Biochimica et Biophysica Acta 1792 (2009) 112–121 Contents lists available at ScienceDirect Biochimica et Biophysica Acta journal homepage: www.elsevier.com/locate/bbadis Characterization of the first FGFRL1 mutation identified in a craniosynostosis patient Thorsten Rieckmann a, Lei Zhuang a, Christa E. Flück a,b, Beat Trueb a,c,⁎ a Department of Clinical Research, University of Bern, 3010 Bern, Switzerland b Department of Pediatrics, University Children's Hospital, 3010 Bern, Switzerland c Department of Rheumatology, University Hospital, 3010 Bern, Switzerland article info abstract Article history: Fibroblast growth factor receptor-like 1 (FGFRL1) is a recently discovered transmembrane protein whose Received 20 July 2008 functions remain unclear. Since mutations in the related receptors FGFR1-3 cause skeletal malformations, Received in revised form 3 November 2008 DNA samples from 55 patients suffering from congenital skeletal malformations and 109 controls were Accepted 4 November 2008 searched for mutations in FGFRL1. One patient was identified harboring a frameshift mutation in the Available online 13 November 2008 intracellular domain of this novel receptor. The patient showed craniosynostosis, radio-ulnar synostosis and genital abnormalities and had previously been diagnosed with Antley–Bixler syndrome. The effect of the Keywords: Fibroblast growth factor (FGF) FGFRL1 mutation was studied in vitro. In a reporter gene assay, the wild-type as well as the mutant receptor Fibroblast growth factor receptor (FGFR) inhibited FGF signaling. However, the mutant protein differed from the wild-type protein in its subcellular FGFRL1 localization. Mutant FGFRL1 was mainly found at the plasma membrane where it interacted with FGF ligands, Craniosynostosis while the wild-type protein was preferentially located in vesicular structures and the Golgi complex. Two Antley-Bixler syndrome ABS motifs from the intracellular domain of FGFRL1 appeared to be responsible for this differential distribution, a Skeletal malformation tandem tyrosine based motif and a histidine-rich sequence. Deletion of either one led to the preferential redistribution of FGFRL1 to the plasma membrane. It is therefore likely that mutant FGFRL1 contributes to the skeletal malformations of the patient. © 2008 Elsevier B.V. All rights reserved. 1. Introduction Conserved sequences for FGFRL1 are found in vertebrates from fish to man [8–10] and in the cephalochordate amphioxus [11], but not in the Organogenesis and pattern formation are controlled by many urochordate Ciona or in other invertebrates. In vitro, recombinant cytokines and growth factors, including the fibroblast growth factors FGFRL1 interacts with FGF2 and with heparin [9]. However, in contrast (FGFs). In human beings and mice, the FGFs form a large family of 22 to the classical FGFRs, it forms constitutive dimers at the surface of the structurally related proteins that bind with varying affinity to four cells even in the absence of FGF or heparin. These dimers promote cell different FGF receptors (FGFR1–FGFR4) [1–3]. Binding to the receptors adhesion in a way similar to other adhesion molecules located at cell- is stabilized by heparin and heparan sulfate chains. The FGFRs belong cell junctions [12]. to the tyrosine kinase receptors and contain three extracellular FGFRL1 is expressed primarily in cartilage and some muscles [13]. immunoglobulin (Ig)-like domains, a single transmembrane domain Our current data suggest that FGFRL1 has a negative effect on cell and an intracellular tyrosine kinase domain. Upon binding of ligands growth and a positive effect on cell differentiation. When over- and heparin, the receptors dimerize and transduce the signal to the expressed in osteosarcoma cells, it inhibits cell proliferation [9].In interior of the cells by autophosphorylation of selected tyrosine ovary tumors, its synthesis is largely perturbed when compared to residues at the cytoplasmic domain [4]. matched control tissues [14]. In a zebrafish model, inhibition of A while ago, we discovered an additional FGFR in a cartilage- FGFRL1 synthesis with the help of morpholino constructs inhibited specific cDNA library and termed it FGFRL1 [5]. Independently, two the proper development of the pharyngeal arches, suggesting a role other research groups described the same receptor and termed it for FGFRL1 in cartilage formation [15]. Recently, we have prepared a FGFR5 [6,7]. Similar to the classical FGFRs, FGFRL1 contains three mouse model with a targeted disruption of the Fgfrl1 gene [16]. These extracellular Ig-like domains and a single transmembrane domain. knock-out mice develop normally until birth, but die immediately However, in contrast to the classical receptors, it lacks the intracellular after birth due to respiratory failure. The respiratory problems are tyrosine kinase domain, but instead contains a short cytoplasmic tail explained by a reduction of the diaphragm muscle, which is not strong of ∼100 amino acid residues with a peculiar histidine-rich motif. enough to inflate the lungs after birth. Thus, FGFRL1 plays a critical role in the development of cartilage and the diaphragm. Germline mutations in FGFRs cause a variety of skeletal disorders ⁎ Corresponding author. Department of Clinical Research, Murtenstr. 35, PO Box 43, CH-3010 Bern, Switzerland. Fax: +41 632 4963. [17,18]. Craniosynostosis, a relatively common malformation of the E-mail address: [email protected] (B. Trueb). human skull, occurs in approximately one of 2500 individuals [18]. 0925-4439/$ – see front matter © 2008 Elsevier B.V. All rights reserved. doi:10.1016/j.bbadis.2008.11.006 T. Rieckmann et al. / Biochimica et Biophysica Acta 1792 (2009) 112–121 113 Some of these patients exhibit alterations in the genes for FGFRs, (CRL-1573), human lung fibroblasts VA13 (CCL 75.1), Chinese hamster primarily in FGFR2 and FGFR1. Missense mutations, deletions, ovary cells CHO-K1 (CCL-61), mouse embryonic fibroblasts 3T3 insertions and splice mutations have been identified causing a variety (CCL-163), and mouse osteoblast-like cells MC3T3-E1 (CRL-2593). of syndromes such as Pfeiffer, Crouzon, Jackson-Weiss, Apert, Beare- Most of these cells were maintained at 37 °C under an atmosphere of Stevenson and Antley–Bixler. Mutations in FGFR3 mostly lead to 5% v/v CO2 in Dulbecco's modified Eagle's medium (DMEM) malformations of the limbs as observed in chondrodysplasias, but can supplemented with 10% v/v fetal bovine serum, 100 units/ml penicillin also cause Muenke syndrome and Crouzon syndrome with acanthosis and 100 µg/ml streptomycin. The medium for SW1353 cells, CHO-K1 nigricans. cells and HEK293 cells under puromycin selection was further In this report, we analyzed the FGFRL1 gene from 55 patients with enriched with non-essential amino acids. MC3T3-E1 cells were different congenital skeletal disorders. We found one patient with propagated in α-minimum essential medium (αMEM). a craniosynostosis syndrome who had a frameshift mutation in the C-terminal domain of the FGFRL1 sequence. Our in vitro studies 2.3. Plasmids indicate that the mutated FGFRL1 protein differs significantly from the wild-type protein in its subcellular localization. The reading frame for human FGFRL1 [5] was inserted into the Bam HI/Xba I site of the expression vector pcDNA3.1 (Invitrogen, Carlsbad 2. Materials and methods CA). For most studies, a special version of pcDNA3 was used, in which the neomycin resistance gene had been replaced by the puromycin 2.1. Genomic sequencing resistance gene. Several truncated versions were derived from the full- length construct by PCR. These covered the nucleotide sequences for Various genomic DNA samples were purchased from the European amino acids 1-416 (FGFRL1ΔC), 1-468 (FGFRL1ΔTyrΔHis), and 1-478 Collection of Cell Cultures (ECACC, Salisbury, England): human (FGFRL1ΔHis). Likewise, the open reading frame for FGFRL1 from random control DNA panel HRC-1, human craniosynostosis panel patient BV0449 was inserted into the Bam HI/ RI site of pcDNA3.1. The HC-1, and Antley–Bixler BV0954, BV0956, NP0003. Genomic DNA was dominant negative version of human FGFR1 was amplified by PCR also isolated from blood leukocytes of several patients followed at the from IMAGE clone 3911101 and ligated into the Bam HI/Xho I site of University Children's Hospital of Bern. For these samples ethical pcDNA3.1. The final construct covered amino acid residues 1-415 approval and informed consent was obtained. DNA was extracted with (FGFR1ΔC), but lacked the intracellular tyrosine kinase domain. The the QIAamp DNA Blood Kit according to the supplier's recommenda- ExSite PCR-based technique was used for site-directed mutagenesis tions (Qiagen, Hilden, Germany). All protein coding exons of the (Stratagene Europe, Amsterdam NL). PCR was performed with a FGFRL1 gene were amplified from the genomic DNA by PCR using forward primer that harbored the desired mutation and a phosphory- specific primer pairs and the GC-rich PCR System from Roche lated reverse primer that annealed immediately adjacent to the 5′ end Diagnostics (Rotkreuz, Switzerland). Primer sequences and amplifica- of the forward primer. After amplification of the entire plasmid, the tion conditions were as follows: exon 1, ACCCTTTGTCTGCCTTTGATAC- maternal DNA was digested with Dpn I, and the ends of the remaining CCAC/GGGCACTGTGGCAGGGTTCAG, annealing temperature 66 °C, product were joined by T4 DNA ligase. The open reading frames of all product length 360 bp; exon 2, CAGTGCTCAGGGCTTTGGTGCATGTG/ constructs were verified by DNA