Blueprint Genetics Craniosynostosis Panel

Total Page:16

File Type:pdf, Size:1020Kb

Load more

Craniosynostosis Panel Test code: MA2901 Is a 38 gene panel that includes assessment of non-coding variants. Is ideal for patients with craniosynostosis. About Craniosynostosis Craniosynostosis is defined as the premature fusion of one or more cranial sutures leading to secondary distortion of skull shape. It may result from a primary defect of ossification (primary craniosynostosis) or, more commonly, from a failure of brain growth (secondary craniosynostosis). Premature closure of the sutures (fibrous joints) causes the pressure inside of the head to increase and the skull or facial bones to change from a normal, symmetrical appearance resulting in skull deformities with a variable presentation. Craniosynostosis may occur in an isolated setting or as part of a syndrome with a variety of inheritance patterns and reccurrence risks. Craniosynostosis occurs in 1/2,200 live births. Availability 4 weeks Gene Set Description Genes in the Craniosynostosis Panel and their clinical significance Gene Associated phenotypes Inheritance ClinVar HGMD ALPL Odontohypophosphatasia, Hypophosphatasia perinatal lethal, AD/AR 78 291 infantile, juvenile and adult forms ALX3 Frontonasal dysplasia type 1 AR 8 8 ALX4 Frontonasal dysplasia type 2, Parietal foramina AD/AR 15 24 BMP4 Microphthalmia, syndromic, Orofacial cleft AD 8 39 CDC45 Meier-Gorlin syndrome 7 AR 10 19 EDNRB Hirschsprung disease, ABCD syndrome, Waardenburg syndrome AD/AR 12 66 EFNB1 Craniofrontonasal dysplasia XL 28 116 ERF Craniosynostosis 4 AD 17 16 ESCO2 SC phocomelia syndrome, Roberts syndrome AR 30 31 FGFR1 Pfeiffer syndrome, Trigonocephaly, Hypogonadotropic AD/Digenic/Multigenic 72 257 hypogonadism, Osteoglophonic Dwarfism - Craniostenosis, Hartsfield syndrome FGFR2 Apert syndrome, Pfeiffer syndrome, Jackson-Weiss syndrome, AD 100 154 Lacrimoauriculodentodigital syndrome, Beare-Stevenson cutis gyrata syndrome, Antley-Bixler syndrome without genital anomalies or disordered steroidogenesis, Craniofacial-skeletal- dermatological dysplasia, Crouzon syndrome, Bent bone dysplasia https://blueprintgenetics.com/ FGFR3 Lacrimoauriculodentodigital syndrome, Muenke syndrome, AD/AR 54 77 Crouzon syndrome with acanthosis nigricans, Camptodactyly, tall stature, and hearing loss (CATSHL) syndrome, Achondroplasia, Hypochondroplasia, Thanatophoric dysplasia type 1, Thanatophoric dysplasia type 2, SADDAN FLNB Larsen syndrome (dominant), Atelosteogenesis type 1, AD/AR 43 121 Atelosteogenesis type 3, Spondylo-carpal-tarsal dyspasia FREM1 Bifid nose, Manitoba oculotrichoanal syndrome, Trigonocephaly AD/AR 14 35 GDF5 Multiple synostoses syndrome, Fibular hypoplasia and complex AD/AR 23 53 brachydactyly, Acromesomelic dysplasia, Hunter-Thompson, Symphalangism, proximal, Chondrodysplasia, Brachydactyly type A2, Brachydactyly type C, Grebe dysplasia GLI3 Acrocallosal syndrome, Pallister-Hall syndrome, Grieg AD 70 235 cephalopolysndactyly syndrome, Postaxial polydactyly type A, Preaxial polydactyly type 3, Preaxial polydactyly type 4 IFT122* Sensenbrenner syndrome, Cranioectodermal dysplasia (Levin- AR 13 23 Sensenbrenner) type 1, Cranioectodermal dysplasia (Levin- Sensenbrenner) type 2 IFT140 Short -rib thoracic dysplasia with or without polydactyly, AR 38 63 Asphyxiating thoracic dysplasia (ATD; Jeune) IL11RA Craniosynostosis and dental anomalies AR 7 21 MASP1 3MC syndrome AR 11 22 MEGF8 Carpenter syndrome 2 AR 6 14 MSX2* Parietal foramina, Parietal foramina with cleidocranial dysplasia, AD 9 25 Craniosynostosis Boston type NOG Tarsal-carpal coalition syndrome, Multiple synostosis syndrome, AD 20 63 Stapes ankylosis with broad thumb and toes (Teunissen-Cremers syndrome), Symphalangism, proximal, Brachydactyly type B2 PAX3 Craniofacial-deafness-hand syndrome, Waardenburg syndrome AD/AR 54 149 POR Disordered steroidogenesis due to cytochrome p450 AR 14 70 oxidoreductase deficiency, Antley-Bixler syndrome RAB23# Carpenter syndrome 1 AR 5 15 RECQL4 Baller-Gerold syndrome, RAPADILINO syndrome, Rothmund- AR 82 114 Thomson syndrome SKI Shprintzen-Goldberg syndrome AD 20 23 SOX10 Peripheral demyelinating neuropathy, central dysmyelination, AD 56 148 Waardenburg syndrome, and Hirschsprung disease, Kallmann syndrome SPECC1L Facial clefting, oblique, 1, Opitz GBBB syndrome, type II AD 7 8 TCF12 Craniosynostosis AD 23 56 TGFBR1 Loeys-Dietz syndrome AD 40 69 https://blueprintgenetics.com/ TGFBR2 Loeys-Dietz syndrome AD 58 139 TWIST1 Saethre-Chotzen syndrome, Robinow-Sorauf syndrome, AD 28 205 Craniosynostosis TWIST2 Ablepharon-macrostomia syndrome, Barber-Say syndrome, AD/AR 7 9 Focal facial dermal dysplasia 3, Setleis type WDR19 Retinitis pigmentosa, Nephronophthisis, Short -rib thoracic AR 33 43 dysplasia with or without polydactyly, Senior-Loken syndrome, Cranioectodermal dysplasia (Levin-Sensenbrenner) type 1, Cranioectodermal dysplasia (Levin-Sensenbrenner) type 2, Asphyxiating thoracic dysplasia (ATD; Jeune) WDR35 Cranioectodermal dysplasia (Levin-Sensenbrenner) type 1, AR 28 31 Cranioectodermal dysplasia (Levin-Sensenbrenner) type 2, Short rib-polydactyly syndrome type 5 ZIC1 Craniosynostosis 6 AD 5 9 *Some regions of the gene are duplicated in the genome. Read more. # The gene has suboptimal coverage (means <90% of the gene’s target nucleotides are covered at >20x with mapping quality score (MQ>20) reads), and/or the gene has exons listed under Test limitations section that are not included in the panel as they are not sufficiently covered with high quality sequence reads. The sensitivity to detect variants may be limited in genes marked with an asterisk (*) or number sign (#). Due to possible limitations these genes may not be available as single gene tests. Gene refers to the HGNC approved gene symbol; Inheritance refers to inheritance patterns such as autosomal dominant (AD), autosomal recessive (AR), mitochondrial (mi), X-linked (XL), X-linked dominant (XLD) and X-linked recessive (XLR); ClinVar refers to the number of variants in the gene classified as pathogenic or likely pathogenic in this database (ClinVar); HGMD refers to the number of variants with possible disease association in the gene listed in Human Gene Mutation Database (HGMD). The list of associated, gene specific phenotypes are generated from CGD or Mitomap databases. Non-coding disease causing variants covered by the panel Gene Genomic location HGVS RefSeq RS-number HG19 ALPL Chr1:21835920 c.-195C>T NM_000478.4 ALPL Chr1:21896764 c.793-30_793-11delGGCATGTGCTGACACAGCCC NM_000478.4 EFNB1 ChrX:68049209 c.-411C>G NM_004429.4 EFNB1 ChrX:68049525 c.-95T>C/G NM_004429.4 EFNB1 ChrX:68049525 c.-95T>C NM_004429.4 EFNB1 ChrX:68049525 c.-95T>G NM_004429.4 ESCO2 Chr8:27650167 c.1354-18G>A NM_001017420.2 rs80359865 FGFR2 Chr10:123099960 c.*139411C>T . IFT122 Chr3:129207087 c.2005-13T>A NM_052985.3 IFT140 Chr16:1576595 c.2577+25G>A NM_014714.3 rs1423102192 https://blueprintgenetics.com/ PAX3 Chr2:223085913 c.958+28A>T NM_181459.3 POR Chr7:75544501 c.-5+4A>G NM_000941.2 SOX10 Chr22:38379877 c.-84-2A>T NM_006941.3 SOX10 Chr22:38412215 c.-31954C>T NM_006941.3 rs606231342 SOX10 Chr22:38412781 c.-32520C>G NM_006941.3 rs533778281 TCF12 Chr15:57554272 c.1468-20T>A NM_207036.1 TGFBR2 Chr3:30648317 c.-59C>T NM_001024847.2 TWIST1 Chr7:19157199 c.-255G>A NM_000474.3 TWIST1 Chr7:19157207 c.-263C>A NM_000474.3 WDR35 Chr2:20151929 c.1434-684G>T NM_001006657.1 WDR35 Chr2:20182313 c.143-18T>A NM_001006657.1 Test Strengths The strengths of this test include: CAP accredited laboratory CLIA-certified personnel performing clinical testing in a CLIA-certified laboratory Powerful sequencing technologies, advanced target enrichment methods and precision bioinformatics pipelines ensure superior analytical performance Careful construction of clinically effective and scientifically justified gene panels Some of the panels include the whole mitochondrial genome (please see the Panel Content section) Our Nucleus online portal providing transparent and easy access to quality and performance data at the patient level Our publicly available analytic validation demonstrating complete details of test performance ~2,000 non-coding disease causing variants in our clinical grade NGS assay for panels (please see ‘Non-coding disease causing variants covered by this panel’ in the Panel Content section) Our rigorous variant classification scheme Our systematic clinical interpretation workflow using proprietary software enabling accurate and traceable processing of NGS data Our comprehensive clinical statements Test Limitations Genes with partial, or whole gene, segmental duplications in the human genome are marked with an asterisk (*) if they overlap with the UCSC pseudogene regions. The technology may have limited sensitivity to detect variants in genes marked with these symbols (please see the Panel content table above). This test does not d etect the following: Complex inversions Gene conversions Balanced translocations Some of the panels include the whole mitochondrial genome (please see the Panel Content section) Repeat expansion disorders unless specifically mentioned Non-coding variants deeper than ±20 base pairs from exon-intron boundary unless otherwise indicated (please see above Panel Content / non-coding variants covered by the panel). https://blueprintgenetics.com/ This test may not reliably detect the following: Low level mosaicism in nuclear genes (variant with a minor allele fraction of 14.6% is detected with 90% probability) Stretches of mononucleotide repeats Low level heteroplasmy in mtDNA (>90% are detected at 5% level) Indels larger than 50bp Single exon deletions
Recommended publications
  • The National Economic Burden of Rare Disease Study February 2021

    The National Economic Burden of Rare Disease Study February 2021

    Acknowledgements This study was sponsored by the EveryLife Foundation for Rare Diseases and made possible through the collaborative efforts of the national rare disease community and key stakeholders. The EveryLife Foundation thanks all those who shared their expertise and insights to provide invaluable input to the study including: the Lewin Group, the EveryLife Community Congress membership, the Technical Advisory Group for this study, leadership from the National Center for Advancing Translational Sciences (NCATS) at the National Institutes of Health (NIH), the Undiagnosed Diseases Network (UDN), the Little Hercules Foundation, the Rare Disease Legislative Advocates (RDLA) Advisory Committee, SmithSolve, and our study funders. Most especially, we thank the members of our rare disease patient and caregiver community who participated in this effort and have helped to transform their lived experience into quantifiable data. LEWIN GROUP PROJECT STAFF Grace Yang, MPA, MA, Vice President Inna Cintina, PhD, Senior Consultant Matt Zhou, BS, Research Consultant Daniel Emont, MPH, Research Consultant Janice Lin, BS, Consultant Samuel Kallman, BA, BS, Research Consultant EVERYLIFE FOUNDATION PROJECT STAFF Annie Kennedy, BS, Chief of Policy and Advocacy Julia Jenkins, BA, Executive Director Jamie Sullivan, MPH, Director of Policy TECHNICAL ADVISORY GROUP Annie Kennedy, BS, Chief of Policy & Advocacy, EveryLife Foundation for Rare Diseases Anne Pariser, MD, Director, Office of Rare Diseases Research, National Center for Advancing Translational Sciences (NCATS), National Institutes of Health Elisabeth M. Oehrlein, PhD, MS, Senior Director, Research and Programs, National Health Council Christina Hartman, Senior Director of Advocacy, The Assistance Fund Kathleen Stratton, National Academies of Science, Engineering and Medicine (NASEM) Steve Silvestri, Director, Government Affairs, Neurocrine Biosciences Inc.
  • Increased Nuchal Translucency Precision Panel

    Increased Nuchal Translucency Precision Panel

    Increased Nuchal Translucency Precision Panel Overview Increased Nuchal Translucency (NT) is defined as an abnormal accumulation of fluid in the nuchal area, which is visualized as a thickened sonolucent area. It is a standardized measure obtained between 11 and 14 weeks of gestation to calculate the risk of a fetus being affected by a chromosomal aneuploidy. NT>3.5mm has been found to be associated with fetal chromosomal abnormalities and single-gene disorders as well as cardiac defects and other structural abnormalities in euploid and aneuploid fetuses. Proportionally as NT increases, even with a normal karyotype, there is a higher risk of adverse pregnancy outcomes such as miscarriage, intrauterine death, congenital heart defects and numerous other structural and genetic syndromes. There is not one single cause of increased NT, it is based on a complex and multifactorial process, linked to one or more embryonic processes. It has been shown that a persistently increased NT with a normal karyotype and aCGH has a 4-10% probability of being associated to Noonan Syndrome and/or other RASopathies using Whole Exome Sequencing (WES). However, the general tendency following detection of isolated enlarged NT in an euploid fetus is that most babies with normal detailed ultrasound examination and echocardiography will have uneventful outcomes. The Igenomix Increased Nuchal Translucency Precision Panel can be used to make a directed and accurate prenatal differential diagnosis of increased nuchal translucency in patients with or without a normal karyotype ultimately leading to a better management and prognosis of the associated comorbidities. It provides a comprehensive analysis of the genes involved in this disease using next-generation sequencing (NGS) to fully understand the spectrum of relevant genes involved.
  • A Novel Locus for Brachydactyly Type A1 on Chromosome 5P13.3-P13.2 C M Armour, M E Mccready, a Baig,Agwhunter, D E Bulman

    A Novel Locus for Brachydactyly Type A1 on Chromosome 5P13.3-P13.2 C M Armour, M E Mccready, a Baig,Agwhunter, D E Bulman

    186 LETTERS TO JMG J Med Genet: first published as 10.1136/jmg.39.3.189 on 1 March 2002. Downloaded from A novel locus for brachydactyly type A1 on chromosome 5p13.3-p13.2 C M Armour, M E McCready, A Baig,AGWHunter, D E Bulman ............................................................................................................................. J Med Genet 2002;39:186–189 he brachydactylies are a group of inherited disorders METHODS characterised by shortened or malformed digits that are The linkage study comprised 34 members including 20 Tthought to be the result of abnormal growth of the affected subjects and was conducted after approval by the phalanges and/or metacarpals. First classified by Bell into Children’s Hospital of Eastern Ontario Ethics Review Com- types A, B, C, D, and E, they were reclassified by Temtamy and mittee. McKusick1 and Fitch.2 Brachydactyly type A1 (BDA1, MIM Peripheral blood samples were taken with informed 112500) is characterised by shortened or absent middle consent from all participating family members, and a stand- phalanges. Often the second and fifth digits, as well as the first ard protocol was used to isolate DNA. A genome wide scan proximal phalanx, are the most severely affected. In addition, was initiated using 36 primer sets from the MAPPAIRS™ all of the small tubular bones tend to be reduced in size and microsatellite markers (Research Genetics, Huntsville, Ala- the metacarpals may be shortened, particularly the fifth bama), encompassing markers from 16 chromosomes. metacarpal. Radial/ulnar clinodactyly, as well as malformed or Particular emphasis was placed on markers from chromo- 11 absent epiphyses, have also been reported.12 Complex some 5 and 17, based on the report by Fukushima et al syndromes have been described in which BDA1 is one of a describing a translocation between 5q11.2 and 17q23 in a girl number of manifestations.3 with Klippel-Feil anomaly and BDA1.
  • FGFR2 Mutations in Pfeiffer Syndrome

    FGFR2 Mutations in Pfeiffer Syndrome

    © 1995 Nature Publishing Group http://www.nature.com/naturegenetics correspondent FGFR2 mutations in Pfeiffer syndrome Sir-In the past few months, several genetic diseases have been ascribed to mutations in genes of the fibroblast growth factor receptor (FGFR) family, including achondroplasia (FGFR3) J-z, Crouzon syndrome (FGFR2)3 and 4 m/+ Pfeiffer syndrome (FGFR1) • In D321A addition, two clinically distinct N:Jl GIJ; AM craniosynostotic conditions, Jackson­ ~ Weiss and Crouzon syndromes, have c been ascribed to allelic mutations in the FGFR2 gene, suggesting that FGFR2mutations might have variable 5 phenotypic effects • We have recently FGFR2 found point mutations in the m/+ gene in two unrelated cases of Pfeiffer syndrome supporting the view that this craniosynostotic syndrome, is a 4 6 genetically heterogenous condition • • Pfeiffer syndrome is an autosomal dominant form of acrocephalo­ Fig. 1 Mutations of FGFR2 in two unrelated patients with craniofacial, hand syndactyly (ACS) characterized by and foot anomalies characteristic of Pfeiffer syndrome. Note midface craniosynostosis (brachycephaly retrusion, hypertelorism, proptosis and radiological evidence of enlargement type) with deviation and enlargement of thumb, with ankylosis of the second and third phalanges and the short, broad and deviated great toes. m, mutation; +, wild type sequence. The of the thumbs and great toes, sequence of wild type and mutant genes are shown and the arrow indicates brachymesophalangy, with pha­ the base substitution resulting in the mutation. langeal ankylosis and a varying degree of soft tissue syndactyly7.8. One of our sporadic cases and one familial form of ACS fulfilled the clinical criteria ofthe Pfeiffer syndrome, with particular respect to interphalangeal an aspartic acid into an alanine in the Elisabeth Lajeunie ankylosis (Fig.
  • Preconception Carrier Screening by Genome Sequencing: Results from the Clinical Laboratory

    Preconception Carrier Screening by Genome Sequencing: Results from the Clinical Laboratory

    The American Journal of Human Genetics, Volume 102 Supplemental Data Preconception Carrier Screening by Genome Sequencing: Results from the Clinical Laboratory Sumit Punj, Yassmine Akkari, Jennifer Huang, Fei Yang, Allison Creason, Christine Pak, Amiee Potter, Michael O. Dorschner, Deborah A. Nickerson, Peggy D. Robertson, Gail P. Jarvik, Laura M. Amendola, Jennifer Schleit, Dana Kostiner Simpson, Alan F. Rope, Jacob Reiss, Tia Kauffman, Marian J. Gilmore, Patricia Himes, Benjamin Wilfond, Katrina A.B. Goddard, and C. Sue Richards Supplemental Note: Clinical Report Carrier Results: Four Known Pathogenic Variants Detected. Gene Inheritance Disease Prevalence Variant Classification Pendred Syndrome/ Non- syndromic Autosomal Hearing Loss A c.1246A>C, SLC26A4 1/500 Pathogenic Recessive DFNB4 with (p.Thr416Pro) enlarged vestibular aqueduct Autosomal Spastic ++ c.1045G>A, SPG7 2-6/100,000 Pathogenic Recessive Paraplegia 7 (p.Gly349Ser) 3.7 Autosomal Alpha +++ -α HBA2 1-5/10,000 Pathogenic Recessive Thalassemia (α+- thalassemia) Autosomal Hereditary 1/200 – c.845G>A HFE Pathogenic Recessive Hemochromatosis 1/1000+ (p.Cys282Tyr) +: GeneReviews; ++: Genetics Home Reference; +++: orphan.net – varies with population; A- Generalized prevalence of all deafness and hearing loss Interpretation: A sample from this individual was referred to our laboratory for analysis of Next-Generation Genome Sequencing (NGS) and Sanger confirmation of variants identified in carrier screening for: (1) conditions with significantly shortened lifespan; (2) serious conditions; (3) mild conditions; (4) conditions with unpredictable outcomes: and (5) conditions that begin as adults. One known heterozygous missense variant, c.1246A>C (p.Thr416Pro) (NM_000441.1), was detected in exon 10 of the SLC26A4 gene of this individual by NGS.
  • Supporting Information

    Supporting Information

    Supporting Information Torkamani et al. 10.1073/pnas.0802403105 Materials and Methods kinase sequences used to generate conserved motifs, as in Kannan Kinase Identifiers. Kinase protein and DNA reference sequences et al. (3), the Gibbs motif sampling method identifies characteristic were obtained from Kinbase. These reference sequences were motifs for each individual subdomain of the kinase catalytic core, used as the basis to assign various gene identifiers (including which are then used to generate high confidence motif-based Ensembl gene IDs, HGNC gene symbols, and Entrez gene IDs) Markov chain Monte Carlo multiple alignments based upon these to every known human protein kinase. Ultimately, only eukary- motifs (4). These subdomains compromise the core structural otic protein kinases, that is, all human protein kinases except components of the protein kinase catalytic core. Intervening re- those belonging to the atypical protein kinase family, were gions between these subdomains were not aligned. considered in this study. The various gene identifiers were assigned as follows: Ensembl Mapping to Multiple Alignments and Generation of Logo Figures. A Gene ID’s were determined for each protein kinase by BLAST- nonredundant set of SNPs was generated to be mapped to the ing the reference Kinbase protein sequence against the Ensembl alignment computationally. That is, if multiple disease or com- ࿝ database (www.ensembl.org/Homo sapiens/blastview). The En- mon SNPs have been observed at a particular position within a sembl Gene ID of the top hit was assigned to the protein kinase. particular protein kinase, it is only considered once in our The Ensembl Gene ID was then used as a query in Biomart analysis.
  • Crouzon Syndrome Genetic and Intervention Review

    Crouzon Syndrome Genetic and Intervention Review

    Journal of Oral Biology and Craniofacial Research 9 (2019) 37–39 Contents lists available at ScienceDirect Journal of Oral Biology and Craniofacial Research journal homepage: www.elsevier.com/locate/jobcr Crouzon syndrome: Genetic and intervention review ∗ T N.M. Al-Namnama, , F. Haririb, M.K. Thongc, Z.A. Rahmanb a Department of Oral Biology, Faculty of Dentistry, University of MAHSA, 42610, Jenjarum, Selangor, Malaysia b Department of Oro-Maxillofacial Clinical Science, Faculty of Dentistry, University of Malaya, 50603, Kuala Lumpur, Malaysia c Department of Paediatrics, Faculty of Medicine, University of Malaya, 50603, Kuala Lumpur, Malaysia ARTICLE INFO ABSTRACT Keywords: Crouzon syndrome exhibits considerable phenotypic heterogeneity, in the aetiology of which genetics play an Crouzon syndrome important role. FGFR2 mediates extracellular signals into cells and the mutations in the FGFR2 gene cause this Molecular pathology syndrome occurrence. Activated FGFs/FGFR2 signaling disrupts the balance of differentiation, cell proliferation, Genetic phenotype and apoptosis via its downstream signal pathways. However, very little is known about the cellular and mole- cular factors leading to severity of this phenotype. Revealing the molecular pathology of craniosynostosis will be a great value for genetic counselling, diagnosis, prognosis and early intervention programs. This mini-review summarizes the fundamental and recent scientific literature on genetic disorder of Crouzon syndrome and presents a graduated strategy for the genetic approach, diagnosis and the management of this complex cra- niofacial defect. 1. Introduction known. CS commonly starts at the first three years of life.4 Craniosy- nostosis can be suspected during antenatal stage via ultrasound scan Craniosynostosis is a birth defect characterized by premature fusion otherwise is often detected at birth from its classic crouzonoid features of one or more of the calvarial sutures before the completion of brain of the newborn.
  • Advances in Understanding the Genetics of Syndromes Involving Congenital Upper Limb Anomalies

    Advances in Understanding the Genetics of Syndromes Involving Congenital Upper Limb Anomalies

    Review Article Page 1 of 10 Advances in understanding the genetics of syndromes involving congenital upper limb anomalies Liying Sun1#, Yingzhao Huang2,3,4#, Sen Zhao2,3,4, Wenyao Zhong1, Mao Lin2,3,4, Yang Guo1, Yuehan Yin1, Nan Wu2,3,4, Zhihong Wu2,3,5, Wen Tian1 1Hand Surgery Department, Beijing Jishuitan Hospital, Beijing 100035, China; 2Beijing Key Laboratory for Genetic Research of Skeletal Deformity, Beijing 100730, China; 3Medical Research Center of Orthopedics, Chinese Academy of Medical Sciences, Beijing 100730, China; 4Department of Orthopedic Surgery, 5Department of Central Laboratory, Peking Union Medical College Hospital, Peking Union Medical College and Chinese Academy of Medical Sciences, Beijing 100730, China Contributions: (I) Conception and design: W Tian, N Wu, Z Wu, S Zhong; (II) Administrative support: All authors; (III) Provision of study materials or patients: All authors; (IV) Collection and assembly of data: Y Huang; (V) Data analysis and interpretation: L Sun; (VI) Manuscript writing: All authors; (VII) Final approval of manuscript: All authors. Correspondence to: Wen Tian. Hand Surgery Department, Beijing Jishuitan Hospital, Beijing 100035, China. Email: [email protected]. Abstract: Congenital upper limb anomalies (CULA) are a common birth defect and a significant portion of complicated syndromic anomalies have upper limb involvement. Mostly the mortality of babies with CULA can be attributed to associated anomalies. The cause of the majority of syndromic CULA was unknown until recently. Advances in genetic and genomic technologies have unraveled the genetic basis of many syndromes- associated CULA, while at the same time highlighting the extreme heterogeneity in CULA genetics. Discoveries regarding biological pathways and syndromic CULA provide insights into the limb development and bring a better understanding of the pathogenesis of CULA.
  • 2018 Etiologies by Frequencies

    2018 Etiologies by Frequencies

    2018 Etiologies in Order of Frequency by Category Hereditary Syndromes and Disorders Count CHARGE Syndrome 958 Down syndrome (Trisomy 21 syndrome) 308 Usher I syndrome 252 Stickler syndrome 130 Dandy Walker syndrome 119 Cornelia de Lange 102 Goldenhar syndrome 98 Usher II syndrome 83 Wolf-Hirschhorn syndrome (Trisomy 4p) 68 Trisomy 13 (Trisomy 13-15, Patau syndrome) 60 Pierre-Robin syndrome 57 Moebius syndrome 55 Trisomy 18 (Edwards syndrome) 52 Norrie disease 38 Leber congenital amaurosis 35 Chromosome 18, Ring 18 31 Aicardi syndrome 29 Alstrom syndrome 27 Pfieffer syndrome 27 Treacher Collins syndrome 27 Waardenburg syndrome 27 Marshall syndrome 25 Refsum syndrome 21 Cri du chat syndrome (Chromosome 5p- synd) 16 Bardet-Biedl syndrome (Laurence Moon-Biedl) 15 Hurler syndrome (MPS I-H) 15 Crouzon syndrome (Craniofacial Dysotosis) 13 NF1 - Neurofibromatosis (von Recklinghausen dis) 13 Kniest Dysplasia 12 Turner syndrome 11 Usher III syndrome 10 Cockayne syndrome 9 Apert syndrome/Acrocephalosyndactyly, Type 1 8 Leigh Disease 8 Alport syndrome 6 Monosomy 10p 6 NF2 - Bilateral Acoustic Neurofibromatosis 6 Batten disease 5 Kearns-Sayre syndrome 5 Klippel-Feil sequence 5 Hereditary Syndromes and Disorders Count Prader-Willi 5 Sturge-Weber syndrome 5 Marfan syndrome 3 Hand-Schuller-Christian (Histiocytosis X) 2 Hunter Syndrome (MPS II) 2 Maroteaux-Lamy syndrome (MPS VI) 2 Morquio syndrome (MPS IV-B) 2 Optico-Cochleo-Dentate Degeneration 2 Smith-Lemli-Opitz (SLO) syndrome 2 Wildervanck syndrome 2 Herpes-Zoster (or Hunt) 1 Vogt-Koyanagi-Harada
  • Repercussions of Inborn Errors of Immunity on Growth☆ Jornal De Pediatria, Vol

    Repercussions of Inborn Errors of Immunity on Growth☆ Jornal De Pediatria, Vol

    Jornal de Pediatria ISSN: 0021-7557 ISSN: 1678-4782 Sociedade Brasileira de Pediatria Goudouris, Ekaterini Simões; Segundo, Gesmar Rodrigues Silva; Poli, Cecilia Repercussions of inborn errors of immunity on growth☆ Jornal de Pediatria, vol. 95, no. 1, Suppl., 2019, pp. S49-S58 Sociedade Brasileira de Pediatria DOI: https://doi.org/10.1016/j.jped.2018.11.006 Available in: https://www.redalyc.org/articulo.oa?id=399759353007 How to cite Complete issue Scientific Information System Redalyc More information about this article Network of Scientific Journals from Latin America and the Caribbean, Spain and Journal's webpage in redalyc.org Portugal Project academic non-profit, developed under the open access initiative J Pediatr (Rio J). 2019;95(S1):S49---S58 www.jped.com.br REVIEW ARTICLE ଝ Repercussions of inborn errors of immunity on growth a,b,∗ c,d e Ekaterini Simões Goudouris , Gesmar Rodrigues Silva Segundo , Cecilia Poli a Universidade Federal do Rio de Janeiro (UFRJ), Faculdade de Medicina, Departamento de Pediatria, Rio de Janeiro, RJ, Brazil b Universidade Federal do Rio de Janeiro (UFRJ), Instituto de Puericultura e Pediatria Martagão Gesteira (IPPMG), Curso de Especializac¸ão em Alergia e Imunologia Clínica, Rio de Janeiro, RJ, Brazil c Universidade Federal de Uberlândia (UFU), Faculdade de Medicina, Departamento de Pediatria, Uberlândia, MG, Brazil d Universidade Federal de Uberlândia (UFU), Hospital das Clínicas, Programa de Residência Médica em Alergia e Imunologia Pediátrica, Uberlândia, MG, Brazil e Universidad del Desarrollo,
  • Genes in Eyecare Geneseyedoc 3 W.M

    Genes in Eyecare Geneseyedoc 3 W.M

    Genes in Eyecare geneseyedoc 3 W.M. Lyle and T.D. Williams 15 Mar 04 This information has been gathered from several sources; however, the principal source is V. A. McKusick’s Mendelian Inheritance in Man on CD-ROM. Baltimore, Johns Hopkins University Press, 1998. Other sources include McKusick’s, Mendelian Inheritance in Man. Catalogs of Human Genes and Genetic Disorders. Baltimore. Johns Hopkins University Press 1998 (12th edition). http://www.ncbi.nlm.nih.gov/Omim See also S.P.Daiger, L.S. Sullivan, and B.J.F. Rossiter Ret Net http://www.sph.uth.tmc.edu/Retnet disease.htm/. Also E.I. Traboulsi’s, Genetic Diseases of the Eye, New York, Oxford University Press, 1998. And Genetics in Primary Eyecare and Clinical Medicine by M.R. Seashore and R.S.Wappner, Appleton and Lange 1996. M. Ridley’s book Genome published in 2000 by Perennial provides additional information. Ridley estimates that we have 60,000 to 80,000 genes. See also R.M. Henig’s book The Monk in the Garden: The Lost and Found Genius of Gregor Mendel, published by Houghton Mifflin in 2001 which tells about the Father of Genetics. The 3rd edition of F. H. Roy’s book Ocular Syndromes and Systemic Diseases published by Lippincott Williams & Wilkins in 2002 facilitates differential diagnosis. Additional information is provided in D. Pavan-Langston’s Manual of Ocular Diagnosis and Therapy (5th edition) published by Lippincott Williams & Wilkins in 2002. M.A. Foote wrote Basic Human Genetics for Medical Writers in the AMWA Journal 2002;17:7-17. A compilation such as this might suggest that one gene = one disease.
  • The Genetic Heterogeneity of Brachydactyly Type A1: Identifying the Molecular Pathways

    The Genetic Heterogeneity of Brachydactyly Type A1: Identifying the Molecular Pathways

    The genetic heterogeneity of brachydactyly type A1: Identifying the molecular pathways Lemuel Jean Racacho Thesis submitted to the Faculty of Graduate Studies and Postdoctoral Studies in partial fulfillment of the requirements for the Doctorate in Philosophy degree in Biochemistry Specialization in Human and Molecular Genetics Department of Biochemistry, Microbiology and Immunology Faculty of Medicine University of Ottawa © Lemuel Jean Racacho, Ottawa, Canada, 2015 Abstract Brachydactyly type A1 (BDA1) is a rare autosomal dominant trait characterized by the shortening of the middle phalanges of digits 2-5 and of the proximal phalange of digit 1 in both hands and feet. Many of the brachymesophalangies including BDA1 have been associated with genetic perturbations along the BMP-SMAD signaling pathway. The goal of this thesis is to identify the molecular pathways that are associated with the BDA1 phenotype through the genetic assessment of BDA1-affected families. We identified four missense mutations that are clustered with other reported BDA1 mutations in the central region of the N-terminal signaling peptide of IHH. We also identified a missense mutation in GDF5 cosegregating with a semi-dominant form of BDA1. In two families we reported two novel BDA1-associated sequence variants in BMPR1B, the gene which codes for the receptor of GDF5. In 2002, we reported a BDA1 trait linked to chromosome 5p13.3 in a Canadian kindred (BDA1B; MIM %607004) but we did not discover a BDA1-causal variant in any of the protein coding genes within the 2.8 Mb critical region. To provide a higher sensitivity of detection, we performed a targeted enrichment of the BDA1B locus followed by high-throughput sequencing.