MAP3K11 (Human) Recombinant Protein
Total Page:16
File Type:pdf, Size:1020Kb
Load more
Recommended publications
-
Gene Symbol Gene Description ACVR1B Activin a Receptor, Type IB
Table S1. Kinase clones included in human kinase cDNA library for yeast two-hybrid screening Gene Symbol Gene Description ACVR1B activin A receptor, type IB ADCK2 aarF domain containing kinase 2 ADCK4 aarF domain containing kinase 4 AGK multiple substrate lipid kinase;MULK AK1 adenylate kinase 1 AK3 adenylate kinase 3 like 1 AK3L1 adenylate kinase 3 ALDH18A1 aldehyde dehydrogenase 18 family, member A1;ALDH18A1 ALK anaplastic lymphoma kinase (Ki-1) ALPK1 alpha-kinase 1 ALPK2 alpha-kinase 2 AMHR2 anti-Mullerian hormone receptor, type II ARAF v-raf murine sarcoma 3611 viral oncogene homolog 1 ARSG arylsulfatase G;ARSG AURKB aurora kinase B AURKC aurora kinase C BCKDK branched chain alpha-ketoacid dehydrogenase kinase BMPR1A bone morphogenetic protein receptor, type IA BMPR2 bone morphogenetic protein receptor, type II (serine/threonine kinase) BRAF v-raf murine sarcoma viral oncogene homolog B1 BRD3 bromodomain containing 3 BRD4 bromodomain containing 4 BTK Bruton agammaglobulinemia tyrosine kinase BUB1 BUB1 budding uninhibited by benzimidazoles 1 homolog (yeast) BUB1B BUB1 budding uninhibited by benzimidazoles 1 homolog beta (yeast) C9orf98 chromosome 9 open reading frame 98;C9orf98 CABC1 chaperone, ABC1 activity of bc1 complex like (S. pombe) CALM1 calmodulin 1 (phosphorylase kinase, delta) CALM2 calmodulin 2 (phosphorylase kinase, delta) CALM3 calmodulin 3 (phosphorylase kinase, delta) CAMK1 calcium/calmodulin-dependent protein kinase I CAMK2A calcium/calmodulin-dependent protein kinase (CaM kinase) II alpha CAMK2B calcium/calmodulin-dependent -
PDF Download
MEK-7 Polyclonal Antibody Catalog No : YT2725 Reactivity : Human,Mouse,Rat Applications : WB,ELISA Gene Name : MAP2K7 Protein Name : Dual specificity mitogen-activated protein kinase kinase 7 Human Gene Id : 5609 Human Swiss Prot O14733 No : Mouse Gene Id : 26400 Mouse Swiss Prot Q8CE90 No : Rat Gene Id : 363855 Rat Swiss Prot No : Q4KSH7 Immunogen : The antiserum was produced against synthesized peptide derived from human MAP2K7. AA range:241-290 Specificity : MEK-7 Polyclonal Antibody detects endogenous levels of MEK-7 protein. Formulation : Liquid in PBS containing 50% glycerol, 0.5% BSA and 0.02% sodium azide. Source : Rabbit Dilution : Western Blot: 1/500 - 1/2000. ELISA: 1/20000. Not yet tested in other applications. Purification : The antibody was affinity-purified from rabbit antiserum by affinity- chromatography using epitope-specific immunogen. Concentration : 1 mg/ml 1 / 3 Storage Stability : -20°C/1 year Molecularweight : 47485 Observed Band : 47 Cell Pathway : MAPK_ERK_Growth,MAPK_G_Protein,ErbB_HER,Toll_Like,T_Cell_Receptor, Fc epsilon RI,Neurotrophin,GnRH, Background : mitogen-activated protein kinase kinase 7(MAP2K7) Homo sapiens The protein encoded by this gene is a dual specificity protein kinase that belongs to the MAP kinase kinase family. This kinase specifically activates MAPK8/JNK1 and MAPK9/JNK2, and this kinase itself is phosphorylated and activated by MAP kinase kinase kinases including MAP3K1/MEKK1, MAP3K2/MEKK2,MAP3K3/MEKK5, and MAP4K2/GCK. This kinase is involved in the signal transduction mediating the cell -
Application of a MYC Degradation
SCIENCE SIGNALING | RESEARCH ARTICLE CANCER Copyright © 2019 The Authors, some rights reserved; Application of a MYC degradation screen identifies exclusive licensee American Association sensitivity to CDK9 inhibitors in KRAS-mutant for the Advancement of Science. No claim pancreatic cancer to original U.S. Devon R. Blake1, Angelina V. Vaseva2, Richard G. Hodge2, McKenzie P. Kline3, Thomas S. K. Gilbert1,4, Government Works Vikas Tyagi5, Daowei Huang5, Gabrielle C. Whiten5, Jacob E. Larson5, Xiaodong Wang2,5, Kenneth H. Pearce5, Laura E. Herring1,4, Lee M. Graves1,2,4, Stephen V. Frye2,5, Michael J. Emanuele1,2, Adrienne D. Cox1,2,6, Channing J. Der1,2* Stabilization of the MYC oncoprotein by KRAS signaling critically promotes the growth of pancreatic ductal adeno- carcinoma (PDAC). Thus, understanding how MYC protein stability is regulated may lead to effective therapies. Here, we used a previously developed, flow cytometry–based assay that screened a library of >800 protein kinase inhibitors and identified compounds that promoted either the stability or degradation of MYC in a KRAS-mutant PDAC cell line. We validated compounds that stabilized or destabilized MYC and then focused on one compound, Downloaded from UNC10112785, that induced the substantial loss of MYC protein in both two-dimensional (2D) and 3D cell cultures. We determined that this compound is a potent CDK9 inhibitor with a previously uncharacterized scaffold, caused MYC loss through both transcriptional and posttranslational mechanisms, and suppresses PDAC anchorage- dependent and anchorage-independent growth. We discovered that CDK9 enhanced MYC protein stability 62 through a previously unknown, KRAS-independent mechanism involving direct phosphorylation of MYC at Ser . -
Kinase Profiling Book
Custom and Pre-Selected Kinase Prof iling to f it your Budget and Needs! As of July 1, 2021 19.8653 mm 128 196 12 Tyrosine Serine/Threonine Lipid Kinases Kinases Kinases Carna Biosciences, Inc. 2007 Carna Biosciences, Inc. Profiling Assays available from Carna Biosciences, Inc. As of July 1, 2021 Page Kinase Name Assay Platform Page Kinase Name Assay Platform 4 ABL(ABL1) MSA 21 EGFR[T790M/C797S/L858R] MSA 4 ABL(ABL1)[E255K] MSA 21 EGFR[T790M/L858R] MSA 4 ABL(ABL1)[T315I] MSA 21 EPHA1 MSA 4 ACK(TNK2) MSA 21 EPHA2 MSA 4 AKT1 MSA 21 EPHA3 MSA 5 AKT2 MSA 22 EPHA4 MSA 5 AKT3 MSA 22 EPHA5 MSA 5 ALK MSA 22 EPHA6 MSA 5 ALK[C1156Y] MSA 22 EPHA7 MSA 5 ALK[F1174L] MSA 22 EPHA8 MSA 6 ALK[G1202R] MSA 23 EPHB1 MSA 6 ALK[G1269A] MSA 23 EPHB2 MSA 6 ALK[L1196M] MSA 23 EPHB3 MSA 6 ALK[R1275Q] MSA 23 EPHB4 MSA 6 ALK[T1151_L1152insT] MSA 23 Erk1(MAPK3) MSA 7 EML4-ALK MSA 24 Erk2(MAPK1) MSA 7 NPM1-ALK MSA 24 Erk5(MAPK7) MSA 7 AMPKα1/β1/γ1(PRKAA1/B1/G1) MSA 24 FAK(PTK2) MSA 7 AMPKα2/β1/γ1(PRKAA2/B1/G1) MSA 24 FER MSA 7 ARG(ABL2) MSA 24 FES MSA 8 AurA(AURKA) MSA 25 FGFR1 MSA 8 AurA(AURKA)/TPX2 MSA 25 FGFR1[V561M] MSA 8 AurB(AURKB)/INCENP MSA 25 FGFR2 MSA 8 AurC(AURKC) MSA 25 FGFR2[V564I] MSA 8 AXL MSA 25 FGFR3 MSA 9 BLK MSA 26 FGFR3[K650E] MSA 9 BMX MSA 26 FGFR3[K650M] MSA 9 BRK(PTK6) MSA 26 FGFR3[V555L] MSA 9 BRSK1 MSA 26 FGFR3[V555M] MSA 9 BRSK2 MSA 26 FGFR4 MSA 10 BTK MSA 27 FGFR4[N535K] MSA 10 BTK[C481S] MSA 27 FGFR4[V550E] MSA 10 BUB1/BUB3 MSA 27 FGFR4[V550L] MSA 10 CaMK1α(CAMK1) MSA 27 FGR MSA 10 CaMK1δ(CAMK1D) MSA 27 FLT1 MSA 11 CaMK2α(CAMK2A) MSA 28 -
HCC and Cancer Mutated Genes Summarized in the Literature Gene Symbol Gene Name References*
HCC and cancer mutated genes summarized in the literature Gene symbol Gene name References* A2M Alpha-2-macroglobulin (4) ABL1 c-abl oncogene 1, receptor tyrosine kinase (4,5,22) ACBD7 Acyl-Coenzyme A binding domain containing 7 (23) ACTL6A Actin-like 6A (4,5) ACTL6B Actin-like 6B (4) ACVR1B Activin A receptor, type IB (21,22) ACVR2A Activin A receptor, type IIA (4,21) ADAM10 ADAM metallopeptidase domain 10 (5) ADAMTS9 ADAM metallopeptidase with thrombospondin type 1 motif, 9 (4) ADCY2 Adenylate cyclase 2 (brain) (26) AJUBA Ajuba LIM protein (21) AKAP9 A kinase (PRKA) anchor protein (yotiao) 9 (4) Akt AKT serine/threonine kinase (28) AKT1 v-akt murine thymoma viral oncogene homolog 1 (5,21,22) AKT2 v-akt murine thymoma viral oncogene homolog 2 (4) ALB Albumin (4) ALK Anaplastic lymphoma receptor tyrosine kinase (22) AMPH Amphiphysin (24) ANK3 Ankyrin 3, node of Ranvier (ankyrin G) (4) ANKRD12 Ankyrin repeat domain 12 (4) ANO1 Anoctamin 1, calcium activated chloride channel (4) APC Adenomatous polyposis coli (4,5,21,22,25,28) APOB Apolipoprotein B [including Ag(x) antigen] (4) AR Androgen receptor (5,21-23) ARAP1 ArfGAP with RhoGAP domain, ankyrin repeat and PH domain 1 (4) ARHGAP35 Rho GTPase activating protein 35 (21) ARID1A AT rich interactive domain 1A (SWI-like) (4,5,21,22,24,25,27,28) ARID1B AT rich interactive domain 1B (SWI1-like) (4,5,22) ARID2 AT rich interactive domain 2 (ARID, RFX-like) (4,5,22,24,25,27,28) ARID4A AT rich interactive domain 4A (RBP1-like) (28) ARID5B AT rich interactive domain 5B (MRF1-like) (21) ASPM Asp (abnormal -
NIH Public Access Provided by Digital.CSIC Author Manuscript Bioessays
View metadata, citation and similar papers at core.ac.uk brought to you by CORE NIH Public Access provided by Digital.CSIC Author Manuscript Bioessays. Author manuscript; available in PMC 2007 October 1. NIH-PA Author ManuscriptPublished NIH-PA Author Manuscript in final edited NIH-PA Author Manuscript form as: Bioessays. 2007 April ; 29(4): 356±370. GTP-binding proteins of the Rho/Rac family: regulation, effectors and functions in vivo Xosé R. Bustelo*, Vincent Sauzeau, and Inmaculada M. Berenjeno Centro de Investigación del Cáncer and Instituto de Biología Molecular y Celular del Cáncer (IBMCC), CSIC-University of Salamanca, Salamanca, Spain. Summary Rho/Rac proteins constitute a subgroup of the Ras superfamily of GTP hydrolases. Although originally implicated in the control of cytoskeletal events, it is currently known that these GTPases coordinate diverse cellular functions, including cell polarity, vesicular trafficking, the cell cycle and transcriptomal dynamics. In this review, we will provide an overview on the recent advances in this field regarding the mechanism of regulation and signaling, and the roles in vivo of this important GTPase family. Introduction The isolation of rhoA,(1) the first member of the Rho/Rac family ever identified, was achieved by Richard Axel’s group in 1985 during the search for ras -related genes in Aplysia.(1) The subsequent use of conventional cloning techniques and the more-recent characterization of genomes revealed that the original gene is not alone, having numerous family counterparts in other species including, among many others, S. cerevisiae(7 genes), A. taliana(11 genes), C. elegans(9 genes), D. melanogaster(9 genes) and H. -
Identification of a Family of Camp Response Element-Binding Protein Coactivators by Genome-Scale Functional Analysis in Mammalian Cells
Identification of a family of cAMP response element-binding protein coactivators by genome-scale functional analysis in mammalian cells Vadim Iourgenko*†, Wenjun Zhang*†, Craig Mickanin*, Ira Daly*, Can Jiang*, Jonathan M. Hexham*, Anthony P. Orth‡, Loren Miraglia‡, Jodi Meltzer*, Dan Garza*, Gung-Wei Chirn*, Elizabeth McWhinnie*, Dalia Cohen*, Joanne Skelton*, Robert Terry*, Yang Yu*, Dale Bodian*, Frank P. Buxton*, Jian Zhu*, Chuanzheng Song*, and Mark A. Labow*§ *Department of Functional Genomics, Novartis Institute for Biomedical Research, 100 Technology Square, Cambridge, MA 02139; and ‡Genomics Institute, Novartis Research Foundation, 10675 John Jay Hopkins Drive, Suite F117, San Diego, CA 92121 Edited by Peter K. Vogt, The Scripps Research Institute, La Jolla, CA, and approved July 30, 2003 (received for review May 8, 2003) This report describes an unbiased method for systematically de- of screening data and further experiments demonstrated that the termining gene function in mammalian cells. A total of 20,704 IL-8 promoter contained an unrecognized cAMP response predicted human full-length cDNAs were tested for induction of element (CRE)-like element that was activated by a protein, the IL-8 promoter. A number of genes, including those for cyto- termed transducer of regulated cAMP response element-binding kines, receptors, adapters, kinases, and transcription factors, were protein (CREB) TORC1, which is the founding member of a identified that induced the IL-8 promoter through known regula- conserved family of CREB coactivators. Thus, screening of tory sites. Proteins that acted through a cooperative interaction arrayed cDNAs represents an unbiased approach for identifica- between an AP-1 and an unrecognized cAMP response element tion of gene function and elucidation of pathways that regulate (CRE)-like site were also identified. -
Characterization of the Small Molecule Kinase Inhibitor SU11248 (Sunitinib/ SUTENT in Vitro and in Vivo
TECHNISCHE UNIVERSITÄT MÜNCHEN Lehrstuhl für Genetik Characterization of the Small Molecule Kinase Inhibitor SU11248 (Sunitinib/ SUTENT in vitro and in vivo - Towards Response Prediction in Cancer Therapy with Kinase Inhibitors Michaela Bairlein Vollständiger Abdruck der von der Fakultät Wissenschaftszentrum Weihenstephan für Ernährung, Landnutzung und Umwelt der Technischen Universität München zur Erlangung des akademischen Grades eines Doktors der Naturwissenschaften genehmigten Dissertation. Vorsitzender: Univ. -Prof. Dr. K. Schneitz Prüfer der Dissertation: 1. Univ.-Prof. Dr. A. Gierl 2. Hon.-Prof. Dr. h.c. A. Ullrich (Eberhard-Karls-Universität Tübingen) 3. Univ.-Prof. A. Schnieke, Ph.D. Die Dissertation wurde am 07.01.2010 bei der Technischen Universität München eingereicht und durch die Fakultät Wissenschaftszentrum Weihenstephan für Ernährung, Landnutzung und Umwelt am 19.04.2010 angenommen. FOR MY PARENTS 1 Contents 2 Summary ................................................................................................................................................................... 5 3 Zusammenfassung .................................................................................................................................................... 6 4 Introduction .............................................................................................................................................................. 8 4.1 Cancer .............................................................................................................................................................. -
MLK3 (MAP3K11) (NM 002419) Human Tagged ORF Clone Product Data
OriGene Technologies, Inc. 9620 Medical Center Drive, Ste 200 Rockville, MD 20850, US Phone: +1-888-267-4436 [email protected] EU: [email protected] CN: [email protected] Product datasheet for RC203782 MLK3 (MAP3K11) (NM_002419) Human Tagged ORF Clone Product data: Product Type: Expression Plasmids Product Name: MLK3 (MAP3K11) (NM_002419) Human Tagged ORF Clone Tag: Myc-DDK Symbol: MAP3K11 Synonyms: MEKK11; MLK-3; MLK3; PTK1; SPRK Vector: pCMV6-Entry (PS100001) E. coli Selection: Kanamycin (25 ug/mL) Cell Selection: Neomycin This product is to be used for laboratory only. Not for diagnostic or therapeutic use. View online » ©2021 OriGene Technologies, Inc., 9620 Medical Center Drive, Ste 200, Rockville, MD 20850, US 1 / 5 MLK3 (MAP3K11) (NM_002419) Human Tagged ORF Clone – RC203782 ORF Nucleotide >RC203782 representing NM_002419 Sequence: Red=Cloning site Blue=ORF Green=Tags(s) TTTTGTAATACGACTCACTATAGGGCGGCCGGGAATTCGTCGACTGGATCCGGTACCGAGGAGATCTGCC GCCGCGATCGCC ATGGAGCCCTTGAAGAGCCTCTTCCTCAAGAGCCCTCTAGGGTCATGGAATGGCAGTGGCAGCGGGGGTG GTGGGGGCGGTGGAGGAGGCCGGCCTGAGGGGTCTCCAAAGGCAGCGGGTTATGCCAACCCGGTGTGGAC AGCCCTGTTCGACTACGAGCCCAGTGGGCAGGATGAGCTGGCCCTGAGGAAGGGTGACCGTGTGGAGGTG CTGTCCCGGGACGCAGCCATCTCAGGAGACGAGGGCTGGTGGGCGGGCCAGGTGGGTGGCCAGGTGGGCA TCTTCCCGTCCAACTATGTGTCTCGGGGTGGCGGCCCGCCCCCCTGCGAGGTGGCCAGCTTCCAGGAGCT GCGGCTGGAGGAGGTGATCGGCATTGGAGGCTTTGGCAAGGTGTACAGGGGCAGCTGGCGAGGTGAGCTG GTGGCTGTGAAGGCAGCTCGCCAGGACCCCGATGAGGACATCAGTGTGACAGCCGAGAGCGTTCGCCAGG AGGCCCGGCTCTTCGCCATGCTGGCACACCCCAACATCATTGCCCTCAAGGCTGTGTGCCTGGAGGAGCC CAACCTGTGCCTGGTGATGGAGTATGCAGCCGGTGGGCCCCTCAGCCGAGCTCTGGCCGGGCGGCGCGTG -
Fibrosis Accumulation in Idiopathic Pulmonary Apoptosis
Increased Cell Surface Fas Expression Is Necessary and Sufficient To Sensitize Lung Fibroblasts to Fas Ligation-Induced Apoptosis: Implications for Fibroblast This information is current as Accumulation in Idiopathic Pulmonary of October 1, 2021. Fibrosis Murry W. Wynes, Benjamin L. Edelman, Amanda G. Kostyk, Michael G. Edwards, Christopher Coldren, Steve D. Groshong, Gregory P. Cosgrove, Elizabeth F. Redente, Alison Bamberg, Kevin K. Brown, Nichole Reisdorph, Downloaded from Rebecca C. Keith, Stephen K. Frankel and David W. H. Riches J Immunol 2011; 187:527-537; Prepublished online 1 June 2011; doi: 10.4049/jimmunol.1100447 http://www.jimmunol.org/ http://www.jimmunol.org/content/187/1/527 Supplementary http://www.jimmunol.org/content/suppl/2011/06/01/jimmunol.110044 Material 7.DC1 References This article cites 62 articles, 18 of which you can access for free at: by guest on October 1, 2021 http://www.jimmunol.org/content/187/1/527.full#ref-list-1 Why The JI? Submit online. • Rapid Reviews! 30 days* from submission to initial decision • No Triage! Every submission reviewed by practicing scientists • Fast Publication! 4 weeks from acceptance to publication *average Subscription Information about subscribing to The Journal of Immunology is online at: http://jimmunol.org/subscription Permissions Submit copyright permission requests at: http://www.aai.org/About/Publications/JI/copyright.html Email Alerts Receive free email-alerts when new articles cite this article. Sign up at: http://jimmunol.org/alerts The Journal of Immunology is published twice each month by The American Association of Immunologists, Inc., 1451 Rockville Pike, Suite 650, Rockville, MD 20852 Copyright © 2011 by The American Association of Immunologists, Inc. -
Protein-Protein Interactions Among Signaling Pathways May Become New Therapeutic Targets in Liver Cancer (Review)
ONCOLOGY REPORTS 35: 625-638, 2016 Protein-protein interactions among signaling pathways may become new therapeutic targets in liver cancer (Review) XIAO ZHANG1*, YULAN WANG1*, Jiayi WANG1,2 and FENYONG SUN1 1Department of Clinical Laboratory Medicine, Shanghai Tenth People's Hospital of Tongji University, Shanghai 200072; 2Translation Medicine of High Institute, Tongji University, Shanghai 200092, P.R. China Received May 29, 2015; Accepted July 6, 2015 DOI: 10.3892/or.2015.4464 Abstract. Numerous signaling pathways have been shown to be 1. Introduction dysregulated in liver cancer. In addition, some protein-protein interactions are prerequisite for the uncontrolled activation Liver cancer is the sixth most common cancer and the second or inhibition of these signaling pathways. For instance, in most common cause of cancer-associated mortality world- the PI3K/AKT signaling pathway, protein AKT binds with wide (1). Approximately 75% of all primary liver cancer types a number of proteins such as mTOR, FOXO1 and MDM2 to are hepatocellular carcinoma (HCC) that formed from liver play an oncogenic role in liver cancer. The aim of the present cells. Liver cancer can be formed from other structures in review was to focus on a series of important protein-protein the liver such as bile duct, blood vessels and immune cells. interactions that can serve as potential therapeutic targets Secondary liver cancer is a result of metastasis of cancer from in liver cancer among certain important pro-carcinogenic other body sites into the liver. The major cause of primary liver signaling pathways. The strategies of how to investigate and cancer is viral infection with either hepatitis C virus (HCV) analyze the protein-protein interactions are also included in or hepatitis B virus (HBV), which leads to massive inflamma- this review. -
(ERK) Interacting Proteins and Their Domain: an in Silico Study
World Journal of Neuroscience, 2021, 11, 67-89 https://www.scirp.org/journal/wjns ISSN Online: 2162-2019 ISSN Print: 2162-2000 Identification of Secondary Structure of Extracellular Signal Regulated Kinase (ERK) Interacting Proteins and Their Domain: An in Silico Study Kurrey Khuleshwari, Paramanik Vijay* Cellular and Molecular Neurobiology & Drug Targeting Laboratory, Department of Zoology, Indira Gandhi National Tribal University, Amarkantak (MP), (MP)-484 887, India How to cite this paper: Khuleshwari, K. Abstract and Vijay, P. (2021) Identification of Sec- ondary Structure of Extracellular Signal ERK is involved in multiple cell signaling pathways through its interacting Regulated Kinase (ERK) Interacting Pro- proteins. By in silico analysis, earlier we have identified 22 putative ERK in- teins and Their Domain: An in Silico Study. teracting proteins namely; ephrin type-B receptor 2 isoform 2 precursor World Journal of Neuroscience, 11, 67-89. https://doi.org/10.4236/wjns.2021.111007 (EPHB2), mitogen-activated protein kinase 1 (MAPK1), interleukin-17 re- ceptor D precursor (IL17RD), WD repeat domain containing 83 (WDR83), Received: November 29, 2020 tescalcin (Tesc), mitogen-activated protein kinase kinase kinase 4 (MAPP3K4), Accepted: February 23, 2021 kinase suppressor of Ras2 (KSR2), mitogen-activated protein kinase kinase 6 Published: February 26, 2021 (MAP3K6), UL16 binding protein 2 (ULBP2), UL16 binding protein 1 Copyright © 2021 by author(s) and (ULBP1), dual specificity phosphatase 14 (DUSP14), dual specificity phos- Scientific Research Publishing Inc. phatase 6 (DUSP6), hyaluronan-mediated motility receptor (RHAMM), ki- This work is licensed under the Creative Commons Attribution International nase D interacting substrate of 220 kDa (KININS220), membrane-associated License (CC BY 4.0).