
International Journal of Clinical Obstetrics and Gynaecology 2018; 2(6): 31-42 ISSN (P): 2522-6614 ISSN (E): 2522-6622 © Gynaecology Journal Characterization, prevalance and antimicrobial www.gynaecologyjournal.com 2018; 2(6): 31-42 susceptibility pattern of bacterial uropathogens isolated Received: 21-09-2018 Accepted: 24-10-2018 from pregnant women at Lahore general hospital, Lahore, Pakistan Rabia Habib Institute of Molecular Biology and Biotechnology, University of Lahore, Pakistan Rabia Habib, Muhammad Danish Mehmood, Sana Noreen, Huma Anwar, Mehreen Gul, Nazia Ayub and Almas Raza Muhammad Danish Mehmood Ottoman Pharma (Immuno Division), Raiwind Road Lahore, Abstract Pakistan Urinary tract infection (UTI) is common in ladies living in developing countries which may progress to complications such as pyelonephritis and preterm delivery during pregnancy. The present study provides an Sana Noreen insight for causative agent of UTI, their prevalence in pregnant ladies and its association with age, Ottoman Pharma (Immuno metabolic disorder and gestational period. Total of 375 midstream samples were collected from pregnant Division), Raiwind Road Lahore, women, pure culture were segregated on selective media and identified through analytical profile index Pakistan (API) to evaluate prevalence of uropathogens in UTI and ASB patients. Isolated uropathogenic E. coli were further characterized by polymerase chain reaction (PCR) using specific primers for genotype cjrA, cjrB, Huma Anwar and cjrC. Among 375 midstream urine samples of pregnant women, 160 cases of UTI and ASB (≥105 Ottoman Pharma (Immuno CFU) were recorded. API analysis of such samples showed 65(40.6%), 55(34.35%) and 40(25%) of E. coli, Division), Raiwind Road Lahore, Pakistan Enterococci and Staphylococci respectively. Furthermore, PCR based characterization of E. coli revealed 42(64.61%) prevalence of both cjrA and cjrB genotype in asymptomatic and urinary tract infected patients. Mehreen Gul Prevalence of uropathogen in UTI suspected patients was found significantly higher in 20-40 age group Post Graduate Medical Institute, 77(74.75%), diabetic patients 90(87.37%) and women reported in first trimester of gestation period Lahore, Pakistan 52(50.48%). Antibiotic susceptibility test results revealed that PCR confirmed uropathogenic E. coli was highly sensitive to Ceftriaxone, Amikacin, Nitofurantoin, Gentamicin and Ciprofloxacin with percentage of Nazia Ayub 79.2%, 76.4%, 75%, 61% and 52% respectively. Whereas, these isolates were resistant to Ampicillin 89%, Post Graduate Medical Institute, Cefuroxime 70%, Amoxicillin 65%, Tobramycin 43% and Ceftazidime 22%. Lahore, Pakistan Keywords: urinary tract infection, asymptimatic bacteriuria, uropathogenic E. coli Almas Raza Sharif Medical & Dental College, Lahore, Pakistan 1. Introduction Urinary tract infections are common problem in females and need serious attention particularly during pregnancy. It is the inflammatory response of epithelium of urinary tract to bacterial invasion, which is typically associated with bacteriuria and pyuria (1). Lower UTI (cystitis) was characterized with the symptoms of suprapubic pain or tenderness, urgency, frequency of urination or dysuria. Upper UTI (pyelonephritis) was diagnosed (without another obvious etiology) with or without urinary symptoms (2). In pregnant women Urinary tract infection (UTI) is a common health problem whose diagnostic process may get complicated as it can be either symptomatic or asymptomatic. Symptomatic bacteriuria is one of the fatal cause of premature birth, high fatality rate and postpartum complications. Urinary tract infections are common in female due to short urethra, its dilatation in various stages of pregnancy make it easy [1] access to faecal flora . Mostly 80-90% of infections caused by Escherichia coli. Other organism are Klebsiella spp, Staphylococcus aureus. Pseudomonas spp [3, 4]. and less common cause of UTI are enterococci, Staphylococcus saprophyticus, Chlamydia spp, Candida albicans, Gardenerella vaginalis. Colonization of group B streptococcus associated with preterm rupture [5] [6] of membrane and labour . Urine in bladder is normally sterile the presence of bacteria in [7] 5 urine is known as bacteriuria . Significant bacteriuria is defined as presence of 10 colony forming units CFU per millilitre of urine [8]. Asymptomatic bacteriuria (ASB) is the presence of bacteria in urine without symptoms of acute urinary tract infection [9, 10]. Asymptomatic Correspondence bacteriuria (ASB) commonly occurs in both pregnant and non-pregnant women [11]. The Muhammad Danish Mehmood Ottoman Pharma (Immuno antibacterial location and position of urinary and reproductive genital in females make them Division), Raiwind Road Lahore, prone to infection specially after conceiving. Uropathogen could have the ability to pose severe Pakistan ~ 31 ~ International Journal of Clinical Obstetrics and Gynaecology threats in terms of creating micro changes in epithelium, showing standard characteristics colony were selected for Gram inflammatory responses and invasiveness. Such conditions may Staining. It was performed according to standard procedure. lead to adverse gynaecological outcomes which includes low- Smear was established by placing a loopful of culture on birth weight, pre-mature birth and even high mortality rate. microscope glass slide re-suspended with drop of distilled water Furthermore, hormonal and anatomical changes during in circular pattern. The smear was fixed by passing 3-4 times on pregnancy and its effect on the dilatation of the ureters and renal flame followed by heat air drying. Straining was performed pelvis may create ample space and time for uropathogen to get according to the method described by Bergey [23] (Fig. 12). entered and cause infection. This combined with short nature of female urethra and perineal colonization by enteric organism, 2.4 Biochemical Assay predispose to UTI and pyelonephritis [12-15]. The analytical profile index of Gram negative rods and Gram It is widely accepted that uropathogenic E. coli (UPEC) positive cocci isolated from urine samples was determined originates from the distal gut microbiota [16-18]. To cause through RapID One Pannel (Remel-Thermo Fisher Scientific, ascending UTI, it needs to overcome and adapt to different USA) and API 20 (Biomerieux-USA), following instructions of distinct host environments, such as the bladder, the kidneys and the manufacturer (Fig. 13, 14). even the bloodstream. It is known that UPEC requires a combination of multiple virulence genes to cause infection19. 2.5 Polymerase Chain Reaction (Pcr) The virulence gene combination of a UPEC strain may All the samples including positive known bacteria were determine the pathogenesis process employed by this strain to subjected for extraction of DNA by using QAIamp DNA Mini cause infection. kit (QIAGEN-Germany). The extracted DNA of the samples Ascending infection of uropathogen has another prospect in were subjected to PCR for amplification of the desired genes development of cystitis and pyelonephritis. In either of the cases, cjrA, (223bp) cjrB (397bp) and cjrC (513bp) of uropathogenic involvement of UPEC make them complicated for the medical E. coli. For the PCR reaction, 2 µl of 10X PCR buffer, 1 µl of professionals to treat because of their versatility and high forward and reverse primer, 2 µl of 80mM MgCl2, 2µl of DNTPs resistance of antibiotics. The severity of such complications can mixture and 1 µl of Taq DNA polymerase (Perkin-Elmer Cetus, be controlled by screening symptomatic bacteriuria and giving Norwalk, Conn.) were added to the reaction mixture. Reaction prompt treatment before conceiving and during different stages volume was obtained by adding 9 µl of Nuclease-free Water and of pregnancy [20]. Therefore, it is important to visit medical 2 µl of extracted DNA sample. The PCR tubes were incubated in professionals for interpretation of urinalysis at different stages of thermal cycler (Applied Biosystems) with an initial denaturation pregnancy to prevent imperial treatment. Screening recommended of 94 °C for 2 mints. Followed by 30 cycles of denaturation at [21] is at first visit or between12-16 week of gestation . 94 °C for 30 secs, annealing at 56 °C for 30 secs. and extension at 72 °C for 45 secs. Final extension was conducted at 72 °C for 2. Materials and Method 5 minutes (Fig. 15, 16). 2.1 Study Design and Protocol 2.1.1 Sample Size Table I: Sequences of Oligonucleotide primers E. coli. Gene Primers The sample size was calculated by using the formula of Kish & Amplicon size Sequences [22] Lisle (1965) states that Forward Primer 223bp AAAGGGTGGTCCTGGGAGAT cjrA n = z2 p (1-p) / d2 Reverse Primer ACGTCAGTTGCTGGCTTTCA Where, z = Score for 95% confidence interval = 1.96 Forward Primer 397bp CGAAGTTCAGCCCGCTATGT cjrB p = Prevalence (To estimate the proportion of pregnant women Reverse Primer GCRRRCCCAAGATGCCTCAG Forward Primer 518bp AAACCTCAGCGCAAAATCGT with UTI) cjrC d = Sampling error that could be tolerate= 5%. Reverse Primer AGGCTTCAGGAATGGGTTCA 1-p= Probability Present study was conducted in co-ordination with 2.6. Culture Sensitivity Test Gynaecology and obstetrics department of Lahore General Antimicrobial susceptibility test (AST) was performed for all the Hospital (LGH) located on Ferozpur road Lahore, Pakistan. The isolates using Kirby-Bauer’s disk diffusion method described by study population comprised of all pregnant women attending the Bauer et al., 1966. All procedures were done as recommended antenatal
Details
-
File Typepdf
-
Upload Time-
-
Content LanguagesEnglish
-
Upload UserAnonymous/Not logged-in
-
File Pages12 Page
-
File Size-