Craniosynostosis Panel Test code: MA2901 Is a 38 gene panel that includes assessment of non-coding variants. Is ideal for patients with craniosynostosis. About Craniosynostosis Craniosynostosis is defined as the premature fusion of one or more cranial sutures leading to secondary distortion of skull shape. It may result from a primary defect of ossification (primary craniosynostosis) or, more commonly, from a failure of brain growth (secondary craniosynostosis). Premature closure of the sutures (fibrous joints) causes the pressure inside of the head to increase and the skull or facial bones to change from a normal, symmetrical appearance resulting in skull deformities with a variable presentation. Craniosynostosis may occur in an isolated setting or as part of a syndrome with a variety of inheritance patterns and reccurrence risks. Craniosynostosis occurs in 1/2,200 live births. Availability 4 weeks Gene Set Description Genes in the Craniosynostosis Panel and their clinical significance Gene Associated phenotypes Inheritance ClinVar HGMD ALPL Odontohypophosphatasia, Hypophosphatasia perinatal lethal, AD/AR 78 291 infantile, juvenile and adult forms ALX3 Frontonasal dysplasia type 1 AR 8 8 ALX4 Frontonasal dysplasia type 2, Parietal foramina AD/AR 15 24 BMP4 Microphthalmia, syndromic, Orofacial cleft AD 8 39 CDC45 Meier-Gorlin syndrome 7 AR 10 19 EDNRB Hirschsprung disease, ABCD syndrome, Waardenburg syndrome AD/AR 12 66 EFNB1 Craniofrontonasal dysplasia XL 28 116 ERF Craniosynostosis 4 AD 17 16 ESCO2 SC phocomelia syndrome, Roberts syndrome AR 30 31 FGFR1 Pfeiffer syndrome, Trigonocephaly, Hypogonadotropic AD/Digenic/Multigenic 72 257 hypogonadism, Osteoglophonic Dwarfism - Craniostenosis, Hartsfield syndrome FGFR2 Apert syndrome, Pfeiffer syndrome, Jackson-Weiss syndrome, AD 100 154 Lacrimoauriculodentodigital syndrome, Beare-Stevenson cutis gyrata syndrome, Antley-Bixler syndrome without genital anomalies or disordered steroidogenesis, Craniofacial-skeletal- dermatological dysplasia, Crouzon syndrome, Bent bone dysplasia https://blueprintgenetics.com/ FGFR3 Lacrimoauriculodentodigital syndrome, Muenke syndrome, AD/AR 54 77 Crouzon syndrome with acanthosis nigricans, Camptodactyly, tall stature, and hearing loss (CATSHL) syndrome, Achondroplasia, Hypochondroplasia, Thanatophoric dysplasia type 1, Thanatophoric dysplasia type 2, SADDAN FLNB Larsen syndrome (dominant), Atelosteogenesis type 1, AD/AR 43 121 Atelosteogenesis type 3, Spondylo-carpal-tarsal dyspasia FREM1 Bifid nose, Manitoba oculotrichoanal syndrome, Trigonocephaly AD/AR 14 35 GDF5 Multiple synostoses syndrome, Fibular hypoplasia and complex AD/AR 23 53 brachydactyly, Acromesomelic dysplasia, Hunter-Thompson, Symphalangism, proximal, Chondrodysplasia, Brachydactyly type A2, Brachydactyly type C, Grebe dysplasia GLI3 Acrocallosal syndrome, Pallister-Hall syndrome, Grieg AD 70 235 cephalopolysndactyly syndrome, Postaxial polydactyly type A, Preaxial polydactyly type 3, Preaxial polydactyly type 4 IFT122* Sensenbrenner syndrome, Cranioectodermal dysplasia (Levin- AR 13 23 Sensenbrenner) type 1, Cranioectodermal dysplasia (Levin- Sensenbrenner) type 2 IFT140 Short -rib thoracic dysplasia with or without polydactyly, AR 38 63 Asphyxiating thoracic dysplasia (ATD; Jeune) IL11RA Craniosynostosis and dental anomalies AR 7 21 MASP1 3MC syndrome AR 11 22 MEGF8 Carpenter syndrome 2 AR 6 14 MSX2* Parietal foramina, Parietal foramina with cleidocranial dysplasia, AD 9 25 Craniosynostosis Boston type NOG Tarsal-carpal coalition syndrome, Multiple synostosis syndrome, AD 20 63 Stapes ankylosis with broad thumb and toes (Teunissen-Cremers syndrome), Symphalangism, proximal, Brachydactyly type B2 PAX3 Craniofacial-deafness-hand syndrome, Waardenburg syndrome AD/AR 54 149 POR Disordered steroidogenesis due to cytochrome p450 AR 14 70 oxidoreductase deficiency, Antley-Bixler syndrome RAB23# Carpenter syndrome 1 AR 5 15 RECQL4 Baller-Gerold syndrome, RAPADILINO syndrome, Rothmund- AR 82 114 Thomson syndrome SKI Shprintzen-Goldberg syndrome AD 20 23 SOX10 Peripheral demyelinating neuropathy, central dysmyelination, AD 56 148 Waardenburg syndrome, and Hirschsprung disease, Kallmann syndrome SPECC1L Facial clefting, oblique, 1, Opitz GBBB syndrome, type II AD 7 8 TCF12 Craniosynostosis AD 23 56 TGFBR1 Loeys-Dietz syndrome AD 40 69 https://blueprintgenetics.com/ TGFBR2 Loeys-Dietz syndrome AD 58 139 TWIST1 Saethre-Chotzen syndrome, Robinow-Sorauf syndrome, AD 28 205 Craniosynostosis TWIST2 Ablepharon-macrostomia syndrome, Barber-Say syndrome, AD/AR 7 9 Focal facial dermal dysplasia 3, Setleis type WDR19 Retinitis pigmentosa, Nephronophthisis, Short -rib thoracic AR 33 43 dysplasia with or without polydactyly, Senior-Loken syndrome, Cranioectodermal dysplasia (Levin-Sensenbrenner) type 1, Cranioectodermal dysplasia (Levin-Sensenbrenner) type 2, Asphyxiating thoracic dysplasia (ATD; Jeune) WDR35 Cranioectodermal dysplasia (Levin-Sensenbrenner) type 1, AR 28 31 Cranioectodermal dysplasia (Levin-Sensenbrenner) type 2, Short rib-polydactyly syndrome type 5 ZIC1 Craniosynostosis 6 AD 5 9 *Some regions of the gene are duplicated in the genome. Read more. # The gene has suboptimal coverage (means <90% of the gene’s target nucleotides are covered at >20x with mapping quality score (MQ>20) reads), and/or the gene has exons listed under Test limitations section that are not included in the panel as they are not sufficiently covered with high quality sequence reads. The sensitivity to detect variants may be limited in genes marked with an asterisk (*) or number sign (#). Due to possible limitations these genes may not be available as single gene tests. Gene refers to the HGNC approved gene symbol; Inheritance refers to inheritance patterns such as autosomal dominant (AD), autosomal recessive (AR), mitochondrial (mi), X-linked (XL), X-linked dominant (XLD) and X-linked recessive (XLR); ClinVar refers to the number of variants in the gene classified as pathogenic or likely pathogenic in this database (ClinVar); HGMD refers to the number of variants with possible disease association in the gene listed in Human Gene Mutation Database (HGMD). The list of associated, gene specific phenotypes are generated from CGD or Mitomap databases. Non-coding disease causing variants covered by the panel Gene Genomic location HGVS RefSeq RS-number HG19 ALPL Chr1:21835920 c.-195C>T NM_000478.4 ALPL Chr1:21896764 c.793-30_793-11delGGCATGTGCTGACACAGCCC NM_000478.4 EFNB1 ChrX:68049209 c.-411C>G NM_004429.4 EFNB1 ChrX:68049525 c.-95T>C/G NM_004429.4 EFNB1 ChrX:68049525 c.-95T>C NM_004429.4 EFNB1 ChrX:68049525 c.-95T>G NM_004429.4 ESCO2 Chr8:27650167 c.1354-18G>A NM_001017420.2 rs80359865 FGFR2 Chr10:123099960 c.*139411C>T . IFT122 Chr3:129207087 c.2005-13T>A NM_052985.3 IFT140 Chr16:1576595 c.2577+25G>A NM_014714.3 rs1423102192 https://blueprintgenetics.com/ PAX3 Chr2:223085913 c.958+28A>T NM_181459.3 POR Chr7:75544501 c.-5+4A>G NM_000941.2 SOX10 Chr22:38379877 c.-84-2A>T NM_006941.3 SOX10 Chr22:38412215 c.-31954C>T NM_006941.3 rs606231342 SOX10 Chr22:38412781 c.-32520C>G NM_006941.3 rs533778281 TCF12 Chr15:57554272 c.1468-20T>A NM_207036.1 TGFBR2 Chr3:30648317 c.-59C>T NM_001024847.2 TWIST1 Chr7:19157199 c.-255G>A NM_000474.3 TWIST1 Chr7:19157207 c.-263C>A NM_000474.3 WDR35 Chr2:20151929 c.1434-684G>T NM_001006657.1 WDR35 Chr2:20182313 c.143-18T>A NM_001006657.1 Test Strengths The strengths of this test include: CAP accredited laboratory CLIA-certified personnel performing clinical testing in a CLIA-certified laboratory Powerful sequencing technologies, advanced target enrichment methods and precision bioinformatics pipelines ensure superior analytical performance Careful construction of clinically effective and scientifically justified gene panels Some of the panels include the whole mitochondrial genome (please see the Panel Content section) Our Nucleus online portal providing transparent and easy access to quality and performance data at the patient level Our publicly available analytic validation demonstrating complete details of test performance ~2,000 non-coding disease causing variants in our clinical grade NGS assay for panels (please see ‘Non-coding disease causing variants covered by this panel’ in the Panel Content section) Our rigorous variant classification scheme Our systematic clinical interpretation workflow using proprietary software enabling accurate and traceable processing of NGS data Our comprehensive clinical statements Test Limitations Genes with partial, or whole gene, segmental duplications in the human genome are marked with an asterisk (*) if they overlap with the UCSC pseudogene regions. The technology may have limited sensitivity to detect variants in genes marked with these symbols (please see the Panel content table above). This test does not d etect the following: Complex inversions Gene conversions Balanced translocations Some of the panels include the whole mitochondrial genome (please see the Panel Content section) Repeat expansion disorders unless specifically mentioned Non-coding variants deeper than ±20 base pairs from exon-intron boundary unless otherwise indicated (please see above Panel Content / non-coding variants covered by the panel). https://blueprintgenetics.com/ This test may not reliably detect the following: Low level mosaicism in nuclear genes (variant with a minor allele fraction of 14.6% is detected with 90% probability) Stretches of mononucleotide repeats Low level heteroplasmy in mtDNA (>90% are detected at 5% level) Indels larger than 50bp Single exon deletions