Characterization, Prevalance and Antimicrobial Susceptibility Pattern

Total Page:16

File Type:pdf, Size:1020Kb

Characterization, Prevalance and Antimicrobial Susceptibility Pattern International Journal of Clinical Obstetrics and Gynaecology 2018; 2(6): 31-42 ISSN (P): 2522-6614 ISSN (E): 2522-6622 © Gynaecology Journal Characterization, prevalance and antimicrobial www.gynaecologyjournal.com 2018; 2(6): 31-42 susceptibility pattern of bacterial uropathogens isolated Received: 21-09-2018 Accepted: 24-10-2018 from pregnant women at Lahore general hospital, Lahore, Pakistan Rabia Habib Institute of Molecular Biology and Biotechnology, University of Lahore, Pakistan Rabia Habib, Muhammad Danish Mehmood, Sana Noreen, Huma Anwar, Mehreen Gul, Nazia Ayub and Almas Raza Muhammad Danish Mehmood Ottoman Pharma (Immuno Division), Raiwind Road Lahore, Abstract Pakistan Urinary tract infection (UTI) is common in ladies living in developing countries which may progress to complications such as pyelonephritis and preterm delivery during pregnancy. The present study provides an Sana Noreen insight for causative agent of UTI, their prevalence in pregnant ladies and its association with age, Ottoman Pharma (Immuno metabolic disorder and gestational period. Total of 375 midstream samples were collected from pregnant Division), Raiwind Road Lahore, women, pure culture were segregated on selective media and identified through analytical profile index Pakistan (API) to evaluate prevalence of uropathogens in UTI and ASB patients. Isolated uropathogenic E. coli were further characterized by polymerase chain reaction (PCR) using specific primers for genotype cjrA, cjrB, Huma Anwar and cjrC. Among 375 midstream urine samples of pregnant women, 160 cases of UTI and ASB (≥105 Ottoman Pharma (Immuno CFU) were recorded. API analysis of such samples showed 65(40.6%), 55(34.35%) and 40(25%) of E. coli, Division), Raiwind Road Lahore, Pakistan Enterococci and Staphylococci respectively. Furthermore, PCR based characterization of E. coli revealed 42(64.61%) prevalence of both cjrA and cjrB genotype in asymptomatic and urinary tract infected patients. Mehreen Gul Prevalence of uropathogen in UTI suspected patients was found significantly higher in 20-40 age group Post Graduate Medical Institute, 77(74.75%), diabetic patients 90(87.37%) and women reported in first trimester of gestation period Lahore, Pakistan 52(50.48%). Antibiotic susceptibility test results revealed that PCR confirmed uropathogenic E. coli was highly sensitive to Ceftriaxone, Amikacin, Nitofurantoin, Gentamicin and Ciprofloxacin with percentage of Nazia Ayub 79.2%, 76.4%, 75%, 61% and 52% respectively. Whereas, these isolates were resistant to Ampicillin 89%, Post Graduate Medical Institute, Cefuroxime 70%, Amoxicillin 65%, Tobramycin 43% and Ceftazidime 22%. Lahore, Pakistan Keywords: urinary tract infection, asymptimatic bacteriuria, uropathogenic E. coli Almas Raza Sharif Medical & Dental College, Lahore, Pakistan 1. Introduction Urinary tract infections are common problem in females and need serious attention particularly during pregnancy. It is the inflammatory response of epithelium of urinary tract to bacterial invasion, which is typically associated with bacteriuria and pyuria (1). Lower UTI (cystitis) was characterized with the symptoms of suprapubic pain or tenderness, urgency, frequency of urination or dysuria. Upper UTI (pyelonephritis) was diagnosed (without another obvious etiology) with or without urinary symptoms (2). In pregnant women Urinary tract infection (UTI) is a common health problem whose diagnostic process may get complicated as it can be either symptomatic or asymptomatic. Symptomatic bacteriuria is one of the fatal cause of premature birth, high fatality rate and postpartum complications. Urinary tract infections are common in female due to short urethra, its dilatation in various stages of pregnancy make it easy [1] access to faecal flora . Mostly 80-90% of infections caused by Escherichia coli. Other organism are Klebsiella spp, Staphylococcus aureus. Pseudomonas spp [3, 4]. and less common cause of UTI are enterococci, Staphylococcus saprophyticus, Chlamydia spp, Candida albicans, Gardenerella vaginalis. Colonization of group B streptococcus associated with preterm rupture [5] [6] of membrane and labour . Urine in bladder is normally sterile the presence of bacteria in [7] 5 urine is known as bacteriuria . Significant bacteriuria is defined as presence of 10 colony forming units CFU per millilitre of urine [8]. Asymptomatic bacteriuria (ASB) is the presence of bacteria in urine without symptoms of acute urinary tract infection [9, 10]. Asymptomatic Correspondence bacteriuria (ASB) commonly occurs in both pregnant and non-pregnant women [11]. The Muhammad Danish Mehmood Ottoman Pharma (Immuno antibacterial location and position of urinary and reproductive genital in females make them Division), Raiwind Road Lahore, prone to infection specially after conceiving. Uropathogen could have the ability to pose severe Pakistan ~ 31 ~ International Journal of Clinical Obstetrics and Gynaecology threats in terms of creating micro changes in epithelium, showing standard characteristics colony were selected for Gram inflammatory responses and invasiveness. Such conditions may Staining. It was performed according to standard procedure. lead to adverse gynaecological outcomes which includes low- Smear was established by placing a loopful of culture on birth weight, pre-mature birth and even high mortality rate. microscope glass slide re-suspended with drop of distilled water Furthermore, hormonal and anatomical changes during in circular pattern. The smear was fixed by passing 3-4 times on pregnancy and its effect on the dilatation of the ureters and renal flame followed by heat air drying. Straining was performed pelvis may create ample space and time for uropathogen to get according to the method described by Bergey [23] (Fig. 12). entered and cause infection. This combined with short nature of female urethra and perineal colonization by enteric organism, 2.4 Biochemical Assay predispose to UTI and pyelonephritis [12-15]. The analytical profile index of Gram negative rods and Gram It is widely accepted that uropathogenic E. coli (UPEC) positive cocci isolated from urine samples was determined originates from the distal gut microbiota [16-18]. To cause through RapID One Pannel (Remel-Thermo Fisher Scientific, ascending UTI, it needs to overcome and adapt to different USA) and API 20 (Biomerieux-USA), following instructions of distinct host environments, such as the bladder, the kidneys and the manufacturer (Fig. 13, 14). even the bloodstream. It is known that UPEC requires a combination of multiple virulence genes to cause infection19. 2.5 Polymerase Chain Reaction (Pcr) The virulence gene combination of a UPEC strain may All the samples including positive known bacteria were determine the pathogenesis process employed by this strain to subjected for extraction of DNA by using QAIamp DNA Mini cause infection. kit (QIAGEN-Germany). The extracted DNA of the samples Ascending infection of uropathogen has another prospect in were subjected to PCR for amplification of the desired genes development of cystitis and pyelonephritis. In either of the cases, cjrA, (223bp) cjrB (397bp) and cjrC (513bp) of uropathogenic involvement of UPEC make them complicated for the medical E. coli. For the PCR reaction, 2 µl of 10X PCR buffer, 1 µl of professionals to treat because of their versatility and high forward and reverse primer, 2 µl of 80mM MgCl2, 2µl of DNTPs resistance of antibiotics. The severity of such complications can mixture and 1 µl of Taq DNA polymerase (Perkin-Elmer Cetus, be controlled by screening symptomatic bacteriuria and giving Norwalk, Conn.) were added to the reaction mixture. Reaction prompt treatment before conceiving and during different stages volume was obtained by adding 9 µl of Nuclease-free Water and of pregnancy [20]. Therefore, it is important to visit medical 2 µl of extracted DNA sample. The PCR tubes were incubated in professionals for interpretation of urinalysis at different stages of thermal cycler (Applied Biosystems) with an initial denaturation pregnancy to prevent imperial treatment. Screening recommended of 94 °C for 2 mints. Followed by 30 cycles of denaturation at [21] is at first visit or between12-16 week of gestation . 94 °C for 30 secs, annealing at 56 °C for 30 secs. and extension at 72 °C for 45 secs. Final extension was conducted at 72 °C for 2. Materials and Method 5 minutes (Fig. 15, 16). 2.1 Study Design and Protocol 2.1.1 Sample Size Table I: Sequences of Oligonucleotide primers E. coli. Gene Primers The sample size was calculated by using the formula of Kish & Amplicon size Sequences [22] Lisle (1965) states that Forward Primer 223bp AAAGGGTGGTCCTGGGAGAT cjrA n = z2 p (1-p) / d2 Reverse Primer ACGTCAGTTGCTGGCTTTCA Where, z = Score for 95% confidence interval = 1.96 Forward Primer 397bp CGAAGTTCAGCCCGCTATGT cjrB p = Prevalence (To estimate the proportion of pregnant women Reverse Primer GCRRRCCCAAGATGCCTCAG Forward Primer 518bp AAACCTCAGCGCAAAATCGT with UTI) cjrC d = Sampling error that could be tolerate= 5%. Reverse Primer AGGCTTCAGGAATGGGTTCA 1-p= Probability Present study was conducted in co-ordination with 2.6. Culture Sensitivity Test Gynaecology and obstetrics department of Lahore General Antimicrobial susceptibility test (AST) was performed for all the Hospital (LGH) located on Ferozpur road Lahore, Pakistan. The isolates using Kirby-Bauer’s disk diffusion method described by study population comprised of all pregnant women attending the Bauer et al., 1966. All procedures were done as recommended antenatal
Recommended publications
  • Pasteurella Multocida Isolated from Cattle
    Journal of Applied Pharmaceutical Science Vol. 3 (04), pp. 106-110, April, 2013 Available online at http://www.japsonline.com DOI: 10.7324/JAPS.2013.3419 ISSN 2231-3354 Antibiotic Susceptibility and Molecular Analysis of Bacterial Pathogen Pasteurella Multocida Isolated from Cattle Azmat Jabeen, Mahrukh Khattak, Shahzad Munir*, Qaiser Jamal, Mubashir Hussain Department of Microbiology, Kohat University of Science and Technology, Kohat, Khyber Pakhtunkhwa, Pakistan. ARTICLE INFO ABSTRACT Article history: Pasteurella multocida is a Gram negative, non motile and coccobacillus bacterium. It has 5 strains i.e. A, B, D, Received on: 01/02/2013 E and F and 16 serotypes (1-16). In present study, we analyzed Pasteurella multocida B: 2 strains, responsible Revised on: 19/02/2013 for Hemorrhagic Septicemia (HS) in cattle, on morphological/microbial, biochemical, molecular level and to Accepted on: 15/03/2013 check the antibiotic sensitivity of the Pasteurella multocida. Microbial analysis showed that while grown on Available online: 27/04/2013 Brain Heart Infusion agar plates and Blood Agar Base Medium, grayish lustrous colonies of Pasteurella multocida were observed. Gram staining showed that Pasteurella multocida are gram negative. Microscopic Key words: observations revealed it to be coccobacillus and it was non- motile. Identification was conducted by Pasteurella multocida, conventional biochemical tests and percentage identification of Analytical Profile Index was 96 %. Antibiotic Hemorrhagic Septicemia, sensitivity with different antibiotics was checked by disk diffusion method and was found resistant to Analytical Profile Index, Augmentin, Amoxicillin and Aztreonam and was more susceptible to Ceftiofur. On molecular level its DNA Antibiotic sensitivity. was extracted and was run with marker having range from 0.5 – 10 kb.
    [Show full text]
  • Physico-Chemical and Bacteriological Quality of Water, And
    PHYSICO-CHEMICAL AND BACTERIOLOGICAL QUALITY OF WATER, AND ANTIMICROBIAL SUSCEPTIBILITY OF PATHOGENIC ISOLATES FROM SELECTED WATER SOURCES IN SAMBURU SOUTH. BY JEOPHITA JUNE MWAJUMA (B.Sc, P.G.D.E) REG. NO. I56/7341/02 DEPARTMENT OF PLANT AND MICROBIAL SCIENCES A thesis submitted in partial fulfillment of the requirements for the award of the degree of Master of Science (Microbiology) in the School of Pure and Applied Sciences, Kenyatta University April 2010 ii DECLARATION I, Jeophita June Mwajuma, declare that this thesis is my original work and has not been presented for the award of a degree in any other University or any other award. Signature…………………………………... Date………………………….. We confirm that the work reported in this thesis was carried out by the candidate under our supervision. SUPERVISORS: Prof. Paul Okemo Department of Plant and Microbial Sciences Kenyatta University Signature…………………………………... Date………………………….. Dr. Alexander Njue Department of Plant and Microbial Sciences Kenyatta University Signature…………………………………... Date………………………….. Prof. Kiplagat Kotut Department of Plant and Microbial Sciences Kenyatta University Signature…………………………………... Date………………………….. iii DEDICATION For my girls, Neema and Wema. Babies, the sky is the limit! iv Formatted: Centered, Indent: Left: 0.25", 1. ACKNOWLEDGEMENT No bullets or numbering I wish to thank my supervisors Prof. Paul Okemo, Dr. Alexander Njue and Prof. Kiplagat Kotut for their expert advice and encouragement throughout the period of this study. My gratitude also goes to Earthwatch Institute for funding my research work through the Samburu Communities, Water and Wildlife project. I also wish to thank KEMRI, Welcome Trust Laboratories Kilifi, Wamba Mission Hospital and Mombasa Polytechnic University College for providing me with laboratory space and analytical tools.
    [Show full text]
  • Resistant Gram-Negative Bacteria in Urine of Pregnant Women Attending Antenatal Clinic of Mother and Child Hospital, Ondo, Nigeria
    Vol. 15(5), pp. 209-216, May, 2021 DOI: 10.5897/AJMR2021.9491 Article Number: FAE2CD666760 ISSN: 1996-0808 Copyright ©2021 Author(s) retain the copyright of this article African Journal of Microbiology Research http://www.academicjournals.org/AJMR Full Length Research Paper Phenotypic and molecular characterization of multiple- resistant gram-negative bacteria in urine of pregnant women attending antenatal clinic of Mother and Child hospital, Ondo, Nigeria 1 1 2* Eunice Damilola Wilkie , Anthonia Olufunke Oluduro , Thonda Oluwakemi Abike and Chidinma Vivian Chukwudum1 1Department of Microbiology, Faculty of Sciences, Obafemi Awolowo University, Ile-Ife, Osun State, Nigeria. 2Department of Biological Sciences, Faculty of Sciences, Kings University, Odeomu, Osun State, Nigeria. Received 27 January, 2021; Accepted 12 March, 2021 Phenotypic and molecular characterization of multiple antibiotic resistant Gram-negative bacteria in urine samples of pregnant women in Mother and Child Hospital, Nigeria was reported. In the study, 407 apparently healthy pregnant women were recruited. Structured questionnaire was administered to the patients to obtain their socio-demographic information and the medical history. Urine samples were collected, processed and analysed using standard microbiological procedures. Detailed identification of the bacteria isolates was done using biochemical characterization using Bergey’s Manual of Determinative Bacteriology and Analytical Profile Index (API) Kit. The antimicrobial susceptibility testing of the bacteria isolates was carried out using the Kirby-Bauer’s disk diffusion technique. Detection of the beta lactamase resistance genes (bla CTX-M and Tet A) was done by polymerase chain reactions (PCR) with appropriate primers. The following Gram-negative bacteria were recovered comprising Pseudomonas aeruginosa 48 (34.0%), Escherichia coli 30 (21.3%), Klebsiella sp.
    [Show full text]
  • Rapid Identification and Antimicrobial Susceptibility Profiling of Anaerobic Bacteria in Clinical Specimens
    Egyptian Journal of Medical Microbiology, July 2012 Vol. 21, No. 3 Rapid Identification and Antimicrobial Susceptibility Profiling of Anaerobic Bacteria in Clinical Specimens *Wafaa N. El-tayab, **Fatma Alzhraa M. Gomaa *Associate Professor of Microbiology & Immunology, Faculty of Pharmacy Misr International University, Cairo, Egypt **Associate Professor of Microbiology & Immunology, Faculty of Pharmacy for girls- Al-Azhar University, Egypt ABSTRACT Objective: The aim of the current study was to evaluate the ability of API 20A, and Microscan Rapid- Anaerobe identification system to identify a spectrum of clinically significant anaerobic isolates against the gold standard conventional method. Also to determine the antimicrobial susceptibility of anaerobic isolates using different methods. Materials and Methods: Anaerobes were isolated from the different clinical specimens and all isolates were initially identified by conventional tests. Identification of isolates were made also by using the API 20A and Microscan systems. Antimicrobial susceptibility of all isolates were determined by disc diffusion and broth-disk method and compared to MIC determined by broth dilution method. Results: A total of 51 isolates were recovered from clinical specimens. API 20A and Microscan correctly identified 70.6% and 82.4% of strains to species level respectively. Eight strains were misidentified by API 20A and 9 were misidentified by Microscan. B. fragilis group isolates were the most encountered clinically significant isolates among the gram-negative anaerobes. Penicillin and ampicillin had poor activity against B. fragilis group, Prevotella spp. Eubacterium spp. and Veillonella spp. Members of the B. fragilis group were more resistant to cefoxitin, than other anaerobes (66.6%). Resistance to clindamycin varied among the species range from 11.1% to 50%.
    [Show full text]
  • Pdf 1032003 6
    Peer-Reviewed Journal Tracking and Analyzing Disease Trends pages 1891–2100 EDITOR-IN-CHIEF D. Peter Drotman Managing Senior Editor EDITORIAL BOARD Polyxeni Potter, Atlanta, Georgia, USA Dennis Alexander, Addlestone Surrey, United Kingdom Senior Associate Editor Barry J. Beaty, Ft. Collins, Colorado, USA Brian W.J. Mahy, Atlanta, Georgia, USA Martin J. Blaser, New York, New York, USA Christopher Braden, Atlanta, GA, USA Associate Editors Carolyn Bridges, Atlanta, GA, USA Paul Arguin, Atlanta, Georgia, USA Arturo Casadevall, New York, New York, USA Charles Ben Beard, Ft. Collins, Colorado, USA Kenneth C. Castro, Atlanta, Georgia, USA David Bell, Atlanta, Georgia, USA Thomas Cleary, Houston, Texas, USA Charles H. Calisher, Ft. Collins, Colorado, USA Anne DeGroot, Providence, Rhode Island, USA Michel Drancourt, Marseille, France Vincent Deubel, Shanghai, China Paul V. Effl er, Perth, Australia Ed Eitzen, Washington, DC, USA K. Mills McNeill, Kampala, Uganda David Freedman, Birmingham, AL, USA Nina Marano, Atlanta, Georgia, USA Kathleen Gensheimer, Cambridge, MA, USA Martin I. Meltzer, Atlanta, Georgia, USA Peter Gerner-Smidt, Atlanta, GA, USA David Morens, Bethesda, Maryland, USA Duane J. Gubler, Singapore J. Glenn Morris, Gainesville, Florida, USA Richard L. Guerrant, Charlottesville, Virginia, USA Patrice Nordmann, Paris, France Scott Halstead, Arlington, Virginia, USA Tanja Popovic, Atlanta, Georgia, USA David L. Heymann, Geneva, Switzerland Jocelyn A. Rankin, Atlanta, Georgia, USA Daniel B. Jernigan, Atlanta, Georgia, USA Didier Raoult, Marseille, France Charles King, Cleveland, Ohio, USA Pierre Rollin, Atlanta, Georgia, USA Keith Klugman, Atlanta, Georgia, USA Dixie E. Snider, Atlanta, Georgia, USA Takeshi Kurata, Tokyo, Japan Frank Sorvillo, Los Angeles, California, USA S.K. Lam, Kuala Lumpur, Malaysia David Walker, Galveston, Texas, USA Bruce R.
    [Show full text]
  • API 20E Manufacture Instructions
    REF 20 100 / 20 160 07584D - GB - 2002/10 ® IVD 20 E Identification system for Enterobacteriaceae and other non-fastidious Gram-negative rods SUMMARY AND EXPLANATION Material : API 20 E is a standardized identification system for - Pipettes or PSIpettes Enterobacteriaceae and other non-fastidious, Gram- - Ampule protector negative rods which uses 21 miniaturized biochemical - Ampule rack tests and a database. The complete list of those - General microbiology laboratory equipment organisms that it is possible to identify with this system is given in the Identification Table at the end of this package POSSIBLE ADDITIONAL REAGENTS : insert. - API OF Medium (Ref. 50 110) : Test for the determination of fermentative or oxidative PRINCIPLE metabolism. The API 20 E strip consists of 20 microtubes containing - API M Medium (Ref. 50 120) : dehydrated substrates. These tests are inoculated with Test for motility of facultative anaerobic bacteria. a bacterial suspension that reconstitutes the media. During incubation, metabolism produces color changes WARNINGS AND PRECAUTIONS that are either spontaneous or revealed by the addition of • For in vitro diagnostic use and microbiological reagents. control. The reactions are read according to the Reading Table • For professional use only. and the identification is obtained by referring to the • This kit contains products of animal origin. Certified Analytical Profile Index or using the identification software. knowledge of the origin and/or sanitary state of the animals does not totally guarantee the absence of CONTENT OF THE KIT transmissible pathogenic agents. It is therefore Kit for 25 tests (ref. 20 100) recommended that these products be treated as - 25 API 20 E strips potentially infectious, and handled observing the usual - 25 incubation boxes safety precautions (do not ingest or inhale).
    [Show full text]
  • Biochemical Characterization and Identification of Bacterial Strains
    Biochemical characterization and identification of bacterial strains isolated from drinking water sources of Kohat, Pakistan Tassadaq Hussain, Aneela Roohi, Shehzad Munir, Iftikhar Ahmed, Jafar Khan, Veronique Edel-Hermann, Kil Yong Kim, Muhammad Anees To cite this version: Tassadaq Hussain, Aneela Roohi, Shehzad Munir, Iftikhar Ahmed, Jafar Khan, et al.. Biochemical characterization and identification of bacterial strains isolated from drinking water sources ofKohat, Pakistan. African Journal of Microbiology Research, Academic Journal, 2013, 7 (16), pp.1579-1590. 10.5897/AJMR12.2204. hal-01005074 HAL Id: hal-01005074 https://hal.archives-ouvertes.fr/hal-01005074 Submitted on 29 May 2020 HAL is a multi-disciplinary open access L’archive ouverte pluridisciplinaire HAL, est archive for the deposit and dissemination of sci- destinée au dépôt et à la diffusion de documents entific research documents, whether they are pub- scientifiques de niveau recherche, publiés ou non, lished or not. The documents may come from émanant des établissements d’enseignement et de teaching and research institutions in France or recherche français ou étrangers, des laboratoires abroad, or from public or private research centers. publics ou privés. Vol. 7(16), pp. 1579-1590, 16 April, 2013 DOI: 10.5897/AJMR12.2204 ISSN 1996-0808 ©2013 Academic Journals African Journal of Microbiology Research http://www.academicjournals.org/AJMR Full Length Research Paper Biochemical characterization and identification of bacterial strains isolated from drinking water sources of Kohat, Pakistan Tassadaq Hussain1, Aneela Roohi1, Shehzad Munir1, Iftikhar Ahmed2, Jafar Khan1, Veronique Edel-Hermann3, Kil Yong Kim4 and Muhammad Anees1* 1Department of Microbiology, Kohat University of Science and Technology, Kohat, Pakistan.
    [Show full text]
  • Factors Affecting Experimental Streptococcus Agalactiae Infection in Tilapia, Oreochromis Niloticus
    View metadata, citation and similar papers at core.ac.uk brought to you by CORE provided by Stirling Online Research Repository FACTORS AFFECTING EXPERIMENTAL STREPTOCOCCUS AGALACTIAE INFECTION IN TILAPIA, OREOCHROMIS NILOTICUS THESIS SUBMITTED TO THE UNIVERSITY OF STIRLING FOR THE DEGREE OF DOCTOR OF PHILOSOPHY BY DILOK WONGSATHEIN 27 SEPTEMBER 2012 INSTITUTE OF AQUACULTURE Declaration Declaration I declare that this thesis has been composed in its entirety by me. Except where specifically acknowledged, the work described in this thesis has been conducted by me and has not been submitted for any other degree. Signature: _________________________________________ Signature of supervisor: _________________________________________ Date: _________________________________________ II Abstract Abstract Streptococcus agalactiae infection is one of the major disease problems affecting farmed tilapia (Oreochromis niloticus) worldwide. Tilapia are highly susceptible to this disease which results in mortality of up to 70% over a period of around 7 days and significant economic losses for farmers. Affected tilapia commonly present with an irregular behaviour associated with meningoencephalitis and septicaemia. Currently, factors affecting the virulence and transmission of S. agalactiae in fish including tilapia are poorly understood. Reports from natural outbreaks of S. agalactiae infection on tilapia farms have suggested larvae and juvenile or fish smaller than 20 g are not susceptible. In addition, there is variability in individual response to experimental inflammatory challenge associated with coping styles (bold, shy) in common carp (Cyprinus carpio). The central hypotheses of this thesis were that weight, age and coping style might affect the development and progression of this bacterial disease. This study investigated these three factors with experimental S. agalactiae infection in Nile tilapia.
    [Show full text]
  • Antimicrobial Sensitivity Pattern of Urine Isolates from Asymptomatic Bacteriuria During Pregnancy
    E:/Biomedica Vol.22 Jan. – Jun. 2006/Bio-9 (A) ANTIMICROBIAL SENSITIVITY PATTERN OF URINE ISOLATES FROM ASYMPTOMATIC BACTERIURIA DURING PREGNANCY 1AZIZ MARJAN KHATTAK, 2HABIB-ULLAH KHAN, 3IHSAN-ULLAH MASHUD 4BUSHRA ASHIQ AND 5SYED HUMAYUN SHAH Departments of 1,5 Pathology, 2,3 Medicine, Gomal Medical College, Dera Ismail Khan – Pakistan 4Departments of Microbiology, BMSI, JPMC, Karachi Screening women for asymptomatic bacteriuria (ASB) on the first antenatal visit is a part of standard obstetric care. Treating women with ASB decreases the chances of maternal and foetal complications. This study was conducted to find out the spectrum of urine pathogens and their drug susceptibility pattern for ASB during pregnancy. The study was conducted in the Basic Medical Sciences Institute, Jinnah Postgraduate Medical Centre Karachi, from September 2001 to March 2002. Two hundred and ninety women, apparently normal with confirmed pregnancy, were registered. A voided midstream urine specimen was collected and cultured. A significant growth i.e. ≥10 5 organisms/ml was identified with Analytical Profile Index 20 tests for identification of Enterobacteraceae (API-20-E) and for Gram positive cocci by other standard methods. The prevalence of ASB was found 6.2%. Antimicrobial sensitivity was determined by disc diffusion Kirby Bauyer method after matching the turbidity with 0.5 McFarland ,s standard. Most of the recommended drugs were found to have encouraging results, however, Escherichia coli showed 66.67% resistance to ampicillins and sulphonamides. Enterobacters showed 100% resistance to ampicillins, cephalosporins and nitrofurantoin. Staphylococcus saprophyticus showed 66.67% resistance to ampicillins and sulphonamides. It was concluded that detection of ASB during pregnancy and appropriate use of antimicrobials is only possible after culture of urine.
    [Show full text]
  • Practical Bacteriology Laboratory Manual
    Practical Bacteriology Laboratory Manual CLS 413 Prepared By: Deemah M. Al-Dabbagh Demonstrator, CLS Department King Saud University Practical Bacteriology CLS 413 Laboratory Safety General Safety Rules and Procedures 1. No food or drinks are permitted in the laboratory at any time. 2. Only closed-toe shoes are to be worn in the laboratory. Sandals are not permitted. 3. Keep hands and other objects away from your face, nose, eyes, ears, and mouth. The application of cosmetics in the laboratory is prohibited in the laboratory 4. Work areas/surfaces must be disinfected before and after use. 5. Laboratory coats must be worn and buttoned while in the laboratory. 6. Long hair should be secured behind your head. 7. Hands must be washed before leaving the laboratory. 8. All unnecessary books, purses, briefcases, etc., must be kept off the countertops. 9. Label all materials with your name, date, and any other applicable information (e.g., media, organism, etc.). 10. Dispose of wastes in their proper containers. 11. When handling chemicals, note the hazard code on the bottle and take the appropriate precautions indicated. 12. Do not pour chemicals down the sink. 13. Return all chemicals, reagents, cultures, and glassware to their appropriate places. 14. Flame (sterilize) transfer loops, wires, or needles before and immediately after use to transfer biological material. 15. Do not walk about the laboratory with transfer loops, wires, needles, or pipettes containing infectious material. 16. Turn off incinerators before leaving the laboratory. 17. Report any broken equipment. 18. If you are injured in the laboratory, immediately contact your course instructor or TA.
    [Show full text]
  • Medical Microbiology Manual
    LABORATORY EXERCISES to accompany MICROBIOLOGY LABORATORY BSL 214 Professor Susan C. Kavanaugh Bluegrass Community & Technical College 2010 INTRODUCTION TO CULTURING, MEDIA, AND ASEPTIC TECHNIQUES Even though you may be starting a career in a health-related field, you may be unaware of the number and variety of microorganisms (microbes) found everywhere in our environment, including the human body. In this laboratory you will learn new techniques and observations which relate to the concepts of microbiology and to your future health career. Most of the microorganisms that you will use in these laboratories are normal inhabitants of our environment. These microbes are called normal microbiota for the environment in which they normally reside. Health professionals need this knowledge in order to be able to distinguish normal flora from a possible infectious agent when interpreting microbiological reports. They also need to understand how normal flora can occasionally cause an infection when they invade a different area of the body, or when the patient's immune responses have been compromised. Microorganisms are found almost everywhere. In these first laboratory exercises you will be introduced to aseptic techniques, the procedures followed by microbiologists and healthcare workers to prevent contamination of cultures from outside sources and to prevent introduction of potentially disease-causing microbes (pathogens) into the human body. The methods for handling previously sterilized materials, for taking samples, for handling cultures, and for disposing contaminated materials are all designed to prevent the spread of microbes from one area to another. Pay close attention to the details in the written procedures and to the instructor's demonstrations to prevent contamination of your cultures, yourself, your environment, and the other people in your laboratory as well as prevention of infecting people outside of the laboratory, such as your friends and family.
    [Show full text]
  • Traditional Culture and Identification Methods 83
    6 © Traditional Culture Images RF/GettyCavan Images and Identification Methods Maria E. Delost, PhD, MT(ASCP) Chapter Outline Introduction Automated Identification Systems Colonial Morphology Matrix-Assisted Laser Desorption Ionization Time of Preliminary Biochemical Tests Flight Mass Spectrometry (MALDI-TOF MS) Multitest Systems Blood Culture Systems Detection of Metabolic Activity Key Terms α hemolytic Colorimetry MALDI-TOF MS Nonhemolytic β hemolytic Fluorometry Nephelometry Phenotypic characteristics Colonial characteristics Learning Objectives Upon successful study and review of this chapter, the learner should be able to: 1. Describe the common bacterial streaking techniques. 7. Discuss the use of manual multitest systems in the 2. Explain the importance of colonial morphology in microbiology laboratory. clinical microbiology. 8. State the principle of the following detection 3. Describe the major phenotypic characteristics used methods and give an application of each: colorim- to evaluate colonial morphology. etry, nephelometry, and fluorometry. 4. Identify and describe the types of hemolysis 9. Describe the principle of MALDI-TOF MS and its observed on sheep blood agar. applications in clinical microbiology. 5. Discuss how the following tests can be used in 10. State the principle of operation and capabilities of the preliminary identification of bacteria: catalase, automated microbiology systems, including identi- cytochrome oxidase, coagulase, PYR hydrolysis, fication and antimicrobial testing. and carbohydrate utilization. 11. Discuss manual and automated blood culture 6. Explain the three methods to detect bacterial systems. metabolism. 81 Copyright © 2022 by Jones & Bartlett Learning, LLC, an Ascend Learning Company 82 Part I Introduction to Clinical Microbiology Introduction primary plates, the microbiologist evaluates the growth to determine if the colonies represent pathogens, normal Traditional methods of identification usingphenotypic microbiota, or contaminants.
    [Show full text]