an incurable disease and, as such, is disproportionately responsible for deaths from this disease. Recurrent breast cancers arise from the pool of disseminated tumor cells (DTCs) that survive adjuvant or neoadjuvant therapy, and patients with detectable DTCs following therapy are at substantially increased risk for recurrence. Consequently, the identification of pathways that contribute to the survival of breast cancer cells following therapy could aid in the development of more effective therapies that decrease the burden of residual disease and thereby reduce the risk of breast cancer recurrence. We now report that Ceramide Kinase (Cerk) is required for mammary tumor recurrence following HER2/neu pathway inhibition and is spontaneously up-regulated during tumor recurrence in multiple genetically engineered mouse models for breast cancer. We find that Cerk is apidlyr up-regulated in tumor cells following HER2/neu down-regulation or treatment with adriamycin and that Cerk is required for tumor cell survival following HER2/neu down-regulation. Consistent with our observations in mouse models, analysis of gene expression profiles from over 2,200 patients revealed that elevated CERK expression is associated with an increased risk of recurrence in women with breast cancer. Additionally, although CERK expression is associated with aggressive subtypes of breast cancer, including those that are ER-negative, HER2-positive, basal-like, or high grade, its association with poor clinical outcome is independent of these clinicopathological variables. Together, our findings identify a functional oler for Cerk in breast cancer recurrence and suggest the clinical utility of agents targeted against this pro- survival pathway.

Degree Type Dissertation

Degree Name Doctor of Philosophy (PhD)

Graduate Group Pharmacology

First Advisor Lewis A. Chodosh

Keywords Breast Cancer Recurrence, Ceramide Kinase, Ceramide Metabolism

Subject Categories Cell Biology | Molecular Biology | Pharmacology

This dissertation is available at ScholarlyCommons: https://repository.upenn.edu/edissertations/1402 ROLE OF CERAMIDE KINASE IN BREAST CANCER PROGRESSON

Ania Warczyk Payne

A DISSERTATION

in

Pharmacology

Presented to the Faculties of the University of Pennsylvania

in

Partial Fulfillment of the Requirements for the

Degree of Doctor of Philosophy

2014

Supervisor of Dissertation

______

Lewis A. Chodosh, M.D., Ph.D., Professor of Cancer Biology and Medicine

Graduate Group Chairperson

______

Julie A. Blendy, Ph.D., Professor of Pharmacology

Dissertation Committee

Margaret M. Chou, Ph.D., Associate Professor of Pathology and Laboratory Medicine Anil K. Rustgi, M.D., T. Grier Miller Professor of Medicine Ben Z. Stanger, M.D., Ph.D., Assistant Professor of Medicine Ian A. Blair, Ph.D., A.N. Richards Professor of Pharmacology

This work is dedicated to my husband, Dennis, whose loving support has been unwavering throughout the years.

ii

ACKNOWLEDGMENTS

I am very grateful for the contributions of many mentors, colleagues, and friends to my work and to my development as a scientist. Above all, I would like to express my thanks to my mentor, Lewis Chodosh, for his guidance and support. I have learned innumerable lessons and have grown enormously as a scientist and a critical thinker thanks to his teachings.

I would like to thank my committee, Margaret Chou, Anil Rustgi, Ben Stanger, and recently Ian Blair. I would also like to thank Emer Smyth, who served on my committee for the majority of my tenure as a graduate student and recently left the University of Pennsylvania. All members of my committee provided me with instrumental advice and were extremely supportive throughout my time as a graduate student. I am also indebted to those who have taught me and collaborated with me scientifically along the way, particularly Nate Snyder,

Bobby Basu, and Tony Mancuso. Thanks also to Jianping Wang from the morphology core, who has assisted me enormously by her work sectioning tumors and performing histology.

I am also deeply thankful to my lab mates, past and present, whose collaborative spirit and selflessness have made this experience so positive and have made it a joy to come to work every day. I am truly grateful for their scientific support as well as their friendship.

Lastly, I am extremely fortunate to have a loving family who has supported me and loved me unconditionally. I am truly blessed to have such a wonderful husband, and wonderful parents and siblings. Thank you all.

iii

ABSTRACT

ROLE OF CERAMIDE KINASE IN BREAST CANCER PROGRESSION

Ania Warczyk Payne

Lewis Chodosh, M.D., Ph.D.

Recurrent breast cancer is typically an incurable disease and, as such, is disproportionately responsible for deaths from this disease. Recurrent breast cancers arise from the pool of disseminated tumor cells (DTCs) that survive adjuvant or neoadjuvant therapy, and patients with detectable DTCs following therapy are at substantially increased risk for recurrence. Consequently, the identification of pathways that contribute to the survival of breast cancer cells following therapy could aid in the development of more effective therapies that decrease the burden of residual disease and thereby reduce the risk of breast cancer recurrence. We now report that Ceramide Kinase (Cerk) is required for mammary tumor recurrence following HER2/neu pathway inhibition and is spontaneously up-regulated during tumor recurrence in multiple genetically engineered mouse models for breast cancer. We find that Cerk is rapidly up-regulated in tumor cells following HER2/neu down-regulation or treatment with adriamycin and that Cerk is required for tumor cell survival following HER2/neu down-regulation. Consistent with our observations in mouse models, analysis of gene expression profiles from over 2,200 patients revealed that elevated CERK expression is associated with an increased risk of recurrence in women with breast cancer. Additionally, although CERK expression is associated with aggressive subtypes of breast cancer, including those that are ER-negative, HER2-positive, basal-like, or high grade, its association with poor

iv clinical outcome is independent of these clinicopathological variables. Together, our findings identify a functional role for Cerk in breast cancer recurrence and suggest the clinical utility of agents targeted against this pro-survival pathway.

v

TABLE OF CONTENTS

ACKNOWLEDGMENTS ...... III

ABSTRACT ...... IV

LIST OF ILLUSTRATIONS ...... VII

CHAPTER 1: BREAST CANCER PROGRESSION, SPHINGOLIPIDS AND CERK ...... 1

CHAPTER 2: GAIN-OF-FUNCTION CERK EXPERIMENTS ...... 33

CHAPTER 3: LOSS-OF-FUNCTION CERK EXPERIMENTS ...... 60

CHAPTER 4: SUMMARY AND FUTURE DIRECTIONS ...... 97

REFERENCES...... 114

vi

LIST OF ILLUSTRATIONS

Chapter 1: Breast Cancer Progression, Sphingolipids and Cerk

Figure 1.1. Ceramide synthetic and metabolic pathways

Figure 1.2. C1P activates cPLA2 leading to eicosanoid synthesis and tumor-promoting signaling

Figure 1.3. Ceramide and ceramide-1-phosphate signaling pathways

Chapter 2: Gain-of-Function Cerk Experiments

Figure 2.1. Cerk is spontaneously up-regulated in recurrent mammary tumors and following acute HER2/neu inhibition

Figure 2.2. Cerk protects cells from apoptosis upon HER2/neu down-regulation in vitro

Figure 2.3. Cerk promotes tumor cell survival in vivo following HER2/neu down-regulation

Figure 2.4. Cerk promotes tumor recurrence in the MTB/TAN model.

Figure 2.5. High CERK expression predicts decreased relapse-free survival in women with breast cancer.

Figure 2.6. CERK expression in human breast cancer subsets

Figure 2.7. Multivariate analysis of the association of CERK expression and relapse-free survival after adjusting for subsets

Figure 2.8. Influence analysis

Chapter 3: Loss-of-Function Cerk Experiments

Figure 3.1. Cerk knockdown sensitizes tumor cells to apoptosis in vitro following HER2/neu down-regulation

vii

Figure 3.2. Cerk is required for tumor cell survival following HER2/neu down-regulation

Figure 3.3. Cerk knockdown cannot be maintained in orthotopic recurrence assays

Figure 3.4. Characterization of FLIPi conditional shRNA expression system in vitro and

MTB/TAN;Ubc-CreERT2 cell line

Figure 3.5. Characterization of FLIPi conditional shRNA expression system and MTB/TAN;Ubc-

CreERT2 cell line in vivo

Figure 3.6. Conditional Cerk knockdown cannot be obtained using FLIPi system in vivo

Figure 3.7. MTB/TAN;Ubc-CreERT2 cells undergo efficient recombination upon treatment with tamoxifen but express low levels of shRNA

Figure 3.8. High dose NVP-231 treatment may synergize with lapatinib in HER2/neu–amplified human breast cancer cells

Figure 3.9. Growth curve cannot delineate role for Cerk in primary or recurrent tumor growth

Chapter 4: Summary and Future Directions

Figure 4.1. Cerk knockdown or overexpression in MTB/TAN cell line withdrawn from doxycycline does not reveal differentially regulated signaling pathways

Figure 4.2. Cerk knockdown in BT474 cell line treated with lapatinib does not reveal differentially regulated signaling pathways

viii

CHAPTER 1: Breast Cancer Progression, Sphingolipids and Cerk

Breast Cancer

Breast cancer is the most common cancer diagnosed and the leading cause of cancer- related death among women worldwide (1). In general, primary tumors can be effectively treated by the combination of surgery, radiotherapy, and adjuvant hormonal therapy, chemotherapy and/or treatment with targeted therapies, and this has resulted in 5-year survival rates for this disease that approach 90% (1). Despite this favorable short-term prognosis, however, many breast cancer survivors relapse with recurrent disease, sometimes up to 20 years after their initial diagnosis and treatment. Since recurrent breast cancers can be treated, but not cured, the re-emergence of tumors following therapy is responsible for the majority of morbidity and mortality associated with this disease.

There are many risk factors known to increase susceptibility to breast cancer. Non- genetic risk factors include gender, age, age at menarche, age at first birth, parity, breastfeeding, menopause and hormonal therapy. Women are 100 times more likely to be diagnosed with breast cancer than men (2). Age is the second strongest risk factor for breast cancer, with 11.4% of breast cancers found in women younger than 45, while 66.4% of breast cancers are found in women age 55 or older (2). Lifestyle factors such as tobacco and alcohol use as well as obesity and physical inactivity can also increase risk of developing breast cancer

(3–5).

Genetic susceptibility is manifested as familial clustering of breast cancer; having a first- degree relative with breast cancer doubles a woman’s risk of developing this disease (6).

Between 5 and 10% of breast cancers are believed to originate from germline mutations, with the majority arising from mutations in the BRCA1 and BRCA2 genes, which can increase risk up

1 to 85% (7). Other genes whose germline mutations predispose women to breast cancer include

TP53, PTEN, STK11, CDH1, ATM and CHEK2.

In an attempt to predict outcome and response to therapy, breast cancers have historically been classified based on histology into ductal or lobular subtypes, and also based on expression of estrogen receptor (ER), progesterone receptor (PR), and HER2/neu into three groups: ER+, HER2+ and triple-negative breast cancer (TNBC). Other prognostic factors that categorize patients as having high risk of relapse include positive lymph node involvement, high tumor grade and large tumor size (8,9). Recently, there has been a transition to a classification system based on differentiation state and gene expression profiling, leading to categorization into the following molecular subtypes: luminal A and luminal B (both subsets of ER+ tumors),

ErbB2+ (which correlates broadly with HER2+ classification), basal and claudin-low (both subsets of triple-negative breast cancer), and normal-like.

One of the most common oncogenes driving spontaneous breast cancer is human epidermal growth factor 2 (HER2/neu). It is genetically amplified or overexpressed in 15-20% of breast cancers (10). Soon after its identification, HER2/neu amplification was shown to be strongly predictive of poor recurrence-free survival, poor overall survival, and relapse, independent of other prognostic factors (11,12). HER2/neu, also known as ErbB2, is a receptor tyrosine kinase of the ErbB family, which also includes EGFR (HER1 or ErbB1), HER3 (ErbB3), and

HER4 (ErbB4). All four members have an extracellular ligand-binding domain, a membrane- spanning domain, and a cytoplasmic tyrosine-kinase domain. Under normal conditions, the spatial and temporal expression of ErbB ligands, which include EGF, TGF-α, neuregulins and other EGF-family growth factors, regulate activation of the ErbB receptors. Ligand binding to

ErbB receptors induces the formation of homo- and heterodimers, which leads to activation of

2 the intrinsic kinase domains. HER2/neu does not have any known ligands, but is the preferred dimerization partner for the other three ErbB receptors, and under physiological conditions requires heterodimerization with another family member for activation. However, when

HER2/neu is overexpressed, such as in HER2/neu-amplified breast cancers, it accumulates at the plasma membrane and becomes able to form constitutively activated homodimers. Receptor dimers become phosphorylated on specific tyrosine residues within the cytoplasmic tail, leading to activation of signaling cascades downstream. The main signaling pathways activated by ErbB receptors are the PI3K/AKT and the RAS/RAF/MAPK pathways. Other important ErbB signaling effectors are the STATs, SRC tyrosine kinase, and mTOR (13).

Targeted Therapies and Resistance in Breast Cancer

Targeted therapies against HER2/neu are now part of the standard of care for patients with HER2+ breast cancer, and have achieved significantly improved outcomes for these patients. Three targeted agents against HER2/neu are currently approved by the FDA: trastuzumab (Herceptin®, Genentech), pertuzumab (PerjetaTM, Genentech), and lapatinib

(Tykerb®, GlaxoSmithKline). Trastuzumab is a humanized monoclonal antibody with an IgG1 Fc structure, which binds subdomain IV of the HER2/neu extracellular domain. Currently, trastuzumab is the only adjuvant therapy approved by the FDA for patients with HER2+ early breast cancer (EBC), after completion of chemotherapy (14). It is also indicated for metastatic breast cancer (MBC) patients in combination with paclitaxel or docetaxel after completion of a course of doxorubicin and cyclophosphamide, or concurrent with carboplatin and docetaxel.

When combined with chemotherapy, trastuzumab has been shown in large clinical trials to significantly extend disease-free survival (DFS) and overall survival (OS) (15–17). Trastuzumab’s

3 complex mechanism of action has been the source of some debate, but is thought to include (1) disruption of ligand-independent heterodimerization of HER2/neu and HER3, (2) prevention of proteolytic cleavage of the HER2/neu extracellular domain (which generates a constitutively active form of the receptor), and (3) antibody-dependent cell-mediated cytotoxicity (ADCC), mediated by natural killer cells (18). Downstream effects of these mechanisms include reduced

PI3K/AKT and MAPK signaling (19), enhanced nuclear import and stabilization of CDK inhibitor p27Kip1, reduced secretion of angiogenic factors (20), and impaired DNA damage response (21).

Lapatinib is a small molecule competitive dual tyrosine kinase inhibitor of EGFR and

HER2/neu. In a large clinical trial, it has demonstrated efficacy in combination with capecitabine in HER2+ MBC that has progressed after treatment with trastuzumab, anthracyclines and taxanes (22). Pertuzumab is a humanized monoclonal antibody that acts as a HER2/neu dimerization inhibitor, but clinical trials evaluating efficacy in MBC have not been successful to date.

In patients with MBC, response to trastuzumab and lapatinib tends to be temporary. In

EBC, although some patients treated in the adjuvant setting will demonstrate pathologic complete response (pCR), it is expected that a fraction will eventually relapse. This suggests that tumors harbor acquired mechanisms of resistance to these targeted therapies (18,23).

Resistance to these therapies can be intrinsic or acquired, and there are many mechanisms that have been described. One mechanism is through mutation or truncation of the HER2/neu receptor itself, including the C-terminal truncation mutant p95-HER2 (24,25) and the exon 16 truncation mutant Δ16-HER2 (23). Another common mechanism of resistance to HER2/neu targeted therapies is activation of parallel bypass signaling pathways. This can happen in many ways, including (1) activation of other receptor tyrosine kinases, specifically EGFR, HER3, HER4,

4

IGF-1R (18), or c-MET, (2) increasing HER-family ligands, including TGF-α (18), EGF, betacellulin or heregulin, (3) hormone receptor expression, (4) activation of intracellular kinases or deactivation of intracellular phosphatases, which can manifest as gain of function mutations in

PIK3CA (p110a) (seen in approximately 25% of breast cancers (26)), AKT1, or PIK3R1 (p85a), or loss of function mutations in PTEN (seen in approximately 40% of breast cancers (26)), or in the tumor suppressor INPP4B (23). Resistance to targeted anti-HER2/neu therapies can also come in the form of defects in apoptosis and cell cycle control, including modifications in BIM, Survivin, or p27Kip1 (27,28). Lastly, resistance to trastuzumab can come in the form of ADCC Resistance, which is frequently attributable to polymorphisms in FcR genes (23).

Many clinical trials are attempting to combat the widespread resistance to targeted therapy by utilizing various strategies. The ALTTO (Adjuvant Lapatinib and/or Trastuzumab

Treatment Optimization) and NeoALTTO trials are evaluating combining lapatinib and trastuzumab for EBC (29), and have demonstrated improved rates of pCR with both targeted therapies used in combination. In the CLEOPATRA (Clinical Evaluation of Pertuzumab and

Trastuzumab) trial, the addition of pertuzumab to trastuzumab and docetaxel was evaluated for

HER2+ MBC (30,31), and it demonstrated significantly improved progression-free survival as well as overall survival. Other strategies to combat resistance include the conjugation of trastuzumab to an inhibitor of microtubule polymerization (trastuzumab-DM1), combining trastuzumab with an anti-VEGF antibody bevacizumab, using HSP90 antagonists (tanespimycin or restapimycin)

(32,33), or the use of aromatase inhibitors (anastrozole or letrozole).

Compounding the issue of resistance to targeted therapy in breast cancer patients is the problem of multidrug resistance (MDR) to chemotherapy. Systemic agents are active at the beginning of therapy in 90% of primary breast cancers but only in 50% of MBC (34). Mechanisms

5 of resistance to chemotherapy are varied and include: (1) decreased drug uptake (via decreased expression of transporters or defective endocytosis); (2) increased drug efflux (through ABC transporters, RLIP76/RALBP1, or ATP7A/B); (3) alterations in lipid metabolism (particularly ceramide metabolism, discussed in detail below, affecting both membrane structure and cell signaling); (4) activation of detoxifying systems, including extra-hepatic drug metabolism

(expression of phase I cytochrome P450 enzymes or phase II conjugation enzymes); (5) activation of DNA repair mechanisms; and (6) evasion of drug-induced apoptosis (through up- regulation of BCL2-family proteins) (35). The classic model of MDR involves drug efflux by P- glycoprotein or Multidrug Resistance Protein 1 (MRP1), changes in topoisomerase II, or modifications in glutathione S-transferase activity.

Although advances in screening and therapy have led to significant improvements in clinical outcome for breast cancer patients, up to 30% of them will eventually relapse with the appearance of recurrent tumors (36). Breast cancer relapse can occur early, with a peak at about 18 months post-surgery, or much later with a second peak at 60 months with a tapered plateau extending up to 15 years (37). Breast cancer has a particular propensity for late recurrence, with some relapses occurring up to 25 years after initial diagnosis and treatment

(9,37–39). To mathematically model how recurrences can arise after such a long period of remission, continuous tumor growth models had to be modified to account for a period of dormancy (40).

Recurrent breast cancers arise from the pool of disseminated tumor cells (DTCs), termed minimal residual disease, that survive therapy in their host presumably due to some intrinsic resistance mechanisms. DTCs can be identified in a substantial fraction of breast cancer patients at the time of diagnosis, even those with early stage disease (41) and predict poor disease-free

6 survival and overall survival (42–44). Nevertheless, despite the clinical importance of DTCs, the mechanisms that underlie their survival and their formation of recurrent tumors following therapy are largely unknown.

Mouse Models of Breast Cancer Recurrence

In order to dissect the mechanisms contributing to breast cancer recurrence, we have employed inducible transgenic mouse models of breast cancer that recapitulate critical features of disease progression as it occurs in patients. In this system, the doxycycline-dependent, mammary-specific expression of oncogenes relevant to human breast cancer, including

HER2/neu, c-MYC, Wnt1 and Akt1, results in the formation of invasive mammary adenocarcinomas (45–49). Furthermore, in a manner analogous to the treatment of cancers with targeted therapies such as trastuzumab, mammary tumors regress to a non-palpable state following oncogene down-regulation induced by doxycycline withdrawal. Similar to breast cancer patients, however, mice bearing primary tumors that have regressed following oncogene down-regulation often develop recurrent tumors after a variable period of dormancy.

Moreover, since recurrent tumors typically arise in the absence of re-expression of the initiating oncogene, the survival and growth of recurrent tumor cells is ostensibly driven by the activation of alternate escape pathways, as is commonly observed in cancer patients treated with targeted therapies. As such, these genetically engineered mouse models provide a platform with which to investigate the cellular and molecular mechanisms that contribute to tumor recurrence, thereby identifying essential pathways that may be amenable to therapeutic targeting.

7

Sphingolipids

In recent years, sphingolipids have emerged as important regulators of tumor cell survival, as well as a number of other pathophysiological processes relevant to cancer, including proliferation, migration and inflammatory signaling. Sphingolipids represent 10-20% of cellular lipids, and have structural roles in membranes as well as cellular signaling roles that are the subject of intense ongoing investigation. Mammalian sphingolipids have an 18-carbon chain sphingoid backbone attached to a head group and are conjugated to an acyl group of varying carbon chain length (50). Sphingolipids are unique lipids in their use of the amino acid serine as the backbone to which acyl chains are attached (51). As the origin of their name suggests (the prefix sphingo means “Sphinx-like”, referring to the riddles posed by the Sphinx), the functions of sphingolipids have been enigmatic since their discovery in 1884. Today, sphingolipids retain a high level of complexity for three reasons: (1) there are a large number of distinct sphingolipids that can be generated by modifications of the sphingoid backbone, (2) most sphingolipids are synthesized by interconversion reactions catalyzed by enzymes maintaining cellular homeostasis, and (3) sphingolipid metabolism is extremely compartmentalized within different cellular membranes (50). A model for cellular homeostasis maintained by sphingolipid metabolism is known as the “sphingolipid rheostat”. Sphingolipid metabolism is in constant flux and regulates cellular fate by balancing pro-survival and pro-apoptotic sphingolipids (50).

Sphingolipids have been implicated in an array of physiological and pathological processes. They were first characterized as having a role in membrane structure. An increase in sphingolipid content from the endoplasmic reticulum to the Golgi to the plasma membrane leads to membrane thickening, which is proposed to control vesicular trafficking and protein sorting through the secretory pathway, as well as the endocytic pathway (51,52). Sphingolipids

8 and cholesterol have been shown to self-associate to form dynamic, laterally segregated membrane microdomains or “lipid rafts” that act as platforms regulating diverse membrane proteins including signaling receptors (such as Fas (53)) by aggregating them, leading to activation and enhanced signaling (51,54). Glycosphingolipids have been implicated in cell adhesion, as binding between glycosphingolipids and lectins is important for the association of myelin with nerve fibers, the formation of nodes of Ranvier, and neutrophil adhesion to the endothelium (51,55). Furthermore, sphingolipids have been implicated in regulation of the cell cycle, cell growth and proliferation, angiogenesis, differentiation and senescence.

Pathological roles for sphingolipids have been described in metabolic disorders, inflammatory diseases, cancer and sphingolipidoses (genetic defects that lead to abnormal metabolism of sphingolipids and their deposition in neural tissues that results in severe mental retardation (56)). Sphingolipids have been thoroughly investigated for their role in inflammation. The first evidence that sphingolipids could play a role in inflammation came from studies using TNFα, demonstrating it activates A-SMase, inducing ceramide production and activation of NF-κB (57). NF-κB is a transcription factor that regulates many genes with important roles in inflammation such as cytokines, chemokines, and pro-inflammatory enzymes such as COX-2 (58). Ceramide can also activate C/EBP transcription factors to induce expression of inflammatory genes such as TNF, IL-6, IL-8 and IL-1β (59). Some of the effects of ceramide in inflammation may, in fact, be attributable to C1P or S1P, which were poorly characterized at the time of the studies performed with ceramide. C1P has been demonstrated to directly activate cPLA2 leading to arachidonic acid release from membranes and downstream eicosanoid formation, specifically PGE2 (60). A coordinated response of S1P-induced COX-2 up-regulation with C1P-induced cPLA2 activation has recently been characterized (61). Mast cell degranulation

9 stimulates inflammatory responses by releasing pro-inflammatory factors from vesicles. C1P stimulates mast cell degranulation in a Ca2+-dependent manner, and may enhance fusion of vesicles with the plasma membrane (62). Mast cell stimulation by engagement of the high- affinity IgE receptor FcεRI leads to activation of SphK and production of S1P. S1P in turn gets secreted and in an autocrine manner binds the S1P receptors expressed on mast cells, S1PR1 and S1PR2, leading to migration and degranulation (63). Due to its role in mast cell activation,

S1P has been implicated in airway hyperresponsiveness, allergy and asthma (64,65).

Sphingolipids, particularly ceramide, have been shown to have an important role in cancer, specifically in regulation of cancer cell growth, differentiation, senescence and apoptosis

(53). In fact, an inverse correlation has been found between levels of ceramide and the degree of malignant progression in patients with malignant astrocytomas (66). Ceramide metabolism has been implicated in cancer drug resistance, as decreased levels of endogenous ceramide caused by increased expression of glucosylceramide synthase (GCS) results in the development of a multidrug resistant (MDR) phenotype in many cancer cells (67).

Ceramide

De novo sphingolipid production begins in the endoplasmic reticulum with the synthesis of two main precursors: long-chain bases (LCBs) and very-long-chain fatty acids (VLCFAs) of various chain lengths (51). Condensation of L-serine and fatty acid-CoAs catalyzed by serine palmitoyltransferase (SPT) forms 3-ketosphinganine (also referred to as 3-keto- dihydrosphingosine) (Figure 1.1). 3-ketosphinganine is reduced by 3-ketosphinganine reductase to sphinganine (also known as dihydrosphingosine). Sphinganine is then N-acylated by

(dihydro)ceramide synthase to dihydroceramide. There are six distinct ceramide synthase

10 enzymes encoded by six genes, each of which has activity only against sphinganines of specific chain lengths (68). Together they generate upwards of 50 different molecular species of dihydroceramide. Dihydroceramide is desaturated by dihydroceramide desaturase (DES) to ceramide (53) (Figure 1.1). Ceramide is then transported by vesicular and non-vesicular means to the Golgi, where it is further elaborated at the headgroup position to generate a large variety of sphingolipids (51). Ceramide can be trafficked from the endoplasmic reticulum to the Golgi by vesicular transport or by ceramide transport protein (CERT) (69), a soluble protein regulated by sphingolipid levels that extracts ceramide from endoplasmic reticulum membranes directly and delivers it to the Golgi (51,70). Although some controversy still exists on this matter, ceramide trafficked by vesicular transport and by CERT appears to have different fates and be compartmentalized within the Golgi. In the Golgi, sphingomyelin synthases and a range of glycosylation enzymes generate diverse glycosphingolipids and sphingomyelin (ceramide conjugated to a phosphocholine moiety) (51). The vast majority of ceramide is converted to sphingomyelin (SM) (71), in which it is believed to be stored for rapid generation of ceramide by sphingomyelinases upon stimulation.

Ceramide is the most basic sphingolipid, containing the requisite sphingosine backbone, a fatty acid side chain and a hydrogen atom as the head group (50). As such, ceramide represents the core structure of most cellular sphingolipids and is the key node in sphingolipid metabolism (51). Once incorporated into a large array of complex sphingolipids within cellular membranes, ceramide can be released by hydrolysis of the head group, but its range of activity is restricted locally due to its hydrophobic nature. As a result, different pools of ceramide are thought to be important for specific functions in each subcellular compartment (50).

11

Despite the many roles for sphingolipids in membrane structure and signaling, the way cells sense and regulate their overall levels is poorly characterized. Serine Palmitoyltransferase

(SPT)-mediated condensation of serine with fatty acid-CoAs to generate LCBs and VLCFAs is the first and rate-limiting step in sphingolipid synthesis and is therefore a crucial point of regulation

(51). In the endoplasmic reticulum, ORM proteins form an inhibitory multiprotein complex with

SPT called the SPOTS complex (Serine Palmitoyltransferase, ORM1/2, TSC3, and SAC1) (51,72), without which cells accumulate toxic levels of sphingolipids. Further downstream, production of ceramides by ceramide synthase is also subject to tight regulation involving a complex balance between the six isoforms (51). In addition to transcriptional regulation, ceramide synthase activity was recently found to be modulated by reversible dimerization (51,73).

Ceramide plays a central role in sphingolipid signaling, and its accumulation has been demonstrated to play an important role in mediating apoptosis in tumor cells in response to chemotherapy (74–77), radiotherapy (78–81) and, more recently, targeted therapy (82–86). In response to therapy and other cellular stresses, ceramide can be generated by the de novo pathway (described above), or more rapidly by the activity of sphingomyelinases (SMases).

SMases hydrolyze the phosphodiester bond of sphingomyelin to liberate ceramide by cleavage of the phosphorylcholine head group (50). Acid sphingomyelinase (A-SMase) is present in lysosomes and has a pH-optimum of 5.0. Neutral sphingomyelinase (N-SMase) is typically active in mitochondria and activated by ROS, and has a pH-optimum of 7.4. N-SMase requires reactive oxygen species (ROS) for activation, linking oxidative injury to ceramide formation (53,87). Both isoforms of SMase can be found at the plasma membrane – A-SMase at the outer leaflet and N-

SMase at the inner leaflet. A-SMase was shown to be required for accumulation of ceramide following ionizing radiation (53,88). In fact, A-SMase deficiency, as seen in the lysosomal storage

12 disorder Niemann-Pick disease, results in resistance to radiation-induced apoptosis (50).

Niemann-Pick disease also leads to excessive accumulation of sphingomyelin that can be toxic to cells, specifically neurons, leading to cell death. This results in severe neurological disease that leads to early death in most patients.

Ceramide accumulation induced by either isoform of SMase has been implicated in the induction of apoptosis. Numerous studies support that ceramide is important in the apoptotic response of cancer cells to death inducers such as FAS/FAS ligand, TNFα, growth factor withdrawal, hypoxia and DNA damage (53,89). Ceramide can mediate apoptosis through the extrinsic and intrinsic pathways with both structural and signaling roles. Ceramide generated at the plasma membrane by A-SMase is incorporated into ceramide-enriched membrane platforms that help cluster death receptors, increasing formation of death-inducing signaling complexes

(DISCs) and leading to induction of apoptotic signaling cascades (90,91). Ceramide can also induce mitochondrial outer membrane permeabilization, a hallmark of the intrinsic pathway of apoptotic signaling, by forming ceramide channels (92,93).

Ceramide Signaling Pathways

In addition to its structural roles in membranes, ceramide has been found to have many important signaling roles in response to stress stimuli, most of which result in induction of apoptosis, differentiation, or senescence. Which outcome is obtained depends on cell type, as ceramide acts preferentially on cancer cells to induce apoptosis and on non-transformed cells to induce cell-cycle arrest and/or senescence (53). The first signaling targets of ceramide to be characterized were named ceramide-activated protein phosphatases (CAPPs), and were later identified as PP1 and PP2A (94), whose downstream targets include RB, BCL2, c-JUN, PKCα, AKT,

13 and SR proteins (which modulate mRNA splicing) (95). Dephosphorylation of these targets by

PP1 and PP2A leads to inhibition of pro-survival and mitogenic pathways and sensitization to apoptosis or cell cycle arrest. In response to TNFα, ceramide activates PP1 leading to RB dephosphorylation, which induces G0/G1 arrest in MOLT-4 acute lymphoblastic leukemia cells

(96). Also through PP1, ceramide has been shown to lead to dephosphorylation and inactivation of CDK2, but interestingly not CDK4 (53,97). Additional studies showed that ceramide induces up-regulation of the CDK inhibitors p21WAF1 in Wi-38 human fibroblasts and p27KIP1 in nasopharyngeal carcinoma cells (53,97,98). Examination of the role of ceramide in senescence demonstrated that fibroblasts have increased ceramide levels when they become senescent, and furthermore that treatment with exogenous ceramide induces senescence (53,99). The mechanism of ceramide-induced senescence involves inhibition of phospholipase D, diacylglycerol generation, and activation of PKC, which leads to suppression of mitogenic pathways (53,99).

Kinase targets of ceramide include stress-activated protein kinases (SAPKs) such as the jun kinases (JNKs), kinase suppressor of Ras (KSR), and the atypical protein kinase C (PKC) isoform, PKCζ (100). Ceramide is thought to activate SAPK signaling via PKCζ, RAC-1 or TAK-1

(100,101). JNK signaling has been shown to be required for stress-induced ceramide accumulation (102), and activation of this pathway can lead to apoptosis or cell cycle arrest

(100,101). The p38 SAPK, also activated by ceramide, phosphorylates the transcription factors

CREB and ATF-1 (100,103). The first non-SAPK enzyme to be identified as a ceramide-activated protein kinase (CAPK) was KSR. KSR activates MAPK, RAF1, PKCζ, and MEKK (53,89), leading to pro-apoptotic signaling. Ceramide has also been shown to activate PKR, the dsRNA-dependent protein kinase, through RAX, the cellular PKR activator (104). Once activated, PKR

14 phosphorylates eIF2α, leading to inhibition of protein translation (105), which if sustained can lead to apoptosis.

Another downstream signaling effector of ceramide is the endolysosomal aspartate protease cathepsin D, which is activated by ceramide generated in lysosomal membranes.

Cathepsin D leads to BID-mediated activation of caspase-9 and caspase-3 (53,106). This connects lysosomal ceramide formation to the mitochondrial pathway of apoptosis.

Ceramide Metabolism

In light of the importance of ceramide in apoptosis induced by anti-neoplastic therapies and in resistance to therapy, ceramide metabolites have been the focus of increasing attention.

Amongst the best-characterized metabolites of ceramide are glucosylceramide, sphingosine-1- phosphate (S1P), sphingomyelin (SM), and ceramide-1-phosphate (C1P) (Figure 1.1) (53,107).

Together, these metabolites decrease levels of apoptotic ceramide and exert anti-apoptotic functions of their own (108).

Glucosylceramide is synthesized by glucosylceramide synthase (GCS), which catalyzes the transfer of a glucose molecule from UDP-glucose to the primary hydroxyl of ceramide to generate glucosyl β1-1 ceramide (109), the first step in glycolipid biosynthesis. Glucosylceramide is the precursor for 90% of glycosphingolipids; the remaining 10% come from the precursor galactosylceramide, which is generated by galactosylceramide synthase (Figure 1.1) (109).

Glycosphingolipids (GSLs) represent more than 3000 molecular species that contain between one and eight sugars moieties. GSLs are clustered with sphingolipids and other membrane components to form GSL-Enriched Microdomains (GEMs) a type of lipid raft in the plasma membrane (69,110). As described above, GSL- and sphingolipid-containing lipid rafts modulate

15 membrane transport, signal transduction, and cell-cell interactions, modulating cell responses to stress and playing key roles in development of drug resistance (54,69).

GCS has been shown to impart resistance to apoptosis to cancer cell lines in the context of cancer therapy in vitro (reviewed in (69)). However, it has not been shown to be explicitly involved in tumorigenesis or tumor progression in vivo. High GCS is the cause of drug resistance in more than 14 cancer cell lines of human breast, ovarian, colon, and cervical cancers, and leukemia (69,83). Multidrug resistant (MDR) cells selected by doxorubicin, paclitaxel, vinblastine, or imatinib overexpress GCS at levels 2- to 4-fold higher than drug-sensitive counterparts (69). Furthermore, silencing or inhibition of GCS sensitizes resistant cell lines to more than 20 anticancer agents including doxorubicin, paclitaxel, cisplatin, vinblastine and imatinib (69). Blocking ceramide glycosylation by inhibiting GCS in can result in increased levels of ceramide and decreased levels of GSLs, sensitizing cancer cells to chemotherapy (69).

Treatment with exogenous ceramide using polymeric nanoparticles can overcome multidrug resistance, providing further evidence that GCS metabolism of ceramide inhibits apoptosis, underlying acquired drug resistance in these cell lines (69,111).

GCS may have a functional role in human cancers, as levels of GCS mRNA or protein were found to be elevated four-fold in approximately 80% of advanced breast cancers (69,112).

Elevated GCS expression is associated with ER-positive breast cancer, though GCS expression was not found to be predictive of DFS in either ER-positive or ER-negative breast cancer patients

(113). Ceramide glycosylation by GCS is enhanced in breast cancer stem cells (BCSCs) but not in normal mammary epithelial cells, and is thought to be implicated in maintaining tumorous pluripotency of BCSCs (114).

16

Because it has been implicated in multidrug resistance in many contexts, GCS has become of interest as a drug target in cancer. “P-drugs”, including PPMP, PDMP, and PPPP, are a family of potent GCS inhibitors that are glucosylceramide mimetics containing a phenyl ring in place of the aliphatic portion of the sphingosine backbone (115). GCS inhibition by PPMP was shown to lead to failure of cleavage furrow ingression and cytokinesis due to ceramide accumulation, demonstrating that the balance of ceramides to glucosylceramides is crucial for effective cytokinesis (116).

Recently, Genzyme Corporation developed and tested a set of ethylenedioxy-PPPP analogs as highly potent and selective GCS inhibitors (115). These inhibitors have been indicated for the treatment of type 1 Gaucher disease in what is known as substrate reduction therapy

(SRT), but could potentially be useful in the treatment of multidrug resistant or refractory cancers in combination with chemotherapy. Gaucher disease is an autosomal recessive genetic disorder caused by an inactivating mutation in the GBA gene, which encodes the enzyme glucocerebrosidase. Glucocerebrosidase cleaves glucosylceramide to release a glucose molecule and ceramide, therefore its deficiency leads to toxic accumulation of glucosylceramide. Typical manifestations of Gaucher disease include anemia, thrombocytopenia, hepatosplenomegaly, and bone pathology. Some patients also develop pulmonary or neurologic symptoms (117).

Genzyme Corporation’s N-octanoyl derivative of PPPP named Genz-112638 (Eliglustat tartrate)

(118) underwent clinical trials (119), and N-butyl-deoxynojirimycin (NB-DNJ) has been commercialized (miglustat, Zavesca®) as SRT for type 1 Gaucher disease (120). Although the development of GCS inhibitors has been used mostly in the context of Gaucher disease, it still holds promise as a target in drug resistant cancers in combination with chemotherapy.

17

Another important and well-characterized metabolite of ceramide is S1P. S1P is generated by the deacylation of ceramide into sphingosine by ceramidase followed by phosphorylation by sphingosine kinase (SphK). S1P and SphK have been implicated in many cellular processes including cell growth, proliferation, survival and migration. The functions of

S1P and SphK in cancer, including in tumorigenesis and resistance to therapy, have been extensively characterized and have led to development of many inhibitors of that pathway

(reviewed in (121)). S1P has many intracellular roles, including activating NF-κB and inducing

COX-2 expression, as well as paracrine and autocrine roles involving stimulation of G-protein coupled receptors (GPCRs) called S1P receptors (S1PRs). Activation of S1PRs has been implicated in cell motility as well as proliferation (122). S1P has been defined as a tumor-promoting lipid

(53) implicated in cell growth, survival, apoptosis, invasion, vascular maturation, and angiogenesis (123).

SphK has been defined as an oncogene, though no evidence has been found of mutations in cancer (121). SphK has, however, been found to be up-regulated in many cancers including stomach, lung, brain, colon, kidney and breast cancer and in non-Hodgkin’s lymphoma

(121,124). Elevation of SphK1 in various cancers implies that it could be a molecule of prognostic value (125), and in fact, high SphK is associated with ER-negative status and predicts poor DFS in

ER-positive breast cancer patients (126). However, SphK was not found to be predictive of OS or

DFS in a prospective neoadjuvant chemotherapy trial (GeparDuo) (127). Animal studies have confirmed SphK to be pro-tumorigenic in orthotopic breast and prostate mouse tumor models

(128,129). Additionally, S1P signaling has been implicated in the development of drug resistance in multiple cancer cell lines (82,130). Overexpression of SphK in breast cancer cells results in

18 increased proliferation and resistance to tamoxifen-induced growth arrest and apoptosis (131), and confers resistance to other anti-cancer drugs, sphingosine and TNFα (125,129,132).

Many therapeutics against SphK are in development, including S1P-specific antibodies, small molecule inhibitors of SphK, and S1P receptor-directed agents (121). Safingol, a small molecule inhibitor of SphK, is in clinical trials in combination with Cisplatin in advanced solid tumors, where it was found to decrease plasma levels of S1P and prolong stable disease, inhibiting cancer progression (133). These findings suggest the potential utility of targeting ceramide metabolism, particularly SphK, in cancer therapy.

Sphingomyelin (SM) is the most abundant sphingolipid and metabolite of ceramide

(134), synthesized by the transfer of phosphorylcholine from phosphatidylcholine to ceramide by sphingomyelin synthase (SMS) (108), yielding mitogenic diacylglycerol (DAG) in the process

(71). Cellular pools of SM are thought to act as a reservoir for rapid release of ceramide by

SMases in response to cellular stresses (71,135,136). Production of SM occurs mostly in the trans-Golgi, where it forms microdomains that affect the organization of other membrane molecules, and helps establish compositional and functional differences between the endoplasmic reticulum, Golgi and plasma membranes (71,137). SM accumulates in the exoplasmic leaflet of the plasma membrane, where high packing density and affinity for cholesterol helps to create a rigid barrier to the extracellular environment. SM synthesis in the

Golgi also creates a local pool of DAG, which recruits PKD and leads to formation of secretory vesicles (71,138). SMS regulates levels of pro-apoptotic ceramide and mitogenic DAG in opposite directions, so it may have a direct impact on proliferation and apoptosis (71,139,140). Up- or down-regulation of SMS activity has been linked to mitogenic and pro-apoptotic signaling in a variety of cell types (71,139,141,142), though the mechanisms remain unclear.

19

Ceramide Kinase

Ceramide Kinase (Cerk), the only enzyme known to generate ceramide-1-phosphate

(C1P), was identified in 1989 by Bajjalieh and colleagues from rat brain synaptic vesicles (143), and was subsequently found in human leukemia (HL-60) cells (144), where C1P was first described (145). Cerk was identified based on its homology with the catalytic domain of DAG- kinase, as Cerk contains a DAG-kinase domain. Cerk introduced new subclass of the DAGK family distinct from sphingosine kinases (146), as it has no activity toward sphingosine. Cerk is a 60 kDa protein encoded by 537 amino acids in humans and 531 amino acids in mice, with the sequence identity between hCerk and mCerk being 84.4% (147). Due to the presence of a Pleckstrin

Homology (PH) domain in its N-terminus between residues 8 and 124 (148), Cerk is exclusively membrane associated. Deletion of the PH domain has been demonstrated to ablate activity and localization to the Golgi and plasma membranes (149). The leucine 10 residue in the PH domain is essential for catalytic activity (150), and the β6-β7 loop bridging the two beta strands of the

PH domain is essential for both localization and activity (151). Sequences outside of the PH domain are also required for proper localization and activity (152), and the interaction between the PH domain and PIP2 regulates plasma membrane targeting of Cerk as well as C1P levels

(148). N-terminal myristolation of Cerk has been shown not to be required for localization or activity.

Cerk contains a calmodulin (CaM) binding motif encompassing amino acid residues 422-

435 in its C-terminus (150). CaM binds directly to this site in a Ca2+-dependent manner (153), acting as Ca2+ sensor for Cerk (146). The binding of CaM to Cerk is regulated by Cerk phosphorylation at serine 427 (154), which is a putative PKA phosphorylation site (154). Cerk activity is enhanced by increases in Ca2+ levels, and association with a Ca2+/CaM complex is

20 necessary for activity (153). However, it was recently shown that Cerk activity is much more dependent on Mg2+ than Ca2+ (155).

Two sites in hCerk have been found to be consistently phosphorylated – serines 340 and

408 – though the functional consequence of these phosphorylation events is unclear, as point mutations did not lead to changes in subcellular localization or activity (154). The S340A mutant did, however, have decreased stability (154). The serine 340 site is a putative casein kinase II phosphorylation site (147), while the serine 408 site is a putative ERK or CDK phosphorylation site (146).

Based on homology of Cerk’s kinase domain with DAGK’s kinase domain, the glycine 198 residue was found to coordinate ATP (156). The glycine residue in DAGK’s kinase domain is known to be essential for catalytic activity, and mutation of glycine 198 to aspartate in Cerk was able to generate a kinase dead mutant (156).

While much work remains to be done in characterizing the regulation of Cerk at the levels of transcription, translation, or post-translational modifications, one group did find by chromatin immunoprecipitation in keratinocytes that PPARβ binds the Cerk gene at a sequence located in first intron, leading to Cerk up-regulation and increased cell survival (157). Another group found a CREB binding site in Cerk’s promoter region and demonstrated that Cerk is up- regulated in response to CREB phosphorylation (158).

Cerk’s only known function is to phosphorylate ceramide at the C-1 position to generate ceramide-1-phosphate (C1P), with no production of the C-3 product (159). Although it has high homology to DAGK and SphK, Cerk has no activity against DAG or sphingosine (147). Cerk requires its substrate to have a minimum of 12-carbons in its acyl chain, and is stereospecific for naturally occurring D-erythro-ceramides (159). To date, it is unclear how C1P is

21 dephosphorylated, as no phosphatase has been identified, but C1P phosphatase activity has been reported in plasma membrane fractions of mouse liver and brain (160–162).

Cerk is localized mostly to the trans-Golgi, but can also be found at the plasma membrane and in cytoplasmic vesicles (146). Cerk preferentially uses ceramide provided by

CERT rather than by vesicular transport from the endoplasmic reticulum to the Golgi (163), which agrees with the observation that the major subspecies of C1P are C16:0, C18:0 and C20:0

(163), the subspecies specifically transported by CERT (164). However, conflicting results show

CERT knockdown does not affect C1P production (165), which may indicate the ability of Cerk to also use ceramide trafficked by vesicular transport.

Cerk kinase activity is measurable in all mouse tissues, but is especially high in the testis, cerebellum, pancreas, and cerebrum. Northern analysis shows high Cerk mRNA expression in the mouse testis, heart and spleen, demonstrating a lack of correlation between mRNA and measurable kinase activity levels (155).

Cerk knockout mice have been generated independently by two laboratories, both by homologous recombination in ES cells. The Igarashi group generated a knockout in the C57BL/6J background (166). They found those mice to be healthy and fertile, with no histological abnormalities. They did find changes in ambulation and defecation patterns due to abnormal emotional behavior associated with low C1P in Purkinje cells. However, surprisingly, they found

C1P levels were not significantly different between Cerk+/+ and Cerk-/- mice in most tissues, which may explain the very mild phenotypes observed.

The Bornancin Group generated their knockout mouse in the BALB/c background (167).

This group saw a profound reduction in levels of C1P formed in macrophages, although they did

22 see significant residual C1P levels. The major phenotype observed was neutropenia, which was associated with significantly increased levels of ceramide in the serum of these animals.

Each of these groups observed significant residual levels of C1P in Cerk-/- mice. This implies that another mechanism must exist to generate C1P in the absence of Cerk. Conflicting results exist about the existence of a Multi-Substrate Lipid Kinase (MuLK) (168), now known as

Acylglycerol Kinase (AGK) (155) (accession numbers AJ278150 and AJ401619). There is a single report that recombinant MuLK may have activity toward ceramide, diacylglycerol and 1- acylglycerol, but not sphingosine (168), though this has not been confirmed since the initial report.

Ceramide-1-Phosphate

All of the functions attributed to Cerk are believed to be carried out by its product, C1P.

Soon after its discovery, C1P was shown to be mitogenic for fibroblasts, able to block apoptosis in macrophages, control phagocytosis in neutrophils, and mediate inflammatory responses

(169). Many studies have characterized the effect of C1P on signaling by using exogenous short- chain C1P, as long-chain C1Ps are extremely hydrophobic and cannot cross the plasma membrane. This has drawn criticism due to the non-physiological chain lengths of C1Ps utilized and their presence in extracellular space. C1P is not known to be secreted and no cell surface receptors have been identified to date. Keeping in mind those caveats, exogenous short chain

C1P was shown to stimulate DNA synthesis and promote cell division in rat fibroblasts (170).

Moreover, exogenous C1P was able to prevent apoptosis induced by macrophage-colony stimulating factor (M-CSF) withdrawal in bone marrow-derived macrophages (171), withdrawal of which is known to induce widespread apoptosis in these cells. C1P blocked DNA

23 fragmentation and stimulation the of caspase-9 and caspase-3 pathway, inhibiting apoptosis

(171). C1P can also bind to and inhibit A-SMase directly – demonstrated by its inhibition of A-

SMase in cell homogenates –, preventing accumulation of ceramide (171), thus amplifying its anti-apoptotic effects.

The first bona fide target of C1P to be described was cPLA2. C1P was shown to directly bind to and activate cPLA2 through its C2/CaLB domain at the plasma membrane (172). C1P specifically activates cPLA2 by an allosteric mechanism, and additionally lowers its dissociation constant from phosphatidylcholine-rich vesicles (172,173). The cPLA2-COX-2 pathway is often activated in inflammation and cancer pathogenesis (53,174), so Cerk has become of interest as a drug target for both of those pathologies (Figure 1.2).

C1P is also a potent inhibitor of PP1 and PP2A in vitro (173), consistent with its mitogenic effects. The potential of C1P to exert anti-apoptotic effects by inhibiting PP1 activity may be due to SR proteins, which are well-characterized PP1 targets. SR proteins, named after their characteristic serine- and arginine-rich domains, are involved in alternative mRNA splicing and have known roles in cancer, including pro-apoptotic changes in splicing of caspase-9 and

Bcl-x pre-mRNA (173,175). In addition to its allosteric activation of cPLA2, C1P-mediated inhibition of PP1 and PP2A may prevent dephosphorylation of cPLA2 at serines 505 and 727

(173). Phosphorylation of both of these residues, mediated by the MAPK pathway, is required for arachidonic acid release from the membrane (176).

Since the discovery that C1P can inhibit apoptosis in many contexts, it has been implicated in a variety of mitogenic signaling pathways. Importantly, C1P has been demonstrated to stimulate PI3K/AKT signaling in macrophages and in A549 lung adenocarcinoma cells, leading to NF-κB signaling and Bcl-xL up-regulation (177–183). The mTOR

24

/ S6 kinase pathway was shown to play a role downstream of PI3K/AKT signaling stimulated by

C1P in bone marrow-derived macrophages (183). There have, however, been conflicting reports on whether C1P can activate or suppress MAPK signaling (170,178,179,182–184), implying this is most likely cell type and context specific.

Subcellular localization of C1P may be important to its ability to activate specific signaling pathways. Ceramide-1-Phosphate Transport Protein (CPTP), or GLTPD1, traffics C1P between the trans-Golgi and the plasma membrane. Decreased CPTP trafficking leads to C1P- mediated activation of cPLA2 in the Golgi, arachidonic acid release, and eicosanoid synthesis

(185).

Due to the increasing evidence that C1P (and thus Cerk) is implicated in inflammation, cell survival, and evasion of apoptosis, inhibitors of Cerk have been under development. NVP-

231 is a diamino-benzothiazole derivative, active against Cerk in the low nanomolar range. It was identified through the screening of over a million compounds (186). NVP-231 is a reversible inhibitor of Cerk competitive toward the ceramide substrate (Ki = 7.4 nM). It demonstrated no inhibition of SphK, DAGK or CERT. NVP-231 inhibits Cerk-dependent C1P formation but has no effect on proliferation and does not lead to induction of cell death. NVP-231 in combination with tamoxifen led to increased ceramide levels and reduced cell growth (186). Unfortunately, due to poor bioavailability and rapid clearance in vivo (186) it has no potential for clinical development, but could be a useful tool for in vitro investigation.

Another inhibitor of Cerk is called K1. It was initially proposed to be a tetrasubstituted olefin isomer of the naturally occurring sphingosine kinase inhibitor F-12509A (187), but its structure was later revised to a dihydropyrane cyclization product of F-12509A (188). It is a non- competitive inhibitor of Cerk, with no effect on SphK or DAGK. It was shown in culture to

25 suppress mast cell degranulation and was not cytotoxic. Its Ki was 2.2 µM, and its IC50 was approximately 200 µM (189). This inhibitor has never been tested in animals so it is not known whether it has potential for clinical development.

Cerk and C1P in Cancer

Increasing lines of evidence have implicated both Cerk and its product C1P in cancer.

High CERK expression has been reported to be associated with poor recurrence-free survival in women with ER-negative breast cancer (190). CERK expression was also shown to be associated with aggressive subtypes of breast cancer, including ER-negative status, HER2-positive status, and high tumor grade (190).

Lung tumor removal in non-small cell lung cancer (NSCLC) patients leads to significant down-regulation of several enzymes associated with ceramide metabolism in peripheral blood mononuclear cells, including Cerk (specifically in NK cells and T cells), S1P receptor 5 (S1PR5) and

N-SMase 2, indicating that these enzymes may serve as biomarkers for lung cancer diagnosis

(191). Furthermore, a retrospective analysis of five clinical trials was used to develop an RNAi screen-derived mitotic and ceramide pathway metagene that predicted response to adjuvant paclitaxel in triple negative breast cancer (192). The fact that enzymes involved in ceramide metabolism were found to predict paclitaxel sensitivity is consistent with previously presented evidence that overexpression of GCS promotes resistance to paclitaxel and GCS inhibition promotes paclitaxel sensitivity (192).

Some evidence from cancer cell lines has also help confirm the role of Cerk in cancer.

For example, Cerk was found to be up-regulated in the hormetic response of hepatoma cells to

26 low dose UV irradiation, and Cerk knockdown increased the susceptibility of these cells to UV- induced apoptosis (193).

27

Thesis Objectives

Although ceramide and its metabolites have been demonstrated to play important roles in cell death following therapy in vitro, whether this pathway plays a functional role in tumor progression or tumor recurrence has not been addressed. Moreover, despite being cytoprotective in tumor cell lines in vitro and predicting poor recurrence-free survival in ER- negative breast cancer patients, a functional role for Cerk and C1P has not been established in tumorigenesis or tumor recurrence. The goal of this thesis was to try to define a functional role for Cerk in tumor progression through the following specific aims:

1a. To test the effect of overexpressing Cerk on mammary tumor progression

As Cerk had previously been shown to be cytoprotective in the context of many cellular stresses, we hypothesized that Cerk might play a role in tumor cell survival following oncogene down-regulation. To test this hypothesis, we first sought to characterize Cerk expression throughout tumor progression in inducible oncogene-driven mammary tumor mouse models.

We then used Cerk overexpression in HER2/neu-driven mouse tumor cells to perform gain-of- function experiments in vitro and in vivo, assessing specifically the ability of enforced Cerk expression to protect cells and tumors from apoptosis. We also sought to test whether Cerk was sufficient to promote tumor recurrence in an in vivo recurrence assay.

1b. To determine whether CERK is a prognostic indicator in breast cancer patients

Additionally, we interrogated human breast cancer patient datasets to determine whether CERK expression was predictive of outcome. Furthermore, we asked if high CERK expression was associated with other prognostic factors, such as ER status, PR status, HER2

28 status, tumor grade, lymph node status and tumor size. We also asked whether the association between CERK expression and relapse-free survival in breast cancer patients was independent of the association between CERK expression and these aggressive tumor subsets.

2. To test the effect of Cerk knockdown on mammary tumor progression

To complement Cerk gain-of-function experiments, we wanted to test the requirement for Cerk in tumor cell survival and tumor recurrence. We therefore performed loss-of-function experiments using two targeting short hairpin RNAs against Cerk. We also utilized the small molecule inhibitor of Cerk NVP-231 to try to inhibit Cerk in vitro.

Due to difficulty maintaining Cerk knockdown in vivo, we sought to generate a conditional shRNA expression system that could be expressed at specific timepoints throughout tumor progression. Although this system was not optimized sufficiently to provide evidence of

Cerk’s requirement for tumor recurrence, future studies will focus on optimizing this system to answer these questions.

Additionally, future studies will need to identify specific signaling pathways that may be involved in mediating the effect of Cerk on tumor cell survival and tumor recurrence. Also, confirming whether the effects of Cerk are in fact mediated by C1P will be of utmost importance, and changes in C1P levels following manipulation of Cerk expression will be indicative of whether C1P is mediating the effects of Cerk.

29

Figure 1.1: Ceramide synthetic and metabolic pathways

Adapted from Ogretmen B, Hannun YA. Biologically active sphingolipids in cancer pathogenesis and treatment. Nat Rev Cancer. 2004;4:604–16.

Summary of de novo synthesis of ceramide as well as major ceramide metabolic pathways.

30

Figure 1.2: C1P activates cPLA2 leading to eicosanoid synthesis and tumor-promoting signaling

Based on and adapted from Wang D, DuBois RN. Eicosanoids and cancer. Nat Rev Cancer.

2010;10:181–93.

C1P generated by Cerk activates cPLA2 at the plasma and Golgi membranes, leading to cleavage of arachidonic acid from membrane phospholipids. Arachidonic acid is then converted into a variety of eicosanoids, including prostaglandins, specifically PGE2. PGE2 is known to be pro- tumorigenic and activate EP1-4 receptors in an autocrine and paracrine manner, leading to mitogenic signaling through pathways including Ras and inhibition of GSK3β.

31

Figure 1.3. Ceramide and ceramide-1-phosphate signaling pathways

Overview of signaling pathways downstream of ceramide and ceramide-1-phosphate. Ceramide signals through many pro-apoptotic pathways, including SAPKs and the phosphatases PP1 and

PP2A. By contributing to cell cycle arrest, protein synthesis arrest, and mitochondrial permeability, ceramide promotes apoptosis. In contrast, ceramide-1-phosphate signals through several pro-survival and inflammatory pathways including PI3K/AKT and cPLA2, which is the rate- limiting step in eicosanoid synthesis.

32

CHAPTER 2: Gain-of-Function Cerk Experiments

Introduction

C1P and its synthetic enzyme Ceramide Kinase (Cerk) have been implicated in a number of pro-tumorigenic cellular processes, including inflammation, proliferation and cell survival.

Several studies have shown that Cerk is cytoprotective in many contexts by generating C1P, which signals through the PI3K/AKT pathway (177,180,194). C1P has also been reported to activate cPLA2, recruiting it to Golgi and plasma membranes, resulting in the cleavage of arachidonic acid that is then converted into a variety of eicosanoids, including prostaglandins.

Prostaglandins have, in turn, been associated with many inflammatory processes as well as regulation of cell growth (195) and cancer (reviewed in (196)). High CERK expression has been reported to be associated with poor recurrence-free survival in women with ER-negative breast cancer (190). CERK expression has also shown to be associated with aggressive subtypes of breast cancer, including ER-negative status, HER2-positive status, and high tumor grade (190).

Although ceramide and its metabolites have been demonstrated to contribute to cell death following therapy in vitro, whether this pathway plays a functional role in tumor progression in vivo has not been addressed. Moreover, despite being cytoprotective in tumor cell lines in vitro and predicting poor recurrence-free survival in ER-negative breast cancer patients, functional roles for Cerk and C1P have not been established in tumorigenesis or tumor recurrence.

In this study, we identify a functional role for Cerk in breast cancer recurrence. We demonstrate that Cerk is spontaneously up-regulated during tumor recurrence in mice and is rapidly up-regulated in response to HER2/neu pathway inhibition or treatment with adriamycin.

We further establish that Cerk promotes tumor cell survival following HER2/neu down-

33 regulation and is sufficient to promote mammary tumor recurrence. Consistent with observations in mice and with an analogous role for this enzyme in human breast cancer, we find that elevated CERK expression in primary tumors is strongly associated with an increased risk of relapse in breast cancer patients. Taken together, these observations provide the first functional evidence for a role for Cerk in cancer and identify a potential target for the treatment and prevention of breast cancer recurrence.

34

Results

Cerk is spontaneously up-regulated in recurrent mammary tumors in mice

As an initial approach to investigating the potential role of sphingolipid metabolites in tumor progression, we evaluated the expression of enzymes involved in sphingolipid metabolism in primary and recurrent mammary tumors induced by the inducible expression – and subsequent down-regulation – of HER2/neu, c-MYC, Wnt1, and Akt1 in MMTV-rtTA;TetO-

HER2/neu, MMTV-rtTA;TetO-MYC, MMTV-rtTA;TetO-Wnt1;p53+/-, and MMTV-rtTA;TetO-Akt1 transgenic mice (45–49). Expression of sphingosine kinase 1, which generates S1P from sphingosine, and glucosylceramide synthase, which generates glucosylceramide from ceramide, were not consistently altered in recurrent compared to primary tumors (data not shown). In contrast, expression of Cerk, which generates C1P from ceramide, was markedly up-regulated in recurrent tumors compared to primary tumors generated by induction of each of the four oncogenes tested (Figure 2.1A).

Cerk is up-regulated following HER2/neu pathway inhibition

To identify the stage of tumor progression at which Cerk up-regulation occurs, tumors were harvested from doxycycline-induced MMTV-rtTA;TetO-HER2/neu (MTB/TAN) mice bearing primary tumors, MTB/TAN mice bearing primary tumors in which the HER2/neu transgene had been de-induced for 48 hr or 96 hr, or MTB/TAN mice bearing primary tumors that had fully regressed and then spontaneously recurred following doxycycline withdrawal and HER2/neu down-regulation.

Quantitative RT-PCR analysis demonstrated Cerk up-regulation in mammary tumors within 48 hr following doxycycline withdrawal, which reached statistical significance by 96 hr

35 and remained up-regulated 4.1-fold in recurrent tumors (Figure 2.1B). To determine whether alterations in Cerk expression occur in tumor cells subjected to HER2/neu down-regulation, we next evaluated Cerk mRNA levels following oncogene down-regulation in vitro in doxycycline- dependent primary tumor cells derived from a tumor-bearing MTB/TAN mouse. Doxycycline withdrawal resulted in Cerk up-regulation within 24 hr that became somewhat more pronounced over time (Figure 2.1C). This finding suggests that Cerk may be acutely up-regulated in primary tumor cells in response to HER2/neu pathway down-regulation.

To determine whether CERK up-regulation is an evolutionarily conserved response to

HER2/neu pathway inhibition in breast cancer cells, we treated two HER2/neu-amplified human breast cancer cell lines, BT474 and SKBR3, with the dual inhibitor of HER2/neu and EGFR, lapatinib. Treatment with lapatinib resulted in up-regulation of CERK in each of the HER2/neu amplified cell lines relative to controls within 24 hr (Figure 2.1D, E), demonstrating that CERK up- regulation is conserved in human and mouse breast cancer cells following HER2/neu pathway inhibition.

To determine whether CERK up-regulation is also seen in response to other types of anti-neoplastic therapy, we treated BT20 human breast cancer cells with the chemotherapeutic agent adriamycin for increasing periods of time. Adriamycin treatment resulted in marked up- regulation of CERK within 8 hr, peaking at 6.5-fold at 24 hr relative to vehicle-treated controls

(Figure 2.1F). Consistent with this, CERK was up-regulated within 4 hr in primary MTB/TAN mouse tumor cells treated with adriamycin, with levels peaking at 4.5-fold at 16 hr (Figure 2.1G).

Together, these data indicate that CERK is rapidly up-regulated in mouse and human mammary tumor cells following HER2/neu pathway inhibition or treatment with adriamycin.

36

Cerk promotes tumor cell survival in vitro following HER2/neu down-regulation

Having observed acute Cerk up-regulation following HER2/neu pathway inhibition in vivo and in vitro, we hypothesized that Cerk up-regulation might contribute to the survival of tumor cells following HER2/neu pathway inhibition. Doxycycline was removed from the culture media of primary MTB/TAN tumor cell lines transduced with expression constructs for wild type

Cerk or the kinase dead mutant G198D-Cerk, which are expressed at comparable levels (data not shown), or a control vector. Cells were then stained for cleaved caspase-3 and Ki67.

Cerk overexpressing MTB/TAN cells exhibited markedly reduced staining for cleaved caspase-3 compared to control cells following HER2/neu down-regulation induced by doxycycline withdrawal (Figure 2.2A, B). In contrast, MTB/TAN cells transduced with kinase dead

G198D-Cerk exhibited an increase in cleaved caspase-3 staining following HER2/neu down- regulation that was comparable to control cells (Figure 2.2A, B). As anticipated, proliferation rates as measured by Ki67 staining fell dramatically upon HER2/neu down-regulation, but did not differ between Cerk, G198D-Cerk, and empty vector controls (Figure 2.2C). These findings suggest that Cerk overexpression is sufficient to suppress apoptosis induced by HER2/neu pathway inhibition and that it does so in a kinase-dependent manner.

To confirm the increase in apoptosis observed by immunofluorescence, we performed

Western blots for cleaved caspase-3 and cleaved PARP under the same culture conditions.

Consistent with immunofluorescence results, Cerk overexpression reduced levels of cleaved

PARP and cleaved caspase-3 detected following doxycycline withdrawal (Figure 2.2D, E, F).

Kinase dead G198D-Cerk had comparable levels of cleaved PARP and cleaved caspase-3 as controls, indicating that kinase activity is required for Cerk to protect cells from apoptosis.

37

Cerk promotes tumor cell survival in vivo following HER2/neu down-regulation

Having observed a protective effect of Cerk overexpression in MTB/TAN cells in vitro upon HER2/neu down-regulation, we wanted to determine whether this would occur in vivo. To address this possibility, we generated mice bearing orthotopic tumors derived from MTB/TAN primary tumor cells overexpressing wild type Cerk, kinase dead G198D-Cerk, or a control vector.

We then performed immunofluorescence staining for cleaved caspase-3 on histological sections from primary tumors on doxycycline or in which HER2/neu had been acutely down-regulated for

48 or 96 hr.

Primary tumors from control, Cerk and G198D-Cerk overexpressing cohorts exhibited comparable, low levels of cleaved caspase-3 staining in the presence of HER2/neu expression and a marked increase in cleaved caspase-3 staining was observed 48 hr following doxycycline withdrawal (Figure 2.3A, B). Strikingly, however, tumors overexpressing Cerk displayed a significantly blunted apoptotic response to HER2/neu down-regulation at 48 hr post- deinduction, and cleaved caspase-3 levels remained lower in Cerk overexpressing tumors compared to controls at 96 hr (Figure 2.3A, B). In contrast, tumors overexpressing the kinase dead mutant G198D-Cerk did not blunt the apoptotic response and exhibited high levels of cleaved caspase-3 comparable to control tumors following HER2/neu down-regulation (Figure

2.3A, B). These findings indicate that Cerk up-regulation protects tumor cells from apoptosis following HER2/neu pathway inhibition, suggesting a cellular mechanism for the observation that cells with Cerk knockdown are selected against following oncogene down-regulation in vivo.

38

Cerk promotes mammary tumor recurrence in vivo

Cerk’s ability to inhibit apoptosis following HER2/neu down-regulation in tumor cells in vivo and in vitro, coupled with its spontaneous up-regulation in recurrent mammary tumors in multiple genetically engineered mouse models, suggested the possibility that Cerk might promote breast cancer recurrence by enhancing the survival of tumor cells following therapy. To test this hypothesis, we injected primary MTB/TAN tumor cells transduced with a Cerk expression vector or a control vector into the mammary fat pads of nu/nu mice maintained on doxycycline. Following primary tumor formation, mice were withdrawn from doxycycline to induce oncogene down-regulation and tumor regression (Figure 2.4A). All tumors regressed to a non-palpable state, irrespective of Cerk expression status. Mice were then monitored for tumor recurrence.

Consistent with our hypothesis, Cerk expression in MTB/TAN tumor cells markedly accelerated tumor recurrence, with median time to recurrence decreasing from 178 days for control tumors to 130 days in Cerk overexpressing tumors (Figure 2.4B, HR = 4.44, p = 0.0006).

However, mean growth rate of recurrent tumors was not found to be different between control and Cerk overexpressing cohorts, indicating increased rates of proliferation are unlikely to be responsible for the observed difference in latency to tumor recurrence (Figure 2.4C).

The above experiment could not rule out the possibility that the increased rate of relapse observed for Cerk overexpressing tumors was due to effects of Cerk expression during primary tumor formation. That is, if Cerk expression resulted in the formation of primary tumors with different properties than control tumors, this could explain the reduced time to recurrence, rather than effects of Cerk following HER2/neu down-regulation. To address the potential confounding effects of Cerk expression during primary tumor formation, we modified the

39 orthotopic recurrence assay to eliminate primary tumor formation, thereby isolating the effects of Cerk on tumor cell survival and recurrence.

Recipient mice pretreated with doxycycline were injected with control or Cerk overexpressing cells and then withdrawn from doxycycline after 48 hr, before primary tumors had formed (Figure 2.4D). Consistent with our prior results, Cerk overexpression accelerated the rate of mammary tumor recurrence and reduced the median time to recurrence from 304 days in controls to 185 days in the presence of Cerk expression (Figure 2.4E, HR = 3.64, p = 0.002).

Again, mean growth rate was not found to be different between control and Cerk overexpressing cohorts (Figure 2.4F). These results indicate that Cerk can promote mammary tumor recurrence following HER2/neu down-regulation and that this effect is unlikely to be due to Cerk-induced alterations in primary tumor formation.

Elevated CERK expression is associated with an increased risk of recurrence in women with breast cancer

A prior report suggested that elevated CERK expression is associated with poor prognosis in ER-negative breast cancer patients (190). To confirm and extend this analysis, we interrogated publicly available human breast cancer expression datasets corresponding to 2,224 patients with tumors of mixed ER status in order to evaluate the association of CERK expression with recurrence-free survival in a meta-analysis. Using a Cox proportional hazards (PH) model, we found that women with primary tumors expressing high levels of CERK exhibited an increased risk of tumor recurrence within five years of diagnosis (Figure 2.5, HR = 1.32 [1.17 –

1.49]).

40

We next asked whether CERK expression is associated with aggressive subtypes of breast cancer. Association studies revealed that CERK is expressed at higher levels in ER- negative compared to ER-positive, and PR-negative compared to PR-positive, tumors. CERK expression was also associated with HER2-positive status as assessed by immunohistochemistry

(Figure 2.6A-C). Evaluation of CERK expression as a function of molecular subtype revealed that

CERK expression is higher in the basal and ErbB2 subtypes compared to the luminal A and luminal B subtypes (Figure 2.6D). CERK expression was also associated with high tumor grade

(Figure 2.6E), but not with tumor size or lymph node status (data not shown).

Since ER-negative, PR-negative, HER2-positive, basal-like and high grade tumors are each associated with a poor prognosis, we wished to determine whether the association between CERK expression and relapse-free survival in breast cancer patients was independent of the association between CERK expression and these aggressive tumor subsets. To address this, we performed multivariate Cox proportional hazards regression in combination with meta- analyses and adjusted for each of these variables individually. In each case, we found that the association between elevated CERK expression and decreased recurrence-free survival remained significant after adjusting for ER status, PR status, HER2 status, molecular subtype or tumor grade (Figure 2.7A–E). Influence analysis performed on each significant result obtained by meta- analysis confirmed that these results were independent of any single dataset (Figure 2.8).

In aggregate, our results indicate that CERK expression in human breast cancer is associated with an increased risk of recurrence within five years, and is independent of the association between CERK expression and aggressive subtypes of human breast cancer.

41

Discussion

The importance of ceramide metabolism in cancer has become of increasing interest in recent years (53,107,197). However, relatively little functional data have emerged in describing ceramide, its metabolites and the metabolic enzymes responsible for their generation in tumorigenesis and tumor progression.

In a number of tumor cell lines, Cerk has been reported to exert cytoprotective effects in a variety of in vitro contexts, including serum starvation, TNFα signaling and UV irradiation. To date, however, no evidence has existed for a functional role for Cerk in tumor cell survival in vivo, tumor progression or tumor recurrence. Using genetically engineered mouse models, human breast cancer cell lines and expression data from breast cancer patients, we have now identified a functional role for Cerk as a regulator of tumor cell survival and breast cancer recurrence following HER2/neu down-regulation.

We found that Cerk is spontaneously up-regulated during the process of tumor recurrence in mammary tumors driven by four different oncogenic pathways. Notably, Cerk was up-regulated as early as 96 hr following oncogene down-regulation in mice bearing HER2/neu- driven mammary tumors and, consistent with this, human HER2/neu-amplified breast cancer cell lines also rapidly up-regulated Cerk following HER2/neu pathway inhibition. Indicative of a role for Cerk in the context of HER2/neu inhibition, enforced Cerk expression inhibited apoptosis.

In accord with the anti-apoptotic effects of Cerk in tumor cells following HER2/neu down-regulation, Cerk expression in orthotopic primary mammary tumor cells promoted tumor recurrence, indicating a functional role for Cerk in this stage of tumor progression. In aggregate, our findings indicate that Cerk is required for tumor cell survival following HER2/neu down-

42 regulation. Ostensibly, this may result in a larger pool of surviving residual tumor cells that can potentially give rise to recurrent tumors. These findings therefore suggest a therapeutic opportunity whereby inhibition of Cerk in concert with treatment with targeted therapies may enhance tumor cell death, reduce the reservoir of residual tumor cells, and thereby prevent tumor recurrence.

In agreement with its functional role in mammary tumor recurrence elucidated in mice,

CERK was associated with increased risk of recurrence in human breast cancer patients. CERK expression was associated with aggressive subtypes of breast cancer, including ER-negative, PR- negative, HER2-positive, high grade, and ErbB2 and basal-like tumors. However, the association between CERK and relapse-free survival was independent of its association with these aggressive subsets of tumors. As such, while CERK was previously reported to be associated with decreased recurrence-free survival in ER-negative breast cancer patients (190), our findings extend this analysis by demonstrating that CERK is associated with poor outcome in all breast cancer patients and does so independently of its association with individual aggressive prognostic factors.

In aggregate, our findings may identify Cerk as a pathway for cell survival in breast cancer cells, as well as define a subset of human breast cancers with a high likelihood of relapse.

43

Materials and Methods

Animals and Orthotopic Recurrence Assays

All animal experiments were performed in accordance with guidelines of the

Institutional Animal Care and Use Committee at the University of Pennsylvania. MTB/TAN,

MTB/TOM, MTB/TWNT;p53+/- and MTB/TAKT mice were bred and tumors were generated as previously described (45–48). Orthotopic recurrence assays and competition assays were performed as described (49,198). Athymic (nu/nu) mice were obtained from Taconic

(Germantown, NY).

Tissue Culture and Reagents

Primary MTB/TAN tumor cells were cultured as described in the presence of doxycycline

(49,198). Primary tumor cells were transduced with retrovirally-packaged mCerk cDNA.

BT474, SKBR3 and BT20 cells were purchased from ATCC. All cells were cultured at 37°C with 5% CO2. BT474 cells were cultured in RPMI 1640 medium supplemented with 10% fetal bovine serum (FBS), 1% Penicillin/Streptomycin and 1% L-glutamine. SKBR3 cells were cultured in McCoy’s 5A modified medium supplemented with 10% FBS, 1% Penicillin/Streptomycin and

1% L-glutamine. BT20 cells were cultured in EMEM medium supplemented with 10% FBS, 1%

Penicillin/Streptomycin and 1% L-glutamine.

Plasmids and RNAi

The cDNA for mCerk (MMM1013-202798251, Open Biosystems) was subcloned into the pk1 vector as described (199). Mutation of the glycine residue at position 198 of human CERK to aspartate was previously shown to generate a catalytically inactive Cerk mutant (156). After

44 confirming this residue to be conserved in mouse, we generated the G198D mutant mCerk using site-directed mutagenesis. Using the Quickchange Lightning Site-Directed Mutagenesis kit

(Agilent Technologies), we generated the primers G198D-F (forward, 5'-

CGTAGGTGGGGACGACATGTTCAGCGAGG-3') and G198D-R (reverse, 5'-

CCTCGCTGAACATGTCGTCCCCACCTACG-3'), and performed the mutagenesis reaction according to manufacturer’s instructions.

cDNA plasmids were virally packaged using Plat-E cells (Morita et al., 2000), which were transfected with retroviral constructs using Lipofectamine® 2000 (Life Technologies).

Supernatant containing viral particles was collected 48 hr post-transfection, filtered and used to infect primary tumor cell lines. Transduction was performed in the presence of 4 µg/ml polybrene (Millipore).

Antibodies

The following antibodies were used as indicated throughout the text: cleaved caspase-3

(Cell Signaling), cleaved PARP (Cell Signaling), Ki67 (Dako), β-Tubulin (Biogenex).

Immunoblotting

Protein lysates were generated by homogenizing cells in RIPA buffer (50 mM Tris pH 8.0,

150 mM NaCl, 1% NP40, 0.5% NaDOC, 0.1% SDS) supplemented with HALTTM Protease and

Phosphatase Inhibitor Cocktail (Thermo Scientific).

Secondary antibodies conjugated to IRDye 800CW (LI-COR Biosciences) were used.

Odyssey V3.0 system (LI-COR Biosciences) was used to visualize and quantify proteins of interest. Quantification was performed using ImageStudio software (LI-COR Biosciences).

45

Immunofluorescence and Microscopy

For immunofluorescence studies of tumor tissue from the competition assay, tumors were snap-frozen in OCT (TissueTek) and cut into 8 µm frozen sections. Sections were fixed in

4% PFA for 10 min then stained with Hoechst 33258 (Sigma). For cleaved caspase-3 staining, tumors were fixed in 4% PFA in PBS overnight then embedded in paraffin. Sections were prepared using a standard xylene-based de-waxing procedure, then subjected to antigen retrieval and stained with appropriate primary and secondary antibodies.

For cell culture experiments, cells were seeded on 4-chamber slides, fixed in 4% PFA for

10 min then permeabilized with 0.5% Triton in PBS for 20 min. Slides were then stained with corresponding primary and secondary antibodies. Fluorescence and immunofluorescence microscopy were performed on a DM 5000B Automated Upright Microscope (Leica). Images were captured with a DFC350 FX monochrome digital camera (Leica).

RNA Isolation and Quantitative RT-PCR

RNA was isolated from tumors using Trizol (Invitrogen) followed by RNeasy® RNA Mini

Kit (Qiagen). RNA was isolated from cells using the RNeasy® RNA Mini Kit (Qiagen). Reverse transcription was performed using the High-Capacity cDNA Reverse Transcription kit (Applied

Biosystems) according to manufacturer’s instructions. qPCR was performed on the ViiaTM 7 Real-

Time PCR System (Life Technologies) using 6-carboxyfluorescein-labeled Taqman probes for mCerk, hCerk, mTBP and hTBP (Applied Biosystems). Relative expression levels were calculated using the comparative CT method.

46

Statistical Analyses

Unpaired Student’s t-tests were utilized to analyze normally distributed data. Mann-

Whitney U tests were used when data were not normally distributed. Two-way ANOVAs were used to compare paired data. Log-rank tests were used to analyze survival curves. p-values <

0.05 were considered statistically significant. Hazard ratios with 95% confidence intervals were calculated for all survival curves.

Human Breast Cancer Microarray Data Analysis

We obtained publicly available microarray data and the corresponding clinical annotations from 14 data sets encompassing 2,224 breast cancer patients (200–213).

Normalized data were downloaded from NCBI GEO or original authors’ websites. Microarray data were converted to base-2 log scale where necessary. Affymetrix microarray data were re- normalized using Robust Multi-array Average when .CEL files were available.

Association between Cerk mRNA expression and 5-year relapse-free survival was estimated using meta-analysis of univariate Cox proportional hazards regression as previously described (198). Meta-analyses were performed in subsets of patients stratified by ER status, PR status, HER2 status, molecular subtype and tumor grade as described (198). Influence analyses were performed on all significant findings derived by meta-analysis to determine whether the significant result was independent of any single dataset.

The association between Cerk mRNA expression and known prognostic factors of human breast cancer such as ER status, PR status, HER2 status, lymph node status, tumor size, tumor grade and molecular subtype was assessed by ANOVA in pooled microarray datasets as previously described (198).

47

For each prognostic factor significantly associated with Cerk mRNA expression, we re- assessed the association between Cerk mRNA expression and relapse-free survival after adjusting for the prognostic factor in a multivariate Cox proportional hazards model. The adjusted hazard ratios and confidence intervals for Cerk mRNA expression were aggregated across multiple data sets and assigned an overall significance using meta-analysis as described above.

48

Figure 2.1: Cerk is spontaneously up-regulated in recurrent mammary tumors and following acute HER2/neu inhibition

49

(A) qRT-PCR analysis of Cerk mRNA expression in primary and recurrent HER2/neu, c-MYC, Wnt1, and Akt1-driven tumors. (B) qRT-PCR analysis of Cerk mRNA expression from MTB/TAN tumors at primary, 48 hr deinduced, 96 hr deinduced, and recurrent time points. (C) qRT-PCR analysis of

Cerk mRNA expression in primary MTB/TAN tumor cell line in vitro removed from doxycycline 1,

2, 4 or 6 days. (D) qRT-PCR analysis of CERK mRNA expression in BT474 cells and (E) SKBR3 cells treated with 100 nM lapatinib or DMSO for 1, 2 or 3 days. qRT-PCR analysis of CERK mRNA expression in (F) BT20 cells and (G) primary MTB/TAN cells treated with 10 µM adriamycin or vehicle for 4, 8, 16 or 24 hr. *p<0.05, **p<0.01, ***p<0.001.

50

Figure 2.2. Cerk protects cells from apoptosis upon HER2/neu down-regulation in vitro

(A) Representative fluorescence images and (B) quantification of MTB/TAN primary tumor cell lines expressing empty vector, Cerk or G198D-Cerk withdrawn from doxycycline 72 hr then stained for cleaved caspase-3 (red; Hoechst = blue). (C) Quantification of MTB/TAN primary tumor cell lines expressing empty vector, Cerk or G198D-Cerk withdrawn from doxycycline 72 hr then stained for Ki67. (D) Western blot of MTB/TAN primary tumor cell lines expressing empty vector, Cerk or G198D-Cerk withdrawn from doxycycline 48 hr, blotted for cleaved PARP, quantified in (E), and cleaved caspase-3, quantified in (F). *p<0.05, **p<0.01, ***p<0.001.

51

Figure 2.3. Cerk promotes tumor cell survival in vivo following HER2/neu down-regulation

(A) Quantification of cleaved caspase-3 staining in primary orthotopic empty vector, Cerk and

G198D-Cerk tumors at 48 and 96 hr post-deinduction. (B) Representative fluorescence images of primary tumors, 48 hr and 96 hr deinduced tumors stained for cleaved caspase-3 (red; Hoechst

= blue). *p<0.05, **p<0.01, ***p<0.001.

52

Figure 2.4. Cerk promotes tumor recurrence in the MTB/TAN model.

(A) Schematic of recurrence assay and timing of doxycycline treatment. (B) Recurrence-free survival of nude mice harboring primary orthotopic tumors from MTB/TAN primary cell lines expressing empty vector or overexpression Cerk induced to regress by doxycycline withdrawal.

(C) Mean growth rate of control and Cerk overexpressing recurrent tumors. (D) Schematic of 53 modified recurrence assay with no primary tumor formation. (E) Recurrence-free survival of nude mice harboring MTB/TAN primary cell lines expressing empty vector or overexpressing

Cerk withdrawn from doxycycline 48 hr post-injection. (F) Mean growth rate of control and Cerk overexpressing recurrent tumors.

54

Figure 2.5. High CERK expression predicts decreased relapse-free survival in women with breast cancer

Forest plot representation of 5-year survival estimates and hazard ratios for relapse-free survival of individual datasets of human breast cancer patients.

55

Figure 2.6. CERK expression in human breast cancer subsets

Association between CERK mRNA expression and (A) ER status, (B) PR status, (C) HER2 status, (D) molecular subtype and (E) tumor grade in pooled datasets of human breast cancer patients.

Each variable was analyzed by ANOVA.

56

Figure 2.7. Multivariate analysis of the association of CERK expression and relapse-free survival after adjusting for subsets

57

Forest plot representation of 5-year survival estimates and hazard ratios after adjusting for the impact of: (A) ER status, (B) PR status, (C) HER2 status, (D) molecular subtype and (E) tumor grade. Multivariate analysis was performed to assess the hazard ratio (HR) in individual datasets.

Overall p-value and HR were calculated by meta-analysis.

58

Figure 2.8. Influence analysis

Influence analyses were performed on all significant p-values derived by meta-analysis to determine whether the significant result was independent of any single dataset.

59

CHAPTER 3: Loss-of-Function Cerk Experiments

Introduction

In Chapter 2, we provided evidence that Cerk protects tumor cells from apoptosis upon oncogene down-regulation and promotes mammary tumor recurrence. Cerk overexpression inhibited apoptosis in MTB/TAN primary tumor cell lines in vitro and in orthotopic tumors in vivo following HER2/neu down-regulation as indicated by decreases in cleaved caspase-3. This was demonstrated to be dependent on Cerk’s kinase activity, as the kinase dead mutant G198D-Cerk did not protect cells or tumors from apoptosis. Furthermore, Cerk overexpression markedly accelerated tumor recurrence in an orthotopic model, illustrating its functional role in tumor progression.

Having shown the relevance of Cerk in tumor cell survival and in mammary tumor progression by gain-of-function experiments, loss-of-function experiments are crucial to determine whether inhibition of Cerk would have therapeutic potential. Genetic experiments knocking down Cerk are specific relative to pharmacological agents and important in determining the effect of loss of Cerk. Also, two small molecule inhibitors of Cerk have been developed, NVP-231 (186) and K1 (187,188), described in detail in Chapter 1. However, they have not been thoroughly tested in vitro and have not been characterized at all in vivo, the reason for which appears to be low bioavailability for NVP-231. In vivo studies with K1 have not been published to date. Inhibitors with better pharmacokinetic profiles will likely need to be developed in order to have potential use in vivo and in the clinic.

Mice lacking both alleles of Cerk are phenotypically normal, except for neutropenia induced by apoptosis in granulocytes, which is associated with increased ceramide levels (167).

Tumor forming ability has not been assessed in these mice, however, endothelial cells derived

60 from Cerk-/- mice display a VEGF-independent defect in angiogenesis (214). Cerk-/- mice have yet to be tested in conjunction with oncogene-driven cancer models. This would provide very specific answers as to the role of Cerk in tumorigenesis and tumor progression. For example, crossing Cerk-/- mice with MMTV-rtTA;TetO-HER2/neu, MMTV-rtTA;TetO-MYC, MMTV- rtTA;TetO-Wnt1;p53+/-, and MMTV-rtTA;TetO-Akt1 transgenic mice would provide evidence for the role of Cerk in tumorigenesis driven by specific oncogenes. Very few shRNA knockdown experiments have been performed with Cerk, although some insight has been obtained from

Cerk-/- cells and treatment with NVP-231 or K1 in vitro (186,187,214).

Whether inhibition of Cerk with small molecules will be a successful approach in the context of cancer remains to be elucidated. Some studies suggest that inhibition of Cerk activity may not be sufficient to cause cell cycle arrest or death, but may sensitize cells to cytotoxic agents (186), providing insight into potential for combination therapy.

In this chapter, we attempt to elucidate the effect of loss-of-function of Cerk and its effect on tumor cell survival and mammary tumor recurrence. First, we generated Cerk knockdown MTB/TAN primary tumor cell lines and tested them for sensitivity to apoptosis in the context of HER2/neu down-regulation. We then tested these cell lines in vivo in orthotopic recurrence assays and orthotopic cellular competition assays. Due to difficulty maintaining shRNA knockdown of Cerk in in vivo experiments, we describe an attempt to characterize and troubleshoot a conditional shRNA expression system in vitro and in vivo.

We obtained the Cerk inhibitor NVP-231 from Novartis to conduct pharmacological studies on human breast cancer cell lines to determine whether inhibition of Cerk would sensitize cells to apoptosis. These studies demonstrated that only at very high doses does NVP-

231 synergize with lapatinib to provide high levels of caspase activity indicating apoptosis. This is

61 unlikely to be attributable solely to Cerk inhibition as the doses of inhibitor used were in the millimolar range. To test the potential synergistic effect of Cerk inhibition with EGFR and

HER2/neu inhibition by lapatinib genetically, we knocked down CERK in BT474 cells treated with lapatinib.

Lastly, having demonstrated a role for Cerk in cell survival acutely following HER2/neu down-regulation, we wished to address the question of whether Cerk has a role in actively proliferating primary and/or recurrent MTB/TAN tumor cell lines in an orthotopic setting in vivo.

We knocked down Cerk in one primary and two recurrent MTB/TAN tumor cell lines and evaluated tumor growth in vivo. The results from these experiments leave many questions that must be addressed to fully characterize Cerk’s potential as a drug target in cancer.

In aggregate, our findings about the difficulty in maintaining Cerk knockdown in orthotopic recurrence assays in vivo may indicate a strong dependence of tumor cell lines on

Cerk signaling, which in turn may indicate that Cerk has potential as a drug target in cancer cells.

62

Results

Cerk knockdown sensitizes tumor cells to apoptosis in vitro following HER2/neu down- regulation

A previous report demonstrated that siRNA targeting Cerk sensitized A549 lung adenocarcinoma cells to apoptosis following serum deprivation (178). To determine whether loss of function of Cerk would sensitize cells to apoptosis following HER2/neu down-regulation, we withdrew doxycycline from the culture media of primary MTB/TAN tumor cells expressing either of two Cerk shRNAs, a scrambled control shRNA or an empty vector control. Cells were then stained for cleaved caspase-3 and Ki67. Cerk knockdown cells exhibited markedly increased staining for cleaved caspase-3 compared to control cells following doxycycline withdrawal

(Figure 3.1A, B). Proliferation rates fell dramatically upon HER2/neu down-regulation, but were not significantly different between control and Cerk knockdown cells (Figure 3.1C). These findings suggest that Cerk is required for the suppression of apoptosis following HER2/neu down-regulation. Similarly, by Western blot, Cerk knockdown cell lines exhibited significantly higher levels of cleaved PARP and cleaved caspase-3 than controls following doxycycline withdrawal (Figure 3.1D-I).

Cerk is required for tumor cell survival following HER2/neu down-regulation in vivo

To expand our in vitro findings that Cerk protects tumor cells from apoptosis upon

HER2/neu pathway inhibition, we sought to test this in vivo. To determine whether Cerk is required for the survival of tumor cells following acute HER2/neu down-regulation, we performed an orthotopic fluorescent cell competition assay using an isogenic pair of doxycycline-dependent MTB/TAN tumor cell lines that differed only in Cerk expression.

63

MTB/TAN primary tumor cells expressing one of two shRNAs targeting Cerk were labeled with an H2B-eGFP reporter, whereas MTB/TAN cells transduced with a control vector were labeled with an H2B-mCherry reporter (Figure 3.2A). These two fluorescent populations of cells were injected into the mammary glands of nu/nu mice at a 1:1 ratio and allowed to form orthotopic primary tumors in the presence of doxycycline and HER2/neu expression. Doxycycline was then withdrawn to initiate tumor regression and the ratio of eGFP-labeled Cerk knockdown cells to mCherry-labeled control cells was determined in primary tumors, residual tumor cells 96 hr following HER2/neu down-regulation, and residual tumor cells 28 days following HER2/neu down-regulation by fluorescence microscopy performed on histological sections (Figure 3.1B).

Cerk shRNA-expressing cells were neither selected for nor against during the outgrowth of primary orthotopic tumors (Figure 3.1C, D, F), indicating that Cerk knockdown does not confer a selective advantage or disadvantage during primary tumorigenesis in the presence of

HER2/neu expression. In contrast, eGFP-labeled Cerk knockdown cells were strongly selected against within 96 hr following doxycycline withdrawal and HER2/neu down-regulation, as these cells comprised only 20-25% of the fluorescent tumor cells at this time point (Figure 3.1C, D, F).

By 28 days following doxycycline withdrawal, Cerk knockdown cells comprised only 14-20% of fluorescent cells, indicating modest further negative selection against Cerk knockdown cells

(Figure 3.1C, D, F). Tumors containing control mCherry-labeled cells and control eGFP-labeled cells maintained an approximately 1:1 ratio throughout tumor progression through all these time points (Figure 3.1E). These findings indicate that cells in which Cerk has been knocked down are rapidly and persistently selected against following HER2/neu down-regulation, but not in actively growing primary tumor cells expressing HER2/neu.

64

Cerk knockdown recurrence assays

Having observed strong selection against cells containing Cerk shRNAs in the context of an orthotopic cellular competition assay, we sought to determine whether Cerk knockdown would delay tumor recurrence. To determine whether Cerk is required for tumor recurrence, we injected primary MTB/TAN tumor cells expressing either of two Cerk shRNAs, a scrambled control shRNA or an empty vector control into the mammary fat pads of nu/nu mice maintained on doxycycline. Analogous to experiments detailed in Figure 2.4A, following primary tumor formation, mice were withdrawn from doxycycline to induce oncogene down-regulation and tumor regression, then monitored for tumor recurrence.

Unexpectedly, although enforced expression of Cerk markedly accelerated tumor recurrence (Figure 2.4B, E), Cerk knockdown cohorts did not display delayed tumor recurrence as median time to recurrence did not differ significantly between any of the cohorts (Figure

3.3A). To investigate why Cerk knockdown did not alter the kinetics of recurrence, we harvested primary tumors from these animals, extracted RNA and performed qRT-PCR to quantify Cerk expression. Despite having seen greater than 65% knockdown in cell lines in vitro prior to injection (Figure 3.2A), we did not observe any measurable knockdown in primary tumors generated in mice injected with Cerk knockdown cells (Figure 3.3B). This may explain why no effect was observed on latency to tumor recurrence. This suggests that Cerk knockdown may not be compatible with tumor growth and must be circumvented for tumors to form.

In an attempt to isolate the effects of Cerk knockdown on tumor recurrence and avoid the loss of knockdown occurring during the process of primary tumor formation, we used a modified recurrence assay described in Figure 2.4D. Recipient mice pretreated with doxycycline were injected with cells expressing either of two Cerk shRNAs, a scrambled control shRNA or an

65 empty vector control and then withdrawn from doxycycline after 48 hr, before primary tumors had formed.

Despite the modification of the recurrence assay to eliminate the potentially confounding effects of primary tumor formation, we observed no effect on recurrence-free survival between Cerk knockdown and control cohorts (Figure 3.3C). qRT-PCR analysis of recurrent tumors from these animals showed no detectable Cerk knockdown (Figure 3.3D), consistent with the loss of knockdown seen in the primary tumors of the original recurrence assay (Figure 3.3B). This indicated that Cerk knockdown is not be sustained throughout tumor recurrence, potentially due to selection against cells with high Cerk knockdown, to Cerk upregulation, or to shRNA silencing. Therefore, to address whether Cerk was required for tumor recurrence, a different approach became necessary.

FLIPi conditional shRNA expression system

We turned to the FLIPi conditional expression system developed by the laboratory of

Richard Hynes (215). This system allows for Cre-regulated expression of shRNAs, with a GFP reporter prior to recombination and an mCherry reporter following recombination. We hoped this system would permit controlled expression of shRNAs targeting Cerk at specific timepoints throughout tumor progression, circumventing the loss of knockdown seen with a constitutive shRNA expression system.

We first sought to confirm the ability of this vector to undergo Cre-mediated recombination in vitro. As we received the FLIPi vector with a p53 shRNA (FLIPi-shp53), we utilized this form of the vector for testing and transduced it into our primary MTB/TAN cell line.

Treatment with adenoviral (adeno)-Cre led to efficient recombination, as monitored by

66 transition from GFP expression to mCherry expression and p53 knockdown detectable by qRT-

PCR (data not shown; performed by Lauren Pferdehirt).

To address the requirement for Cerk in tumor recurrence in vivo, this system required adaptation, as no route of administration was known to efficiently deliver adeno-Cre to all cells in a solid mammary tumor. Instead, a tamoxifen-inducible Cre-expressing MTB/TAN mouse cell line would allow recipient mice to be treated with tumor-permeable tamoxifen by oral gavage in order to induce recombination. To that end, we crossed bitransgenic MTB/TAN mice with Ubc-

CreERT2 mice to generate triple-transgenic MTB/TAN;Ubc-CreERT2 offspring. At six weeks of age, female MTB/TAN;Ubc-CreERT2 mice were administered doxycycline through drinking water to induce tumor formation. Once tumors had formed, the animals were sacrificed, their tumors excised, minced, then digested with collagenase, hyaluronidase, and trypsin. Tumor cells were plated in culture to generate stable cell lines. Despite many attempts, only one stable cell line was generated that was capable of continued passaging in vitro.

Testing of FLIPi in MTB/TAN;Ubc-CreERT2 cell line in vitro

MTB/TAN;Ubc-CreERT2 cells were transduced with the FLIPi-shp53 vector for testing of recombination following tamoxifen treatment. Cells were selected with puromycin for one week prior to testing. Puromycin was removed from the culture media prior to recombination testing, as the puromycin resistance cassette is excised upon recombination (215). As tamoxifen is a pro- drug that becomes hydroxylated by CYP450 enzymes in vivo, we utilized 4-OH-tamoxifen for in vitro testing (216). Cells were treated with 100, 150, 200, 250 or 300 nM 4-OH-tamoxifen for 24 or 48 hr. The majority of untreated cells were GFP-positive and exhibited very rare spontaneous recombination, monitored by mCherry expression, even when cultured in the absence of

67 puromycin for several passages (Figure 3.4A). Following 24 hr treatment with any dose of 4-OH- tamoxifen, most cells still expressed GFP but also expressed mCherry (Figure 3.4A). By 48 hr treatment, most cells expressed detectable mCherry and GFP expression was significantly decreased (Figure 3.4B). GFP expression was no longer detectable at 96 hr at any dose of treatment (data not shown). These results confirmed that this system is capable of tightly controlled recombination induced by 4-OH-tamoxifen in vitro.

Characterizing MTB/TAN;Ubc-CreERT2 cell line in vivo

To test whether the MTB/TAN;Ubc-CreERT2 cell line could be used in vivo for orthotopic recurrence assays, we sought to characterize its tumor forming ability, tumor morphology, dependence on doxycycline, and ability to recur following oncogene-downregulation. We injected the parental MTB/TAN;Ubc-CreERT2 cell line into the mammary fat pads of nu/nu mice maintained on doxycycline. Following primary tumor formation, one cohort was sacrificed for harvest of primary tumors. The remaining animals were withdrawn from doxycycline to induce oncogene down-regulation and tumor regression. All tumors regressed to a non-palpable state.

Mice were then monitored for tumor recurrence.

Primary tumors exhibited a highly epithelial morphology (Figure 3.4C), with structures mirroring the intact tumor from which this cell line originated. All animals withdrawn from doxycycline displayed stochastic mammary recurrence with a median of 246 days. This confirms that this MTB/TAN;Ubc-CreERT2 cell line is capable of primary tumor formation, is dependent on doxycycline, forms epithelial tumors, and exhibits a highly penetrant recurrence phenotype.

68

Testing of FLIPi recombination in MTB/TAN;Ubc-CreERT2 cell line in vivo

Having established the MTB/TAN;Ubc-CreERT2 cell line’s suitability for orthotopic recurrence assays, we wished to determine whether the FLIPi vector could be recombined efficiently in this cell line in vivo. We injected MTB/TAN;Ubc-CreERT2 cells transduced with FLIPi- shp53 into the mammary fat pads of nu/nu mice maintained on doxycycline. Primary tumors of

5 x 5 mm were allowed to form, animals were then treated with vehicle for 1, 3, or 5 days, treated with tamoxifen 1, 3, or 5 days by oral gavage, or sacrificed. All treated animals were sacrificed 72 hr after the final treatment to provide time for degradation of GFP and expression of detectable levels of mCherry.

Tumors from untreated and vehicle treated animals were 100% GFP-positive at all timepoints, with no detectable mCherry expression, indicating an absence of spontaneous recombination (Figure 3.5A). Tumors from tamoxifen-treated animals underwent efficient recombination at all timepoints, exhibiting strong mCherry expression (Figure 3.5B, C, D).

Residual GFP expression was detectable in tumors treated for one day (Figure 3.5B), but not in tumors treated for 3 or 5 d. Therefore, the 3 d treatment course was chosen for further experiments.

Recurrence assays with MTB/TAN;Ubc-CreERT2 cell line

Having identified an optimal treatment course for efficient recombination in vivo, we sought to answer the question of whether Cerk is required for tumor recurrence. We set out to test whether Cerk shRNA expression using this conditional system would have an effect on latency of recurrence. We cloned two Cerk-targeting shRNAs as well as our scrambled control, previously tested in the MLP vector, into the FLIPi vector. We also generated an empty vector by

69 blunt-end ligation. These constructs were transduced into the MTB/TAN;Ubc-CreERT2 cell line, then injected into the mammary fat pads of nu/nu mice maintained on doxycycline. Primary tumors were allowed to form, then animals were treated by oral gavage for three consecutive days with tamoxifen or vehicle. Mice were either sacrificed or removed from doxycycline on the fourth day. All tumors regressed to a non-palpable state, regardless of Cerk knockdown status or treatment regimen. Another cohort was sacrificed 96 hr post-deinduction. The remaining animals were monitored for tumor recurrence.

Despite tightly-regulated and efficient recombination assessed by GFP or mCherry fluorescence at sacrifice, the presence of Cerk shRNAs did not affect recurrence-free survival in these animals. Median time to recurrence was not significantly altered in any of the cohorts, whether treated with tamoxifen (Figure 3.6A) or with vehicle (Figure 3.6B). qRT-PCR analysis revealed that Cerk expression in tumors arising from Cerk shRNA, scrambled or vector control cells was not significantly different at any timepoint, and was not altered by treatment with tamoxifen over vehicle (Figure 3.6C).

Troubleshooting FLIPi shRNA expression in vitro

Having observed no effect of FLIPi-shCerk recombination on tumor recurrence in the orthotopic recurrence assay and no detectable Cerk knockdown in vivo at any timepoint, we sought to determine whether Cerk was being effectively knocked down in this system in vitro.

Upon recombination, the FLIPi vector produces a single transcript with the mCherry reporter followed by the shRNA. The transcript is then spliced at sites flanking the shRNA. Therefore, as a surrogate for Cerk shRNA expression, we interrogated GFP and mCherry expression levels in

MTB/TAN;Ubc-CreERT2 cell lines with Cerk shRNAs compared to an empty vector control before

70 and after 4-OH-tamoxifen treatment. In a different context, we had observed a bimodal distribution of cells expressing low and high levels of fluorophores (data not shown, performed by James Alvarez), which was hypothesized to correlate with levels of shRNA expression, which may in turn lead to reduced knockdown detected globally. If true, this could provide an avenue to allow us to sort for high levels of fluorophore expression to obtain higher levels of shRNA expression and therefore better shRNA-mediated knockdown of Cerk. However, we did not observe a bimodal distribution of fluorophore expression either before or after treatment with

4-OH-tamoxifen in vitro (Figure 3.7A), indicating that sorting out low-expressing cells is likely not a solution to obtain better shRNA-mediated knockdown of Cerk.

As another method to potentially obtain better knockdown of Cerk with this system, we transduced cells twice with the same vector. MTB/TAN;Ubc-CreERT2 cells were transduced with each construct, selected with puromycin 72 hr post-transduction, grown for one week in the presence of puromycin, then transduced again with the same construct. Total RNA was extracted and qRT-PCR for Cerk expression was performed on cell lines following a single or double infection. Cerk expression was compared to that of MTB/TAN cell lines expressing one of two Cerk shRNAs, a scrambled hairpin or an empty vector control (MLPHG). Considerably less knockdown was obtained with the same shRNAs targeting Cerk in FLIPi in MTB/TAN;Ubc-CreERT2 cell lines compared with MLPHG in MTB/TAN cells (Figure 3.7B). This does not explicitly address whether this is the result of the cell line or the expression system. Double infection with FLIPi vectors did not improve Cerk knockdown (Figure 3.7B).

To directly interrogate levels of shRNA expression, we designed miRNA primer-probe sets against both Cerk-directed shRNAs to quantify expression of the shRNAs themselves. The total RNA extracted from singly and doubly infected MTB/TAN;Ubc-CreERT2 cell lines was utilized

71 for miRNA targeted RT and qPCR. Markedly lower levels of shRNA were expressed in FLIPi in

MTB/TAN;Ubc-CreERT2 cell lines than in MLPHG in MTB/TAN cell lines (Figure 3.7C, D). Double infection appeared to moderately increase expression of Cerk shRNAs (Figure 3.7C, D), although this did not lead to improved knockdown (Figure 3.7B). These results indicate that insufficient shRNA expression may be the cause for undetectable levels of Cerk knockdown leading to undetectable effects on tumor recurrence in the orthotopic setting. This system will have to be optimized or altered to efficiently knock down Cerk and interrogate its role in tumor recurrence.

High dose NVP-231 treatment may synergize with lapatinib in HER2/neu–amplified human breast cancer cells

To employ pharmacological methods to inhibit Cerk, we obtained the Cerk inhibitor

NVP-231 (Novartis) in order to assess whether pharmacological inhibition of Cerk would sensitize human breast cancer cell lines to apoptosis. We treated BT474 and SKBR3 cells with

100 nM lapatinib or vehicle for 16, 24, or 48 hr along with increasing doses of NVP-231 from 100 nM to 3 µM and assessed apoptosis with the Caspase Glo® 3/7 Assay System (Promega). At these points, 100 nM lapatinib did not lead to increases in luminescence, indicating that it did not induce caspase-3 and caspase-7 cleavage (Figure 3.8A-F). NVP-231 alone did not lead to significant increases in luminescence at any dose below 1 µM, and exhibited potentially synergistic effects with lapatinib at 3 µM, particularly in BT474 cells at 16 hr and in SKBR3 cells at 48 hr (Figure 3.8A, F).

These studies seem to indicate that only at high doses of NVP-231 does it synergize with lapatinib to induce apoptosis, making it unlikely to be attributable solely to Cerk inhibition.

72

Further examination of pharmacological inhibition of Cerk, possibly with other agents, will be necessary to determine whether it is responsible for this effect.

Cerk may not be required for actively proliferating primary and recurrent tumors

We wanted to address the question of whether Cerk has a role in actively proliferating primary and/or recurrent MTB/TAN tumor cell lines in an orthotopic setting in vivo. We injected one primary and two recurrent MTB/TAN tumor cells expressing either of two Cerk shRNAs, a scrambled control shRNA or an empty vector control (Figure 3.9A) into the mammary fat pads of nu/nu mice maintained on doxycycline.

Cerk knockdown in primary and recurrent cell lines did not alter growth kinetics as measured by tumor volume over time (Figure 3.9B, D, F) or as mean growth rate (Figure 3.9C, E,

G). This may indicate that Cerk is not required for actively proliferating primary or recurrent tumors. However, this cannot distinguish between the possibility that Cerk knockdown may have been selected against or otherwise lost in early stages of tumor growth, precluding the appearance of a difference in tumor growth rate. This possibility cannot be eliminated as the tumors were not tested for Cerk expression. Future studies will have to address this caveat.

73

Discussion

The inhibition of ceramide metabolic pathways is under investigation in many cancers and holds promise in clinical trials in combination with chemotherapy. Agents targeting glucosylceramide synthase (GCS) and sphingosine kinase (SphK) have been tested in clinical trials and hold promise as combination therapies in many cancers. Although Cerk has been shown to regulate cell survival in the context of many stresses including chemotherapy, radiotherapy and targeted therapy, the development and characterization of Cerk inhibitors is lagging behind that of other enzymes involved in ceramide metabolism. Only two small molecule inhibitors of Cerk have been identified to date. NVP-231 cannot be used in vivo due to poor pharmacokinetics (186), while K1 has never been tested in animals. Much work remains to be done to determine whether Cerk could be a successful drug target in human cancer patients.

We found that Cerk knockdown sensitizes tumor cells to apoptosis upon doxycycline withdrawal and HER2/neu down-regulation in vitro. Furthermore, tumor cells in which Cerk had been knocked down were strongly selected against within 96 hr following HER2/neu down- regulation, with further selection continuing into the dormant phase of tumor regression at 28 days post-deinduction. Of note, we did not observe a selective effect against Cerk knockdown cells in the primary tumor of the orthotopic competition assay, indicating that Cerk expression in actively proliferating HER2/neu-driven tumor cells may not be rate limiting. This may also indicate that a non-cell autonomous mechanism may be at play.

Based on published findings, we hypothesize that the paracrine secretion of PGE2 may be responsible for maintaining Cerk knockdown cells in primary tumors in the competition assay setting. Synthesis of C1P by Cerk is required for activation of cPLA2, which in turn releases arachidonic acid from membrane phospholipids for the synthesis of eicosanoids including

74 prostaglandins such as PGE2. PGE2 and other prostaglandins are then secreted and in an autocrine and paracrine manner bind to and activate PGE2 G-protein coupled receptors, leading to mitogenic signaling (Figure 1.2). This may allow Cerk knockdown cells to persist in primary tumors in a setting where Cerk knockdown is usually lost (Figure 3.3B). This suggests that cell- autonomous mechanisms become important upon HER2/neu down-regulation, as Cerk knockdown cells were selected against very strongly within 96 hr despite the presence of control cells.

The most abundant prostanoid in mammary tumors is PGE2, and high levels are associated with poor prognosis (217). PGE2 is known to promote inflammation and be pro- tumorigenic (218). The role of chronic inflammation in tumorigenesis is well-established, and treatment with non-steroidal anti-inflammatory agents (NSAIDs) has been demonstrated to hold promise as a chemopreventive approach to some human cancers, including the four most prevalent cancers: breast, colon, lung and prostate (219–221). Cell-autonomous effects of prostanoids, especially PGE2, have been implicated in the activation of pro-tumorigenic signaling pathways, as exemplified by the stimulation of the Ras/Raf/MAP kinase and GSK3β – β catenin pathways downstream of the EP (PGE2) receptors (222). Also, effects of prostanoids on the mammary microenvironment, including stimulation of aromatase production in stromal fat cells, have been shown to stimulate tumor cell proliferation (223). Lastly, secreted prostanoids may have chemotactic functions for infiltrating neutrophils and macrophages that may have immune suppressive functions in situ (224,225). As such, the potential involvement of Cerk and C1P in eicosanoid-associated tumorigenesis would have important implications for the possible use of anti-inflammatory drugs in chemoprevention.

75

This also suggests that rate-limiting pathways regulating tumor cell growth and survival may differ depending upon the stage of tumor progression. As such, pharmacological agents that may be effective in treating primary breast cancers may have little effect in women with minimal residual disease or recurrent breast cancer. As such, the identification of pharmacological targets unique to these stages of tumor progression will be essential for improving long-term survival in this disease. Consequently, the inhibition of pathways that allow cells to survive therapy and eventually recur may be key to preventing the persistence of disseminated tumor cells and subsequence relapse.

Although we were not able to demonstrate a requirement for Cerk in tumor recurrence in orthotopic tumor recurrence assays, future experiments delineated in Chapter 4 are expected to specifically address this question. This will help conclusively identify whether inhibition of

Cerk is likely to be a successful target for therapy in the context of cancer, specifically those cancers refractory to chemotherapy or targeted therapy, in which Cerk inhibitors could be used in combination therapy regimens.

76

Materials and Methods

Animals and Orthotopic Recurrence Assays

All animal experiments were performed in accordance with guidelines of the

Institutional Animal Care and Use Committee at the University of Pennsylvania. Orthotopic recurrence assays and competition assays were performed as described (49,198). Athymic

(nu/nu) mice were obtained from Taconic (Germantown, NY). Mice treated with tamoxifen received 225 mg/kg tamoxifen by oral gavage for 1, 3 or 5 consecutive days.

Tissue Culture and Reagents

Primary MTB/TAN tumor cells were cultured as described in the presence of doxycycline

(49,198). Primary tumor cells were transduced with retrovirally-packaged shRNAs targeting mCerk.

Caspase-Glo and CellTiter-Glo Assays

Viable cell number was measured using the CellTiter-Glo® Luminescent Cell Viability

Assay (Promega) and used to normalize caspase activity values measured with Caspase-Glo® 3/7

Assay System (Promega). Briefly, cells grown in 96-well white-bottom plates were treated with a

1:1 mixture of Caspase-Glo or CellTiter-Glo reagent and PBS (50μl per well), and gently shaken protected from light for 30 min at RT. Luminescence was measured using a GloMax 96-

Microplate Luminometer (Promega) with an integration time of 0.5 s. Experiments were performed in triplicate.

77

Plasmids and RNAi

shRNAs targeting mCerk were designed using RNAi Central

(http://katahdin.cshl.org/siRNA/RNAi.cgi?type=shRNA) and purchased from Open Biosystems.

The following sequences were used: shCerk1 TGCTGTTGACAGTGAGCGCGCACTTGCTGGTATTCAT

CAATAGTGAAGCCACAGATGTATTGATGAATACCAGCAAGTGCTTGCCTACTGCCTCGGA; shCerk2

TGCTGTTGACAGTGAGCGAAGATTGTGTGTGTTACTCAACTAGTGAAGCCACAGATGTAGTTGAGTAACA

CACACAATCTG TGCCTACTGCCTCGGA. Oligonucleotides were cloned into the LMP vector (Open

Biosystems), modified to express H2B-eGFP (referred to as MLPHG in the text) or H2B-mCherry as described (199).

shRNA plasmids were virally packaged using Plat-E cells (Morita et al., 2000), which were transfected with retroviral constructs using Lipofectamine® 2000 (Life Technologies).

Supernatant containing viral particles was collected 48 hr post-transfection, filtered and used to infect primary tumor cell lines. Transduction was performed in the presence of 4 µg/ml polybrene (Millipore).

Antibodies

The following antibodies were used as indicated throughout the text: cleaved caspase-3

(Cell Signaling), cleaved PARP (Cell Signaling), Ki67 (Dako), β-Tubulin (Biogenex).

Immunoblotting

Protein lysates were generated by homogenizing cells in RIPA buffer (50 mM Tris pH 8.0,

150 mM NaCl, 1% NP40, 0.5% NaDOC, 0.1% SDS) supplemented with HALTTM Protease and

Phosphatase Inhibitor Cocktail (Thermo Scientific).

78

Secondary antibodies conjugated to IRDye 800CW (LI-COR Biosciences) were used.

Odyssey V3.0 system (LI-COR Biosciences) was used to visualize and quantify proteins of interest. Quantification was performed using ImageStudio software (LI-COR Biosciences).

Immunofluorescence and Microscopy

For immunofluorescence studies of tumor tissue from the competition assay, tumors were snap-frozen in OCT (TissueTek) and cut into 8 µm frozen sections. Sections were fixed in

4% PFA for 10 min then stained with Hoechst 33258 (Sigma).

For cell culture experiments, cells were seeded on 4-chamber slides, fixed in 4% PFA for

10 min then permeabilized with 0.5% Triton in PBS for 20 min. Slides were then stained with corresponding primary and secondary antibodies. Fluorescence and immunofluorescence microscopy were performed on a DM 5000B Automated Upright Microscope (Leica). Images were captured with a DFC350 FX monochrome digital camera (Leica).

RNA Isolation and Quantitative RT-PCR

RNA was isolated from tumors using Trizol (Invitrogen) followed by RNeasy® RNA Mini

Kit (Qiagen). RNA was isolated from cells using the RNeasy® RNA Mini Kit (Qiagen). Reverse transcription was performed using the High-Capacity cDNA Reverse Transcription kit (Applied

Biosystems) according to manufacturer’s instructions. qPCR was performed on the ViiaTM 7 Real-

Time PCR System (Life Technologies) using 6-carboxyfluorescein-labeled Taqman probes for mCerk, hCerk, mTBP and hTBP (Applied Biosystems). Relative expression levels were calculated using the comparative CT method.

79

Total RNA was isolated from cells for detection of shRNAs using the miRNeasy® Mini Kit

(Qiagen). Reverse transcription was performed with custom primers for shCerk1, shCerk2 and snoRNA202 as an internal control using the TaqMan® MicroRNA Reverse Transcription Kit (Life

Technologies). qPCR was performed on the ViiaTM 7 Real-Time PCR System (Life Technologies) using 6-carboxyfluorescein-labeled Taqman probes for shCerk1, shCerk2 and SnoRNA202

(Applied Biosystems). Relative expression levels were calculated using the comparative CT method.

Flow Cytometry

To measure the ratio of GFP- and mCherry-positive cells before and after 4-OH- tamoxifen-induced recombination in vitro, cells were collected by trypsinization and fixed in 1% formaldehyde and 0.04% sodium azide, washed, and analyzed on an LSRII flow cytometer (BD

Biosciences). Data were analyzed using FlowJo software.

Statistical Analyses

Unpaired Student’s t-tests were utilized to analyze normally distributed data. Mann-

Whitney U tests were used when data were not normally distributed. Two-way ANOVAs were used to compare paired data. Log-rank tests were used to analyze survival curves. p-values <

0.05 were considered statistically significant. Hazard ratios with 95% confidence intervals were calculated for all survival curves.

80

Figure 3.1. Cerk knockdown sensitizes tumor cells to apoptosis in vitro following HER2/neu down-regulation

81

(A) Representative fluorescence images and (B) quantification of MTB/TAN primary tumor cell lines expressing empty vector, a control scrambled shRNA, shCerk1 or shCerk2 withdrawn from doxycycline 72 hr then stained for cleaved caspase-3 (red; Hoechst = blue). (C) Quantification of

MTB/TAN primary tumor cell lines expressing empty vector, a control scrambled shRNA, shCerk1 or shCerk2 withdrawn from doxycycline 72 hr then stained for Ki67. (D) Western blot of

MTB/TAN primary tumor cell lines expressing empty vector, a control scrambled shRNA, or Cerk shRNA1 withdrawn from doxycycline 48 hr, blotted for cleaved PARP, quantified in (E), and cleaved caspase-3, quantified in (F). (G) Western blot of MTB/TAN primary tumor cell lines expressing empty vector, a control scrambled shRNA, or Cerk shRNA2 withdrawn from doxycycline 48 hr, blotted for cleaved PARP, quantified in (H), and cleaved caspase-3, quantified in (I). *p<0.05, **p<0.01, ***p<0.001.

82

Figure 3.2. Cerk is required for tumor cell survival following HER2/neu down-regulation

83

(A) qRT-PCR analysis of Cerk mRNA expression in Cerk knockdown tumor cell lines. (B) Schematic of competition assay and timing of doxycycline treatment and tumor harvest. (C) Percentage of eGFP-positive and mCherry-positive cells was determined at timepoints in (B) up to 28 days post-deinduction. Data represent mean ± SEM. (D) Representative fluorescence images of primary tumors, 96 hr deinduced tumors and residual lesions 28 days post-deinduction. (E)

Percentage of eGFP-positive and mCherry-positive cells at timepoints in (B) in control cohort and

(F) in a second shRNA cohort. *p<0.05, **p<0.01, ***p<0.001.

84

Figure 3.3. Cerk knockdown is not maintained in orthotopic recurrence assays

(A) Recurrence-free survival of nude mice harboring primary orthotopic tumors from MTB/TAN primary tumor cell lines expressing empty vector, a control scrambled shRNA, shCerk1 or shCerk2 induced to regress by doxycycline withdrawal. (B) qRT-PCR analysis of Cerk mRNA expression in primary tumors formed from all cell lines in (A). (C) Recurrence-free survival of nude mice harboring MTB/TAN primary cell lines expressing empty vector, a control scrambled shRNA, shCerk1 or shCerk2 withdrawn from doxycycline 48 hr post-injection. (D) qRT-PCR analysis of Cerk mRNA expression in recurrent tumors formed from all cell lines in (C).

85

Figure 3.4. Characterization of FLIPi conditional shRNA expression system in vitro and

MTB/TAN;Ubc-CreERT2 cell line

86

(A) Representative images of MTB/TAN;Ubc-CreERT2 cells transduced with FLIPi-shp53 construct treated with 4-OH-tamoxifen at indicated doses for 24 hr and (B) 48 hr. (C) Representative hematoxylin and eosin stained sections from primary MTB/TAN;Ubc-CreERT2 tumors. (D)

Recurrence-free survival of nude mice harboring primary orthotopic tumors from

MTB/TAN;Ubc-CreERT2 cells induced to regress by doxycycline withdrawal.

87

Figure 3.5. Characterization of FLIPi conditional shRNA expression system and MTB/TAN;Ubc-

CreERT2 cell line in vivo

88

Dissection images of primary orthotopic tumors generated from injection of MTB/TAN;Ubc-

CreERT2 FLIPi-shp53 cells, (A) untreated or treated with vehicle, (B) treated with tamoxifen for 1 d, (C) treated with tamoxifen for 3 d, and (D) treated with tamoxifen for 5 d.

89

Figure 3.6. Conditional Cerk knockdown is not obtained using FLIPi system in vivo

Recurrence-free survival of nude mice harboring primary orthotopic tumors from

MTB/TAN;Ubc-CreERT2 primary tumor cell lines conditionally expressing FLIPi empty vector, a control scrambled shRNA, shCerk1 or shCerk2, (A) induced to recombine with 3 d tamoxifen treatment or (B) treated with vehicle, then induced to regress by doxycycline withdrawal. (C)

90 qRT-PCR analysis of Cerk mRNA expression in primary tumors, tumors withdrawn from doxycycline for 96 h, and recurrent tumors formed from all cohorts in (A) and (B).

91

Figure 3.7. MTB/TAN;Ubc-CreERT2 cells undergo efficient recombination upon treatment with tamoxifen but express low levels of shRNA

(A) Flow cytometric analysis of MTB/TAN;Ubc-CreERT2 primary tumor cell lines before recombination (untreated) or following Cre-mediated recombination (treated with 4-OH- tamoxifen). (B) qRT-PCR analysis of Cerk mRNA expression in MTB/TAN primary tumor cell lines constitutively expressing MLPHG empty vector, a control scrambled shRNA, shCerk1 or shCerk2, and MTB/TAN;Ubc-CreERT2 primary tumor cell lines transduced once (1x) or twice (2x) with FLIPi

92 empty vector, a control scrambled shRNA, shCerk1 or shCerk2 then induced to recombine with

4-OH-tamoxifen treatment.

93

Figure 3.8. High dose NVP-231 treatment may synergize with lapatinib in HER2/neu–amplified human breast cancer cells

BT474 and SKBR3 cells were treated with 100 nM lapatinib or DMSO and increasing doses of

NVP-231 from 100 nM to 3 µM for 16 h (A)(D), 24 h (B)(E), or 48h (C)(F). Caspase activity values were measured with Caspase-Glo® 3/7 Assay System and normalized to viable cell number measured using the CellTiter-Glo® Luminescent Cell Viability Assay.

94

Figure 3.9. Growth curve cannot delineate role for Cerk in primary or recurrent tumor growth

(A) qRT-PCR analysis of Cerk knockdown in primary (54074) and recurrent (42929 and 48316)

MTB/TAN cell lines expressing empty vector, a control scrambled shRNA, shCerk1 or shCerk2.

Growth curve demonstrating tumor volume over time for primary orthotopic tumors from (B) primary MTB/TAN cell lines (54074), (D) 42929 recurrent MTB/TAN cell lines and (F) 48316

95 recurrent MTB/TAN cell lines. Mean growth rates for (C) primary MTB/TAN cell lines (54074), (E)

42929 recurrent MTB/TAN cell lines and (G) 48316 recurrent MTB/TAN cell lines.

96

CHAPTER 4: Summary and Future Directions

Summary

The ability of tumor cells to survive adjuvant or neoadjuvant therapy and persist in patients leads to breast cancer recurrence, and recurrence in turn is responsible for the majority of morbidity and mortality associated with breast cancer. Understanding pathways involved in tumor cell survival following therapy will provide insight into effective treatments to eliminate tumor cells during primary therapy thereby preventing breast cancer recurrence. In this thesis, we propose Ceramide Kinase as a novel target that is functionally involved in tumor cell survival following therapy.

First we demonstrated that Cerk is spontaneously up-regulated in recurrent mammary tumors of inducible bitransgenic mouse models of breast cancer recurrence driven by four different oncogenes – HER2/neu, c-MYC, Wnt1 and Akt1. Having observed this up-regulation in vivo upon oncogene down-regulation, we then determined that Cerk is up-regulated in vitro in

MTB/TAN cell lines following HER2/neu down-regulation, as well as in human HER2/neu- amplified breast cancer cells following HER2/neu pathway inhibition with lapatinib. We also demonstrated that chemotherapeutic treatment with adriamycin leads to acute Cerk up- regulation in mouse and human breast cancer cells.

We then showed that Cerk up-regulation has the functional consequence of promoting tumor cell survival in vitro following HER2/neu down-regulation. Furthermore, Cerk promotes tumor cell survival in vivo acutely following HER2/neu down-regulation. As a result, Cerk promotes mammary tumor recurrence in vivo.

Additionally, we interrogated human breast cancer patient datasets to determine whether CERK expression was predictive of outcome. We found that elevated CERK expression

97 was associated with an increased risk of recurrence in women with breast cancer. We also found that high CERK expression was associated with aggressive subtypes of breast cancer, including those with ER-negative status, PR-negative status, HER2-positive status, high tumor grade, and

ErbB2 and basal-like tumors. We also found that the association between CERK expression and relapse-free survival in breast cancer patients was independent of the association between

CERK expression and these aggressive tumor subsets.

In loss of function studies, we sought to further our understanding of the potential usefulness of targeting Cerk in cancer. We found that Cerk knockdown sensitizes tumor cells to apoptosis in vitro following doxycycline withdrawal and HER2/neu down-regulation, as seen by increases in cleaved caspase-3 detected by immunofluorescence and Western blot.

Furthermore, we found Cerk knockdown cells are strongly selected against following HER2/neu down-regulation in vivo. We hypothesize that the paracrine secretion of PGE2 may be involved in maintaining Cerk knockdown cells in primary tumors in the competition assay setting. This will have to be confirmed by experiments outlined in the next section (Future Directions). Secreted

PGE2 may allow Cerk knockdown cells to persist in primary tumors in a setting where Cerk knockdown was previously determined to be lost. Cell-autonomous mechanisms may overwhelm the dependence on paracrine factors upon HER2/neu down-regulation, as Cerk knockdown cells were selected against very strongly within 96 hr despite the presence of control cells.

We then wished to determine whether Cerk is required for tumor recurrence by performing Cerk knockdown recurrence assays. Due to difficulty maintaining knockdown using

Cerk shRNAs, we were not able to answer this question using constitutive knockdown systems.

We then turned to the FLIPi conditional shRNA expression system in an attempt to circumvent

98 selection events occurring against Cerk knockdown. We tested FLIPi in an MTB/TAN;Ubc-CreERT2 cell line in vitro then in vivo, demonstrating that FLIPi was able to undergo efficient and tightly- regulated recombination upon treatment with tamoxifen.

Having optimized this system, we sought to address the initial question of whether Cerk was required for tumor recurrence by inducing recombination at deinduction, when doxycycline is withdrawn and HER2/neu is down-regulated. Unfortunately, we were not able to address the requirement for Cerk in tumor recurrence as no knockdown was detectable in any cohort irrespective of shRNA expression or treatment regimen. This system holds promise but will require further troubleshooting to answer the question of the requirement for Cerk in tumor recurrence.

As genetic knockdown of Cerk proved technically challenging, we attempted to use the small molecule inhibitor of Cerk NVP-231 to test whether it would sensitize HER2/neu–amplified human breast cancer cells to lapatinib treatment. We found that high dose NVP-231 treatment may synergize with lapatinib, but as the doses were very high this effect may not be attributable solely to inhibition of Cerk.

Lastly, having demonstrated a role for Cerk acutely upon oncogene down-regulation, we wanted to determine whether Cerk was required for actively proliferating primary and recurrent tumors. Although we saw no effect of Cerk knockdown on tumor growth rates, these results are inconclusive as Cerk knockdown was not shown to be maintained throughout the course of the experiment.

The difficulty of maintaining Cerk knockdown in orthotopic recurrence assays in vivo may indicate a strong dependence of tumor cell lines on Cerk signaling, which in turn may indicate that Cerk has potential as a drug target in cancer cells. In aggregate, our findings

99 identify Cerk signaling as a pathway for cell survival in breast cancer cells that is sufficient to promote tumor recurrence. Additionally, we find that Cerk kinase activity is required for its effect promoting tumor cell survival. Moreover, we demonstrate a requirement for Cerk upon

HER2/neu down-regulation as Cerk knockdown cells are subjected to strong negative selection in this context. We also find that high CERK expression defines a subset of human breast cancers with a high likelihood of relapse.

100

Future Directions

Characterize Cerk protein expression in cell lines and tumors

Although several antibodies have been synthesized against human CERK and are commercially available, two of which were predicted to have cross-reactivity against mouse, neither detected mouse Cerk in our hands (data not shown). As a result, we sought to generate a custom antibody for Cerk. Several attempts to generate purified full-length recombinant Cerk in bacteria and insect cells failed (data not shown). Consequently, we chose to use a peptide- based approach to generate an antibody against Cerk.

A C-terminal peptide identified by Open Biosystems (now Thermo-Fisher) was chosen for synthesis and immunization into two rabbits. Early bleeds (day 35, 56/58, 104, 145, 215 and

264) from these rabbits have been tested for reactivity against mouse Cerk, and all bleeds from both rabbits detect overexpressed Cerk in cell lysates and immunoprecipitated HA-tagged Cerk.

Purification was completed on bleeds from days 35, 56/58 and 104 from each rabbit independently, yielding two purified antibodies. Both antibodies also detected overexpressed

Cerk in lysates and immunoprecipitated HA-tagged Cerk. It is unclear at this time whether the purified antibodies are capable of recognizing endogenous Cerk in cell and tumor lysates.

Additional testing and characterization of these Cerk antibodies will be necessary before they can be of use. First, these antibodies need to be tested for immunoprecipitation of overexpressed, and subsequently endogenous, Cerk protein from cell lysates. The ability to immunoprecipitate Cerk may solve the issues of detection of endogenous protein by eliminating other proteins and concentrating Cerk. We have attempted immunoprecipitation with both purified Cerk antibodies and saw that they appear to be capable of immunoprecipitation.

However, this has not been successfully repeated, so this experiment will require optimization.

101

Furthermore, later bleeds need to be tested for titer, and if their titer is higher than earlier bleeds then their purification will likely yield antibodies with higher avidity. Once a functional antibody has been optimized, then analysis of Cerk protein expression will be possible. Testing Cerk antibodies for immunofluorescence will also help provide key insights, as many questions about tumor heterogeneity as well as sub-cellular localization could be answered with immunofluorescence.

First, Cerk expression patterns will need to be assessed by performing Western blots on tumor lysates from primary and recurrent tumors of MMTV-rtTA;TetO-HER2/neu, MMTV- rtTA;TetO-MYC, MMTV-rtTA;TetO-Wnt1;p53+/-, and MMTV-rtTA;TetO-Akt1 mice. Additionally, immunofluorescence with this antibody will confirm changes in expression as well as help identify heterogeneity within tumors. This may identify regions of primary tumors with high levels of Cerk prior to oncogene down-regulation.

Additionally, using the Cerk antibody, we will assess the changes of Cerk expression in response to HER2/neu down-regulation in vitro and in vivo to determine whether it follows mRNA up-regulation. We will also assess changes of Cerk protein expression in response to chemotherapy by treating MTB/TAN cell lines with adriamycin.

Characterize ceramide-1-phosphate levels in cell lines and tumors

An important question needing to be address is whether the product of Cerk, ceramide-

1-phosphate (C1P), is altered in proportion to Cerk protein levels. Specifically, when Cerk is overexpressed, C1P levels are expected to increase, and when Cerk is knocked down, C1P levels are expected to decrease. C1P is the only known product of Cerk, so the functional effect of Cerk is believed to be through its modulation of C1P and consequently ceramide levels. Confirming

102 this by assessing levels of C1P in cells and tumors where Cerk expression has been altered will help confirm or disprove that C1P is mediating the effects of Cerk on tumor cell survival and tumor recurrence.

We addressed this question by liquid chromatography tandem mass spectrometry (LC-

MS/MS) in collaboration with the laboratory of Ian Blair (performed by Nate Snyder). We performed Folch lipid extractions of MTB/TAN cells with Cerk overexpression or Cerk knockdown. This was followed by liquid chromatography optimized for ceramides and tandem mass spectrometry on a TSQ Quantum Ultra™ Triple Stage Quadrupole Mass Spectrometer

(Thermo Scientific), based on previously published protocols (226,227). Unfortunately, although we analyzed all species of C1P and ceramide between C12 and C22, we did not detect changes in C1P or ceramide that were consistent with levels of Cerk expression (assessed by mRNA).

There are many possible explanations for the lack of changes observed, including the conditions in which cells were cultured. In normal culture conditions, the ceramide rheostat may be able to compensate for levels of Cerk and maintain physiological levels of C1P and ceramide.

However, if the cells were placed in conditions of stress, such as serum deprivation, that are known to lead to ceramide accumulation, this may reveal a change in C1P to ceramide balance.

These culture conditions may have to be optimized.

The extraction protocols will also require optimization to minimize loss of ceramides thought to occur at several stages. Also, the LC-MS/MS protocols require optimization to account for the phosphorylation state of C1P and the chain lengths of C1P being detected. Once these steps have been optimized, this will allow for thorough characterization of C1P and ceramide levels in cell lines and tumors. We will perform LC-MS/MS on lipids extracted from primary and recurrent tumors of MMTV-rtTA;TetO-HER2/neu, MMTV-rtTA;TetO-MYC, MMTV-

103 rtTA;TetO-Wnt1;p53+/-, and MMTV-rtTA;TetO-Akt1 mice to determine whether C1P and ceramide levels change as expected in correlation with Cerk protein levels. We will also assess the changes of C1P and ceramide in response to HER2/neu down-regulation in vitro and in vivo to determine whether they mirror predicted Cerk protein up-regulation. We will also measure changes in C1P and ceramide in response to chemotherapy in MTB/TAN cell lines treated with adriamycin.

Importantly, optimization of LC-MS/MS will allow us to determine conclusively whether our G198D-Cerk mutant is truly kinase dead. A kinase assay will need to be performed in a cell- free system to test for kinase activity of G198D-Cerk relative to wildtype Cerk. Also, this will allow us to address the possibility that G198D-Cerk may be dominant negative. This will be tested by detecting levels of C1P and Cerk in cells where G198D-Cerk is expressed and comparing to wildtype Cerk. If G198D-Cerk is dominant negative, it is expected that cells in which it is expressed will have lower levels of C1P than control cells.

Together, these experiments will be very important in determining whether C1P is in fact mediating the effects of Cerk or whether an additional level of complexity may need to be investigated. If C1P is not found to mediate the effects of Cerk, this may indicate other roles for

Cerk which would have to be elucidated. Cerk may have other substrates yet to be identified.

Alternatively, Cerk may serve as a scaffolding protein or have other roles that have yet to be characterized. These options will have to be investigated to understand whether inhibition of kinase activity will be sufficient to prevent the pro-tumorigenic effects of Cerk, or whether other classes of inhibitors will be needed.

104

Determine the molecular mechanisms by which Cerk promotes tumor cell survival

Once C1P can be confirmed or disproven to be mediating the effects of Cerk expression on tumor cell survival and tumor recurrence, the molecular mechanisms downstream will need to be elucidated. Attempts to identify signaling pathways that are differentially regulated in

MTB/TAN cells with Cerk overexpression or Cerk knockdown following HER2/neu down- regulation have not revealed any candidates (Figure 4.1). We investigated candidate pathways based on many previously published reports, including cPLA2, PI3K/AKT, NF-κB, and MAPK.

Although these conditions demonstrated differential survival between MTB/TAN cells with Cerk overexpression, control and Cerk knockdown vectors, we did not see any alterations in signaling pathways, indicating the effect of Cerk on signaling pathways may be cell-type and context specific.

Interestingly, cPLA2 protein levels and phosphorylation were found to be regulated by

HER2/neu expression, as doxycycline withdrawal led to decreased phospho- and total-cPLA2 levels, which has not been published (Figure 4.1A, B). Although this was not altered by levels of

Cerk expression, this constitutes a novel finding that merits further investigation.

In an attempt to interrogate potential pathways altered downstream of Cerk in a more unbiased way, we turned to phospho-protein arrays. As we had found that Cerk has an effect on cell survival, we identified phospho-protein arrays with many survival pathways, and chose

Sigma-Aldrich’s Panorama® Antibody Microarray-XPRESS Profiler725. Unfortunately, these phospho-protein arrays only exist with antibodies with reactivity to human proteins, only a fraction of which cross-react with mouse proteins. We decided to transition to human cell lines to perform these phospho-protein arrays. We cloned seven shRNAs against CERK into the GIPZ

105 vector, packaged them in lentivirus, transduced BT474 cells and tested them for CERK knockdown. Three shRNAs yielded CERK knockdown of approximately 60% (Figure 4.2A).

Prior to utilizing BT474 CERK knockdown cell lines for phospho-protein arrays, we tested them for candidate pathways following treatment with 100 nM lapatinib. No candidate pathways appeared altered in DMSO or lapatinib treated cells between control and CERK knockdown cells (Figure 4.2B-O). This indicates that either the levels of CERK knockdown obtained were insufficient to result in a change in survival pathways downstream or that the pathways tested may not regulate the effect of CERK in our system.

Future experiments will need to address these two possibilities. The generation of

BT474 cell lines with higher levels of CERK knockdown combined with the use of Sigma-Aldrich’s

Panorama® Antibody Microarray-XPRESS Profiler725 will help identify pathways downstream of

Cerk regulating its effect on cell survival in various contexts. Once candidate pathways have been identified by phospho-protein arrays, they will have to be validated by Western blot then confirmed by targeting those pathways to rescue apoptosis upon HER2/neu down-regulation.

Characterizing signaling downstream of Cerk and C1P will help advance the understanding of the biology of tumors relying on this pathway and help identify the most relevant way of inhibiting escape mechanisms in tumor recurrence.

Assess eicosanoid composition and involvement in tumor recurrence

As we hypothesized that PGE2 secretion may be involved in maintaining Cerk knockdown tumor cells in the orthotopic competition assay, the question of eicosanoid composition and contribution to tumor progression must be addressed. Mass spectrometry methods have been developed to assess relative levels of many eicosanoids, particularly prostaglandins such as

106

PGE2, in tumors (228). Assessing changes in eicosanoid composition based on Cerk levels manipulated by overexpression, shRNA knockdown or germline knockout will help determine whether these changes may be mediating downstream effects of Cerk. We anticipate that Cerk overexpression will lead to increases in C1P levels and activation of cPLA2, which in turn will lead to increases in secreted PGE2. This would indicate that the balance of eicosanoids such as prostaglandins may be functionally involved in tumor recurrence. This will warrant further investigation by genetic manipulation of cPLA2. Pharmacological approaches to inhibiting eicosanoid synthesis could include administration of arachidonyl trifluoromethyl ketone

(AACOCF3), an inhibitor of cPLA2 (229), or more clinically relevant, inhibitors of the cyclooxygenase (COX) and lipoxygenase (LOX) enzymes. COX and LOX inhibitors are currently in clinical trials for their potential as chemopreventives.

If Cerk is found to be an upstream regulator of eicosanoid synthesis in mammary tumors, it may offer a new way to target inflammatory signaling known to play a part in tumorigenesis and tumor progression in many cancers. Cerk’s role in inflammation has been identified, however, whether it has a functional role in cancer has not been addressed. These experiments would be instrumental in determining Cerk’s potential as a drug target.

Determine whether Cerk is required for tumor recurrence

Despite many attempts delineated in Chapter 3, the question of Cerk’s requirement in tumor recurrence still remains to be answered. This will need to be addressed either by optimizing the FLIPi system or by identifying a new system to express Cerk shRNAs conditionally.

Upon recombination, the FLIPi vector generates a single transcript with the mCherry reporter followed by the shRNA of interest in a miR30 setting. This transcript is then spliced due to the

107 presence of splice donor and splice acceptor sites flanking the shRNA. This single transcript and processing required to release the shRNA may be at fault in creating low levels of shRNA transcript (Figure 3.7C, D).

To address these issues, the FLIPi vector could be rearranged so that the fluorescent reporter is transcribed independently of the shRNA, hopefully leading to improved transcription of shRNA and circumventing the potential issues with processing. Alternatively, we could turn to other conditional expression systems such as pSico (230), and clone in a fluorescent reporter that would be expressed following recombination.

With either approach, orthotopic recurrence assays will need to be performed to address the requirement for Cerk in tumor cell survival upon HER2/neu down-regulation and in tumor recurrence. Additionally, inducing recombination and expression of Cerk shRNAs at various points will allow elucidation of the role of Cerk at each stage of tumor progression.

Additionally, the crossing of Cerk-/- mice with oncogene-induced cancer models needs to be performed. This will provide strong evidence for the role of Cerk in the context of tumorigenesis driven by specific oncogenes and tumor recurrence following oncogene down- regulation. We propose crossing Cerk-/- mice with MMTV-rtTA;TetO-HER2/neu, MMTV- rtTA;TetO-MYC, MMTV-rtTA;TetO-Wnt1;p53+/-, and MMTV-rtTA;TetO-Akt1 transgenic mice to determine whether loss of Cerk will delay tumor recurrence in these models. If Cerk knockout leads to delayed tumor recurrence in these mice, this will point to the possible utility of clinical intervention in this pathway to prevent or treat recurrent breast tumors. If, however, knockout of Cerk has no effect on tumor recurrence, compensatory pathways may be active in promoting tumor cell survival upon oncogene down-regulation and in tumor recurrence, which may indicate that Cerk would not be an ideal drug target for breast cancer patients.

108

Conclusions

In aggregate, the proposed experiments will help to characterize CERK as a potential drug target in the context of breast cancer, particularly breast cancer refractory to targeted therapy. The ultimate hope would be to identify an inhibitor of CERK with good pharmacokinetic and pharmacodynamics profiles. We could then determine whether CERK inhibition in combination with chemotherapy and/or targeted therapy can overcome drug resistance in cell lines, mouse models of breast cancer, and ultimately in breast cancer patients.

109

Figure 4.1. Cerk knockdown or overexpression in MTB/TAN cell line withdrawn from doxycycline does not reveal differentially regulated signaling pathways

110

(A) Western blot of MTB/TAN primary tumor cell lines expressing empty vector or Cerk shRNA2 withdrawn from doxycycline 72 hr, blotted for phospho- and total-cPLA2 quantified in (B), phospho- and total-p65 quantified in (C), phospho- and total-p44/42 MAPK quantified in (D), phospho- and total-Akt quantified in (E), and Bcl-xL quantified in (F). (G) Western blot of

MTB/TAN primary tumor cell lines expressing Cerk, empty vector or Cerk shRNA2 withdrawn from doxycycline 72 hr, blotted for phospho- and total-cPLA2 quantified in (H), phospho- and total-p65 quantified in (I), phospho- and total-Akt quantified in (J), phospho- and total-p44/42

MAPK quantified in (K), and Bcl-xL quantified in (L).

111

Figure 4.2. CERK knockdown in BT474 cell line treated with lapatinib does not reveal differentially regulated signaling pathways

112

(A) qRT-PCR analysis of CERK mRNA expression in CERK knockdown BT474 cell lines. (B) Western blot of BT474 cell lines expressing control shFF3 or shCerk1, shCerk2 or shCerk7 treated with

DMSO or lapatinib 4 hr, blotted for phospho- and total-HER2 quantified in (C), phospho- and total-Akt quantified in (D), and Bcl-xL quantified in (E). (F) Western blot of BT474 cell lines expressing control shFF3 or shCerk1, shCerk2 or shCerk7 treated with DMSO or lapatinib 4 hr, blotted for phospho- and total-p65 quantified in (G), and phospho- and total-p44/42 MAPK quantified in (H). (I) Western blot of BT474 cell lines expressing control shFF3 or shCerk1, shCerk2 or shCerk7 treated with DMSO or lapatinib 4 hr, blotted for phospho- and total-JNK quantified in (J), and phospho- and total-Bcl-2 quantified in (K). (L) Western blot of BT474 cell lines expressing control shFF3 or shCerk1, shCerk2 or shCerk7 treated with DMSO or lapatinib 4 hr, blotted for cleaved PARP (M), phospho- and total-GSK-3β quantified in (N), and total-IκBα quantified in (O).

113

REFERENCES

1. Maxmen A. The hard facts. Nature. 2012;485:S50–S51.

2. Howlader N, Noone A, Krapcho M, Garshell J, Neyman N, Altekruse S, et al. SEER Cancer Statistics Review, 1975-2010 [Internet]. National Cancer Institute; 2012. Available from: http://seer.cancer.gov/csr/1975_2010/

3. Key J, Hodgson S, Omar RZ, Jensen TK, Thompson SG, Boobis AR, et al. Meta-analysis of Studies of Alcohol and Breast Cancer with Consideration of the Methodological Issues. Cancer Causes Control. 2006;17:759–70.

4. Maruti SS, Willett WC, Feskanich D, Rosner B, Colditz GA. A Prospective Study of Age- Specific Physical Activity and Premenopausal Breast Cancer. J Natl Cancer Inst. 2008;100:728–37.

5. Hamajima N, Hirose K, Tajima K, Rohan T, Calle EE, Heath CW Jr, et al. Alcohol, tobacco and breast cancer--collaborative reanalysis of individual data from 53 epidemiological studies, including 58,515 women with breast cancer and 95,067 women without the disease. Br J Cancer. 2002;87:1234–45.

6. Pharoah PDP, Day NE, Duffy S, Easton DF, Ponder BAJ. Family history and the risk of breast cancer: A systematic review and meta-analysis. Int J Cancer. 1997;71:800–9.

7. Njiaju UO, Olopade OI. Genetic Determinants of Breast Cancer Risk: A Review of Current Literature and Issues Pertaining to Clinical Application. Breast J. 2012;18:436–42.

8. Jatoi I, Tsimelzon A, Weiss H, Clark GM, Hilsenbeck SG. Hazard rates of recurrence following diagnosis of primary breast cancer. Breast Cancer Res Treat. 2005;89:173–8.

9. Saphner T, Tormey DC, Gray R. Annual hazard rates of recurrence for breast cancer after primary therapy. J Clin Oncol. 1996;14:2738–46.

10. Ross JS, Slodkowska EA, Symmans WF, Pusztai L, Ravdin PM, Hortobagyi GN. The HER-2 Receptor and Breast Cancer: Ten Years of Targeted Anti–HER-2 Therapy and Personalized Medicine. The Oncologist. 2009;14:320–68.

11. Slamon DJ, Godolphin W, Jones LA, Holt JA, Wong SG, Keith DE, et al. Studies of the HER- 2/neu proto-oncogene in human breast and ovarian cancer. Science. 1989;244:707–12.

12. Slamon DJ, Clark GM, Wong SG, Levin WJ, Ullrich A, McGuire WL. Human breast cancer: correlation of relapse and survival with amplification of the HER-2/neu oncogene. Science. 1987;235:177–82.

13. Hynes NE, Lane HA. ERBB receptors and cancer: the complexity of targeted inhibitors. Nat Rev Cancer. 2005;5:341–54.

114

14. Arteaga CL, Sliwkowski MX, Osborne CK, Perez EA, Puglisi F, Gianni L. Treatment of HER2- positive breast cancer: current status and future perspectives. Nat Rev Clin Oncol. 2012;9:16–32.

15. Smith I, Procter M, Gelber RD, Guillaume S, Feyereislova A, Dowsett M, et al. 2-year follow-up of trastuzumab after adjuvant chemotherapy in HER2-positive breast cancer: a randomised controlled trial. The Lancet. 6;369:29–36.

16. Slamon D, Eiermann W, Robert N, Pienkowski T, Martin M, Press M, et al. Adjuvant Trastuzumab in HER2-Positive Breast Cancer. N Engl J Med. 2011;365:1273–83.

17. Romond EH, Perez EA, Bryant J, Suman VJ, Geyer CE, Davidson NE, et al. Trastuzumab plus Adjuvant Chemotherapy for Operable HER2-Positive Breast Cancer. N Engl J Med. 2005;353:1673–84.

18. De P, Hasmann M, Leyland-Jones B. Molecular determinants of trastuzumab efficacy: What is their clinical relevance? Cancer Treat Rev. 2013;39:925–34.

19. Asanuma H, Torigoe T, Kamiguchi K, Hirohashi Y, Ohmura T, Hirata K, et al. Survivin Expression Is Regulated by Coexpression of Human Epidermal Growth Factor Receptor 2 and Epidermal Growth Factor Receptor via Phosphatidylinositol 3-Kinase/AKT Signaling Pathway in Breast Cancer Cells. Cancer Res. 2005;65:11018–25.

20. Izumi Y, Xu L, di Tomaso E, Fukumura D, Jain RK. Tumour biology: Herceptin acts as an anti-angiogenic cocktail. Nature. 2002;416:279–80.

21. Spector NL, Blackwell KL. Understanding the Mechanisms Behind Trastuzumab Therapy for Human Epidermal Growth Factor Receptor 2–Positive Breast Cancer. J Clin Oncol. 2009;27:5838–47.

22. Geyer CE, Forster J, Lindquist D, Chan S, Romieu CG, Pienkowski T, et al. Lapatinib plus Capecitabine for HER2-Positive Advanced Breast Cancer. N Engl J Med. 2006;355:2733– 43.

23. Rexer BN, Arteaga CL. Intrinsic and Acquired Resistance to HER2-Targeted Therapies in HER2 Gene-Amplified Breast Cancer: Mechanisms and Clinical Implications. Crit Rev Oncog. 2012;17:1–16.

24. Arribas J, Baselga J, Pedersen K, Parra-Palau JL. p95HER2 and Breast Cancer. Cancer Res. 2011;71:1515–9.

25. Molina MA, Codony-Servat J, Albanell J, Rojo F, Arribas J, Baselga J. Trastuzumab (Herceptin), a Humanized Anti-HER2 Receptor Monoclonal Antibody, Inhibits Basal and Activated HER2 Ectodomain Cleavage in Breast Cancer Cells. Cancer Res. 2001;61:4744–9.

115

26. Pérez-Tenorio G, Alkhori L, Olsson B, Waltersson MA, Nordenskjöld B, Rutqvist LE, et al. PIK3CA Mutations and PTEN Loss Correlate with Similar Prognostic Factors and Are Not Mutually Exclusive in Breast Cancer. Clin Cancer Res. 2007;13:3577–84.

27. Scaltriti M, Eichhorn PJ, Cortés J, Prudkin L, Aura C, Jiménez J, et al. Cyclin E amplification/overexpression is a mechanism of trastuzumab resistance in HER2+ breast cancer patients. Proc Natl Acad Sci. 2011;108:3761–6.

28. Yakes FM, Chinratanalab W, Ritter CA, King W, Seelig S, Arteaga CL. Herceptin-induced Inhibition of Phosphatidylinositol-3 Kinase and Akt Is Required for Antibody-mediated Effects on p27, Cyclin D1, and Antitumor Action. Cancer Res. 2002;62:4132–41.

29. Baselga J, Bradbury I, Eidtmann H, Di Cosimo S, de Azambuja E, Aura C, et al. Lapatinib with trastuzumab for HER2-positive early breast cancer (NeoALTTO): a randomised, open-label, multicentre, phase 3 trial. The Lancet. 18;379:633–40.

30. Baselga J, Cortés J, Kim S-B, Im S-A, Hegg R, Im Y-H, et al. Pertuzumab plus Trastuzumab plus Docetaxel for Metastatic Breast Cancer. N Engl J Med. 2012;366:109–19.

31. Swain SM, Kim S-B, Cortés J, Ro J, Semiglazov V, Campone M, et al. Pertuzumab, trastuzumab, and docetaxel for HER2-positive metastatic breast cancer (CLEOPATRA study): overall survival results from a randomised, double-blind, placebo-controlled, phase 3 study. Lancet Oncol. 2013;14:461–71.

32. Modi S, Saura C, Henderson C, Lin NU, Mahtani R, Goddard J, et al. A multicenter trial evaluating retaspimycin HCL (IPI-504) plus trastuzumab in patients with advanced or metastatic HER2-positive breast cancer. Breast Cancer Res Treat. 2013;139:107–13.

33. Modi S, Stopeck A, Linden H, Solit D, Chandarlapaty S, Rosen N, et al. HSP90 Inhibition Is Effective in Breast Cancer: A Phase II Trial of Tanespimycin (17-AAG) Plus Trastuzumab in Patients with HER2-Positive Metastatic Breast Cancer Progressing on Trastuzumab. Clin Cancer Res. 2011;17:5132–9.

34. Gonzalez-Angulo AM, Morales-Vasquez F, Hortobagyi GN. Overview of resistance to systemic therapy in patients with breast cancer. Adv Exp Med Biol. 2007;608:1–22.

35. Gillet J-P, Gottesman MM. Mechanisms of Multidrug Resistance in Cancer. In: Zhou J, editor. Multi-Drug Resist Cancer [Internet]. Humana Press; 2010 [cited 2014 Mar 10]. page 47–76. Available from: http://link.springer.com/protocol/10.1007/978-1-60761- 416-6_4

36. Mollick JA, Carlson RW. Rational Surveillance Programs for Early Stage Breast Cancer Patients After Primary Treatment. Breast Dis. 2004;21:47–54.

37. Demicheli R, Abbattista A, Miceli R, Valagussa P, Bonadonna G. Time distribution of the recurrence risk for breast cancer patients undergoing mastectomy: further support about the concept of tumor dormancy. Breast Cancer Res Treat. 1996;41:177–85. 116

38. Karrison TG, Ferguson DJ, Meier P. Dormancy of Mammary Carcinoma After Mastectomy. J Natl Cancer Inst. 1999;91:80–5.

39. Weiss RB, Woolf SH, Demakos E, Holland JF, Berry DA, Falkson G, et al. Natural History of More Than 20 Years of Node-Positive Primary Breast Carcinoma Treated With Cyclophosphamide, Methotrexate, and Fluorouracil–Based Adjuvant Chemotherapy: A Study by the Cancer and Leukemia Group B. J Clin Oncol. 2003;21:1825–35.

40. Demicheli R. Tumour dormancy: findings and hypotheses from clinical research on breast cancer. Semin Cancer Biol. 2001;11:297–306.

41. Bednarz-Knoll N, Alix-Panabières C, Pantel K. Clinical relevance and biology of circulating tumor cells. Breast Cancer Res BCR. 2011;13:228.

42. Braun S, Vogl FD, Naume B, Janni W, Osborne MP, Coombes RC, et al. A Pooled Analysis of Bone Marrow Micrometastasis in Breast Cancer. N Engl J Med. 2005;353:793–802.

43. Janni W, Vogl FD, Wiedswang G, Synnestvedt M, Fehm T, Jückstock J, et al. Persistence of Disseminated Tumor Cells in the Bone Marrow of Breast Cancer Patients Predicts Increased Risk for Relapse—A European Pooled Analysis. Clin Cancer Res. 2011;17:2967– 76.

44. Mathiesen RR, Borgen E, Renolen A, Løkkevik E, Nesland JM, Anker G, et al. Persistence of disseminated tumor cells after neoadjuvant treatment for locally advanced breast cancer predicts poor survival. Breast Cancer Res. 2012;14:R117.

45. Boxer RB, Jang JW, Sintasath L, Chodosh LA. Lack of sustained regression of c-MYC- induced mammary adenocarcinomas following brief or prolonged MYC inactivation. Cancer Cell. 2004;6:577–86.

46. D’Cruz CM, Gunther EJ, Boxer RB, Hartman JL, Sintasath L, Moody SE, et al. c-MYC induces mammary tumorigenesis by means of a preferred pathway involving spontaneous Kras2 mutations. Nat Med. 2001;7:235–9.

47. Gunther EJ, Moody SE, Belka GK, Hahn KT, Innocent N, Dugan KD, et al. Impact of p53 loss on reversal and recurrence of conditional Wnt-induced tumorigenesis. Genes Dev. 2003;17:488–501.

48. Moody SE, Sarkisian CJ, Hahn KT, Gunther EJ, Pickup S, Dugan KD, et al. Conditional activation of Neu in the mammary epithelium of transgenic mice results in reversible pulmonary metastasis. Cancer Cell. 2002;2:451–61.

49. Moody SE, Perez D, Pan T, Sarkisian CJ, Portocarrero CP, Sterner CJ, et al. The transcriptional repressor Snail promotes mammary tumor recurrence. Cancer Cell. 2005;8:197–209.

50. Tirodkar TS, Voelkel-Johnson C. Sphingolipids in apoptosis. Exp Oncol. 2012;34:231–42. 117

51. Breslow DK. Sphingolipid Homeostasis in the Endoplasmic Reticulum and Beyond. Cold Spring Harb Perspect Biol. 2013;5:a013326.

52. Lippincott-Schwartz J, Phair RD. Lipids and Cholesterol as Regulators of Traffic in the Endomembrane System. Annu Rev Biophys. 2010;39:559–78.

53. Ogretmen B, Hannun YA. Biologically active sphingolipids in cancer pathogenesis and treatment. Nat Rev Cancer. 2004;4:604–16.

54. Lingwood D, Simons K. Lipid Rafts As a Membrane-Organizing Principle. Science. 2010;327:46–50.

55. Lopez PH, Schnaar RL. Gangliosides in cell recognition and membrane protein regulation. Curr Opin Struct Biol. 2009;19:549–57.

56. Sastry PS. Lipids of nervous tissue: Composition and metabolism. Prog Lipid Res. 1985;24:69–176.

57. Schütze S, Potthoff K, Machleidt T, Berkovic D, Wiegmann K, Krönke M. TNF activates NF- κB by phosphatidylcholine-specific phospholipase C-induced “Acidic” sphingomyelin breakdown. Cell. 1992;71:765–76.

58. Xiao C, Ghosh S. NF-κB, an Evolutionarily Conserved Mediator of Immune and Inflammatory Responses. In: Gupta S, Paul WE, Steinman R, editors. Mech Lymph Act Immune Regul X [Internet]. Springer US; 2005 [cited 2014 Mar 28]. page 41–5. Available from: http://link.springer.com/chapter/10.1007/0-387-24180-9_5

59. Poli V. The Role of C/EBP Isoforms in the Control of Inflammatory and Native Immunity Functions. J Biol Chem. 1998;273:29279–82.

60. Pettus BJ, Bielawska A, Subramanian P, Wijesinghe DS, Maceyka M, Leslie CC, et al. Ceramide 1-phosphate is a direct activator of cytosolic phospholipase A2. J Biol Chem. 2004;279:11320–6.

61. Pettus BJ, Kitatani K, Chalfant CE, Taha TA, Kawamori T, Bielawski J, et al. The Coordination of Prostaglandin E2 Production by Sphingosine-1-phosphate and Ceramide- 1-phosphate. Mol Pharmacol. 2005;68:330–5.

62. Mitsutake S, Kim T-J, Inagaki Y, Kato M, Yamashita T, Igarashi Y. Ceramide Kinase Is a Mediator of Calcium-dependent Degranulation in Mast Cells. J Biol Chem. 2004;279:17570–7.

63. Jolly PS, Bektas M, Olivera A, Gonzalez-Espinosa C, Proia RL, Rivera J, et al. Transactivation of Sphingosine-1–Phosphate Receptors by FcεRI Triggering Is Required for Normal Mast Cell Degranulation and Chemotaxis. J Exp Med. 2004;199:959–70.

118

64. Ammit AJ, Hastie AT, Edsall LC, Hoffman RK, Amrani Y, Krymskaya VP, et al. Sphingosine 1-phosphate modulates human airway smooth muscle cell functions that promote inflammation and airway remodeling in asthma. FASEB J [Internet]. 2001 [cited 2014 Mar 13]; Available from: http://www.fasebj.org/content/early/2001/05/02/fj.00-0742fje

65. Jolly PS, Rosenfeldt HM, Milstien S, Spiegel S. The roles of sphingosine-1-phosphate in asthma. Mol Immunol. 2002;38:1239–45.

66. Riboni L, Campanella R, Bassi R, Villani R, Gaini SM, Martinelli-Boneschi F, et al. Ceramide levels are inversely associated with malignant progression of human glial tumors. Glia. 2002;39:105–13.

67. Liu Y-Y, Han T-Y, Giuliano AE, Cabot MC. Ceramide glycosylation potentiates cellular multidrug resistance. FASEB J. 2001;15:719–30.

68. Gault C, Obeid L, Hannun Y. An overview of sphingolipid metabolism: from synthesis to breakdown. Adv Exp Med Biol. 2010;688:1–23.

69. Liu Y-Y, Hill RA, Li Y-T. Chapter Three - Ceramide Glycosylation Catalyzed by Glucosylceramide Synthase and Cancer Drug Resistance. In: James S. Norris, editor. Adv Cancer Res [Internet]. Academic Press; 2013 [cited 2013 Nov 6]. page 59–89. Available from: http://www.sciencedirect.com/science/article/pii/B9780123942746000030

70. Hanada K, Kumagai K, Yasuda S, Miura Y, Kawano M, Fukasawa M, et al. Molecular machinery for non-vesicular trafficking of ceramide. Nature. 2003;426:803–9.

71. Tafesse FG, Ternes P, Holthuis JCM. The Multigenic Sphingomyelin Synthase Family. J Biol Chem. 2006;281:29421–5.

72. Breslow DK, Collins SR, Bodenmiller B, Aebersold R, Simons K, Shevchenko A, et al. Orm family proteins mediate sphingolipid homeostasis. Nature. 2010;463:1048–53.

73. Laviad EL, Kelly S, Merrill AH, Futerman AH. Modulation of Ceramide Synthase Activity via Dimerization. J Biol Chem. 2012;287:21025–33.

74. Bose R, Verheij M, Haimovitz-Friedman A, Scotto K, Fuks Z, Kolesnick R. Ceramide synthase mediates daunorubicin-induced apoptosis: an alternative mechanism for generating death signals. Cell. 1995;82:405–14.

75. Jaffrézou JP, Levade T, Bettaïeb A, Andrieu N, Bezombes C, Maestre N, et al. Daunorubicin-induced apoptosis: triggering of ceramide generation through sphingomyelin hydrolysis. EMBO J. 1996;15:2417–24.

76. Senchenkov A, Litvak DA, Cabot MC. Targeting Ceramide Metabolism—a Strategy for Overcoming Drug Resistance. J Natl Cancer Inst. 2001;93:347–57.

119

77. Strum JC, Small GW, Pauig SB, Daniel LW. 1-beta-D-Arabinofuranosylcytosine stimulates ceramide and diglyceride formation in HL-60 cells. J Biol Chem. 1994;269:15493–7.

78. Bruno AP, Laurent G, Averbeck D, Demur C, Bonnet J, Bettaïeb A, et al. Lack of ceramide generation in TF-1 human myeloid leukemic cells resistant to ionizing radiation. Cell Death Differ. 1998;5:172–82.

79. Chmura SJ, Nodzenski E, Beckett MA, Kufe DW, Quintans J, Weichselbaum RR. Loss of ceramide production confers resistance to radiation-induced apoptosis. Cancer Res. 1997;57:1270–5.

80. Haimovitz-Friedman A, Kan CC, Ehleiter D, Persaud RS, McLoughlin M, Fuks Z, et al. Ionizing radiation acts on cellular membranes to generate ceramide and initiate apoptosis. J Exp Med. 1994;180:525–35.

81. Kolesnick R, Fuks Z. Radiation and ceramide-induced apoptosis. Oncogene. 2003;22:5897–906.

82. Baran Y, Salas A, Senkal CE, Gunduz U, Bielawski J, Obeid LM, et al. Alterations of ceramide/sphingosine 1-phosphate rheostat involved in the regulation of resistance to imatinib-induced apoptosis in K562 human chronic myeloid leukemia cells. J Biol Chem. 2007;282:10922–34.

83. Baran Y, Bielawski J, Gunduz U, Ogretmen B. Targeting glucosylceramide synthase sensitizes imatinib-resistant chronic myeloid leukemia cells via endogenous ceramide accumulation. J Cancer Res Clin Oncol. 2011;137:1535–44.

84. Bonhoure E, Lauret A, Barnes DJ, Martin C, Malavaud B, Kohama T, et al. Sphingosine kinase-1 is a downstream regulator of imatinib-induced apoptosis in chronic myeloid leukemia cells. Leukemia. 2008;22:971–9.

85. Camgoz A, Gencer EB, Ural AU, Avcu F, Baran Y. Roles of ceramide synthase and ceramide clearence genes in nilotinib-induced cell death in chronic myeloid leukemia cells. Leuk Lymphoma. 2011;52:1574–84.

86. Zhu Q, Wang Z, Ji C, Cheng L, Yang Y, Ren J, et al. C6-ceramide synergistically potentiates the anti-tumor effects of histone deacetylase inhibitors via AKT dephosphorylation and α- tubulin hyperacetylation both in vitro and in vivo. Cell Death Dis. 2011;2:e117.

87. Liu B, Andrieu-Abadie N, Levade T, Zhang P, Obeid LM, Hannun YA. Glutathione Regulation of Neutral Sphingomyelinase in Tumor Necrosis Factor-α-induced Cell Death. J Biol Chem. 1998;273:11313–20.

88. Santana P, Peña LA, Haimovitz-Friedman A, Martin S, Green D, McLoughlin M, et al. Acid Sphingomyelinase–Deficient Human Lymphoblasts and Mice Are Defective in Radiation- Induced Apoptosis. Cell. 1996;86:189–99.

120

89. Pettus BJ, Chalfant CE, Hannun YA. Ceramide in apoptosis: an overview and current perspectives. Biochim Biophys Acta BBA - Mol Cell Biol Lipids. 2002;1585:114–25.

90. Grassmé H, Jekle A, Riehle A, Schwarz H, Berger J, Sandhoff K, et al. CD95 Signaling via Ceramide-rich Membrane Rafts. J Biol Chem. 2001;276:20589–96.

91. Miyaji M, Jin Z-X, Yamaoka S, Amakawa R, Fukuhara S, Sato SB, et al. Role of membrane sphingomyelin and ceramide in platform formation for Fas-mediated apoptosis. J Exp Med. 2005;202:249–59.

92. Siskind LJ, Kolesnick RN, Colombini M. Ceramide Channels Increase the Permeability of the Mitochondrial Outer Membrane to Small Proteins. J Biol Chem. 2002;277:26796–803.

93. Siskind LJ, Kolesnick RN, Colombini M. Ceramide forms channels in mitochondrial outer membranes at physiologically relevant concentrations. Mitochondrion. 2006;6:118–25.

94. Dobrowsky RT, Kamibayashi C, Mumby MC, Hannun YA. Ceramide activates heterotrimeric protein phosphatase 2A. J Biol Chem. 1993;268:15523–30.

95. Hannun YA. Functions of ceramide in coordinating cellular responses to stress. Science. 1996;274:1855–9.

96. Dbaibo GS, Pushkareva MY, Jayadev S, Schwarz JK, Horowitz JM, Obeid LM, et al. Retinoblastoma gene product as a downstream target for a ceramide-dependent pathway of growth arrest. Proc Natl Acad Sci. 1995;92:1347–51.

97. Lee JY, Bielawska AE, Obeid LM. Regulation of Cyclin-Dependent Kinase 2 Activity by Ceramide. Exp Cell Res. 2000;261:303–11.

98. Zhu X-F, Liu Z-C, Xie B-F, Feng G-K, Zeng Y-X. Ceramide induces cell cycle arrest and upregulates p27kip in nasopharyngeal carcinoma cells. Cancer Lett. 2003;193:149–54.

99. Venable ME, Obeid LM. Phospholipase D in cellular senescence. Biochim Biophys Acta BBA - Mol Cell Biol Lipids. 1999;1439:291–8.

100. Ruvolo PP. Intracellular signal transduction pathways activated by ceramide and its metabolites. Pharmacol Res. 2003;47:383–92.

101. Bourbon NA, Yun J, Kester M. Ceramide Directly Activates Protein Kinase C ζ to Regulate a Stress-activated Protein Kinase Signaling Complex. J Biol Chem. 2000;275:35617–23.

102. Verheij M, Bose R, Hua Lin X, Yao B, Jarvis WD, Grant S, et al. Requirement for ceramide- initiated SAPK/JNK signalling in stress-induced apoptosis. Nature. 1996;380:75–9.

103. Scheid MP, Foltz IN, Young PR, Schrader JW, Duronio V. Ceramide and Cyclic Adenosine Monophosphate (cAMP) Induce cAMP Response Element Binding Protein

121

Phosphorylation via Distinct Signaling Pathways While Having Opposite Effects on Myeloid Cell Survival. Blood. 1999;93:217–25.

104. Ruvolo PP, Gao F, Blalock WL, Deng X, May WS. Ceramide Regulates Protein Synthesis by a Novel Mechanism Involving the Cellular PKR Activator RAX. J Biol Chem. 2001;276:11754–8.

105. Clemens MJ, Elia A. The double-stranded RNA-dependent protein kinase PKR: structure and function. J Interferon Cytokine Res Off J Int Soc Interferon Cytokine Res. 1997;17:503–24.

106. Heinrich M, Neumeyer J, Jakob M, Hallas C, Tchikov V, Winoto-Morbach S, et al. Cathepsin D links TNF-induced acid sphingomyelinase to Bid-mediated caspase-9 and -3 activation. Cell Death Differ. 2004;11:550–63.

107. Saddoughi SA, Song P, Ogretmen B. Roles of bioactive sphingolipids in cancer biology and therapeutics. Subcell Biochem. 2008;49:413–40.

108. Reynolds CP, Maurer BJ, Kolesnick RN. Ceramide synthesis and metabolism as a target for cancer therapy. Cancer Lett. 2004;206:169–80.

109. Lingwood CA. Glycosphingolipid Functions. Cold Spring Harb Perspect Biol. 2011;3:a004788.

110. Gupta G, Surolia A. Glycosphingolipids in microdomain formation and their spatial organization. FEBS Lett. 2010;584:1634–41.

111. Vlerken LE van, Duan Z, Seiden MV, Amiji MM. Modulation of Intracellular Ceramide Using Polymeric Nanoparticles to Overcome Multidrug Resistance in Cancer. Cancer Res. 2007;67:4843–50.

112. Liu Y-Y, Patwardhan GA, Xie P, Gu X, Giuliano AE, Cabot MC. Glucosylceramide synthase, a factor in modulating drug resistance, is overexpressed in metastatic breast carcinoma. Int J Oncol. 2011;39:425–31.

113. Ruckhäberle E, Karn T, Hanker L, Gätje R, Metzler D, Holtrich U, et al. Prognostic relevance of glucosylceramide synthase (GCS) expression in breast cancer. J Cancer Res Clin Oncol. 2009;135:81–90.

114. Gupta V, Bhinge KN, Hosain SB, Xiong K, Gu X, Shi R, et al. Ceramide Glycosylation by Glucosylceramide Synthase Selectively Maintains the Properties of Breast Cancer Stem Cells. J Biol Chem. 2012;287:37195–205.

115. Ballereau S, Levade T, Genisson Y, Andrieu-Abadie N. Alteration of Ceramide 1-O- Functionalization as a Promising Approach for Cancer Therapy. Anticancer Agents Med Chem. 2012;12:316–28.

122

116. Atilla-Gokcumen GE, Bedigian AV, Sasse S, Eggert US. Inhibition of Glycosphingolipid Biosynthesis Induces Cytokinesis Failure. J Am Chem Soc. 2011;133:10010–3.

117. Sidransky E. Gaucher Disease: Insights from a Rare Mendelian Disorder. Discov Med. 2012;14:273–81.

118. McEachern KA, Fung J, Komarnitsky S, Siegel CS, Chuang W-L, Hutto E, et al. A specific and potent inhibitor of glucosylceramide synthase for substrate inhibition therapy of Gaucher disease. Mol Genet Metab. 2007;91:259–67.

119. Lukina E, Watman N, Arreguin EA, Dragosky M, Iastrebner M, Rosenbaum H, et al. Improvement in hematological, visceral, and skeletal manifestations of Gaucher disease type 1 with oral eliglustat tartrate (Genz-112638) treatment: 2-year results of a phase 2 study. Blood. 2010;116:4095–8.

120. Butters TD, Dwek RA, Platt FM. Imino sugar inhibitors for treating the lysosomal glycosphingolipidoses. Glycobiology. 2005;15:43R–52R.

121. Pyne NJ, Pyne S. Sphingosine 1-phosphate and cancer. Nat Rev Cancer. 2010;10:489–503.

122. Hla T. Signaling and biological actions of sphingosine 1-phosphate. Pharmacol Res. 2003;47:401–7.

123. Dimanche-Boitrel M-T, Rebillard A. Sphingolipids and Response to Chemotherapy. In: Gulbins E, Petrache I, editors. Sphingolipids Dis [Internet]. Springer Vienna; 2013 [cited 2014 Mar 9]. page 73–91. Available from: http://link.springer.com/chapter/10.1007/978- 3-7091-1511-4_4

124. French KJ, Schrecengost RS, Lee BD, Zhuang Y, Smith SN, Eberly JL, et al. Discovery and Evaluation of Inhibitors of Human Sphingosine Kinase. Cancer Res. 2003;63:5962–9.

125. Heffernan-Stroud LA, Obeid LM. Chapter Seven - Sphingosine Kinase 1 in Cancer. In: James S. Norris, editor. Adv Cancer Res [Internet]. Academic Press; 2013 [cited 2013 Nov 7]. page 201–35. Available from: http://www.sciencedirect.com/science/article/pii/B9780123942746000078

126. Ruckhäberle E, Rody A, Engels K, Gaetje R, Minckwitz G von, Schiffmann S, et al. Microarray analysis of altered sphingolipid metabolism reveals prognostic significance of sphingosine kinase 1 in breast cancer. Breast Cancer Res Treat. 2008;112:41–52.

127. Ruckhäberle E, Karn T, Denkert C, Loibl S, Ataseven B, Reimer T, et al. Predictive value of sphingosine kinase 1 expression in neoadjuvant treatment of breast cancer. J Cancer Res Clin Oncol. 1–9.

128. Pchejetski D, Golzio M, Bonhoure E, Calvet C, Doumerc N, Garcia V, et al. Sphingosine kinase-1 as a chemotherapy sensor in prostate adenocarcinoma cell and mouse models. Cancer Res. 2005;65:11667–75. 123

129. Nava VE, Hobson JP, Murthy S, Milstien S, Spiegel S. Sphingosine kinase type 1 promotes estrogen-dependent tumorigenesis of breast cancer MCF-7 cells. Exp Cell Res. 2002;281:115–27.

130. Akao Y, Banno Y, Nakagawa Y, Hasegawa N, Kim T-J, Murate T, et al. High expression of sphingosine kinase 1 and S1P receptors in chemotherapy-resistant prostate cancer PC3 cells and their camptothecin-induced up-regulation. Biochem Biophys Res Commun. 2006;342:1284–90.

131. Sukocheva O, Wang L, Verrier E, Vadas MA, Xia P. Restoring Endocrine Response in Breast Cancer Cells by Inhibition of the Sphingosine Kinase-1 Signaling Pathway. Endocrinology. 2009;150:4484–92.

132. Scolan EL, Pchejetski D, Banno Y, Denis N, Mayeux P, Vainchenker W, et al. Overexpression of sphingosine kinase 1 is an oncogenic event in erythroleukemic progression. Blood. 2005;106:1808–16.

133. Dickson MA, Carvajal RD, Merrill AH, Gonen M, Cane LM, Schwartz GK. A Phase I Clinical Trial of Safingol in Combination with Cisplatin in Advanced Solid Tumors. Clin Cancer Res. 2011;17:2484–92.

134. Kihara A, Mitsutake S, Mizutani Y, Igarashi Y. Metabolism and biological functions of two phosphorylated sphingolipids, sphingosine 1-phosphate and ceramide 1-phosphate. Prog Lipid Res. 2007;46:126–44.

135. Wiegmann K, Schütze S, Machleidt T, Witte D, Krönke M. Functional dichotomy of neutral and acidic sphingomyelinases in tumor necrosis factor signaling. Cell. 1994;78:1005–15.

136. Adam-Klages S, Adam D, Wiegmann K, Struve S, Kolanus W, Schneider-Mergener J, et al. FAN, a Novel WD-Repeat Protein, Couples the p55 TNF-Receptor to Neutral Sphingomyelinase. Cell. 1996;86:937–47.

137. Holthuis JCM, Pomorski T, Raggers RJ, Sprong H, Van Meer G. The Organizing Potential of Sphingolipids in Intracellular Membrane Transport. Physiol Rev. 2001;81:1689–723.

138. Baron CL, Malhotra V. Role of Diacylglycerol in PKD Recruitment to the TGN and Protein Transport to the Plasma Membrane. Science. 2002;295:325–8.

139. Hannun YA, Obeid LM. The Ceramide-centric Universe of Lipid-mediated Cell Regulation: Stress Encounters of the Lipid Kind. J Biol Chem. 2002;277:25847–50.

140. Hampton RY, Morand OH. Sphingomyelin synthase and PKC activation. Science. 1989;246:1050.

141. Luberto C, Hannun YA. Sphingomyelin Synthase, a Potential Regulator of Intracellular Levels of Ceramide and Diacylglycerol during SV40 Transformation DOES

124

SPHINGOMYELIN SYNTHASE ACCOUNT FOR THE PUTATIVE PHOSPHATIDYLCHOLINE- SPECIFIC PHOSPHOLIPASE C? J Biol Chem. 1998;273:14550–9.

142. Riboni L, Viani P, Bassi R, Giussani P, Tettamanti G. Basic Fibroblast Growth Factor- induced Proliferation of Primary Astrocytes EVIDENCE FOR THE INVOLVEMENT OF SPHINGOMYELIN BIOSYNTHESIS. J Biol Chem. 2001;276:12797–804.

143. Bajjalieh SM, Martin TF, Floor E. Synaptic vesicle ceramide kinase. A calcium-stimulated lipid kinase that co-purifies with brain synaptic vesicles. J Biol Chem. 1989;264:14354–60.

144. Kolesnick RN, Hemer MR. Characterization of a ceramide kinase activity from human leukemia (HL-60) cells. Separation from diacylglycerol kinase activity. J Biol Chem. 1990;265:18803–8.

145. Dressler KA, Kolesnick RN. Ceramide 1-phosphate, a novel phospholipid in human leukemia (HL-60) cells. Synthesis via ceramide from sphingomyelin. J Biol Chem. 1990;265:14917–21.

146. Bornancin F. Ceramide kinase: the first decade. Cell Signal. 2011;23:999–1008.

147. Sugiura M, Kono K, Liu H, Shimizugawa T, Minekura H, Spiegel S, et al. Ceramide Kinase, a Novel Lipid Kinase MOLECULAR CLONING AND FUNCTIONAL CHARACTERIZATION. J Biol Chem. 2002;277:23294–300.

148. Kim T-J, Mitsutake S, Igarashi Y. The interaction between the pleckstrin homology domain of ceramide kinase and phosphatidylinositol 4,5-bisphosphate regulates the plasma membrane targeting and ceramide 1-phosphate levels. Biochem Biophys Res Commun. 2006;342:611–7.

149. Carré A, Graf C, Stora S, Mechtcheriakova D, Csonga R, Urtz N, et al. Ceramide kinase targeting and activity determined by its N-terminal pleckstrin homology domain. Biochem Biophys Res Commun. 2004;324:1215–9.

150. Kim T-J, Mitsutake S, Kato M, Igarashi Y. The leucine 10 residue in the pleckstrin homology domain of ceramide kinase is crucial for its catalytic activity. FEBS Lett. 2005;579:4383–8.

151. Rovina P, Jaritz M, Höfinger S, Graf C, Dévay P, Billich A, et al. A critical β6–β7 loop in the pleckstrin homology domain of ceramide kinase. Biochem J. 2006;400:255.

152. Rovina P, Schanzer A, Graf C, Mechtcheriakova D, Jaritz M, Bornancin F. Subcellular localization of ceramide kinase and ceramide kinase-like protein requires interplay of their Pleckstrin Homology domain-containing N-terminal regions together with C- terminal domains. Biochim Biophys Acta BBA - Mol Cell Biol Lipids. 2009;1791:1023–30.

153. Mitsutake S, Igarashi Y. Calmodulin Is Involved in the Ca2+-dependent Activation of Ceramide Kinase as a Calcium Sensor. J Biol Chem. 2005;280:40436–41. 125

154. Chen W-Q, Graf C, Zimmel D, Rovina P, Krapfenbauer K, Jaritz M, et al. Ceramide Kinase Profiling by Mass Spectrometry Reveals a Conserved Phosphorylation Pattern Downstream of the Catalytic Site. J Proteome Res. 2010;9:420–9.

155. Overloop HV, Sofie Gijsbers, Veldhoven PPV. Further characterization of mammalian ceramide kinase: substrate delivery and (stereo)specificity, tissue distribution, and subcellular localization studies. J Lipid Res. 2006;47:268–83.

156. Hinkovska-Galcheva V, Boxer LA, Kindzelskii A, Hiraoka M, Abe A, Goparju S, et al. Ceramide 1-Phosphate, a Mediator of Phagocytosis. J Biol Chem. 2005;280:26612–21.

157. Tsuji K, Mitsutake S, Yokose U, Sugiura M, Kohama T, Igarashi Y. Role of ceramide kinase in peroxisome proliferator-activated receptor beta-induced cell survival of mouse keratinocytes. FEBS J. 2008;275:3815–26.

158. Euskirchen G, Royce TE, Bertone P, Martone R, Rinn JL, Nelson FK, et al. CREB Binds to Multiple Loci on Human Chromosome 22. Mol Cell Biol. 2004;24:3804–14.

159. Wijesinghe DS, Massiello A, Subramanian P, Szulc Z, Bielawska A, Chalfant CE. Substrate specificity of human ceramide kinase. J Lipid Res. 2005;46:2706–16.

160. Boudker O, Futerman AH. Detection and characterization of ceramide-1-phosphate phosphatase activity in rat liver plasma membrane. J Biol Chem. 1993;268:22150–5.

161. Brindley DN, Xu J, Jasinska R, Waggoner DW. [27] Analysis of ceramide 1-phosphate and sphingosine-1-phosphate phosphatase activities. In: Alfred H. Merrill J, Yusuf A. Hannun, editor. Methods Enzymol [Internet]. Academic Press; 2000 [cited 2014 Mar 13]. page 233–44. Available from: http://www.sciencedirect.com/science/article/pii/S0076687900110869

162. Shinghal R, Scheller RH, Bajjalieh SM. Ceramide 1-phosphate phosphatase activity in brain. J Neurochem. 1993;61:2279–85.

163. Lamour NF, Stahelin RV, Wijesinghe DS, Maceyka M, Wang E, Allegood JC, et al. Ceramide kinase uses ceramide provided by ceramide transport protein: localization to organelles of eicosanoid synthesis. J Lipid Res. 2007;48:1293–304.

164. Kumagai K, Yasuda S, Okemoto K, Nishijima M, Kobayashi S, Hanada K. CERT Mediates Intermembrane Transfer of Various Molecular Species of Ceramides. J Biol Chem. 2005;280:6488–95.

165. Boath A, Graf C, Lidome E, Ullrich T, Nussbaumer P, Bornancin F. Regulation and Traffic of Ceramide 1-Phosphate Produced by Ceramide Kinase COMPARATIVE ANALYSIS TO GLUCOSYLCERAMIDE AND SPHINGOMYELIN. J Biol Chem. 2008;283:8517–26.

126

166. Mitsutake S, Yokose U, Kato M, Matsuoka I, Yoo J-M, Kim T-J, et al. The generation and behavioral analysis of ceramide kinase-null mice, indicating a function in cerebellar Purkinje cells. Biochem Biophys Res Commun. 2007;363:519–24.

167. Graf C, Zemann B, Rovina P, Urtz N, Schanzer A, Reuschel R, et al. Neutropenia with Impaired Immune Response to Streptococcus pneumoniae in Ceramide Kinase-Deficient Mice. J Immunol. 2008;180:3457–66.

168. Waggoner DW, Johnson LB, Mann PC, Morris V, Guastella J, Bajjalieh SM. MuLK, a Eukaryotic Multi-substrate Lipid Kinase. J Biol Chem. 2004;279:38228–35.

169. Gómez-Muñoz A. Ceramide-1-phosphate: a novel regulator of cell activation. FEBS Lett. 2004;562:5–10.

170. Gomez-Muñoz A, Duffy PA, Martin A, O’Brien L, Byun HS, Bittman R, et al. Short-chain ceramide-1-phosphates are novel stimulators of DNA synthesis and cell division: antagonism by cell-permeable ceramides. Mol Pharmacol. 1995;47:833–9.

171. Gómez-Muñoz A, Kong JY, Salh B, Steinbrecher UP. Ceramide-1-phosphate blocks apoptosis through inhibition of acid sphingomyelinase in macrophages. J Lipid Res. 2004;45:99–105.

172. Subramanian P, Stahelin RV, Szulc Z, Bielawska A, Cho W, Chalfant CE. Ceramide 1- Phosphate Acts as a Positive Allosteric Activator of Group IVA Cytosolic Phospholipase A2α and Enhances the Interaction of the Enzyme with Phosphatidylcholine. J Biol Chem. 2005;280:17601–7.

173. Lamour NF, Chalfant CE. Ceramide-1-phosphate: the “missing” link in eicosanoid biosynthesis and inflammation. Mol Interv. 2005;5:358–67.

174. Wang D, DuBois RN. Eicosanoids and cancer. Nat Rev Cancer. 2010;10:181–93.

175. Chalfant CE, Rathman K, Pinkerman RL, Wood RE, Obeid LM, Ogretmen B, et al. De Novo Ceramide Regulates the Alternative Splicing of Caspase 9 and Bcl-x in A549 Lung Adenocarcinoma Cells DEPENDENCE ON PROTEIN PHOSPHATASE-1. J Biol Chem. 2002;277:12587–95.

176. Lin L-L, Wartmann M, Lin AY, Knopf JL, Seth A, Davis RJ. cPLA2 is phosphorylated and activated by MAP kinase. Cell. 1993;72:269–78.

177. Gómez-Muñoz A, Kong JY, Parhar K, Wang SW, Gangoiti P, González M, et al. Ceramide-1- phosphate promotes cell survival through activation of the phosphatidylinositol 3- kinase/protein kinase B pathway. FEBS Lett. 2005;579:3744–50.

178. Mitra P, Maceyka M, Payne SG, Lamour N, Milstien S, Chalfant CE, et al. Ceramide kinase regulates growth and survival of A549 human lung adenocarcinoma cells. FEBS Lett. 2007;581:735–40. 127

179. Gangoiti P, Granado MH, Wang SW, Kong JY, Steinbrecher UP, Gómez-Muñoz A. Ceramide 1-phosphate stimulates macrophage proliferation through activation of the PI3-kinase/PKB, JNK and ERK1/2 pathways. Cell Signal. 2008;20:726–36.

180. Gangoiti P, Granado MH, Arana L, Ouro A, Gómez-Muñoz A. Involvement of nitric oxide in the promotion of cell survival by ceramide 1-phosphate. FEBS Lett. 2008;582:2263–9.

181. Granado MH, Gangoiti P, Ouro A, Arana L, Gómez-Muñoz A. Ceramide 1-phosphate inhibits serine palmitoyltransferase and blocks apoptosis in alveolar macrophages. Biochim Biophys Acta BBA - Mol Cell Biol Lipids. 2009;1791:263–72.

182. Gangoiti P, Granado MH, Arana L, Ouro A, Gomez-Muñoz A. Activation of protein kinase C-alpha is essential for stimulation of cell proliferation by ceramide 1-phosphate. FEBS Lett. 2010;584:517–24.

183. Gangoiti P, Arana L, Ouro A, Granado MH, Trueba M, Gómez-Muñoz A. Activation of mTOR and RhoA is a major mechanism by which ceramide 1-phosphate stimulates macrophage proliferation. Cell Signal. 2011;23:27–34.

184. Gomez-Muñoz A, Frago LM, Alvarez L, Varela-Nieto I. Stimulation of DNA synthesis by natural ceramide 1-phosphate. Biochem J. 1997;325 ( Pt 2):435–40.

185. Simanshu DK, Kamlekar RK, Wijesinghe DS, Zou X, Zhai X, Mishra SK, et al. Non-vesicular trafficking by a ceramide-1-phosphate transfer protein regulates eicosanoids. Nature. 2013;

186. Graf C, Klumpp M, Habig M, Rovina P, Billich A, Baumruker T, et al. Targeting Ceramide Metabolism with a Potent and Specific Ceramide Kinase Inhibitor. Mol Pharmacol. 2008;74:925–32.

187. Kim J-W, Inagaki Y, Mitsutake S, Maezawa N, Katsumura S, Ryu Y-W, et al. Suppression of mast cell degranulation by a novel ceramide kinase inhibitor, the F-12509A olefin isomer K1. Biochim Biophys Acta BBA - Mol Cell Biol Lipids. 2005;1738:82–90.

188. Kim J-W, Inagaki Y, Mitsutake S, Maezawa N, Katsumura S, Ryu Y-W, et al. Corrigendum to “Suppression of mast cell degranulation by a novel ceramide kinase inhibitor, the F- 12509A olefin isomer K1” [Biochim. Biophys. Acta 1738 (2005) 82–90]. Biochim Biophys Acta BBA - Mol Cell Biol Lipids. 2007;1771:1262.

189. Kumada H, Mitsutake S, Inagaki Y, Mitsunaga S, Tsuchikawa H, Katsumura S, et al. Kinetics of the Ceramide Kinase Inhibitor K1, a Suppressor of Mast-Cell Activation. Biosci Biotechnol Biochem. 2007;71:2581–4.

190. Ruckhäberle E, Karn T, Rody A, Hanker L, Gätje R, Metzler D, et al. Gene expression of ceramide kinase, galactosyl ceramide synthase and ganglioside GD3 synthase is associated with prognosis in breast cancer. J Cancer Res Clin Oncol. 2009;135:1005–13.

128

191. Kossenkov AV, Vachani A, Chang C, Nichols C, Billouin S, Horng W, et al. Resection of Non- Small Cell Lung Cancers Reverses Tumor-Induced Gene Expression Changes in the Peripheral Immune System. Clin Cancer Res Off J Am Assoc Cancer Res. 2011;17:5867–77.

192. Juul N, Szallasi Z, Eklund AC, Li Q, Burrell RA, Gerlinger M, et al. Assessment of an RNA interference screen-derived mitotic and ceramide pathway metagene as a predictor of response to neoadjuvant paclitaxel for primary triple-negative breast cancer: a retrospective analysis of five clinical trials. Lancet Oncol. 2010;11:358–65.

193. Hsieh S-Y, Hsu C-Y, He J-R, Liu C-L, Lo S-J, Chen Y-C, et al. Identifying apoptosis-evasion proteins/pathways in human hepatoma cells via induction of cellular hormesis by UV irradiation. J Proteome Res. 2009;8:3977–86.

194. Gangoiti P, Granado MH, Alonso A, Goñi FM, Gómez-Muñoz A. Implication of ceramide, ceramide 1-phosphate and sphingosine 1-phosphate in tumorigenesis. Transl Oncogenomics. 2008;3:81–98.

195. Ishihara S, Rumi MAK, Okuyama T, Kinoshita Y. Effect of prostaglandins on the regulation of tumor growth. Curr Med Chem Anti-Cancer Agents. 2004;4:379–87.

196. Wang D, DuBois RN. Prostaglandins and Cancer. Gut. 2006;55:115–22.

197. Morad SAF, Cabot MC. Ceramide-orchestrated signalling in cancer cells. Nat Rev Cancer. 2013;13:51–65.

198. Alvarez JV, Pan T-C, Ruth J, Feng Y, Zhou A, Pant D, et al. Par-4 Downregulation Promotes Breast Cancer Recurrence by Preventing Multinucleation following Targeted Therapy. Cancer Cell. 2013;24:30–44.

199. Paddison PJ, Cleary M, Silva JM, Chang K, Sheth N, Sachidanandam R, et al. Cloning of short hairpin RNAs for gene knockdown in mammalian cells. Nat Methods. 2004;1:163–7.

200. Chang HY, Nuyten DSA, Sneddon JB, Hastie T, Tibshirani R, Sørlie T, et al. Robustness, scalability, and integration of a wound-response gene expression signature in predicting breast cancer survival. Proc Natl Acad Sci U S A. 2005;102:3738–43.

201. Chanrion M, Negre V, Fontaine H, Salvetat N, Bibeau F, Grogan GM, et al. A Gene Expression Signature that Can Predict the Recurrence of Tamoxifen-Treated Primary Breast Cancer. Clin Cancer Res. 2008;14:1744–52.

202. Chin S-F, Wang Y, Thorne NP, Teschendorff AE, Pinder SE, Vias M, et al. Using array- comparative genomic hybridization to define molecular portraits of primary breast cancers. Oncogene. 2007;26:1959–70.

203. Desmedt C, Piette F, Loi S, Wang Y, Lallemand F, Haibe-Kains B, et al. Strong time dependence of the 76-gene prognostic signature for node-negative breast cancer

129

patients in the TRANSBIG multicenter independent validation series. Clin Cancer Res Off J Am Assoc Cancer Res. 2007;13:3207–14.

204. Esserman LJ, Berry DA, DeMichele A, Carey L, Davis SE, Buxton M, et al. Pathologic Complete Response Predicts Recurrence-Free Survival More Effectively by Cancer Subset: Results From the I-SPY 1 TRIAL—CALGB 150007/150012, ACRIN 6657. J Clin Oncol. 2012;30:3242–9.

205. Hess KR, Anderson K, Symmans WF, Valero V, Ibrahim N, Mejia JA, et al. Pharmacogenomic Predictor of Sensitivity to Preoperative Chemotherapy With Paclitaxel and Fluorouracil, Doxorubicin, and Cyclophosphamide in Breast Cancer. J Clin Oncol. 2006;24:4236–44.

206. Ivshina AV, George J, Senko O, Mow B, Putti TC, Smeds J, et al. Genetic reclassification of histologic grade delineates new clinical subtypes of breast cancer. Cancer Res. 2006;66:10292–301.

207. Ma X-J, Wang Z, Ryan PD, Isakoff SJ, Barmettler A, Fuller A, et al. A two-gene expression ratio predicts clinical outcome in breast cancer patients treated with tamoxifen. Cancer Cell. 2004;5:607–16.

208. Minn AJ, Gupta GP, Padua D, Bos P, Nguyen DX, Nuyten D, et al. Lung metastasis genes couple breast tumor size and metastatic spread. Proc Natl Acad Sci U S A. 2007;104:6740–5.

209. Oh DS, Troester MA, Usary J, Hu Z, He X, Fan C, et al. Estrogen-regulated genes predict survival in hormone receptor-positive breast cancers. J Clin Oncol Off J Am Soc Clin Oncol. 2006;24:1656–64.

210. Pawitan Y, Bjöhle J, Amler L, Borg A-L, Egyhazi S, Hall P, et al. Gene expression profiling spares early breast cancer patients from adjuvant therapy: derived and validated in two population-based cohorts. Breast Cancer Res BCR. 2005;7:R953–964.

211. Schmidt M, Victor A, Bratzel D, Boehm D, Cotarelo C, Lebrecht A, et al. Long-term outcome prediction by clinicopathological risk classification algorithms in node-negative breast cancer--comparison between Adjuvant!, St Gallen, and a novel risk algorithm used in the prospective randomized Node-Negative-Breast Cancer-3 (NNBC-3) trial. Ann Oncol Off J Eur Soc Med Oncol ESMO. 2009;20:258–64.

212. Sotiriou C, Wirapati P, Loi S, Harris A, Fox S, Smeds J, et al. Gene expression profiling in breast cancer: understanding the molecular basis of histologic grade to improve prognosis. J Natl Cancer Inst. 2006;98:262–72.

213. Wang Y, Klijn JGM, Zhang Y, Sieuwerts AM, Look MP, Yang F, et al. Gene-expression profiles to predict distant metastasis of lymph-node-negative primary breast cancer. Lancet. 2005;365:671–9.

130

214. Niwa S, Graf C, Bornancin F. Ceramide kinase deficiency impairs microendothelial cell angiogenesis in vitro. Microvasc Res. 2009;77:389–93.

215. Stern P, Astrof S, Erkeland SJ, Schustak J, Sharp PA, Hynes RO. A system for Cre-regulated RNA interference in vivo. Proc Natl Acad Sci. 2008;105:13895–900.

216. Singh MS, Francis PA, Michael M. Tamoxifen, cytochrome P450 genes and breast cancer clinical outcomes. The Breast. 2011;20:111–8.

217. Wang D, Dubois RN. Cyclooxygenase-2: a potential target in breast cancer. Semin Oncol. 2004;31:64–73.

218. Mestre JR, Subbaramaiah K, Sacks PG, Schantz SP, Tanabe T, Inoue H, et al. Retinoids Suppress Epidermal Growth Factor-induced Transcription of Cyclooxygenase-2 in Human Oral Squamous Carcinoma Cells. Cancer Res. 1997;57:2890–5.

219. Harris RE. Cyclooxygenase-2 (cox-2) blockade in the chemoprevention of cancers of the colon, breast, prostate, and lung. Inflammopharmacology. 2009;17:55–67.

220. Flossmann E, Rothwell PM. Effect of aspirin on long-term risk of colorectal cancer: consistent evidence from randomised and observational studies. The Lancet. 2007;369:1603–13.

221. Chan AT, Ogino S, Fuchs CS. Aspirin and the Risk of Colorectal Cancer in Relation to the Expression of COX-2. N Engl J Med. 2007;356:2131–42.

222. Wang D, Buchanan FG, Wang H, Dey SK, DuBois RN. Prostaglandin E2 Enhances Intestinal Adenoma Growth via Activation of the Ras-Mitogen-Activated Protein Kinase Cascade. Cancer Res. 2005;65:1822–9.

223. Zhou J, Suzuki T, Kovacic A, Saito R, Miki Y, Ishida T, et al. Interactions between Prostaglandin E2, Liver Receptor Homologue-1, and Aromatase in Breast Cancer. Cancer Res. 2005;65:657–63.

224. Thivierge M, Gouill CL, Tremblay MJ, Stanková J, Rola-Pleszczynski M. Prostaglandin E2 Induces Resistance to Human Immunodeficiency Virus-1 Infection in Monocyte-Derived Macrophages: Downregulation of CCR5 Expression by Cyclic Adenosine Monophosphate. Blood. 1998;92:40–5.

225. Simpkins CO, Mazorow DL, Alailima ST, Tate EA, Sweatt W, Johnson M, et al. Prostaglandin D2 modulates human neutrophil intracellular calcium flux and inhibits superoxide release via its ring carbonyl. Life Sci. 1990;46:793–801.

226. Sullards MC, Liu Y, Chen Y, Merrill Jr. AH. Analysis of mammalian sphingolipids by liquid chromatography tandem mass spectrometry (LC-MS/MS) and tissue imaging mass spectrometry (TIMS). Biochim Biophys Acta BBA - Mol Cell Biol Lipids. 2011;1811:838–53.

131

227. Kasumov T, Huang H, Chung Y-M, Zhang R, McCullough AJ, Kirwan JP. Quantification of ceramide species in biological samples by liquid chromatography electrospray ionization tandem mass spectrometry. Anal Biochem. 2010;401:154–61.

228. Cao H, Xiao L, Park G, Wang X, Azim AC, Christman JW, et al. An improved LC-MS-MS method for the quantification of prostaglandins E2 and D2 production in biological fluids. Anal Biochem. 2008;372:41–51.

229. Riendeau D, Guay J, Weech PK, Laliberté F, Yergey J, Li C, et al. Arachidonyl trifluoromethyl ketone, a potent inhibitor of 85-kDa phospholipase A2, blocks production of arachidonate and 12-hydroxyeicosatetraenoic acid by calcium ionophore-challenged platelets. J Biol Chem. 1994;269:15619–24.

230. Ventura A, Meissner A, Dillon CP, McManus M, Sharp PA, Parijs LV, et al. Cre-lox- regulated conditional RNA interference from transgenes. Proc Natl Acad Sci U S A. 2004;101:10380–5.

132