MAP3K11 Is a Tumor Suppressor Targeted by the Oncomir Mir-125B in Early B Cells
Total Page:16
File Type:pdf, Size:1020Kb
Load more
Recommended publications
-
Gene Symbol Gene Description ACVR1B Activin a Receptor, Type IB
Table S1. Kinase clones included in human kinase cDNA library for yeast two-hybrid screening Gene Symbol Gene Description ACVR1B activin A receptor, type IB ADCK2 aarF domain containing kinase 2 ADCK4 aarF domain containing kinase 4 AGK multiple substrate lipid kinase;MULK AK1 adenylate kinase 1 AK3 adenylate kinase 3 like 1 AK3L1 adenylate kinase 3 ALDH18A1 aldehyde dehydrogenase 18 family, member A1;ALDH18A1 ALK anaplastic lymphoma kinase (Ki-1) ALPK1 alpha-kinase 1 ALPK2 alpha-kinase 2 AMHR2 anti-Mullerian hormone receptor, type II ARAF v-raf murine sarcoma 3611 viral oncogene homolog 1 ARSG arylsulfatase G;ARSG AURKB aurora kinase B AURKC aurora kinase C BCKDK branched chain alpha-ketoacid dehydrogenase kinase BMPR1A bone morphogenetic protein receptor, type IA BMPR2 bone morphogenetic protein receptor, type II (serine/threonine kinase) BRAF v-raf murine sarcoma viral oncogene homolog B1 BRD3 bromodomain containing 3 BRD4 bromodomain containing 4 BTK Bruton agammaglobulinemia tyrosine kinase BUB1 BUB1 budding uninhibited by benzimidazoles 1 homolog (yeast) BUB1B BUB1 budding uninhibited by benzimidazoles 1 homolog beta (yeast) C9orf98 chromosome 9 open reading frame 98;C9orf98 CABC1 chaperone, ABC1 activity of bc1 complex like (S. pombe) CALM1 calmodulin 1 (phosphorylase kinase, delta) CALM2 calmodulin 2 (phosphorylase kinase, delta) CALM3 calmodulin 3 (phosphorylase kinase, delta) CAMK1 calcium/calmodulin-dependent protein kinase I CAMK2A calcium/calmodulin-dependent protein kinase (CaM kinase) II alpha CAMK2B calcium/calmodulin-dependent -
A Computational Approach for Defining a Signature of Β-Cell Golgi Stress in Diabetes Mellitus
Page 1 of 781 Diabetes A Computational Approach for Defining a Signature of β-Cell Golgi Stress in Diabetes Mellitus Robert N. Bone1,6,7, Olufunmilola Oyebamiji2, Sayali Talware2, Sharmila Selvaraj2, Preethi Krishnan3,6, Farooq Syed1,6,7, Huanmei Wu2, Carmella Evans-Molina 1,3,4,5,6,7,8* Departments of 1Pediatrics, 3Medicine, 4Anatomy, Cell Biology & Physiology, 5Biochemistry & Molecular Biology, the 6Center for Diabetes & Metabolic Diseases, and the 7Herman B. Wells Center for Pediatric Research, Indiana University School of Medicine, Indianapolis, IN 46202; 2Department of BioHealth Informatics, Indiana University-Purdue University Indianapolis, Indianapolis, IN, 46202; 8Roudebush VA Medical Center, Indianapolis, IN 46202. *Corresponding Author(s): Carmella Evans-Molina, MD, PhD ([email protected]) Indiana University School of Medicine, 635 Barnhill Drive, MS 2031A, Indianapolis, IN 46202, Telephone: (317) 274-4145, Fax (317) 274-4107 Running Title: Golgi Stress Response in Diabetes Word Count: 4358 Number of Figures: 6 Keywords: Golgi apparatus stress, Islets, β cell, Type 1 diabetes, Type 2 diabetes 1 Diabetes Publish Ahead of Print, published online August 20, 2020 Diabetes Page 2 of 781 ABSTRACT The Golgi apparatus (GA) is an important site of insulin processing and granule maturation, but whether GA organelle dysfunction and GA stress are present in the diabetic β-cell has not been tested. We utilized an informatics-based approach to develop a transcriptional signature of β-cell GA stress using existing RNA sequencing and microarray datasets generated using human islets from donors with diabetes and islets where type 1(T1D) and type 2 diabetes (T2D) had been modeled ex vivo. To narrow our results to GA-specific genes, we applied a filter set of 1,030 genes accepted as GA associated. -
PDF Download
MEK-7 Polyclonal Antibody Catalog No : YT2725 Reactivity : Human,Mouse,Rat Applications : WB,ELISA Gene Name : MAP2K7 Protein Name : Dual specificity mitogen-activated protein kinase kinase 7 Human Gene Id : 5609 Human Swiss Prot O14733 No : Mouse Gene Id : 26400 Mouse Swiss Prot Q8CE90 No : Rat Gene Id : 363855 Rat Swiss Prot No : Q4KSH7 Immunogen : The antiserum was produced against synthesized peptide derived from human MAP2K7. AA range:241-290 Specificity : MEK-7 Polyclonal Antibody detects endogenous levels of MEK-7 protein. Formulation : Liquid in PBS containing 50% glycerol, 0.5% BSA and 0.02% sodium azide. Source : Rabbit Dilution : Western Blot: 1/500 - 1/2000. ELISA: 1/20000. Not yet tested in other applications. Purification : The antibody was affinity-purified from rabbit antiserum by affinity- chromatography using epitope-specific immunogen. Concentration : 1 mg/ml 1 / 3 Storage Stability : -20°C/1 year Molecularweight : 47485 Observed Band : 47 Cell Pathway : MAPK_ERK_Growth,MAPK_G_Protein,ErbB_HER,Toll_Like,T_Cell_Receptor, Fc epsilon RI,Neurotrophin,GnRH, Background : mitogen-activated protein kinase kinase 7(MAP2K7) Homo sapiens The protein encoded by this gene is a dual specificity protein kinase that belongs to the MAP kinase kinase family. This kinase specifically activates MAPK8/JNK1 and MAPK9/JNK2, and this kinase itself is phosphorylated and activated by MAP kinase kinase kinases including MAP3K1/MEKK1, MAP3K2/MEKK2,MAP3K3/MEKK5, and MAP4K2/GCK. This kinase is involved in the signal transduction mediating the cell -
Application of a MYC Degradation
SCIENCE SIGNALING | RESEARCH ARTICLE CANCER Copyright © 2019 The Authors, some rights reserved; Application of a MYC degradation screen identifies exclusive licensee American Association sensitivity to CDK9 inhibitors in KRAS-mutant for the Advancement of Science. No claim pancreatic cancer to original U.S. Devon R. Blake1, Angelina V. Vaseva2, Richard G. Hodge2, McKenzie P. Kline3, Thomas S. K. Gilbert1,4, Government Works Vikas Tyagi5, Daowei Huang5, Gabrielle C. Whiten5, Jacob E. Larson5, Xiaodong Wang2,5, Kenneth H. Pearce5, Laura E. Herring1,4, Lee M. Graves1,2,4, Stephen V. Frye2,5, Michael J. Emanuele1,2, Adrienne D. Cox1,2,6, Channing J. Der1,2* Stabilization of the MYC oncoprotein by KRAS signaling critically promotes the growth of pancreatic ductal adeno- carcinoma (PDAC). Thus, understanding how MYC protein stability is regulated may lead to effective therapies. Here, we used a previously developed, flow cytometry–based assay that screened a library of >800 protein kinase inhibitors and identified compounds that promoted either the stability or degradation of MYC in a KRAS-mutant PDAC cell line. We validated compounds that stabilized or destabilized MYC and then focused on one compound, Downloaded from UNC10112785, that induced the substantial loss of MYC protein in both two-dimensional (2D) and 3D cell cultures. We determined that this compound is a potent CDK9 inhibitor with a previously uncharacterized scaffold, caused MYC loss through both transcriptional and posttranslational mechanisms, and suppresses PDAC anchorage- dependent and anchorage-independent growth. We discovered that CDK9 enhanced MYC protein stability 62 through a previously unknown, KRAS-independent mechanism involving direct phosphorylation of MYC at Ser . -
Kinase Profiling Book
Custom and Pre-Selected Kinase Prof iling to f it your Budget and Needs! As of July 1, 2021 19.8653 mm 128 196 12 Tyrosine Serine/Threonine Lipid Kinases Kinases Kinases Carna Biosciences, Inc. 2007 Carna Biosciences, Inc. Profiling Assays available from Carna Biosciences, Inc. As of July 1, 2021 Page Kinase Name Assay Platform Page Kinase Name Assay Platform 4 ABL(ABL1) MSA 21 EGFR[T790M/C797S/L858R] MSA 4 ABL(ABL1)[E255K] MSA 21 EGFR[T790M/L858R] MSA 4 ABL(ABL1)[T315I] MSA 21 EPHA1 MSA 4 ACK(TNK2) MSA 21 EPHA2 MSA 4 AKT1 MSA 21 EPHA3 MSA 5 AKT2 MSA 22 EPHA4 MSA 5 AKT3 MSA 22 EPHA5 MSA 5 ALK MSA 22 EPHA6 MSA 5 ALK[C1156Y] MSA 22 EPHA7 MSA 5 ALK[F1174L] MSA 22 EPHA8 MSA 6 ALK[G1202R] MSA 23 EPHB1 MSA 6 ALK[G1269A] MSA 23 EPHB2 MSA 6 ALK[L1196M] MSA 23 EPHB3 MSA 6 ALK[R1275Q] MSA 23 EPHB4 MSA 6 ALK[T1151_L1152insT] MSA 23 Erk1(MAPK3) MSA 7 EML4-ALK MSA 24 Erk2(MAPK1) MSA 7 NPM1-ALK MSA 24 Erk5(MAPK7) MSA 7 AMPKα1/β1/γ1(PRKAA1/B1/G1) MSA 24 FAK(PTK2) MSA 7 AMPKα2/β1/γ1(PRKAA2/B1/G1) MSA 24 FER MSA 7 ARG(ABL2) MSA 24 FES MSA 8 AurA(AURKA) MSA 25 FGFR1 MSA 8 AurA(AURKA)/TPX2 MSA 25 FGFR1[V561M] MSA 8 AurB(AURKB)/INCENP MSA 25 FGFR2 MSA 8 AurC(AURKC) MSA 25 FGFR2[V564I] MSA 8 AXL MSA 25 FGFR3 MSA 9 BLK MSA 26 FGFR3[K650E] MSA 9 BMX MSA 26 FGFR3[K650M] MSA 9 BRK(PTK6) MSA 26 FGFR3[V555L] MSA 9 BRSK1 MSA 26 FGFR3[V555M] MSA 9 BRSK2 MSA 26 FGFR4 MSA 10 BTK MSA 27 FGFR4[N535K] MSA 10 BTK[C481S] MSA 27 FGFR4[V550E] MSA 10 BUB1/BUB3 MSA 27 FGFR4[V550L] MSA 10 CaMK1α(CAMK1) MSA 27 FGR MSA 10 CaMK1δ(CAMK1D) MSA 27 FLT1 MSA 11 CaMK2α(CAMK2A) MSA 28 -
HCC and Cancer Mutated Genes Summarized in the Literature Gene Symbol Gene Name References*
HCC and cancer mutated genes summarized in the literature Gene symbol Gene name References* A2M Alpha-2-macroglobulin (4) ABL1 c-abl oncogene 1, receptor tyrosine kinase (4,5,22) ACBD7 Acyl-Coenzyme A binding domain containing 7 (23) ACTL6A Actin-like 6A (4,5) ACTL6B Actin-like 6B (4) ACVR1B Activin A receptor, type IB (21,22) ACVR2A Activin A receptor, type IIA (4,21) ADAM10 ADAM metallopeptidase domain 10 (5) ADAMTS9 ADAM metallopeptidase with thrombospondin type 1 motif, 9 (4) ADCY2 Adenylate cyclase 2 (brain) (26) AJUBA Ajuba LIM protein (21) AKAP9 A kinase (PRKA) anchor protein (yotiao) 9 (4) Akt AKT serine/threonine kinase (28) AKT1 v-akt murine thymoma viral oncogene homolog 1 (5,21,22) AKT2 v-akt murine thymoma viral oncogene homolog 2 (4) ALB Albumin (4) ALK Anaplastic lymphoma receptor tyrosine kinase (22) AMPH Amphiphysin (24) ANK3 Ankyrin 3, node of Ranvier (ankyrin G) (4) ANKRD12 Ankyrin repeat domain 12 (4) ANO1 Anoctamin 1, calcium activated chloride channel (4) APC Adenomatous polyposis coli (4,5,21,22,25,28) APOB Apolipoprotein B [including Ag(x) antigen] (4) AR Androgen receptor (5,21-23) ARAP1 ArfGAP with RhoGAP domain, ankyrin repeat and PH domain 1 (4) ARHGAP35 Rho GTPase activating protein 35 (21) ARID1A AT rich interactive domain 1A (SWI-like) (4,5,21,22,24,25,27,28) ARID1B AT rich interactive domain 1B (SWI1-like) (4,5,22) ARID2 AT rich interactive domain 2 (ARID, RFX-like) (4,5,22,24,25,27,28) ARID4A AT rich interactive domain 4A (RBP1-like) (28) ARID5B AT rich interactive domain 5B (MRF1-like) (21) ASPM Asp (abnormal -
Supplementary Materials
Supplementary materials Supplementary Table S1: MGNC compound library Ingredien Molecule Caco- Mol ID MW AlogP OB (%) BBB DL FASA- HL t Name Name 2 shengdi MOL012254 campesterol 400.8 7.63 37.58 1.34 0.98 0.7 0.21 20.2 shengdi MOL000519 coniferin 314.4 3.16 31.11 0.42 -0.2 0.3 0.27 74.6 beta- shengdi MOL000359 414.8 8.08 36.91 1.32 0.99 0.8 0.23 20.2 sitosterol pachymic shengdi MOL000289 528.9 6.54 33.63 0.1 -0.6 0.8 0 9.27 acid Poricoic acid shengdi MOL000291 484.7 5.64 30.52 -0.08 -0.9 0.8 0 8.67 B Chrysanthem shengdi MOL004492 585 8.24 38.72 0.51 -1 0.6 0.3 17.5 axanthin 20- shengdi MOL011455 Hexadecano 418.6 1.91 32.7 -0.24 -0.4 0.7 0.29 104 ylingenol huanglian MOL001454 berberine 336.4 3.45 36.86 1.24 0.57 0.8 0.19 6.57 huanglian MOL013352 Obacunone 454.6 2.68 43.29 0.01 -0.4 0.8 0.31 -13 huanglian MOL002894 berberrubine 322.4 3.2 35.74 1.07 0.17 0.7 0.24 6.46 huanglian MOL002897 epiberberine 336.4 3.45 43.09 1.17 0.4 0.8 0.19 6.1 huanglian MOL002903 (R)-Canadine 339.4 3.4 55.37 1.04 0.57 0.8 0.2 6.41 huanglian MOL002904 Berlambine 351.4 2.49 36.68 0.97 0.17 0.8 0.28 7.33 Corchorosid huanglian MOL002907 404.6 1.34 105 -0.91 -1.3 0.8 0.29 6.68 e A_qt Magnogrand huanglian MOL000622 266.4 1.18 63.71 0.02 -0.2 0.2 0.3 3.17 iolide huanglian MOL000762 Palmidin A 510.5 4.52 35.36 -0.38 -1.5 0.7 0.39 33.2 huanglian MOL000785 palmatine 352.4 3.65 64.6 1.33 0.37 0.7 0.13 2.25 huanglian MOL000098 quercetin 302.3 1.5 46.43 0.05 -0.8 0.3 0.38 14.4 huanglian MOL001458 coptisine 320.3 3.25 30.67 1.21 0.32 0.9 0.26 9.33 huanglian MOL002668 Worenine -
NIH Public Access Provided by Digital.CSIC Author Manuscript Bioessays
View metadata, citation and similar papers at core.ac.uk brought to you by CORE NIH Public Access provided by Digital.CSIC Author Manuscript Bioessays. Author manuscript; available in PMC 2007 October 1. NIH-PA Author ManuscriptPublished NIH-PA Author Manuscript in final edited NIH-PA Author Manuscript form as: Bioessays. 2007 April ; 29(4): 356±370. GTP-binding proteins of the Rho/Rac family: regulation, effectors and functions in vivo Xosé R. Bustelo*, Vincent Sauzeau, and Inmaculada M. Berenjeno Centro de Investigación del Cáncer and Instituto de Biología Molecular y Celular del Cáncer (IBMCC), CSIC-University of Salamanca, Salamanca, Spain. Summary Rho/Rac proteins constitute a subgroup of the Ras superfamily of GTP hydrolases. Although originally implicated in the control of cytoskeletal events, it is currently known that these GTPases coordinate diverse cellular functions, including cell polarity, vesicular trafficking, the cell cycle and transcriptomal dynamics. In this review, we will provide an overview on the recent advances in this field regarding the mechanism of regulation and signaling, and the roles in vivo of this important GTPase family. Introduction The isolation of rhoA,(1) the first member of the Rho/Rac family ever identified, was achieved by Richard Axel’s group in 1985 during the search for ras -related genes in Aplysia.(1) The subsequent use of conventional cloning techniques and the more-recent characterization of genomes revealed that the original gene is not alone, having numerous family counterparts in other species including, among many others, S. cerevisiae(7 genes), A. taliana(11 genes), C. elegans(9 genes), D. melanogaster(9 genes) and H. -
Identification of a Family of Camp Response Element-Binding Protein Coactivators by Genome-Scale Functional Analysis in Mammalian Cells
Identification of a family of cAMP response element-binding protein coactivators by genome-scale functional analysis in mammalian cells Vadim Iourgenko*†, Wenjun Zhang*†, Craig Mickanin*, Ira Daly*, Can Jiang*, Jonathan M. Hexham*, Anthony P. Orth‡, Loren Miraglia‡, Jodi Meltzer*, Dan Garza*, Gung-Wei Chirn*, Elizabeth McWhinnie*, Dalia Cohen*, Joanne Skelton*, Robert Terry*, Yang Yu*, Dale Bodian*, Frank P. Buxton*, Jian Zhu*, Chuanzheng Song*, and Mark A. Labow*§ *Department of Functional Genomics, Novartis Institute for Biomedical Research, 100 Technology Square, Cambridge, MA 02139; and ‡Genomics Institute, Novartis Research Foundation, 10675 John Jay Hopkins Drive, Suite F117, San Diego, CA 92121 Edited by Peter K. Vogt, The Scripps Research Institute, La Jolla, CA, and approved July 30, 2003 (received for review May 8, 2003) This report describes an unbiased method for systematically de- of screening data and further experiments demonstrated that the termining gene function in mammalian cells. A total of 20,704 IL-8 promoter contained an unrecognized cAMP response predicted human full-length cDNAs were tested for induction of element (CRE)-like element that was activated by a protein, the IL-8 promoter. A number of genes, including those for cyto- termed transducer of regulated cAMP response element-binding kines, receptors, adapters, kinases, and transcription factors, were protein (CREB) TORC1, which is the founding member of a identified that induced the IL-8 promoter through known regula- conserved family of CREB coactivators. Thus, screening of tory sites. Proteins that acted through a cooperative interaction arrayed cDNAs represents an unbiased approach for identifica- between an AP-1 and an unrecognized cAMP response element tion of gene function and elucidation of pathways that regulate (CRE)-like site were also identified. -
Characterization of the Small Molecule Kinase Inhibitor SU11248 (Sunitinib/ SUTENT in Vitro and in Vivo
TECHNISCHE UNIVERSITÄT MÜNCHEN Lehrstuhl für Genetik Characterization of the Small Molecule Kinase Inhibitor SU11248 (Sunitinib/ SUTENT in vitro and in vivo - Towards Response Prediction in Cancer Therapy with Kinase Inhibitors Michaela Bairlein Vollständiger Abdruck der von der Fakultät Wissenschaftszentrum Weihenstephan für Ernährung, Landnutzung und Umwelt der Technischen Universität München zur Erlangung des akademischen Grades eines Doktors der Naturwissenschaften genehmigten Dissertation. Vorsitzender: Univ. -Prof. Dr. K. Schneitz Prüfer der Dissertation: 1. Univ.-Prof. Dr. A. Gierl 2. Hon.-Prof. Dr. h.c. A. Ullrich (Eberhard-Karls-Universität Tübingen) 3. Univ.-Prof. A. Schnieke, Ph.D. Die Dissertation wurde am 07.01.2010 bei der Technischen Universität München eingereicht und durch die Fakultät Wissenschaftszentrum Weihenstephan für Ernährung, Landnutzung und Umwelt am 19.04.2010 angenommen. FOR MY PARENTS 1 Contents 2 Summary ................................................................................................................................................................... 5 3 Zusammenfassung .................................................................................................................................................... 6 4 Introduction .............................................................................................................................................................. 8 4.1 Cancer .............................................................................................................................................................. -
Supp Table 6.Pdf
Supplementary Table 6. Processes associated to the 2037 SCL candidate target genes ID Symbol Entrez Gene Name Process NM_178114 AMIGO2 adhesion molecule with Ig-like domain 2 adhesion NM_033474 ARVCF armadillo repeat gene deletes in velocardiofacial syndrome adhesion NM_027060 BTBD9 BTB (POZ) domain containing 9 adhesion NM_001039149 CD226 CD226 molecule adhesion NM_010581 CD47 CD47 molecule adhesion NM_023370 CDH23 cadherin-like 23 adhesion NM_207298 CERCAM cerebral endothelial cell adhesion molecule adhesion NM_021719 CLDN15 claudin 15 adhesion NM_009902 CLDN3 claudin 3 adhesion NM_008779 CNTN3 contactin 3 (plasmacytoma associated) adhesion NM_015734 COL5A1 collagen, type V, alpha 1 adhesion NM_007803 CTTN cortactin adhesion NM_009142 CX3CL1 chemokine (C-X3-C motif) ligand 1 adhesion NM_031174 DSCAM Down syndrome cell adhesion molecule adhesion NM_145158 EMILIN2 elastin microfibril interfacer 2 adhesion NM_001081286 FAT1 FAT tumor suppressor homolog 1 (Drosophila) adhesion NM_001080814 FAT3 FAT tumor suppressor homolog 3 (Drosophila) adhesion NM_153795 FERMT3 fermitin family homolog 3 (Drosophila) adhesion NM_010494 ICAM2 intercellular adhesion molecule 2 adhesion NM_023892 ICAM4 (includes EG:3386) intercellular adhesion molecule 4 (Landsteiner-Wiener blood group)adhesion NM_001001979 MEGF10 multiple EGF-like-domains 10 adhesion NM_172522 MEGF11 multiple EGF-like-domains 11 adhesion NM_010739 MUC13 mucin 13, cell surface associated adhesion NM_013610 NINJ1 ninjurin 1 adhesion NM_016718 NINJ2 ninjurin 2 adhesion NM_172932 NLGN3 neuroligin -
MLK3 (MAP3K11) (NM 002419) Human Tagged ORF Clone Product Data
OriGene Technologies, Inc. 9620 Medical Center Drive, Ste 200 Rockville, MD 20850, US Phone: +1-888-267-4436 [email protected] EU: [email protected] CN: [email protected] Product datasheet for RC203782 MLK3 (MAP3K11) (NM_002419) Human Tagged ORF Clone Product data: Product Type: Expression Plasmids Product Name: MLK3 (MAP3K11) (NM_002419) Human Tagged ORF Clone Tag: Myc-DDK Symbol: MAP3K11 Synonyms: MEKK11; MLK-3; MLK3; PTK1; SPRK Vector: pCMV6-Entry (PS100001) E. coli Selection: Kanamycin (25 ug/mL) Cell Selection: Neomycin This product is to be used for laboratory only. Not for diagnostic or therapeutic use. View online » ©2021 OriGene Technologies, Inc., 9620 Medical Center Drive, Ste 200, Rockville, MD 20850, US 1 / 5 MLK3 (MAP3K11) (NM_002419) Human Tagged ORF Clone – RC203782 ORF Nucleotide >RC203782 representing NM_002419 Sequence: Red=Cloning site Blue=ORF Green=Tags(s) TTTTGTAATACGACTCACTATAGGGCGGCCGGGAATTCGTCGACTGGATCCGGTACCGAGGAGATCTGCC GCCGCGATCGCC ATGGAGCCCTTGAAGAGCCTCTTCCTCAAGAGCCCTCTAGGGTCATGGAATGGCAGTGGCAGCGGGGGTG GTGGGGGCGGTGGAGGAGGCCGGCCTGAGGGGTCTCCAAAGGCAGCGGGTTATGCCAACCCGGTGTGGAC AGCCCTGTTCGACTACGAGCCCAGTGGGCAGGATGAGCTGGCCCTGAGGAAGGGTGACCGTGTGGAGGTG CTGTCCCGGGACGCAGCCATCTCAGGAGACGAGGGCTGGTGGGCGGGCCAGGTGGGTGGCCAGGTGGGCA TCTTCCCGTCCAACTATGTGTCTCGGGGTGGCGGCCCGCCCCCCTGCGAGGTGGCCAGCTTCCAGGAGCT GCGGCTGGAGGAGGTGATCGGCATTGGAGGCTTTGGCAAGGTGTACAGGGGCAGCTGGCGAGGTGAGCTG GTGGCTGTGAAGGCAGCTCGCCAGGACCCCGATGAGGACATCAGTGTGACAGCCGAGAGCGTTCGCCAGG AGGCCCGGCTCTTCGCCATGCTGGCACACCCCAACATCATTGCCCTCAAGGCTGTGTGCCTGGAGGAGCC CAACCTGTGCCTGGTGATGGAGTATGCAGCCGGTGGGCCCCTCAGCCGAGCTCTGGCCGGGCGGCGCGTG