sign in sign up
<<
Home , Anthocoridae, Hippodamia convergens, Thiamethoxam

TOXICOLOGICAL INTERACTIONS BETWEEN THIAMETHOXAM, , AND

PREDATORY NATURAL ENEMIES

Dissertation

Presented in Partial Fulfillment of the Requirements for the Degree Doctor of Philosophy in the Graduate School of The Ohio State University

By

Carlos J. Esquivel Palma, MSc.

Graduate Program in Entomology

The Ohio State University

2019

Dissertation Committee

Andy Michel, PhD and Luis Canas PhD, Advisors

Bill Hendrix, PhD

Kelley Tilmon, PhD

Reed Johnson, PhD

1

Copyrighted by

Carlos J. Esquivel Palma

2019

2 Abstract

Insecticides are important tools for control in various agricultural systems. Currently, are one of the most widely used . In particular, thiamethoxam is extensively used in crops for the control of several insect pests, including aphids. In field crops such as soybean, thiamethoxam is applied as seed treatment for the control of the soybean

(Aphis glycines) Matsumura (: ), an important invasive pest of soybean in

North America. To date, however, it is unknown when and how quickly populations could increase after planting. Moreover, it is not clear whether seed treatments can control soybean aphid populations that are virulent to host-plant resistance. Determining the survival of soybean aphids over time and the capacity to control virulence on seed-treated soybean is crucial to improve soybean aphid control and virulence management.

While thiamethoxam has shown to be effective against aphids, it could also cause negative effects on beneficial . One of the least understood ways thiamethoxam can harm beneficial insects is when predators consume aphids that have fed on plants treated with thiamethoxam (i.e. via the trophic food chain). Two important aphid predators, the convergent lady ( convergens) (Coleoptera: ) and the insidiosus flower bug

( insidiosus) (Anthocoridae: Hemiptera) have not been investigated for trophic food chain toxicity via prey (i.e. aphids). Furthermore, there is minimal information about the acute toxicity of insecticides on these predators.

ii Therefore, the goals of this dissertation are 1) evaluate the durability of thiamethoxam seed treatment for the control of avirulent and virulent soybean aphids; 2) evaluate the effectiveness of thiamethoxam seed treatment for the control of soybean virulence; 3) estimate the toxicity thiamethoxam could have via the food chain on the convergent lady beetle and insidiosus flower bug; and 4) estimate the acute toxicity of various insecticides on the convergent lady beetle and insidiosus flower bugs.

In Chapter 2, I evaluated the survival of soybean aphid when exposed to thiamethoxam seed-treated soybean. I used two soybean aphid biotypes, biotype 1 (avirulent) and biotype 4

(virulent to host plant resistance conferred by Resistance to Aphis glycines or Rag genes). I hypothesized that: 1) soybean aphid survival and thiamethoxam concentrations would be negatively correlated; and 2) that biotype 1 would have similar fitness to biotype 4 on insecticidal seed-treated soybean, but higher fitness than biotype 4 on untreated soybean. As expected, I found that thiamethoxam residues in plant decrease quickly, in correlation with the increase of soybean aphid survival. Moreover, I found that both soybean aphid biotypes have similar fitness on seed-treated soybean. On untreated soybean, however, biotype 4 had higher fitness than biotype 1.

In Chapter 3, I explored the concept of soybean aphid virulence control with seed treatment. In addition to a seed treatment, I also included a refuge strategy into the experimental design by planting aphid-susceptible and Rag-soybean. My goal was to evaluate whether aphid- susceptible soybean refuge in combination with thiamethoxam seed-treated Rag-soybean can control soybean aphid virulence. I hypothesized that 1) fitness of soybean aphid biotype 4 will be significantly lower when fed on Rag-soybean from thiamethoxam-treated seeds, 2) fitness of biotype 1 will be significantly higher when fed on untreated aphid-susceptible soybean, and 3)

iii seed treatment of Rag-soybean and untreated aphid-susceptible soybean will increase biotype 1 population in comparison with biotype 4. I found insights that the use of aphid-susceptible refuge in combination with seed treatment changes the population size of avirulent and virulent soybean aphid.

In Chapter 4, I evaluated the effects of the thiamethoxam on the convergent lady beetle and the insidiosus flower bug. I hypothesized that natural enemies feeding on aphids exposed to thiamethoxam-treated plants would have shorter longevity than those preying on aphids from untreated plants. As prey, I used the soybean aphid (Aphis glycines) Matsumura (Hemiptera:

Aphididae), the green peach aphid () (Sulzer) (Hemiptera: Aphididae), and the melon aphid () Glover (Hemiptera: Aphididae). Aphid cohorts were exposed to thiamethoxam-treated plants to ingest from the plants. Predators were later fed with these potentially toxic aphids. I found that thiamethoxam toxicity via the food chain negatively affected insidiosus flower bugs, but not convergent lady .

In Chapter 5, I evaluated the susceptibility or tolerance of convergent lady beetles and insidiosus flower bug to thiamethoxam. In brief, I estimated the acute toxicity of thiamethoxam on the convergent lady beetle and insidiosus flower bug. I performed topical applications to estimate the lethal concentration (LC50) of thiamethoxam, in comparison with , , , lambda-, , and flupyradifurone. Furthermore, LC50 of all insecticides were also estimated with the addition of piperonyl butoxide (PBO), a widely used insecticide synergist. I found that thiamethoxam has limited negative effects on convergent lady beetles, whereas thiamethoxam was highly toxic to the insidiosus flower bug. I also observed that the inclusion of PBO did not always increased the toxicity of insecticides on both predatory insects.

iv In this dissertation, I provided detailed insights of the duration of soybean aphid control by seed treatment and its use for the management of soybean aphid virulence. I also found that the use of thiamethoxam could harm the insidiosus flower bug via the food chain, whereas the convergent lady beetle is apparently not affected. Further topical toxicity trials revealed that convergent lady beetles might be tolerant to thiamethoxam. Moreover, I found that thiamethoxam is highly toxic to insidiosus flower bug. Our findings are critical for the development of novel integrated pest management strategies to control aphids combining insecticides, host-plant resistance and biological control.

v Dedication

This work is dedicated to God,

to my parents Braulio Antonio and Bera Alicia

to my siblings Dalia, Nery and Alice, to my nephews Andres and José and my niece Cielito,

and to my lovely fiancé Jodie A. White.

vi Acknowledgments

I would like to thank:

My advisors Dr. Andy Michel and Dr. Luis Canas for their unconditional support;

Nuris Acosta (la madrina) for her endless patience and help;

my friends to make every single day, the best day;

to all the Zamorano/OARDC family;

Dr. Chris Ranger and Dr. Larry Phelan for their support;

Corteva Agrisciences for the internship opportunity at Fresno, CA;

and to the wonderful Department of Entomology at The Ohio State University.

vii Vita

2005–2007...... Associate Degree in Escuela Nacional Central de Agricultura, Bárcena, Villa Nueva, Guatemala.

2008–2011...... BSc. in Science and Production, Pan-American College of Agriculture, Zamorano, Francisco Morazán, Honduras.

2012–2013...... Visiting Scholar, Department of Entomology, The Ohio State University.

2013–2015…...... Master in Entomology, Department of Entomology, The Ohio State University.

Summer, 2016...... Graduate intern, Dow AgroSciences, Western Research Station, Fresno, CA.

2015–2018...... Ph.D. student, Department of Entomology, The Ohio State University.

2018–present...... Ph.D. Candidate and Graduate Fellow, Department of Entomology, The Ohio State University.

viii

Publications

Parker, C., L. Bernaola, B. W. Lee, D. Elmquist, A. Cohen, A. Marshall, J. Hepler, A. Pekarcik, E. Justus, K. King, T. Y. Lee, C. Esquivel, K. Hauri, C. McCullough, W. Hadden, M. Ragozzino, M. Roth, J. Villegas, E. Kraus, M. Becker, M. Mulcahy, R. Chen, P. Mittapelly, C. S. Clem, R. Skinner, T. Josek, D. Pearlstein, J. Tetlie, A. Tran, A. Auletta, E. Benkert, and D. Tussey. 2019. Entomology in the 21st century: Tackling insect invasions, promoting advancements in technology, and using effective science communication: 2018 student debates. Journal of Insect Science 19.

Esquivel, C. J., C. M. Ranger, P. L. Phelan, E. J. Martinez, W. H. Hendrix, L. A. Canas, and A. P. Michel. 2019. Weekly survivorship curves of soybean aphid biotypes 1 and 4 on insecticidal seed-treated soybean. Journal of Economic Entomology 112: 712-719.

Li, Y., P. M. Piermarini, C. J. Esquivel, H. E. Drumm, F. D. Schilkey, and I. A. Hansen. 2017. RNA-Seq comparison of larval and adult Malpighian tubules of the yellow fever mosquito Aedes aegypti reveals life stage-specific changes in renal function. Frontiers in Physiology 8: 283.

Piermarini, P. M., C. J. Esquivel, and J. S. Denton. 2017. Malpighian tubules as novel targets for mosquito control. International Journal of Environmental Research and Public Health 14.

Yang, Z., B. M. Statler, T. L. Calkins, E. Alfaro, C. J. Esquivel, M. F. Rouhier, J. S. Denton, and P. M. Piermarini. 2017. Dynamic expression of genes encoding subunits of inward rectifier potassium (Kir) channels in the yellow fever mosquito Aedes aegypti. Comparative Biochemistry Physiology - Part B: Biochemistry and Molecular Biology 204: 35-44.

Esquivel, C. J., B. J. Cassone, and P. M. Piermarini. 2016. A de novo transcriptome of the Malpighian tubules in non-blood-fed and blood-fed Asian tiger mosquitoes Aedes albopictus: insights into diuresis, detoxification, and blood meal processing. PeerJ 4: e1784.

Esquivel, C. J., B. J. Cassone, and P. M. Piermarini. 2014. Transcriptomic evidence for a dramatic functional transition of the Malpighian tubules after a blood meal in the Asian tiger mosquito Aedes albopictus. PLoS Neglected Tropical Diseases 8: e2929.

Fields of Study

Major Field: Entomology

ix Table of Contents

Page Abstract ...... ii Dedication ...... vi Acknowledgments ...... vii Vita ...... viii Table of Contents ...... x List of Tables ...... xiii List of Figures ...... xv 1. Chapter 1. Literature review ...... 1 1.1. Overview of insecticides as tools for ...... 1 1.2. Life cycle and biology of the soybean aphid, green peach aphid and melon aphid ...... 2 1.2.1. The soybean aphid ...... 3 1.2.2. The green peach aphid ...... 6 1.2.3. The melon aphid ...... 9 1.3. Predatory natural enemies of aphids ...... 11 1.3.1. The convergent lady beetle ...... 11 1.3.2. The insidiosus flower bug ...... 12 1.4. Effects of insecticides on the convergent lady beetle and insidiosus flower bug ...... 13 1.5. Rationale, goals, and hypotheses of the studies in this dissertation ...... 14 1.6. Table and figures ...... 18 1.7. References cited ...... 25 2. Chapter 2. Weekly survivorship curves of soybean aphid biotypes 1 and 4 on insecticidal seed-treated soybean ...... 36 2.1. Abstract ...... 36 2.2. Introduction ...... 37 2.3. Materials and methods ...... 40 2.3.1. Soybean seeds ...... 40 2.3.2. Soybean aphids ...... 41 2.3.3. Greenhouse experiments ...... 41 2.3.4. Field experiment ...... 42 2.3.5. Aphid survival ...... 43 2.3.6. Plant tissue and extraction ...... 44 2.3.7. Insecticide quantification by UPLC-MS/MS ...... 45 x 2.4.1. Greenhouse experiment ...... 45 2.4.2. Field experiment ...... 46 2.4.3. Thiamethoxam concentration in soybean ...... 47 2.5. Discussion ...... 48 2.6. Tables and figures ...... 53 2.7. References cited ...... 61 3. Chapter 3: Evaluating the role of insecticidal seed treatment and refuge for managing soybean aphid virulence ...... 65 3.1. Abstract ...... 65 3.2. Introduction ...... 66 3.3. Materials and methods ...... 68 3.3.1. Soybean seeds ...... 68 3.3.2. Soybean aphids ...... 68 3.3.3. Microcosm conditions and experimental design ...... 69 3.3.4. Molecular biotype genotyping ...... 70 3.3.5. Statistical analysis ...... 71 3.4. Results ...... 72 3.4.1. Effect of refuge and seed treatment on aphid population size ...... 72 3.4.2. Change in fitness of aphid biotypes on seed-treated or untreated soybean ...... 73 3.5. Discussion ...... 75 3.5.1. Seed treatment effect on aphid population size ...... 75 3.5.2. Biotype fitness by seed treatment, soybean type and plant ages ...... 78 3.5.3. Potential interactions between aphid-susceptible refuge and seed treatment with natural enemies ...... 79 3.6. Conclusions and significance ...... 80 3.7. Figures and tables ...... 81 3.8. References cited ...... 85 4. Chapter 4: Thiamethoxam differentially impacts longevity on insidiosus flower bug and convergent lady beetle when exposed via the food chain ...... 89 4.1. Abstract ...... 89 4.2. Introduction ...... 90 4.3. Materials and methods ...... 93 4.3.1. Plant material ...... 93 4.3.2. Aphid colonies and thiamethoxam exposure ...... 94 4.3.3. Natural enemy colonies ...... 96 4.3.4. Predation of aphids by natural enemies ...... 96 4.3.5. Molecular gut analysis of insidiosus flower bug ...... 97 4.4. Results ...... 98 4.4.1. Predation and longevity of lady beetles ...... 98 4.4.2. Predation and longevity of the insidiosus flower bug ...... 99 4.5. Discussion ...... 101 4.6. Figures and tables ...... 106 4.7. References cited ...... 114 5. Chapter 5: Acute toxicity of insecticides on the convergent lady beetle and insidiosus flower bug 121 xi 5.1. Abstract ...... 121 5.2. Introduction ...... 122 5.3. Materials and methods ...... 125 5.3.1. Natural enemy colonies ...... 125 5.3.2. Microcosm arenas ...... 125 5.3.3. Chemicals used for topical applications ...... 126 5.3.4. Insecticide topical application ...... 126 5.3.5. Mortality assessment and statistical analyses ...... 127 5.4. Results ...... 128 5.4.1. Insecticide toxicity on convergent lady beetles ...... 128 5.4.2. Insecticide toxicity on insidiosus flower bug ...... 129 5.5. Discussion ...... 130 5.5.1. Insecticide toxicity on lady beetles ...... 131 5.5.2. Insecticide toxicity on insidiosus flower bug ...... 133 5.5.3. Effects of PBO in the toxicity of insecticides on the convergent lady beetle and insidiosus flower bug ...... 134 5.5.4. Compatibility of insecticides with convergent lady beetle and insidiosus flower bug 136 5.5.5. Tables and figures ...... 138 5.6. References cited ...... 143 6. Chapter 6: Summary and future directions ...... 150 6.1. Future directions of research ...... 152 6.2. References cited ...... 155 Bibliography ...... 157

xii List of Tables

Page Table 1. IRAC classification of insecticides based on mode of action and biological processed targeted...... 18 Table 2. List of insecticides with systemic/translaminar and non-systemic movement within plants...... 20 Table 3. Mortality of convergent lady beetle and insidiosus flower bug adults when exposed to various insecticides...... 21 Table 4. UPLC-MS/MS parameters used for multiple reaction monitoring mode (MRM) of thiamethoxam and triphenyl phosphate (TPP) transition ions...... 53 Table 5. Analysis of variance (ANOVA) of aphid survival values in greenhouse, 2015 experiment...... 53 Table 6. Analysis of variance (ANOVA) of aphid survival values in greenhouse, 2016 experiment...... 54 Table 7. Analysis of variance (ANOVA) of aphid survival values in field experiment...... 55 Table 8. Linear regression of aphid survival values (dependent variable) and days after planting (independent covariant) on untreated soybean in greenhouse (2016 experiment) and field...... 55 Table 9. Survival values (in percentage) from field experiment with soybean aphid biotypes 1 and 4 on seed-treated or untreated soybean across all plant ages (14–42 DAP)...... 55 Table 10. Analysis of variance of treatment, plant type (aphid-susceptible or Rag-soybean), biotype and plant age main effects and their interactions on the pcp values of soybean aphids. . 83 Table 11. Comparison of the per capita progeny (pcp) (±SEM) values of biotype 1 or biotype 4 soybean aphids between treatments (SR, SRt, StR, and StRt) when fed on aphid-susceptible (S) or Rag-soybean (R) at 7, 14, 21, 28, 35, and 42 days after planting (DAP). Soybeans were either seed coated or remained untreated as follows: A) aphid-susceptible soybean untreated, Rag- resistant soybean untreated (SR); B) aphid-susceptible soybean untreated, Rag-soybean treated (SRt); C) aphid-susceptible soybean treated, Rag-soybean untreated (StR); and D) aphid- susceptible soybean treated, Rag-soybean treated (StRt). Means within plant type (aphid- susceptible or Rag-soybean) column followed by different letter indicates significant difference between treatments (SR, SRt, StR, and StRt), Tukey’s HSD (α = 0.05)...... 84 Table 12. Forward and reverse oligo primers to amplify ‘cytochrome c oxidase 1’ (CO1) of insidiosus flower bug and soybean aphid...... 113

xiii Table 13. Estimated LC50 of insecticides on convergent lady beetles and pairwise comparison of the slope (hypothesis of parallelism) and intercept (hypothesis of equality) of insecticides with and without PBO...... 138 Table 14. Estimated LC50 of insecticides on insidiosus flower bugs and pairwise comparison of the slope (hypothesis of parallelism) and intercept (hypothesis of equality) of insecticides with and without PBO...... 139 Table 15. Lowest and highest dose (mg a.i./L) recommended on labels of several formulated insecticides. Insecticide dose are based on 935 liters of water per hectare...... 140

xiv List of Figures

Page Figure 1. Abdominal dimorphism (marked with red lines) between convergent lady beetle males (left) and females (right)...... 24 Figure 2. Abdominal dimorphism between convergent lady beetle males (left) and females (right)...... 24 Figure 3. Soybean plant age and soybean aphid survival in the greenhouse on plants grown from thiamethoxam-treated seeds (solid triangles) or untreated seeds (open triangles). Ten adult aphids were placed on plants at the time point indicated and survival assessed at 72 h. A and C: 2015 experiment; B and D: 2016 experiment; A and B: biotype 1 (Rag-susceptible) aphids; and C and D: biotype 4 (Rag-resistant) aphids. Bars represent the standard error of the mean. Asterisks indicate significant differences between thiamethoxam-treated seeds and untreated plants based on Tukey’s HSD (a = 0.05)...... 56 Figure 4. Soybean plant age and soybean aphid survival in the field on plants grown from thiamethoxam-treated seeds (solid triangles) or untreated seeds (open triangles). Ten adult aphids were placed on plants at the time point indicated and survival assessed at 72 h. Figure A indicates survival of biotype 1 (Rag-susceptible) aphids, whereas figure B indicates survival of biotype 4 (Rag-resistant) aphids. Bars represent the standard error of the mean. Asterisks indicate significant differences between thiamethoxam-treated seeds and untreated plants based on Tukey’s HSD (a = 0.05)...... 57 Figure 5. Residues of thiamethoxam in insecticide seed treated soybean plant (in mg of a.i. per kilogram of dry weight of plant tissue) detected by the UPLC-MS/MS in greenhouse (Figure A) and field (Figure B) experiments. Bars represent the standard error of the mean. (Note: No residues were detected for untreated soybean and therefore are not included; see Results)...... 58 Figure 6. Soybean plant age and soybean aphid survival in the greenhouse on plants from thiamethoxam-treated seeds (solid figures) or untreated seeds (open figures). Ten adult aphids were placed on plants at the time point indicated and survival assessed at 24 h (circles) and 48 h (triangles). A and C: 2015 experiment; B and D: 2016 experiment; A and B: biotype 1 (Rag- susceptible) aphids; and C and D: biotype 4 (Rag-resistant) aphids. Bars represent the standard error of the mean...... 59 Figure 7. Soybean plant age and soybean aphid survival in the field on plants from thiamethoxam-treated seeds (solid figures) or untreated seeds (open figures). Ten adult aphids were placed on plants at the time point indicated and survival assessed at 24 h (circles) and 48 h (triangles). Figure A indicates survival of biotype 1 (Rag-susceptible) aphids, whereas figure B

xv indicates survival of biotype 4 (Rag-resistant) aphids. Bars represent the standard error of the mean...... 60 Figure 8. Band visualization of the DNA ladder (left) and the amplicon (red lines and amplicon size in bp) for the molecular genotyping of biotype 1 (middle) and biotype 4 (right)...... 81 Figure 9. Total aphid count of biotype 1 (black line-circles) and biotype 4 (red line-squares) one week after infestation soybean plants at 7, 14, 21, 28, 35, and 42 days after planting (DAP). All experimental units were planted with 25% aphid-susceptible an 75% Rag-soybean. Soybeans were either seed coated or remained untreated as follows: A) aphid-susceptible soybean untreated, Rag-soybean untreated (SR); B) aphid-susceptible soybean untreated, Rag-soybean treated (SRt); C) aphid-susceptible soybean treated, Rag-soybean untreated (StR); and D) aphid- susceptible soybean treated, Rag-soybean seeds treated (StRt). Bars represent the standard error of the mean. Asterisks indicate significant differences between biotype population size based on Tukey’s HSD (α = 0.05). The numbers above bars or asterisks indicate the ‘virulence index’ estimated at each time DAP time point...... 82 Figure 10. Number of soybean aphids eaten (± SEM) by convergent lady beetles within the first 24 h after feeding on soybean leaflets from untreated (U, white bar) or thiamethoxam-treated soybean (T, black bar). The 7, 14, 21, 28, and 35 at the ‘x axis’ are the time points, in days after planting, when soybean leaflets were collected for aphid feeding. Bars within the same time point followed by the same letter means no significant difference in number of aphids eaten by convergent lady beetles (Tukey HSD post-hoc test with a 95% family-wise confidence level, P- value ³ 0.05)...... 106 Figure 11. Number of green peach aphids eaten (± SEM) by convergent lady beetles within the first 24 h after feeding on zinnias leaves from untreated (U, white bars) or with thiamethoxam- treated plants (T, black bars). The 7, 14, 21, 28, and 35 at the ‘x axis’ are the time points, in days after treatment, when leaves from zinnias were collected for aphid feeding. Bars within the same time point followed by the same letter means no significant difference in number of aphids eaten by convergent lady beetles (Tukey HSD post-hoc test with a 95% family-wise confidence level, P-value ³ 0.05)...... 107 Figure 12. Longevity of convergent lady beetles (in days, ± SEM) when they preyed upon soybean aphids that fed on soybean plants from untreated-seeds (U, white bar) or from thiamethoxam-treated seeds (T, black bar). The 7, 14, 21, 28, and 35 at the ‘x axis’ are the time points, in days after planting, when soybean leaflets were collected for aphid feeding. Bars within the same time point followed by the same letter means no significant difference was found in convergent lady beetle longevity (Kaplan-Meier estimator, P-value ³ 0.05)...... 108 Figure 13. Longevity of convergent lady beetles (in days, ± SEM) when they preyed upon green peach aphids that fed on untreated (U, white bar) or thiamethoxam-treated zinnias (T, black bar). The 7, 14, 21, 28, and 35 at the ‘x axis’ are the time points, in days after treatment, when leaves from zinnias were collected for aphid feeding. Bars within the same time point followed by the same letter means no significant difference was found in convergent lady beetle longevity (Kaplan-Meier estimator, P-value ³ 0.05)...... 109 Figure 14. Percentages of insidiosus flower bugs within each treatment detected positive by molecular gut analysis for ‘soybean aphid CO1’ when fed on soybean aphids from untreated (U, xvi white bars) or thiamethoxam-treated soybean (T, black bars). The 14, 21, 28, and 35 at the ‘x axis’ are the time points, in days after planting, when soybean leaflets were collected for aphid feeding. No SEM ranges are shown, since values of each bar represents the amount of insidiosus flower bugs positive with soybean aphid CO1. Bars within the same time point followed by the same letter means no significant difference in number of positive samples (Student’s T-test, P- value ³ 0.05)...... 110 Figure 15. Longevity of insidiosus flower bugs (in days, ± SEM) when they preyed upon soybean aphids that fed on soybean plants from thiamethoxam-treated seeds (T, black bar) or from untreated-seeds (U, white bar). The 7, 14, 21, 28, and 35 at the ‘x axis’ are the time points, in days after planting, when soybean leaflets were collected for aphid feeding. Bars within the same time point followed by the same letter means no significant difference was found in insidiosus flower bug longevity (Kaplan-Meier estimator, P-value ³ 0.05)...... 111 Figure 16. Longevity of insidiosus flower bugs (in days, ± SEM) when they preyed upon melon aphids that fed on untreated (U, white bar) or thiamethoxam-treated green pepper plants (T, black bar). The 7, 14, 21, 28, and 35 at the ‘x axis’ are the time points, in days after treatment, when leaves from green peppers were collected for aphid feeding. Bars within the same time point followed by the same letter means no significant difference was found in insidiosus flower bug longevity (Kaplan-Meier estimator, P-value ³ 0.05)...... 112 Figure 17. Percentage of soybean aphid mortality (± SEM) after feeding on soybean from untreated (U, white bar) or thiamethoxam-treated soybean (T, black bar) for 24 h and be then exposed to insidiosus flower bugs for another period of 24 h. Bars followed by the same letter means no significant difference in percentage of mortality (Tukey HSD post-hoc test with a 95% family-wise confidence level, P-value ³ 0.05)...... 113 Figure 18. Probit curves of convergent lady beetle adult females when exposed to topical applications of chlorantraniliprole (A), clothianidin (B), lambda-cyhalothrin (C) and thiamethoxam (D) without PBO (dashed black line) or with PBO (solid red line)...... 141 Figure 19. Mortality (in percentage) of convergent lady beetle adult females when exposed to topical applications of thiamethoxam without PBO (red line, circles) and with PBO (black line, squares)...... 142 Figure 20. Probit curves of insidiosus flower bug adult females when exposed to topical applications of acetamiprid (A), clothianidin (B) or flupyradifurone (C) without PBO (dashed black line) or with PBO (solid red line)...... 142

xvii Chapter 1. Literature review

1.1. Overview of insecticides as tools for pest control

Insecticides are important tools for insect pest control. Annually, worldwide sales are about US$

1.5 billions (FAOSTAT 1997, Jeschke et al. 2011, Roser and Ritchie 2019). To date, there are at least 200 insecticidal active ingredients with 29 modes of action categorized by the Insecticide

Resistance Action Committee (IRAC) (Sparks and Nauen 2015, E.P.A. 2017). An insecticide mode of action affects at least one the following major biological processes 1) nerve and muscle,

2) growth and development, 3) respiration, and 4) midgut (Table 1). In particular, insecticides targeting the nerve and muscle make the majority of active ingredients available for pest control

(Sparks 2013). Some of the most important groups by sales included in this category are neonicotinoids (group 4A), (group 3A), diamides (group 28), butenolides (group

4D), (group 1A) and (group 1B). Insecticides with action on nerve and muscle systems have several molecular and physiological targets. For instance, the neonicotinoids (i.e. thiamethoxam, clothianidin, and acetamiprid) are competitive modulators of nicotinic acetylcholine receptors, labeled to control a wide variety of hemipteran, coleopteran, lepidopteran, and dipteran insect pests (Jeschke et al. 2011). Lambda-cyhalothrin is a widely used (Table 1) that blocks the sodium channel of neurons labeled for the control of dipterans, coleopterans, hemipterans, and blattodeans, among others (Shafer et al. 2005, Davies et al. 2007). Diamides and butenolides are newer insecticide groups with potent efficacy controlling lepidopterans, hemipterans, coleopterans, and dipterans (Lahm et al. 2009, Nauen et 1 al. 2015). Two representative active ingredients are chlorantraniliprole and flupyradifurone, respectively. The carbamates and organophosphates groups (e.g. carbofuran and chlorpyrifos) are older insecticides that target the acetylcholinesterase at the neural synaptic cleft (Spencer and

Obrien 1957, Casida 1963). The variety in modes of action makes insecticides targeting nerve and muscle biological processes one of the most important groups and a critical component for the development of insecticide resistance management programs (e.g. insecticide rotation based on mode of action) (see Bloomquist 1996 and Jeschke et al. 2011).

Within the nerve and muscle acting insecticide category, a prominent group of insecticides are those with systemic movement through plant vascular tissues (Table 2)

(Weintraub and Horowitz 1998, Legind et al. 2011, Stoner and Eitzer 2012, Barry et al. 2015).

Neonicotinoids, in particular, are systemic insecticides widely used in agriculture for the control of sap-feeding insects (Maienfisch et al. 2001, Jeschke et al. 2011, North et al. 2016, Krupke et al. 2017). One of the most important neonicotinoids is thiamethoxam. Thiamethoxam is usually applied as seed treatment or a drench (Jeschke et al. 2011). As a seed treatment, thiamethoxam is used to manage field crop pests such as the soybean aphid, whereas as drench it is used for the control of insects such as the green peach aphid and the melon aphid that affect ornamentals and vegetable crops (e.g. zinnias, green peppers) (Castle et al. 2005, McCornack and Ragsdale 2006,

Seagraves and Lundgren 2012, McCarville and O'Neal 2013, Qureshi et al. 2014, Krupke et al.

2017, Esquivel et al. 2019).

1.2. Life cycle and biology of the soybean aphid, green peach aphid and melon aphid

Aphids are important pests of several agronomic, ornamental and vegetable crops (Yano et al.

1983, Fuchs and Minzenmayer 1995, Blackman and Eastop 2000, Song et al. 2006). Aphids have

2 the ability to quickly increase in population size (due to their asexual reproduction), transmit several plant viruses, and promote fungal infections (e.g. sooty mold) (Ebert 1997, Radcliffe and

Ragsdale 2002, Ng and Perry 2004, Tilmon et al. 2011). Although there are many aphid species

(Blackman and Eastop 2000), three of the most important aphid species in North America are the soybean aphid, the green peach aphid and the melon aphid (Ebert 1997, van Emden and

Harrington 2007, Ragsdale et al. 2011).

1.2.1. The soybean aphid

The soybean aphid Aphis glycines Matsumura (Hemiptera: Aphididae) is an invasive species of soybean in North America. The soybean aphid was introduced from Asia into Wisconsin in 2000 and quickly dispersed to several states in the Midwest in the following years (Alleman et al.

2002, Venette and Ragsdale 2004). The soybean aphid is now considered the most important pest of soybean in the Midwest region (Ragsdale et al. 2004), capable of causing yield losses of 40% or more during peak years if no control is performed (Ragsdale et al. 2007).

The soybean aphid is considered heteroecious (host-alternating) and holocyclic (asexual reproduction interrupted by an obligatory sexual reproduction phase). The primary hosts of soybean aphid are several species of buckthorn (Rhamnus spp) L. (Fam: Rhamnaceae) (Voegtlin et al. 2004), where sexual reproduction and overwintering take place during late autumn and winter (Ragsdale et al. 2004). In spring, eggs from sexual reproduction hatch into wingless fundatrices, that produces a second generation of mostly wingless females. The third and subsequent generations develop mostly winged aphids that disperse to soybean. Throughout the soybean growing season, the soybean aphid could have over 14 parthenogenetic generations of winged and wingless morphs (Tilmon et al. 2011). Later during summer, gynoparae (winged

3 females) emigrate back to buckthorn, where they produce a generation of oviparae. In late autumn, winged males from soybean fly in search of the females on buckthorn. After mating, females lay overwintering eggs near the buds and twigs of buckthorn (Ragsdale et al. 2004).

Control of the soybean aphid relies on host plant resistance, foliar application of insecticides, insecticidal seed treatment and biological control. Soybean aphid resistance in soybean varieties is conferred by Rag (Resistance to Aphis glycines) genes. To date, there are eight known genes associated with aphid-resistance (Hill et al. 2012), but only soybean varieties with Rag1, Rag2 or with Rag genes in pyramid (Rag1/Rag2) are commercially grown

(McCarville et al. 2012). Rag soybean has shown promising control of soybean aphid populations and compatibility with IPM practices (McCarville et al. 2014). However, there are aphid populations that can overcome such resistance (i.e. virulent) and threaten the durability of

Rag genes (Hill et al. 2012, Alt and Ryan-Mahmutagic 2013). Aphid populations with different levels of virulence toward Rag genes are designated as biotypes (Kim et al. 2008). Biotype is a pseudo-taxonomic denomination that defines an intraspecies taxon by their differentiating phenotype (Diehl and Bush 1984). The soybean aphid ‘biotype 1’ is considered susceptible to all

Rag genes (Hill et al. 2006, Hill et al. 2007), ‘biotype 2’ is virulent to only Rag1 (Kim et al.

2008), ‘biotype 3’ is partially virulent to Rag1 and virulent to Rag2 (Hill et al. 2010), and

‘biotype 4’ is virulent to Rag1, Rag2 and Rag1/Rag2 (Alt and Ryan-Mahmutagic 2013).

The use of foliar applications for soybean aphid control are typically performed with broad-spectrum insecticides such as pyrethroid and organophosphates (Hodgson et al. 2010,

Hodgson et al. 2012). Regular scouting should be performed every week after soybean reaches

R1 (R1 is the reproductive stage when soybean begins flowering) (based on Fehr et al. 1971 soybean phenological stages) (Hodgson et al. 2012), however scouting earlier might be necessary

4 because infestations could occur at preceding stages (see Orantes et al., 2012). Foliar applications are performed if more than 80% of the plants (between R1–R5 soybean phenological stages) have ³250 aphids/plant (Ragsdale et al. 2007). After foliar applications, soybean fields should be regularly monitored because soybean aphid populations can quickly rebound due to its migratory capacity and high reproduction rate (Myers et al. 2005). The use of foliar applications as part of an IPM program is considered the most cost-effective practice for soybean aphid control (Krupke et al. 2017). However, rapid development of insecticide resistance to pyrethroids and organophosphates (Wang et al. 2011, Hanson et al. 2017) and the negative effects of insecticide on biological control agents (Varenhorst and O'Neal 2012) threatens the effectiveness of foliar applications for soybean aphid control.

In addition to foliar applications, insecticides are also applied as seed treatment to control the soybean aphid and other early-season pests (Hodgson et al. 2012, Hesler et al. 2018). More than 40% of soybean planted in 2011 had an insecticidal seed treatment (Douglas and Tooker

2015) and this percentage has likely grown (Hurley and Mitchell 2017). To date, clothianidin, and thiamethoxam are the three active ingredients registered for seed treatment in soybean (Hodgson et al. 2012), with thiamethoxam being the most widely used (USGS 2014).

Depending on the conditions, a seed treatment provides protection against soybean aphid for about 3–8 weeks after planting (McCornack and Ragsdale 2006, Seagraves and Lundgren 2012,

McCarville and O'Neal 2013, Krupke et al. 2017, Esquivel et al. 2019). Despite the effectiveness of seed treatment controlling soybean aphid, aphid populations can quickly rebound later during the growing season, when presumably the protection by seed treatment has decreased (Krell et al.

2004, Rutledge and O’Neil 2006).

5 Biological control agents also provide important control on aphids. To date, there are several known parasitoids (Brewer and Noma 2010), predatory insects (Rutledge et al. 2004,

Mignault et al. 2006), and pathogenic fungi (Nielsen and Hajek 2005) that act as biological control agents of soybean aphid at various times during the soybean aphid annual cycle. Natural enemies have a critical role suppressing soybean aphid population (Fox et al. 2004, Rutledge and

O'Neil 2005, Costamagna and Landis 2006). In a natural-enemy free environment, soybean aphid population is estimated to grow 2–7 times faster (Costamagna and Landis 2006). Moreover, the use of unnecessary applications of insecticides might disrupt biological control agents and precipitate pest outbreaks (Ohnesorg et al. 2009, Koch et al. 2010). The proper use of insecticides in combination with less disturbing pest control strategies (e.g. use of Rag-soybean) might promote the preservation of natural enemies and their control services (Brewer and Noma

2010, Brace and Fehr 2012).

1.2.2. The green peach aphid

The green peach aphid (Myzus persicae) (Sulzer) (Hemiptera: Aphididae) is a cosmopolitan species found around the globe (Capinera 2001). In North America, the green peach aphid is found in all states infesting field and greenhouse crops. The economic importance of the green peach aphid is partially due to the ability of nymphs and adults to transmit several plant viruses that could cause 100% yield loss (Kennedy et al. 1962, Beirne 1972, Namba and Sylvester 1981,

Perring et al. 1992). Plants infested by the green peach aphid could also be debilitated by their active sap-feeding (Petitt and Smilowitz 1982). Moreover, the green peach aphid has an outstanding ability to survive and reproduce on more than 40 different plant families (Patch

1938, Bodenheimer and Swirski 1957, Bünzli and Büttiker 1959, Capinera 2001).

6 The green peach aphid is a heteroecious and holocyclic species. Under temperate climates, aphids reproduce sexually and overwinter as eggs on trees of the genus Prunus (e.g. peach, apricot, plum) (Capinera 2001). In early spring after Prunus trees break dormancy, eggs hatch and nymphs feed on flowers, young foliage and stems. After eight generations on Prunus, winged forms emigrate to its multiple secondary hosts and reproduce. Winged forms typically deposit a few nymphs on a plant and then disperse, increasing the range of green peach aphid infestation in a relatively short period of time (Capinera 2001). The deposited nymphs on the secondary hosts are wingless and have rapid parthenogenetic reproduction throughout the summer. Plants at young stages, actively growing plants, or plants with high nitrogen fertilization are more susceptible to aphid infestations (Heathcote 1962, Jansson and Smilowitz 1986).

During autumn, day length or temperature triggers the production of winged females and males.

Females emigrate back to Prunus and give birth to egg-laying forms. Winged males from the secondary hosts fly to Prunus infested by the oviparae and mate. Eggs are laid in crevices and near buds of Prunus where they overwinter. Greenhouses and residential plants can also be considered important sources of infestation for the following year (Bishop and Guthrie 1964).

Under warmer conditions, green peach aphid typically does not migrate to their primary hosts; rather, they produce a large number of nymphs on the main crops or surrounding broad-leaf weeds (Tamaki 1975).

The management of green peach aphid and its damage is based on cultural practices, sanitation, use of insecticide and biological control. A cultural practice is the removal or treatment of the primary overwintering hosts at early spring (Powell and Mondor 1976).

Moreover, the proper removal and elimination of greenhouse and residential plants during winter is recommended to reduce aphid populations in the following spring (Bishop and Guthrie 1964).

7 Sanitation practices are based on propagating healthy plants and eliminating virus-infected plants; this practice is effective in decreasing the dissemination of persistent viruses (where aphids remains infective throughout their lifetime), but not very effective against non-persistent viruses (Flanders et al. 1991). Lastly, contact and systemic insecticides are widely used for the control of green peach aphid. Contact insecticides are less effective, since the green peach aphid typically infests the underside of leaves where coverage is lower (Capinera 2001). Systemic insecticides such as neonicotinoids are preferred for the control of green peach aphid. However, the green peach aphid has become resistant to several different insecticides with different modes of action (Bass et al. 2014) such as organophosphates and carbamates (Moores et al. 1994, Field et al. 1999), pyrethroids (Martinez-Torres et al. 1999), cyclodiene (Unruh et al.

1996) and neonicotinoids (Philippou et al. 2010, Bass et al. 2011). Currently, chemical control relies on the use of insecticides with novel modes of action that have no documented cross- resistance. Some of the alternatives include flonicamid acting on the chordotonal organs (group

9), spirotetramat as inhibitors of acetyl CoA carboxylase (group 23) and as a modulator of the receptors (group 28) (Bass et al. 2014).

Biological control of green peach aphid encompasses several natural enemies including the parasitoid wasp Diaeretiella rapae (Hymenoptera: Braconidae), predatory insects such as lady beetles (Coleoptera: Coccinellidae), big eye bugs (Hemiptera: Lygaeidae), the predatory midge Aphidoletes aphidomyza (Diptera: Cecidomyiidae), anthocoridae bugs and entomopathogenic fungi such as Verticillium lecanii (Mackauer 1968, Tamaki et al. 1981, Milner and Lutton 1986, Gilkeson and Hill 1987, Wang et al. 2014). However, the ability of natural enemies to control green peach aphid is greatly affected by the crop system (Tamaki et al. 1981) and the predominant temperature in the area (Mackauer 1968).

8 Wide host range, transmission of numerous plant viruses and resistance to several insecticide mode of actions make the green peach aphid currently one of the most challenging aphid species to control (Blackman and Eastop 2000). Therefore, integrated pest management

(e.g. cultural, chemical, biological) and insecticide resistance management (e.g. mode of action rotation) must be implemented to promote cost/effective control of green peach aphid in the long term.

1.2.3. The melon aphid

The melon aphid, Aphis gossypii Glover (Hemiptera: Aphididae), is a species found on temperate and tropical regions of the world. In North America, the melon aphid is mainly found in southern states, where temperatures are predominately warmer. The economic importance of the melon aphid is due to its high reproductive rates, damage on the foliage by its sap-feeding action, decreased plant photosynthetic capacity, and impact of sooty mold as the result of the high production of sugar-rich liquid (i.e. honeydew) (Capinera 2001). The melon aphid is also capable of transmitting plant viruses (Perring et al. 1992, Komazaki 1994), but its importance as a vector is relatively low in comparison to the green peach aphid (Fereres et al. 1992).

The life cycle of the melon aphid varies with the geographic location. In the south, aphids do not overwinter and can grow and disperse on secondary hosts (Ebert 1997, Capinera 2001). In the north, the melon aphid overwinters on its primary hosts catalpa Catalpa bignonioides Walter

(Fam: Bignoniaceae) and rose of Sharon Hibiscus syriacus L. (Fam: Malvaceae) (Kring 1959).

During spring, eggs hatch, produce nymphs and reproduce all summer parthenogenetically on the primary hosts. In summer aphids can also generate winged morphs and search for secondary hosts where reproduce parthenogenetically. Winged aphids prefer new growth to feed and

9 produce wingless or winged morphs. Infested plants can be quickly overwhelmed by the high number of aphids (Ebert 1997); decaying plants produce a larger proportion of winged aphids that will fly to find another host. Contrary to other aphid species, the melon aphid typically increases its reproductive rates at higher temperatures (Capinera 2001). Later during autumn, females and males fly back to their primary hosts to mate and lay overwintering eggs; however, in warmer climates, melon aphids typically do not overwinter (Kring 1959, Capinera 2001).

The control of melon aphid is similar to the one used for green peach aphid. Elimination of the primary hosts is recommended in northern regions; however, in the south elimination of the primary host does not have significant impact. Sanitation practices are based on the proper removal of infested plants out of the planting area. If possible, a crop-free period and rotation of crops with non-hosts plants is also recommended (Capinera 2001). Chemical control is also frequently performed, especially with systemic insecticides. Contact insecticides could be used for melon aphid control, however, due to the foliage distortion caused by aphid feeding, poor insect coverage is achieved on curled-leaf plants (Capinera 2001, Gaber et al. 2015). In addition to the spraying difficulties, there are melon aphid populations in North America and Australia that have shown various levels of resistance to systemic neonicotinoids (Nauen and Elbert 2003,

Herron and Wilson 2011, Gore et al. 2013, Bass et al. 2015).

Several natural enemy species provide control of the melon aphid. Some of these biological control agents include: parasitic wasps in the genus Aphidius, Lysephlebus, Trioxys

(Hymenoptera: Braconidae) and Aphelinus (Hymenoptera: Aphelinidae) several aphidophagous coccinellids (Coleoptera: Coccinelllidae), syrphids (Diptera: Syrphidae), lacewings (Neuroptera:

Chrysopidae), predatory midges (Diptera: Cecidomyiidae), anthocorids (Hemiptera:

Anthocoridae) and the fungi Verticillium lecanii (van Steenis 1992, Wang et al. 2014). Natural

10 enemies are more effective at lower temperatures, because in warmer conditions, biological control could be surpassed by the high reproductive rates of melon aphids (Jacobson and Croft

1998). Proper use of insecticide application is critical to avoid the disruption of natural enemy populations, to reduce insecticide resistance development and to mitigate aphid high reproductive rates.

1.3. Predatory natural enemies of aphids

The soybean, green peach and melon aphids have in common several biological control agents, including generalist predatory insects (Mackauer 1968, Tamaki et al. 1981, Milner and Lutton

1986, Gilkeson and Hill 1987, van Steenis 1992, Rutledge et al. 2004, Nielsen and Hajek 2005,

Brewer and Noma 2010, Wang et al. 2014). Two of the most important predatory natural enemies are the convergent lady beetle and the insidiosus flower bug.

1.3.1. The convergent lady beetle

The convergent lady beetle Hippodamia convergens Guérin-Méneville (Coleoptera:

Coccinellidae) is one of the most abundant native species of lady beetles in North America

(Gardiner et al. 2009). It is a major predator of several aphids in crops such as cotton, pea, melon, cabbage, potato, peach, corn and soybean aphid (Jyoti and Michaud 2005, Lee et al.

2005). Females are typically bigger, ovoid shaped and have distinctive abdominal segments compared to males (Figure 1). The convergent lady beetle is one of the most commercially traded biological control species in the United States, partially due to its overwintering aggregations that allow collection in large numbers (Dreistadt and Flint 1996, Flint and Dreistadt

2005, Hagler 2009, White and Johnson 2010).

11 Adults of the convergent lady beetle aggregate in the late fall for overwintering. In the western United States, large populations of lady beetles aggregate at the foothills of the

California’s Sierra Mountains. During this time, their feeding behavior is reduced. In early spring, lady beetles mate and disperse to regions where prey is more abundant. Females lay eggs near prey sources; once hatched, aphid-feeding larvae go through four instars and form a pupae that typically remains attached to the foliage (Heinz et al. 2004). After pupation, adults emerge and keep feeding on aphids, but also on other food sources such as plant nectar and

(Hagen 1962). On average, a lady beetle can consume about 100 aphids per day (Hodek 1973), but the number will vary depending of the physiological conditions and the life stage of the lady beetle, environment, prey species, and prey density, among others (Hagen 1962). As biological control agents in agriculture, convergent lady beetles provide effective control against aphids.

However, constant introduction of convergent lady beetles might be necessary because they have a low capacity to maintain a self-perpetuating population (especially in greenhouses) and a high ability to fly out of the target area (Davis and Kirkland 1982, Heinz et al. 2004).

1.3.2. The insidiosus flower bug

The insidiosus flower bug (Say) (Hemiptera: Anthocoridae) is one of the most important species within the anthocoridae family and widely used as biological control of various insects in agricultural systems (Mccaffrey and Horsburgh 1986, Rutledge and O'Neil

2005, Bueno and Van Lenteren 2012). Insidiosus flower bugs are typically abundant in field and row crops including alfalfa, soybean, corn, small grains, and tomatoes. Both females and males are active searchers for prey such as mites, , small caterpillars, insect eggs, and aphids

(van den Meiracker 1994). Females are slightly bigger than males with a distinctive abdominal

12 dimorphism (Figure 2). The growth of insidiosus flower bug populations is enhanced at high prey-densities and higher temperatures (Malais et al. 1992). During autumn, adults go into for overwintering dictated primarily by a shorter day-length (<10 h of daylight) and lower temperature (van den Meiracker 1994, Ruberson et al. 2000).

In early spring, adults break their overwintering stage and become active predators.

Adults also feed on plant products such as nectar, plant sap and pollen (Kiman and Yeargan

1985). Females lay a few dozen eggs during their lifetime; eggs are laid into the plant tissue, especially in the petiole of leaves or leaflets (Lundgren and Fergen 2006). Nymphs are pale in color and have five instars; at all instars, nymphs are active predators. Once they molt as adults, they develop wings that help them disperse to seek prey. Insidiosus flower bug adults are induced into diapause by day-length between late summer and early autumn (Ruberson et al.

2000). In temperate regions, insidiosus flower bug can have between 2-3 generations per year.

1.4. Effects of insecticides on the convergent lady beetle and insidiosus flower bug

The use of insecticides is usually associated with detrimental effects on natural enemies (Croft and Brown 1975, Croft and Whalon 1982, Ioannides 1991, Cloyd and Bethke 2011, Seagraves and Lundgren 2012, Popp et al. 2013, Roubos et al. 2014b, Roubos et al. 2014a). Natural enemies are exposed to insecticides when they are directly sprayed upon, encounter contaminated surfaces, feed on plant products containing insecticides, or feed on prey with insecticide residues (Tillman and Mulrooney 2000, Desneux et al. 2007, Cloyd and Bethke

2011). Currently, there are numerous insecticides (Sparks and Nauen 2015, E.P.A. 2017) that could have negative effects on natural enemies that are not yet described. The integration of pest management strategies, such as biological and chemical control, has been one of the fundamental

13 objectives of integrated pest management (Stern et al. 1959, van den Bosch and Stern 1962). In order to combine biological and chemical pest control, however, it is necessary to understand the intrinsic toxicity of insecticides on natural enemies (Desneux et al. 2007).

The convergent lady beetle and insidiosus flower bug are usually neglected in toxicological trials with insecticides. To date, our understanding is limited to a few active ingredients (see Table 3). Moreover, insecticides are usually applied in combination with synergists compounds to improve pest control. One of the most widely used synergist is piperonyl butoxide (PBO). PBO is a blocker of the cytochrome P450 family (P450) of enzymes

(Feyereisen 2012, B-Bernard and Philogene 1993, Kasai et al. 1998). Despite the frequency that

PBO is used in combination with insecticides, the effects that PBO mixed with insecticides have on the convergent lady beetle and insidiosus flower bug are mostly unknown (but see Rodriguez et al. 2013).

1.5. Rationale, goals, and hypotheses of the studies in this dissertation

Insecticides are important tools in agriculture for pest control. When used following label indications and with proper application methods, insecticides provide effective control with limited off-target effects. This dissertation evaluates the use of thiamethoxam for the control of soybean aphid virulence and estimates the toxicity of thiamethoxam on the convergent lady beetle and insidiosus flower bug via the food chain (by preying on soybean aphid, green peach aphid, and melon aphid). Moreover, we investigated the acute toxicity of several insecticides on these natural enemies.

In Chapter 2, we aimed to evaluate the survival of soybean aphid when exposed to thiamethoxam seed-treated soybean. Soybean aphid survival was evaluated every week for the

14 course of six weeks. We used two soybean aphid biotypes: biotype 1 avirulent, and biotype 4 virulent to soybean host plant resistance conferred by Rag1 and Rag2 genes. We estimated the residues of thiamethoxam in soybean plants every week of soybean growth. We hypothesized that soybean aphid survival and thiamethoxam concentrations would be negatively correlated.

We also hypothesized that biotype 1 would have similar fitness to biotype 4 on insecticidal seed- treated soybean, and higher fitness than biotype 4 on untreated soybean. We found that 1) seed treatment provides control of soybean aphid up to 35 days after planting, and 2) insights that seed treatments might support the control of virulent soybean aphids.

In Chapter 3, we explored the approach of using seed treatment to reduce the frequency of virulent aphids. In addition to seed treatment, we also included an aphid-susceptible soybean as refuge into the experimental design. Our goal was to evaluate whether aphid-susceptible soybean refuge in combination with thiamethoxam seed treatment can be used for soybean aphid virulence management. Seed treatment was applied to either the aphid-susceptible, the aphid- resistant, both or none of the soybeans. Soybean plants were infested with biotype 1 and biotype

4 soybean aphids in a 1:1 ratio every week over the course of six weeks. We hypothesized that:

1) fitness of biotype 4 will be significantly lower when fed on aphid-resistant soybean from treated seeds, 2) fitness of biotype 1 will be significantly higher when fed on untreated aphid- susceptible soybean, and 3) seed treatment on aphid-resistant soybean and untreated aphid- susceptible soybean will increase biotype 1 population in comparison with biotype 4. We found that the use of aphid-susceptible refuge in combination with seed treatment changed the population size of both avirulent and virulent soybean aphid. Moreover, we observed a decrease in mortality when aphids fed on older treated plants. If these aphids were encountered by predatory natural enemies, the insecticide ingested by aphids could affect the predatory insect.

15 However, how much insecticide could affect predatory natural enemies via the food chain is unknown.

In Chapter 4, we aimed to evaluate the effects of the thiamethoxam via the food chain on two important aphid predators, the convergent lady beetle and the insidiosus flower bug. We hypothesized that natural enemies feeding on aphids exposed to thiamethoxam-treated plans would have shorter longevity than those preying on aphids from untreated plants. As prey of natural enemies, we used the soybean aphid, the green peach aphid, and the melon aphid from thiamethoxam-treated soybean, zinnias, and green peppers, respectively. Aphid cohorts were exposed to thiamethoxam-treated plants every week over the course of 5 weeks. In general, we found that thiamethoxam toxicity via food chain negatively affected insidiosus flower bugs, but not convergent lady beetles. We speculated that the lack of toxicity on convergent lady beetles could be caused by their tolerance to thiamethoxam, whereas the significant decrease in longevity of insidiosus flower but might be associated to their susceptibility to thiamethoxam.

In Chapter 5, we evaluated whether lady beetles are tolerant to thiamethoxam by performing topical applications to estimate the acute lethal concentration (LC50). Thiamethoxam

LC50 values were compared with acetamiprid, clothianidin, carbofuran, lambda-cyhalothrin, chlorantraniliprole, chlorpyrifos and flupyradifurone. LC50 of all insecticides were also estimated with the addition of piperonyl butoxide (PBO). In a similar way, LC50 of all insecticides with

PBO were also estimated for the insidiosus flower bug. We found that thiamethoxam has limited negative effects on convergent lady beetles. On the other hand, thiamethoxam was highly toxic to insidiosus flower bugs. We also observed that the inclusion of PBO does not always increase the toxicity of insecticides on both natural enemies.

16 Our findings revealed new insights on the durability of thiamethoxam for the control of soybean aphid. We found that seed treatment could also be beneficial for the management of soybean aphid virulence. Moreover, our results show that thiamethoxam does not cause negative impacts on the predatory convergent lady beetle via food chain, whereas the predatory insidiosus flower bug is affected. The insidiosus flower bug could be used in combination with thiamethoxam if its release coincides with the depletion of thiamethoxam residues in plant.

Lastly, we also found that thiamethoxam and other insecticides have various levels of toxicity on the convergent lady beetle and insidiosus flower bug. The outcomes of this dissertation are critical for the development of new integrated pest management strategies to control aphids combining insecticides, host-plant resistance and biological control.

17 1.6. Table and figures

Table 1. IRAC classification of insecticides based on mode of action and biological processed targeted. Mode of action Biological process affected IRAC group Acetylcholinesterase inhibitors Nerve and muscle 1 GABA-gated chloride channels antagonists Nerve and muscle 2 Sodium channel modulators Nerve and muscle 3 Nicotinic acetylcholine receptors competitive modulators Nerve and muscle 4 Nicotinic acetylcholine receptors allosteric modulators site I Nerve and muscle 5 Glutamate-gated chloride channel allosteric modulators Nerve and muscle 6 Chordotonal organs TRPV channel modulators Nerve and muscle 9 Nicotinic acetylcholine receptors blockers Nerve and muscle 14 Octopamine receptor agonists Nerve and muscle 19 Voltage-dependent sodium channel blockers Nerve and muscle 22 Ryanodine receptor modulator Nerve and muscle 28 Chordotonal organ modulators Nerve and muscle 29 GABA-gated chloride channels allosteric modulators Nerve and muscle 30 Nicotinic acetylcholine modulators of site II Nerve and muscle 32 Juvenile hormone mimics Growth and development 7 Mite growth inhibitors affecting CHS1 Growth and development 10 Inhibitors of chitin biosynthesis affecting CHS1 Growth and development 15 Inhibitors of chitin biosynthesis affecting, type 1 Growth and development 16 Moulting disruptors, dipteran Growth and development 17 Ecdysone receptor agonists Growth and development 18 Inhibitors of acetyl CoA carboxylase Growth and development 23 Inhibitors of mitochondrial ATP synthase Respiration 12 Uncouplers of oxidative phosphorylation via disruption of proton gradient Respiration 13 Mitochondrial complex III electron transport inhibitors Respiration 20 Continued

18

Table 1 continued Mode of action Biological process affected IRAC group Mitochondrial complex I electron transport inhibitors Respiration 21 Mitochondrial complex IV electron transport inhibitors Respiration 24 Mitochondrial complex II electron transport inhibitors Respiration 25 Microbial disruptors of insect midgut membranes Midgut 11 Baculoviruses Midgut 31

19

Table 2. List of insecticides with systemic/translaminar and non-systemic movement within plants. Active ingredient IRAC group Movement within plant 1B Systemic Acetamiprid 4A Systemic UN Systemic Carbofuran 1A Non-systemic Chlorpyrifos 1B Non-systemic Chrlorantraniliprole 28 Translaminar/limited systemic Clothianidin 4A Systemic Cyantraniliprole 28 Translaminar/limited systemic Cyclaniliprole 28 Translaminar/limited systemic 4A Systemic 2B Systemic Flonicamid 29 Systemic 28 Translaminar/limited systemic Flupyradifurone 4D Systemic Imidacloprid 4A Systemic Lambda-cyhalothrin 3A Non-systemic 4A Systemic Pymetrozine 9B Systemic Spirotetramat 23 Systemic 4C Systemic 4A Systemic Thiamethoxam 4A Systemic Tretraniliprole 28 Translaminar/limited systemic

20

Table 3. Mortality of convergent lady beetle and insidiosus flower bug adults when exposed to various insecticides. Mortality (in %) Convergent Insidiosus Insecticide Author Exposure/application Dose used lady beetle flower bug Acetamiprid Herrick and Cloyd, 2017 Surface residues 25 mg a.i/L 80% Acetamiprid Naranjo and Akey, 2005 Spray 56 g a.i./ha 10–64% Rodriguez-Saona et al. Acetamiprid 2016 Surface residues 480 g a.i./ha 50% Acetamiprid Roubos et al. 2014 Surface residues 117 g a.i./ha 90% 60% Carbofuran Al-Deeb et al. 2001 Surface residues 560 g a.i./ha 86% Chlorantraniliprole Barbosa et al. 2017 Topical 706.2 mg a.i./L (LC50) 50% Chlorantraniliprole Barbosa et al. 2017 Via food-chain 198.7 mg a.i./L (LC50) 50% 2 Chlorantraniliprole Fernandes et al. 2016 Surface residues 4.05 mg a.i./cm (LC50) 50% Chlorantraniliprole Barbosa et al. 2017 Surface residues 153 mg a.i./L (LC50) 50% Chlorantraniliprole Mills et al. 2016 Topical 118 mg a.i./L 15% Chlorantraniliprole Roubos et al. 2014 Surface residues 77 g a.i./ha 23% 5% Rodriguez-Saona et al. Chlorantraniliprole 2016 Surface residues 280 g a.i./ha 50% Rodriguez-Saona et al. Chlorpyrifos 2016 Surface residues 1.68 kg a.i./ha 85% Chlorpyrifos Santos et al. 2017 Topical 72 mg a.i./L 70% 2 Chlorpyrifos Fernandes et al. 2016 Surface residues 0.2 mg a.i./cm (LC50) 50% Treated plant tissues, Clothianidin Prabhaker et al. 2017 systemic uptake 10.13 µg/mL (LC50) 50% Cyantraniliprole Cloyd and Herrick 2018 Surface residues 0.06 g a.i./L 50% Cyantraniliprole Herrick and Cloyd 2017 Surface residues 0.12 g a.i./L 0% Cyantraniliprole Mills et al. 2016 Topical 149 g a.i./ha or 159 mg a.i./L 8% Dinotefuran Herrick and Cloyd 2017 Surface residues 0.08 g a.i./L 80% Continued 21

Table 3 continued Mortality (in %) Convergent Insidiosus Insecticide Author Exposure/application Dose used lady beetle flower bug Fipronil Elzen 2001 Via food-chain 56 g a.i./L 38%–53% Fipronil Studebaker and Kring 2000 Spray 42–56 g a.i./ha 90%–100% Fipronil Studebaker and Kring 2003 Spray 42–56 g a.i./ha 100% Flonicamid Barbosa et al. 2017b Surface residues 1.05 g a.i./L 15% Flonicamid Pezzini and Koch 2015 Surface residues 98–169 g a/i./ha 60%–85% 50% Flupyradifurone Barbosa et al. 2017b Surface residues 0.22 g a.i./L 95% imidacloprid Roubos et al. 2014 Surface residues 68.4 g a.i./ha 35% 25% Seagraves and Ludgren Imidacloprid 2012 Seed treatment 62.5 g a.i./100 kg seed 37% Imidacloprid Studebaker and Kring 2000 Spray 26–52 g a.i./ha 25%–50% Imidacloprid Studebaker and Kring 2003 Spray 27–53 g a.i./ha 42%–53% Treated plant tissues, Imidacloprid Prabhaket et al. 2011 systemic uptake 2.78 µg/mL Lambda- cyhalothrin Pezzini and Koch 2015 Surface residues 26 g a.i./ha 100% 100% Lambda- cyhalothrin Studebaker and Kring 2000 Spray 13.3–28 g a.i./ha 80–100% Lambda- cyhalothrin Studebaker and Kring 2003 Spray 14–28 g a.i./ha 100% Lambda- cyhalothrin Al-Deeb et al. 2001 Surface residues 28–560 g a.i./ha 37–81% Continued

22 Table 3 continued Mortality (in %) Convergent Insidiosus Insecticide Author Exposure/application Dose used lady beetle flower bug Lambda- Tillman and Mulrooney cyhalothrin 2000 Topical 28 g a.i./ha 27% Lambda- cyhalothrin Koch et al. 2019 Surface residues 29.16 g a.i./ha 50% 100% Spinetoram Mills et al. 2016 Topical 131 mg a.i./L 64% Herrick and Cloyd 2017 Surface residues 0.05 g a.i./L 0% Spinosad Studebaker and Kring 2000 Spray 99–199 g a.i./ha 20%–40% Spinosad Studebaker and Kring 2003 Spray 90–199 g a.i./ha 18%–23% Tillman and Mulrooney Spinosad 2000 Topical 100 g a.i./ha 5% Spirotetramat Herrick and Cloyd 2017 Surface residues 0.05 g a.i./L 0% Sulfoxaflor Barbosa et al. 2017b Surface residues 0.59 g a.i./L 95% Sulfoxaflor Colares et al. 2017 Topical 0.27–0.5 g a.i./L 0% Sulfoxaflor Colares et al. 2017 Via food-chain 0.27–0.5 g a.i./L 60%–70% Thiamethoxam Herrick and Cloyd 2017 Surface residues 0.14 g a.i./L 80% Thiamethoxam Santos et al. 2017 Topical 25 mg a.i./L 12.5% Treated plant tissues, Thiamethoxam Prabhaker et al. 2011 systemic uptake 1.67 µg/mL (LC50) 50% Treated plant tissues, Thiamethoxam Prabhaker et al. 2017 systemic uptake 1.29 µg/mL (LC50) 50%

23

Figure 1. Abdominal dimorphism (marked with red lines) between convergent lady beetle males (left) and females (right).

Figure 2. Abdominal dimorphism between insidiosus flower bug males (left) and females (right).

24 1.7. References cited

Al-Deeb, M. A., G. E. Wilde, and K. Y. Zhu. 2001. Effect of insecticides used in corn, sorghum, and alfalfa on the predator Orius insidiosus (Hemiptera: Anthocoridae). Journal of Economic Entomology 94: 1353-1360. Alleman, R. J., C. R. Grau, and D. B. Hogg. 2002. Soybean aphid host range and virus transmission efficiency, Proceedins of the Wisconsin Fertilizer, Aglime, and Pest Management Conference. University of Wisconsin-Madison. Alt, J., and M. Ryan-Mahmutagic. 2013. Soybean aphid biotype 4 identified. Crop Science 53. B-Bernard, C., and B. J. R. Philogene. 1993. Insecticide synergists: Role, importance, and perspectives. Journal of Toxicology and Environmental Health 38: 199-223. Barbosa, P. R. R., J. B. Torres, J. P. Michaud, and A. R. S. Rodrigues. 2017a. High concentrations of chlorantraniliprole reduce its compatibility with a key predator, Hippodamia convergens (Coleoptera: Coccinellidae). Journal of Economic Entomology 110: 2039-2045. Barbosa, P. R. R., J. P. Michaud, C. L. Bain, and J. B. Torres. 2017b. Toxicity of three aphicides to the generalist predators Chrysoperla carnea (Neuroptera: Chrysopidae) and Orius insidiosus (Hemiptera: Anthocoridae). Ecotoxicology 26: 589-599. Barry, J. D., H. E. Portillo, I. B. Annan, R. A. Cameron, D. G. Clagg, R. F. Dietrich, L. J. Watson, R. M. Leighty, D. L. Ryan, J. A. McMillan, R. S. Swain, and R. A. Kaczmarczyk. 2015. Movement of cyantraniliprole in plants after foliar applications and its impact on the control of sucking and chewing insects. Pest Management Science 71: 395-403. Bass, C., I. Denholm, M. S. Williamson, and R. Nauen. 2015. The global status of insect resistance to insecticides. Pesticidie Biochemistry of Physiology 121: 78- 87. Bass, C., A. M. Puinean, C. T. Zimmer, I. Denholm, L. M. Field, S. P. Foster, O. Gutbrod, R. Nauen, R. Slater, and M. S. Williamson. 2014. The evolution of insecticide resistance in the peach potato aphid, Myzus persicae. Insect Biochemistry and Molecular Biology 51: 41-51. Bass, C., A. M. Puinean, M. Andrews, P. Cutler, M. Daniels, J. Elias, V. L. Paul, A. J. Crossthwaite, I. Denholm, L. M. Field, S. P. Foster, R. Lind, M. S. Williamson, and R. Slater. 2011. Mutation of a nicotinic acetylcholine receptor beta subunit is associated with resistance to neonicotinoid insecticides in the aphid Myzus persicae. BMC Neurosci 12: 51. Beirne, B. P. 1972. Pest Insects of annual crop plants in Canada. IV. Hemiptera-Homoptera. V. Orthoptera. VI. Other Groups. Memoirs of the Entomological Society of Canada: 1-73. Bishop, G. W., and J. W. Guthrie. 1964. Home gardens as a source of the green peach aphid and virus diseases in Idaho. American Potato Journal 41: 28-34.

25 Blackman, R. L., and V. F. Eastop. 2000. Aphids on the world's crops: an identification and information guide, 2nd ed. ed. Wiley, Chichester, West Sussex, England. Bloomquist, J. R. 1996. Ion channels as targets for insecticides. Annual Review of Entomology 41: 163-190. Bodenheimer, F. S., and E. Swirski. 1957. The aphidoidea of the Middle East, Weizmann Science Press of Israel, Jerusalem. Brace, R. C., and W. R. Fehr. 2012. Impact of combining the Rag1 and Rag2 alleles for aphid resistance on agronomic and seed traits of soybean. Crop Science 52: 2070-2074. Brewer, M. J., and T. Noma. 2010. Habitat affinity of resident natural enemies of the invasive Aphis glycines (Hemiptera: Aphididae), on soybean, with comments on biological control. Journal of Economic Entomology 103: 583-596. Bueno, V. H. P., and J. C. Van Lenteren. 2012. Predatory bugs (), pp. 539-569. In A. R. Panizzi and J. R. P. Parra (eds.), Insect Bioecology and Nutrition for Integrated Pest Management. Crc Press-Taylor & Francis Group, Boca Raton. Bünzli, G. H., and W. W. G. Büttiker. 1959. Host-plants of Myzus persicae Sulz., with a list of aphids of common occurrence in the tobacco growing districts of S. Rhodesia. Journal of the Entomological Society of Southern Africa 22: 35-50. Capinera, J. L. 2001. Handbook of vegetable pests. Academic Press, San Diego, Calif. Casida, J. E. 1963. Mode of action of carbamates. Annual Review of Entomology 8: 39-58. Castle, S. J., F. J. Byrne, J. L. Bi, and N. C. Toscano. 2005. Spatial and temporal distribution of imidacloprid and thiamethoxam in citrus and impact on Homalodisca coagulata populations. Pest Management Science 61: 75-84. Cloyd, R. A., and J. A. Bethke. 2011. Impact of neonicotinoid insecticides on natural enemies in greenhouse and interiorscape environments. Pest Management Science 67: 3-9. Costamagna, A. C., and D. A. Landis. 2006. Predators exert top-down control of soybean aphid across a gradient of agricultural management systems. Ecological Applications 16: 1619-1628. Croft, B. A., and A. W. Brown. 1975. Responses of natural enemies to insecticides. Annual Review of Entomology 20: 285-335. Croft, B. A., and M. E. Whalon. 1982. Selective toxicity of pyrethroid insecticides to arthropod natural enemies and pests of agricultural crops. Entomophaga 27: 3-21. Davies, T. G. E., L. M. Field, P. N. R. Usherwood, and M. S. Williamson. 2007. DDT, , pyrethroids and insect sodium channels. IUBMB Life 59: 151-162. Davis, J. R., and R. L. Kirkland. 1982. Physiological and environmental factors related to the dispersal flight of the convergent lady beetle, Hippodamia convergens (Guerin- Meneville). Journal of the Kansas Entomological Society 55: 187-196. Desneux, N., A. Decourtye, and J. M. Delpuech. 2007. The sublethal effects of pesticides on beneficial . Annual Review of Entomology 52: 81-106.

26 Diehl, S. R., and G. L. Bush. 1984. An evolutionary and applied perspective of insect biotypes. Annual Review of Entomology 29: 471-504. Douglas, M. R., and J. F. Tooker. 2015. Large-scale deployment of seed treatments has driven rapid increase in use of neonicotinoid insecticides and preemptive pest management in US field crops. Environmental Science and Technology 49: 5088-5097. Dreistadt, S. H., and M. L. Flint. 1996. Melon Aphid (Homoptera: Aphididae) control by inundative convergent lady beetle (Coleoptera: Coccinellidae) release on chrysanthemum. Environmental Entomology 25: 688-697. E.P.A. 2017. Registration division conventional pesticides - Branch and product manager (PM) assignments. E.P.A. Ebert, T. A. 1997. Biology and ecology of Aphis gossypii Glover (Homoptera: Aphididae). The Southwestern Entomologist 22: 116-153. Esquivel, C. J., C. M. Ranger, P. L. Phelan, E. J. Martinez, W. H. Hendrix, L. A. Canas, and A. P. Michel. 2019. Weekly survivorship curves of soybean aphid biotypes 1 and 4 on insecticidal seed-treated soybean. Journal of Economic Entomology 112: 712-719. FAOSTAT 1997. FAOSTAT statistical database computer program, version By FAOSTAT, Rome, Italy. Fereres, A., M. J. Blua, and T. M. Perring. 1992. Retention and transmission characteristics of zucchini yellow mosaic virus by Aphis gossypii and Myzus persicae (Homoptera: Aphididae). Journal of Economic Entomology 85: 759-765. Fernandes, M. E. S., F. M. Alves, R. C. Pereira, L. A. Aquino, F. L. Fernandes, and J. C. Zanuncio. 2016. Lethal and sublethal effects of seven insecticides on three beneficial insects in laboratory assays and field trials. Chemosphere 156: 45-55. Feyereisen, R. 2012. Insect CYP genes and P450 enzymes. Insect Molecular Biology and Biochemistry: 236-316. Field, L. M., R. L. Blackman, C. Tyler-Smith, and A. L. Devonshire. 1999. Relationship between amount of esterase and gene copy number in insecticide-resistant Myzus persicae (Sulzer). Biochemical Journal 339: 737-742. Flanders, K. L., E. B. Radcliffe, and D. W. Ragsdale. 1991. Potato leafroll virus spread in relation to densities of green peach aphid (Homoptera: Aphididae): Implications for management thresholds for Minnesota seed potatoes. Journal of Economic Entomology 84: 1028-1036. Flint, M. L., and S. H. Dreistadt. 2005. Interactions among convergent lady beetle (Hippodamia convergens) releases, aphid populations, and rose cultivar. Biological Control 34: 38-46. Fox, T. B., D. A. Landis, F. F. Cardoso, and C. D. Difonzo. 2004. Predators suppress Aphis glycines Matsumura population growth in soybean. Environmental Entomology 33: 608- 618.

27 Fuchs, T. W., and R. Minzenmayer. 1995. Effect of Aphis gossypii Homopera, Aphididae on cotton development and yield in west Texas. Southwestern Entomologist 20: 341-349. Gaber, A. S., A. A. Abd-Ella, G. H. Abou-Elhagag, and Y. A. Abdel-Rahman. 2015. Field efficiency and selectivity effects of selected insecticides on cotton aphid, Aphis gossypii Glover (Homoptera: Aphididea) and its predators. Journal of Phytopathology and Pest Management 2. Gardiner, M. M., D. A. Landis, C. Gratton, N. Schmidt, M. O'Neal, E. Mueller, J. Chacon, G. E. Heimpel, and C. D. DiFonzo. 2009. Landscape composition influences patterns of native and exotic lady beetle abundance. Diversity and Distributions 15: 554-564. Gilkeson, L. A., and S. B. Hill. 1987. Release rates for control of green peach aphid (Homoptera: Aphidae) by the predatory midge Aphidoletes aphidimyza (Diptera: Cecidomyiidae) under winter greenhouse conditions. Journal of Economic Entomology 80: 147-150. Gore, J., D. Cook, A. Catchot, B. R. Leonard, S. D. Stewart, G. Lorenz, and D. Kerns. 2013. Cotton aphid (Heteroptera: Aphididae) susceptibility to commercial and experimental insecticides in the southern United States. Journal of Economic Entomology 106: 1430- 1439. Hagen, K. S. 1962. Biology and ecology of predaceous coccinellidae. Annual Review of Entomology 7: 289-326. Hagler, J. 2009. Comparative studies of predation among feral, commercially-purchased, and laboratory-reared predators. Journal of the International Organization for Biological Control 54: 351-361. Hanson, A. A., J. Menger-Anderson, C. Silverstein, B. D. Potter, I. V. MacRae, E. W. Hodgson, and R. L. Koch. 2017. Evidence for soybean aphid (Hemiptera: Aphididae) resistance to pyrethroid insecticides in the upper midwestern United States. Journal of Economic Entomology 110: 2235-2246. Heathcote, G. D. 1962. The suitability of some plant hosts for the development of the peach- potato aphid, Myzus persicae (Sulzer). Entomologia Experimentalis et Applicata 5: 114- 118. Heinz, K. M., R. Van Driesche, and M. P. Parrella. 2004. Biocontrol in protected culture, Ball Pub., Batavia, Ill. Herron, G. A., and L. J. Wilson. 2011. Neonicotinoid resistance in Aphis gossypii Glover (Aphididae: Hemiptera) from Australian cotton. Australian Journal of Entomology 50: 93-98. Hesler, L. S., K. C. Allen, R. G. Luttrell, T. W. Sappington, and S. K. Papiernik. 2018. Early-season pests of soybean in the United States and factors that affect their risk of infestation. Journal of Integrated Pest Management 9. Hill, C. B., Y. Li, and G. L. Hartman. 2006. A single dominant gene for resistance to the soybean aphid in the soybean cultivar Dowling. Crop Science 46.

28 Hill, C. B., L. Yan, and G. L. Hartman. 2007. Soybean aphid resistance in soybean Jackson is controlled by a single dominant gene. Crop Science 47. Hill, C. B., A. Chirumamilla, and G. L. Hartman. 2012. Resistance and virulence in the soybean Aphis glycines interaction. Euphytica: International Journal of Plant Breeding 186: 635-646. Hill, C. B., L. Crull, T. K. Herman, D. J. Voegtlin, and G. L. Hartman. 2010. A new soybean aphid (Hemiptera: Aphididae) biotype identified. Journal of Economic Entomology 103: 509-515. Hodek, I. 1973. Biology of Coccinellidae, 1 ed. Springer Netherlands, The Hague. Hodgson, E. W., G. VanNostrand, and M. E. O’Neal. 2010. 2010 yellow book: report of insecticide evaluation for soybean aphid. Iowa State University. Hodgson, E. W., B. P. McCornack, K. Tilmon, and J. J. Knodel. 2012. Management recommendations for soybean aphid (Hemiptera: Aphididae) in the United States. Journal of Integrated Pest Management 3: E1-E10. Hurley, T., and P. Mitchell. 2017. Value of neonicotinoid seed treatments to US soybean farmers. Pest Management Science 73: 102-112. Ioannides, C. 1991. Public health impact of pesticides ssed in agriculture. Journal of the Royal Society of Health 111: 206-206. Jacobson, R. J., and P. Croft. 1998. Strategies for the control of Aphis gossypii Glover (Hom.: Aphididae) with Aphidius colemani Viereck (Hym.: Braconidae) in protected cucumbers. Biocontrol Science of Technology 8: 377-387. Jansson, R. K., and Z. Smilowitz. 1986. Influence of nitrogen on population parameters of potato insects: Abundance, population growth, and within-plant distribution of the green peach aphid, Myzus persicae (Homoptera: Aphididae). Environmental Entomology 15: 49-55. Jeschke, P., R. Nauen, M. Schindler, and A. Elbert. 2011. Overview of the status and global strategy for neonicotinoids. Journal of Agricultural and Food Chemistry 59: 2897-2908. Jyoti, J. L., and J. P. Michaud. 2005. Comparative biology of a novel strain of russian wheat aphid (Homoptera: Aphididae) on three wheat cultivars. Journal of Economic Entomology 98: 1032-1039. Kasai, S., I. S. Weerashinghe, and T. Shono. 1998. P450 monooxygenases are an important mechanism of resistance in Culex quinquefasciatus Say larvae. Archives of Insect Biochemistry and Physiology 37: 47-56. Kennedy, J. S., M. F. Day, and V. F. Eastop. 1962. A conspectus of aphids as vectors of plant viruses, Commonwealth Institute of Entomology, London. Kim, K.-S., C. B. Hill, G. L. Hartman, M. A. R. Mian, and B. W. Diers. 2008. Discovery of soybean aphid biotypes. Crop Science 48.

29 Kiman, Z. B., and K. V. Yeargan. 1985. Development and reproduction of the predator Orius insidiosus (Hemiptera: Anthocoridae) reared on diets of selected plant material and arthropod prey. Annals of the Entomological Society of America 78: 464-467. Koch, K. A., B. D. Potter, and D. W. Ragsdale. 2010. Non-target impacts of soybean rust fungicides on the fungal entomopathogens of soybean aphid. Journal of Invertebrate Pathology 103: 156-164. Koch, R. L., O. da Silva Queiroz, R. C. Aita, E. W. Hodgson, B. D. Potter, T. Nyoike, and C. D. Ellers-Kirk. 2019. Efficacy of afidopyropen against soybean aphid (Hemiptera: Aphididae) and toxicity to natural enemies. Pest Management Science. Komazaki, S. 1994. Ecology of citrus aphids and their importance to virus transmission. Japan Agricultural Research Quarterly 28: 177. Krell, R. K., L. P. Pedigo, J. H. Hill, and M. E. Rice. 2004. Bean leaf beetle (Coleoptera: Chrysomelidae) management for reduction of bean pod mottle virus. Journal of Economic Entomology 97: 192-202. Kring, J. B. 1959. The Life cycle of the melon aphid, Aphis gossypii Glover, an example of facultative migration. Annals of the Entomological Society of America 52: 284-286. Krupke, C. H., A. M. Alford, E. M. Cullen, E. W. Hodgson, J. J. Knodel, B. McCornack, B. D. Potter, M. I. Spigler, K. Tilmon, and K. Welch. 2017. Assessing the value and pest management window provided by neonicotinoid seed treatments for management of soybean aphid (Aphis glycines Matsumura) in the upper midwestern United States. Pest Management Science 73: 2184-2193. Lahm, G. P., D. Cordova, and J. D. Barry. 2009. New and selective ryanodine receptor activators for insect control. Bioorganic and Medicindal Chemistry 17: 4127-4133. Lee, J. H., N. C. Elliott, S. D. Kindler, B. W. French, C. B. Walker, and R. D. Eikenbary. 2005. Natural enemy impact on the russian wheat aphid in southeastern Colorado. Environmental Entomology 34: 115-123. Legind, C. N., C. M. Kennedy, A. Rein, N. Snyder, and S. Trapp. 2011. Dynamic plant uptake model applied for drip irrigation of an insecticide to pepper fruit plants. Pest Management Science 67: 521-527. Lundgren, J. G., and J. K. Fergen. 2006. The oviposition behavior of the predator Orius insidiosus: Acceptability and preference for different plants. Biocontrol 51: 217-227. Mackauer, M. 1968. Insect parasites of the green peach aphid, Myzus persicae Sulz, and their control potential. Entomophaga 13: 91-106. Maienfisch, P., M. Angst, F. Brandl, W. Fischer, D. Hofer, H. Kayser, W. Kobel, A. Rindlisbacher, R. Senn, A. Steinemann, and H. Widmer. 2001. Chemistry and biology of thiamethoxam: a second generation neonicotinoid. Pest Management Science 57: 906- 913.

30 Malais, M., W. J. Ravensberg, S. King, G.-J. Terwolde, P. Walker, and S. Koppert Biological. 1992. Knowing and recognizing: the biology of glasshouse pests and their natural enemies, 1st ed. ed. Koppert Biological Systems, Berkel en Rodenrijs, the Netherlands. Martinez-Torres, D., S. P. Foster, L. M. Field, A. L. Devonshire, and M. S. Williamson. 1999. A sodium channel point mutation is associated with resistance to DDT and pyrethroid insecticides in the peach-potato aphid, Myzus persicae (Sulzer) (Hemiptera: Aphididae). Insect Molecular Biology 8: 339-346. Mccaffrey, J. P., and R. L. Horsburgh. 1986. Biology of Orius insidiosus (Heteroptera: Anthocoridae): A predator in Virginia apple orchards. Environmental Entomology 15: 984-988. McCarville, M. T., and M. E. O'Neal. 2013. Soybean aphid (Aphididae: Hemiptera) population growth as affected by host plant resistance and an insecticidal seed treatment. Journal of Economic Entomology 106: 1302-1309. McCarville, M. T., E. W. Hodgson, and M. O’Neal. 2012. Soybean aphid-resistant soybean varieties for Iowa. Iowa State University Extension and Outreach, Ames. IA, USA. McCarville, M. T., M. E. O'Neal, B. D. Potter, K. J. Tilmon, E. M. Cullen, B. P. McCornack, J. F. Tooker, and D. A. Prischmann-Voldseth. 2014. One gene versus two: A regional study on the efficacy of single gene versus pyramided resistance for soybean aphid management. Journal of Economic Entomology 107: 1680-1687. McCornack, B., and D. W. Ragsdale. 2006. Efficacy of thiamethoxam to suppress soybean aphid populations in Minnesota soybean. Crop management. Mignault, M.-P., M. l. Roy, and J. Brodeur. 2006. Soybean aphid predators in Québec and the suitability of Aphis glycines as prey for three coccinellidae. BioControl 51: 89-106. Milner, R. J., and G. G. Lutton. 1986. Dependence of Verticillium lecanii (Fungi: Hyphomycetes) on high humidities for infection and sporulation using Myzus persicae (Homoptera: Aphididae) as host. Environmental Entomology 15: 380-382. Moores, G. D., G. J. Devine, and A. L. Devonshire. 1994. Insecticide-insensitive acetylcholinesterase can enhance esterase-based resistance in Myzus persicae and Myzus nicotianae. Pesticide Biochemistry and Physiology 49: 114-120. Myers, S. W., D. B. Hogg, and J. L. Wedberg. 2005. Determining the optimal timing of foliar insecticide applications for control of soybean aphid (Hemiptera: Aphididae) on soybean. Journal of Economic Entomology 98: 2006-2012. Namba, R., and E. S. Sylvester. 1981. Transmission of cauliflower mosaic virus by the green peach, turnip, cabbage, and pea aphids (Homoptera: Aphididae). Journal of Economic Entomology 74: 546-551. Nauen, R., and A. Elbert. 2003. European monitoring, of resistance to insecticides in Myzus persicae and Aphis gossypii (Hemiptera: Aphididae) with special reference to imidacloprid. Bulletin Entomological Research 93: 47-54.

31 Nauen, R., P. Jeschke, R. Velten, M. E. Beck, U. Ebbinghaus-Kintscher, W. Thielert, K. Wolfel, M. Haas, K. Kunz, and G. Raupach. 2015. Flupyradifurone: a brief profile of a new butenolide insecticide. Pest Management Science 71: 850-862. Ng, J. C. K., and K. L. Perry. 2004. Transmission of plant viruses by aphid vectors. Molecular Plant Pathology 5: 505-511. Nielsen, C., and A. E. Hajek. 2005. Control of invasive soybean aphid, Aphis glycines (Hemiptera: Aphididae), populations by existing natural enemies in New York state, with emphasis on entomopathogenic fungi. Environmental Entomology 34: 1036-1047. North, J. H., J. Gore, A. L. Catchot, S. D. Stewart, G. M. Lorenz, F. R. Musser, D. R. Cook, D. L. Kerns, and D. M. Dodds. 2016. Value of neonicotinoid insecticide seed treatments in mid-south soybean (Glycine max) production systems. Journal of Economic Entomology. Ohnesorg, W. J., K. D. Johnson, and M. E. O'Neal. 2009. Impact of reduced-risk insecticides on soybean aphid and associated natural enemies. Journal of Economic Entomology 102: 1816-1826. Orantes, L. C., W. Zhang, M. A. Mian, and A. P. Michel. 2012. Maintaining genetic diversity and population panmixia through dispersal and not gene flow in a holocyclic heteroecious aphid species. Heredity (Edinb) 109: 127-134. Patch, E. M. 1938. Food-plant catalogue of the aphids of the world: including the Phylloxeridae, Maine Agricultural Experiment Station, Orono. Perring, T. M., C. A. Farrar, M. Blua, and K. Mayberry. 1992. Management strategies outlined: Research reveals pattern of cucurbit virus spread. California Agriculture 46: 35- 40. Petitt, F. L., and Z. Smilowitz. 1982. Green peach aphid feeding damage to potato at various plant growth stages. Journal of Economic Entomology 75: 431-435. Philippou, D., L. Field, and G. Moores. 2010. Metabolic enzyme(s) confer imidacloprid resistance in a clone of Myzus persicae (Sulzer) (Hemiptera: Aphididae) from Greece. Pest Management Science 66: 390-395. Popp, J., K. Peto, and J. Nagy. 2013. Pesticide productivity and food security. A review. Agronomy for Sustainable Development 33: 243-255. Powell, D. M., and W. T. Mondor. 1976. Area control of the green peach aphid on peach and the reduction of potato leaf roll virus. American Potato Journal 53: 123-139. Qureshi, J. A., B. C. Kostyk, and P. A. Stansly. 2014. Insecticidal suppression of Asian citrus psyllid Diaphorina citri (Hemiptera: Liviidae) vector of huanglongbing pathogens. PLoS One 9: e112331. Radcliffe, E. B., and D. W. Ragsdale. 2002. Aphid-transmitted potato viruses: The importance of understanding vector biology. American Journal of Potato Research 79: 353-386. Ragsdale, D. W., D. J. Voegtlin, and R. J. O'Neil. 2004. Soybean aphid biology in North America. Annals of the Entomological Society of America 97: 204-208.

32 Ragsdale, D. W., D. A. Landis, J. Brodeur, G. E. Heimpel, and N. Desneux. 2011. Ecology and management of the soybean aphid in North America. Annual Review of Entomology 56: 375-399. Ragsdale, D. W., B. P. McCornack, R. C. Venette, B. D. Potter, I. V. MacRae, E. W. Hodgson, M. E. O’Neal, K. D. Johnson, R. J. O’Neil, C. D. DiFonzo, T. E. Hunt, P. A. Glogoza, and E. M. Cullen. 2007. Economic threshold for soybean aphid (Hemiptera: Aphididae). Journal of Economic Entomology 100: 1258-1267. Rodrigues, A. R. S., J. R. Ruberson, J. B. Torres, H. A. A. Siqueira, and J. G. Scott. 2013. Pyrethroid resistance and its inheritance in a field population of Hippodamia convergens (Guerin-Meneville) (Coleoptera: Coccinellidae). Pesticide Biochemistry and Physiology 105: 135-143. Rodriguez-Saona, C., A. C. Wanumen, J. Salamanca, R. Holdcraft, and V. Kyryczenko- Roth. 2016. Toxicity of insecticides on various life stages of two tortricid pests of cranberries and on a non-target predator. Insects 7. Roser, M., and H. Ritchie. 2019. Fertilizer and pesticides. Our World in Data, Published online at OurWorldInData.org. Roubos, C. R., C. Rodriguez-Saona, and R. Isaacs. 2014a. Mitigating the effects of insecticides on arthropod biological control at field and landscape scales. Biological Control 75: 28-38. Roubos, C. R., C. Rodriguez-Saona, R. Holdcraft, K. S. Mason, and R. Isaacs. 2014b. Relative toxicity and residual activity of insecticides used in blueberry pest management: mortality of natural enemies. Journal of Economic Entomology 107: 277-285. Ruberson, J. R., Y. J. Shen, and T. J. Kring. 2000. Photoperiodic sensitivity and diapause in the predator Orius insidiosus (Heteroptera: Anthocoridae). Annals of the Entomological Society of America 93: 1123-1130. Rutledge, C. E., and R. J. O'Neil. 2005. Orius insidiosus (Say) as a predator of the soybean aphid, Aphis glycines Matsumura. Biological Control 33: 56-64. Rutledge, C. E., and R. J. O’Neil. 2006. Soybean plant stage and population growth of soybean aphid. Journal of Economic Entomology 99: 60-66. Rutledge, C. E., rsquo, R. J. Neil, T. B. Fox, and D. A. Landis. 2004. Soybean aphid predators and their use in integrated pest management. Annals of the Entomological Society of America 97: 240-248. Seagraves, M. P., and J. G. Lundgren. 2012. Effects of neonicitinoid seed treatments on soybean aphid and its natural enemies. Journal of Pest Science 85: 125-132. Shafer, T. J., D. A. Meyer, and K. M. Crofton. 2005. Developmental neurotoxicity of pyrethroid insecticides: Critical review and future research needs. Environ Health Persp 113: 123-136.

33 Song, F., S. M. Swinton, C. DiFonzo, M. E. O'Neal, and D. Ragsdale. 2006. Profitability analysis of soybean aphid control treatments in three north-central States. Michigan State University, Department of Agricultural, Food, and Resource Economics Staff Paper Series 11489. Sparks, T. C. 2013. Insecticide discovery: an evaluation and analysis. Pesticide Biochemistry and Physiology 107: 8-17. Sparks, T. C., and R. Nauen. 2015. IRAC: Mode of action classification and insecticide resistance management. Pesticide Biochemistry and Physiology 121: 122-128. Spencer, E. Y., and R. D. Obrien. 1957. Chemistry and mode of action of organophosphorus insecticides. Annual Review of Entomology 2: 261-278. Stern, V. M., R. F. Smith, R. van den Bosch, and K. S. Hagen. 1959. The integration of chemical and biological control of the spotted alfalfa aphid: The integrated control concept. Hilgardia 29: 81-101. Stoner, K. A., and B. D. Eitzer. 2012. Movement of soil-applied imidacloprid and thiamethoxam into nectar and pollen of squash (Cucurbita pepo). PloS One 7. Tamaki, G. 1975. Weeds in orchards as important alternate sources of green peach aphids in late spring. Environmental Entomology 4: 958-960. Tamaki, G., B. Annis, and M. Weiss. 1981. Response of natural enemies to the green peach aphid in different plant cultures (Homoptera: Aphididae). Environmental Entomology 10: 375-378. Tillman, P. G., and J. E. Mulrooney. 2000. Effect of selected insecticides on the natural enemies Coleomegilla maculata and Hippodamia convergens (Coleoptera: Coccinellidae), Geocoris punctipes (Hemiptera: Lygaeidae), and Bracon mellitor, Cardiochiles nigriceps, and Cotesia marginiventris (Hymenoptera: Braconidae) in cotton. Journal of Economic Entomology 93: 1638-1643. Tilmon, K. J., E. W. Hodgson, M. E. O'Neal, and D. W. Ragsdale. 2011. Biology of the soybean aphid, Aphis glycines (Hemiptera: Aphididae) in the United States. Journal of Integrated Pest Management 2: 1-7. Unruh, T., A. Knight, and M. R. Bush. 1996. Green peach aphid (Homoptera: Aphididae) resistance to in peach and nectarine orchards in Washington State. Journal of Economic Entomology 89: 1067-1073. USGS, U. S. G. S. 2014. Project: estimated annual agricultural pesticide use maps— thiamethoxam, pesticide national synthesis project. van den Bosch, R., and V. M. Stern. 1962. The Integration of Chemical and Biological Control of Arthropod Pests. Annual Review of Entomology 7: 367-386. van den Meiracker, R. A. F. 1994. Induction and termination of diapause in orius predatory bugs. Entomologia Experimentalis Et Applicata 73: 127-137. van Emden, H. F., and R. Harrington. 2007. Aphids as crop pests, CABI, Wallingford, UK; Cambridge, MA.

34 van Steenis, M. J. 1992. Biological control of the cotton aphid, Aphis gossypii Glover (Hom, Aphididae): preintroduction evaluation of natural enemies. Journal of Applied Entomology 114: 362-380. Varenhorst, A. J., and M. E. O'Neal. 2012. The response of natural enemies to selective insecticides applied to soybean. Environmental Entomology 41: 1565-1574. Venette, R. C., and D. W. Ragsdale. 2004. Assessing the invasion by soybean aphid (Homoptera: Aphididae): Where will it end? Annals of the Entomological Society of America 97: 219-226. Voegtlin, D. J., R. J. O'Neil, and W. R. Graves. 2004. Tests of suitability of overwintering hosts of Aphis glycines: Identification of a new host association with Rhamnus alnifolia L'Heritier. Annals of the Entomological Society of America 97: 233-234. Wang, Q., X. Weijun, Y. Shanchun, and C. Wang. 2011. Research on resistance of Aphis glycines in Hei longjiang province. Advanced Materials Research 393-395: 926-929. Wang, S., J. P. Michaud, X. L. Tan, and F. Zhang. 2014. Comparative suitability of aphids, and mites as prey for the flower bug Orius sauteri (Hemiptera: Anthocoridae). European Journal of Entomology 111: 221-226. Weintraub, P. G., and A. R. Horowitz. 1998. Effects of translaminar versus conventional insecticides on Liriomyza huidobrensis (Diptera: Agromyzidae) and Diglyphus isaea (Hymenoptera: Eulophidae) populations in celery. Journal of Economic Entomology 91: 1180-1185. White, J., and D. Johnson. 2010. ENTFACT-125: Vendors of beneficial organisms in North America. University of Kentucky College of Agriculture. Yano, K., T. Miyake, and V. F. Eastop. 1983. The biology and economic importance of rice aphids (Hemiptera: Aphididae): A review. Bulletin Entomological Research 73: 539-566.

35 Chapter 2. Weekly survivorship curves of soybean aphid biotypes 1 and 4 on insecticidal

seed-treated soybean1

2.1. Abstract

Thiamethoxam, an insecticide used in soybean seed treatments, effectively suppresses soybean aphids (Aphis glycines) for a short time after planting. However, exactly when and how quickly soybean aphid populations could increase is unknown. Likewise, we lack data on virulent soybean aphid biotypes (that can overcome soybean resistance) when fed on seed-treated soybean. Determining the survival of soybean aphids over time on insecticidal seed-treated soybean is critical for improving soybean aphid management and may provide insights to manage aphid virulence to aphid resistant-soybean. In greenhouse and field experiments, aphid- susceptible soybean plants (with and without an insecticidal seed treatment) were infested at 7,

14, 21, 28, 35, and 42 days after planting (DAP). We compared aphid survival among biotypes 1

(avirulent) and 4 (virulent) and insecticide treatment 72 h after infestation. We also measured thiamethoxam concentrations in plant tissue using liquid chromatography-tandem mass spectrometry. As expected, soybean aphid survival was significantly lower on seed-treated soybean up to 35 DAP for both biotypes, which correlates with the decrease of thiamethoxam in the plant over time. Moreover, we found no significant difference between avirulent and virulent

1 Published at Journal of Economic Entomology (Esquivel, C. J., C. M. Ranger, P. L. Phelan, E. J. Martinez, W. H. Hendrix, L. A. Canas, and A. P. Michel. 2019. Weekly survivorship curves of soybean aphid biotypes 1 and 4 on insecticidal seed-treated soybean. Journal of Economic Entomology 112: 712-719).

36 biotype survivorship on insecticidal seed-treated soybean plants, although we did find significantly greater survival for the virulent biotype compared to the avirulent biotype on untreated soybean in the field. In conclusion, our study further characterized the relative short duration of seed treatment effectiveness on soybean aphid and showed that survivorship of virulent aphids on seed-treated soybean is similar to avirulent aphids.

2.2. Introduction

Insecticidal seed treatments provide early season control of insect pests in several crops (Wilde et al. 2001, Wilde et al. 2004, Wilde et al. 2007, Hummel et al. 2014, Schmidt-Jeffris and Nault

2016). More than 40% of soybean planted in 2011 had an insecticidal seed treatment (Douglas et al. 2015), and this percentage has likely grown (Hurley and Mitchell 2017) for various reasons, including their easy use and efficacy against target pests. In soybean, these pests include a few soil insects, e.g. wireworms (Coleoptera: Elateridae) and seedcorn maggot (Delia platura)

(Meigen) (Diptera: Anthomyiidae), but also early season foliar feeders such as the bean leaf beetle (Cerotoma trifurcata) (Föster) (Coleoptera: Chrysomelidae) and the soybean aphid (Aphis glycines) Matsumura (Hemiptera: Aphididae) (Hesler et al. 2018). Damage from foliage-feeding insects occurs throughout the growing season and may indeed be heavier later in the season

(Krell et al. 2004, Rutledge and O’Neil 2006). However, the protection provided by insecticidal seed treatments is short lived, ranging from 3–8 weeks after planting, depending on experimental conditions (McCornack and Ragsdale 2006, Seagraves and Lundgren 2012, McCarville and

O'Neal 2013, Krupke et al. 2017). A more complete understanding of the timing between insecticidal seed treatment efficacy and pest survival is needed to improve integrated pest

37 management in soybean, including for the soybean aphid, which is the most important insect pest of soybean in the North-Central region (Tilmon et al. 2011).

The soybean aphid is an invasive pest, infesting soybean as early as the first week of June

(V1–V3 based on Fehr et al. 1971), where it asexually reproduces for more than 15 generations

(Ragsdale et al. 2004). Soybean aphid densities exceeding 600 aphids per plant cause economically significant yield losses to soybean (Ragsdale et al. 2007) and heavy infestations can exceed thousands of aphids per plant (Ragsdale et al. 2004). In North America, insecticide applications to soybean have increased 130-fold since the invasion of soybean aphid in 2000

(Ragsdale et al. 2011). Foliar applications are the most common, but insecticide resistance to some of the more generally used chemicals (e.g. pyrethroids) limits soybean aphid management options (Hanson et al. 2017, Koch et al. 2018).

Seed treatment for soybean aphid control can include one of the three active ingredients: imidacloprid, clothianidin, and thiamethoxam (all within IRAC Group 4A) (Hodgson et al.

2012), with the latter being the most widely used (USGS 2014). Field studies (McCarville and

O'Neal 2013, Krupke et al. 2017) and laboratory bioassays (McCornack and Ragsdale 2006,

Magalhaes et al. 2009, Seagraves and Lundgren 2012) indicate that insecticidal seed treatments can provide control against the soybean aphid up to 40–49 days after planting (DAP). Loss of activity corresponds to a decrease in thiamethoxam concentration in soybean tissue (Magalhaes et al. 2009, Krupke et al. 2017). However, we lack data on aphid survivorship at early time points, especially during the critical time when the concentration of seed treatments decreases to negligible levels (between 14–42 DAP). Estimating survivorship of soybean aphid on insecticidal seed-treated soybean early in the growing season could enhance our understanding of soybean aphid population dynamics and improve integrated pest management (IPM).

38 Another option for soybean aphid control includes aphid-resistant soybean varieties

(Hesler et al. 2013). Rag (Resistance to Aphis glycines) soybean varieties have genetic resistance against the soybean aphid. A total of eight Rag genes have been mapped (Hesler et al. 2013) and soybean varieties with Rag1, Rag2, or both (Rag1/Rag2) are commercially grown (McCarville et al. 2012). McCarville and O’Neal (2013) showed that an insecticidal seed treatment might enhance soybean aphid control in combination with single Rag gene soybeans (e.g. Rag1 or

Rag2), but it provides little added benefit with multi-genic resistant varieties (e.g. Rag1/Rag2), since the effect of multiple Rag genes is a ‘high-dose’ for most aphid populations.

Virulent biotypes of soybean aphid, however, have overcome Rag resistance including varieties that contain Rag1/Rag2 (Kim et al. 2008). Currently there are at least four soybean aphid biotypes: biotype 1 is susceptible or avirulent to any Rag gene, biotype 2 is virulent to

Rag1, biotype 3 is virulent to Rag2, and biotype 4 is virulent to Rag1, Rag2, and Rag1/Rag2 genes (Kim et al. 2008, Hill et al. 2010, Alt and Ryan-Mahmutagic 2013). Unless strategies are developed to manage virulence similar to insecticide resistance management (IRM) in transgenic crops, virulent soybean aphid biotypes will threaten the durability of Rag soybean. Typically, a virulence management strategy for asexually reproducing aphids would require a fitness cost, where a virulent aphid is less fit than an avirulent aphid on a susceptible plant (Crowder and

Carriere 2009). Indeed, Rag virulence in biotype 4 appears to have a fitness cost compared to biotype 1 (Varenhorst et al. 2015), but there is little information comparing survival among biotypes on seed-treated soybean. If Rag soybean is treated with an insecticidal seed treatment and planted with an untreated susceptible refuge, the durability of resistance to soybean aphid might be extended if avirulent biotypes outperform virulent biotypes on untreated susceptible soybean (i.e. the refuge) as in other systems (Roush 1998, Petzold-Maxwell et al. 2013). We

39 must understand the fitness of different soybean aphid biotypes on insecticidal seed-treated plants to determine what role, if any, these tools can have for IRM with aphid-resistant soybean.

Using greenhouse and field experiments, we estimated soybean aphid survival over 42 days for both biotype 1 (avirulent) and biotype 4 (virulent). We infested treated and untreated susceptible soybean at six different time points, and measured aphid survival as well as foliar concentrations of thiamethoxam. We hypothesized that soybean aphid survival and thiamethoxam concentrations would be negatively correlated. We also hypothesized that biotype

1 would have similar fitness to biotype 4 on insecticidal seed-treated soybean, and higher fitness than biotype 4 on untreated soybean, which might support the use of seed treatments in IRM for

Rag genes.

2.3. Materials and methods

2.3.1. Soybean seeds

We used Mycogen® (a subsidiary of Corteva Agriscience®, Indianapolis, IN) variety 5N248R2

(aphid-susceptible), treated with Cruiser Maxx® (Syngenta®, Greensboro, NC) containing thiamethoxam (56.3 g of active ingredient), and two fungicides, mefenoxam (3.75 g of active ingredient), and fludioxonil (2.5 g of active ingredient), per 100 kg of seed. For untreated seeds, we removed the seed coating following a modified protocol from Gassmann et al. (2011).

Briefly, a total of 120 seeds were processed three times with 200 mL of deionized water and 1 mL of dish liquid soap Dawn® (Procter & Gamble, MI), each time stirring for 20 min at 125 rpm.

Seeds were then washed with 200 mL of a 1% bleach solution stirred at 125 rpm for 40 min, followed by rinsing 10 times with deionized water. Removal of insecticide was confirmed by ultra-performance liquid chromatography mass spectrometry (UPLC-MS/MS, see below).

40

2.3.2. Soybean aphids

For all experiments, we used 7-day-old adult apterae of both biotype 1 and biotype 4 soybean aphids. Aphids were kept in the Michel Laboratory at the Ohio Agricultural Research and

Development Center (OARDC), The Ohio State University, Wooster, Ohio. Colonies were maintained in growth chambers at 26˚C, 14:10 hours of light:dark, and 50% RH. Biotype 1 aphids were reared on susceptible soybean (variety Wyandot), whereas biotype 4 were reared on

Rag1/Rag2 soybean (variety IA3027RA12). Colonies were established with a single, founding aphid female, resulting in two clonal lineages. We age-synchronized aphids of both biotypes by transferring adults to detached, susceptible soybean leaves in petri dishes. Adults were removed after 48 h, leaving behind nymphs that were then maintained until they reached adulthood (7- day-old) for infestation.

2.3.3. Greenhouse experiments

Greenhouse experiments, initiated in December of 2015 and October 2016, were maintained at

23–25˚C, 16:8 hours of light:dark, and 60–75% RH, using an Argus® Control System –a

Conviron® Company (British Columbia, Canada). Three soybean seeds of either insecticide- treated or untreated were planted in a Kord Regal® (Toronto, Canada) pot (10.1 cm upper diameter, 7.6 cm lower diameter, 8.9 cm height) filled with soilless media Pro-Mix BX®

(Québec, Canada). Pots were arranged in a randomized complete block design. We watered soybean using drip irrigation with the following schedule: 1) days 0–15, 60 mL per pot four times per week; 2) days 16–27, 90 mL per pot per day; 3) days 28–38, 60 mL per pot two times per day; and 4) days 39–42, 90 mL per pot two times per day. Fertilization was also included via

41 irrigation by diluting, in a 1:64 ratio, a solution of 121.13 g N, 52.49 g P2O5, and 121.13 g K2O in 7.57 L of water.

Pots with soybeans were arranged using a factorial randomized complete block design.

The factors were: 1) aphid biotype: biotype 1 and biotype 4; 2) seed treatment: treated-seed and untreated; and 3) plant age: 7, 14, 21, 28, 35, and 42 days after planting (DAP). Treatments were replicated 10 times for each greenhouse experiment. We infested soybeans at six plant ages: 7,

14, 21, 28, 35, and 42 DAP. At each time point, we thinned soybeans to one plant per pot and transferred 10 synchronized adult aphids to the newest, fully mature middle leaflet using a fine- haired paintbrush. Transferred aphids were confined to the corresponding leaf using customized polyethylene terephathalate plastic cages (1.9-cm diameter, 1.9-cm height, with Casa Collection®

(South Korea) polyester mesh ‘U.S. #100’ on top) glued to an 8.8 cm metallic hair clip for leaf attachment. Aphid survival was measured 24, 48, and 72 h after infestation. Dead aphids were those that were brown or showed no movement when touched with a paintbrush.

2.3.4. Field experiment

The field experiment was performed at OARDC (40˚46’56.8” N; 81˚55’27.3” W). The soil in the soybean field was Wooster Riddles silt loam (17% sand, 70% silt, 13% clay), with 1.79% of organic matter, and no history of neonicotinoid exposure for the last five years. During the experiment (Jun 20–Aug. 5, 2017), temperature ranged from 15.9–27.3˚C and had a total of

182.2 mm of precipitation. Seed material and seed treatment were the same types used in greenhouse experiments. Seeds were planted using a split-plot design due to restrictions in randomization between treated and untreated seeds. The main plots were seed treatment (treated and untreated) and the experimental units (subplots) were the combination of aphid biotypes

42 (biotype 1 and biotype 4) and plant ages (7, 14, 21, 28, 35, and 42 DAP) for aphid infestation.

The main plots were 1.2 m apart. Subplots were 40 cm between rows and 30 cm within the row.

Treatments were replicated 10 times. We planted three seeds per experimental unit and then thinned to just one plant before infestation. Due to dry environmental conditions, subplots were watered every other day during the first 10 days after planting. Aphid infestation with clip cages and survival measurement were performed as previously described for the greenhouse experiment.

2.3.5. Aphid survival

We analyzed aphid survival 72 h after infestation to ensure that mortality was not due to handling of aphids. (Note: survival at 24 h and 48 h is reported in Figure 6 and Figure 7).

Survival for the 2015 and 2016 greenhouse experiments were analyzed separately. We evaluated normality and homoscedasticity of raw and arcsine-transformed greenhouse and field data using

RStudio (version 1.0.136). We used raw data for statistical analysis as we found them normally distributed and with homogeneous variances. ANOVA was used to evaluate the effects on aphid survival (percentage of aphids alive) from the seed treatment (i.e. treated and untreated seeds), plant age (7, 14, 21, 28, 35, and 42 DAP), and their interactions. We performed mean separation using Tukey HSD test with a 95% family-wise confidence level on main factors and least square means with Tukey’s adjustment on significant interactions (P < 0.05). We further estimated the effects of soybean age on aphid survival by an analysis of covariance (ANCOVA) using days after planting as a continuous covariant. ANOVA and ANCOVA were performed using SAS® software (version 9.4) for greenhouses and field experiments. Graphics were generated using

GraphPad Prism® (version 6) GraphPad Software Inc. (La Jolla, CA).

43

2.3.6. Plant tissue and extraction

After recording aphid survival at 72 h, the infested leaf and all the younger foliage were flash frozen using liquid nitrogen and stored at -80°C until we performed analysis by ultra- performance liquid chromatography mass spectrometry (UPLC-MS/MS). Leaves were collected from both treated and untreated plants at each time point. For chemical analysis, frozen soybean samples were dried at 70°C in an oven for 48 hours. We placed 1.5 g of ground dry plant material into a 50 mL tube with 10 mL of 1% acetic acid solution in acetonitrile (v/v), containing

15 µg of triphenyl phosphate (TPP) as an internal standard. Tissue samples were cleaned using the Restek® Q-sep® (Bellefonte, PA) QuEChERS method (Anastassiades et al. 2003), following the manufacturer’s protocols. In short, 6 g magnesium sulfate and 1.5 g anhydrous sodium acetate were added to each test tube. The tube was vortexed for 1 min and then centrifuged for 1 min at 3000 rpm. The top layer (1 mL) was transferred to a dispersive solid phase extraction

(dSPE) tube for further cleaning based on the AOAC 2007.01 method (Horwitz 2000). The dSPE tube contained 150 mg magnesium sulfate, 50 mg primary-secondary amine, and 50 mg of C18 sorbent. The dSPE tube was vortexed for 30 sec and centrifuged for 1 min at 3600 rpm. A 600

µL aliquot from each test tube was transferred to a 12 × 32 mm Waters® autosampler vial

(Milford, MA). The extracts were evaporated and dried using nitrogen at 55˚C. Residues were reconstituted in 600 µL of ultra-pure water and transferred to a new autosampler vial for analysis by UPLC-MS/MS.

44 2.3.7. Insecticide quantification by UPLC-MS/MS

Thiamethoxam quantification was performed using an Acquity™ UPLC system coupled to a

Xevo™ TQD tandem quadrupole mass spectrometer (Waters® Corp., Milford, MA). The UPLC was equipped with an Acquity™ BEH C18 column (1.7 µm particle size, 50 mm × 2.1 mm) maintained at 40°C. The mobile phases consisted of (A) 0.1% formic acid and 5 mM ammonium formate in ultra-pure water and (B) 0.1% formic acid and 5 mM ammonium formate in acetonitrile at a flow rate of 0.18 mL/min. The following mobile phase parameters were used: 0–

2.5 min: 100% A to 60% A; 2.5–3.5 min: 60% A to 0% A; 3.5–4.5 min: 0% A; 4.5–5.0 min: 0% to 100% A; and 5.0–8.0 min: 100% A. The injection volume was 5 µL. The mass spectrometer was operated in positive electrospray ionization mode using a source temperature of 150°C. The nitrogen desolvation gas flowed at a rate of 540 L/h and a temperature of 150°C. Multiple reaction monitoring (MRM) was used to measure parent and product ions for thiamethoxam and

TPP (Table 4). The primary and secondary ion transition were determined using the

IntelliStart™ function in MassLynx software (Waters Micromass, Manchester, UK), by directly infusing 0.5 mg/mL of standard solutions at a rate of 5 µL/min. The IntelliStart™ function was also used to determine the optimal cone voltage and collision energy for the primary and secondary ion transitions (Table 4).

2.4. Results

2.4.1. Greenhouse experiment

On untreated soybean, survival of biotype 1 ranged from 63%–88%, across all time points and among years, whereas biotype 4 survival ranged from 46%–92% (Figure 3). There were neither significant differences among biotype survival (Table 5 and Table 6), nor observable fitness

45 costs (i.e. survival) with biotype 4 among years. In the 2016 experiment only, biotype 1 and biotype 4 soybean aphid survival showed a significant parallel decreasing slope in response to plant age (slope: -0.7082 ± 0.13, P < 0.05) (Table 8).

In contrast, aphids feeding on seed-treated soybean showed a sigmoidal curve in response to plant age. Sigmoidal curves were visually categorized in three sections according to their slopes: 7–21, 21–35, and ³ 35 DAP. Survival at 7–21 DAP showed an average of 1% survival with no rapid increase, whereas survival at 21–35 DAP sharply rose up to 41.5%. At > 35 DAP, survival reached a plateau or decreased between 60–80% survival in biotype 1 and biotype 4.

Among years, the main effects ‘plant age’ and ‘seed treatment’ were all significant (P < 0.05), but no significant difference was observed between biotypes (Table 5 and Table 6). The interaction effects ‘plant age × seed treatment’ were significant among years, whereas ‘plant age

× biotype’ was significant only in 2015. Survival on seed-treated soybean was significantly lower at 7–28 DAP for both biotype 1 and biotype 4 than on untreated soybean. At 35 DAP, however, only biotype 4 in 2015 still had lower survival on insecticidal seed-treated soybean (P

< 0.05). At 42 DAP, any impact of thiamethoxam on aphid survival was negligible and not significantly different from untreated soybean in any of our greenhouse experiments.

2.4.2. Field experiment

Generally, aphid survival in the field mirrored our greenhouse experiments, albeit with overall lower rates (Figure 4). Due to slower plant emergence in the field, data collection started at 14

DAP. On untreated soybean, survival of biotype 1 ranged from 37%–61% with a significant decreasing slope in response to plant age of -0.2143 ± 0.29 (P < 0.05), whereas survival in biotype 4 ranged from 45%–80% with a significant positive slope of 0.9286 ± 0.29 (P < 0.05)

46 (Table 8). The increase in soybean aphid survival on seed-treated soybean was lower in the field study than in the greenhouse. At 28 DAP, survival of biotype 1 was 0.9% ± 3.0 (compared to

11.5% ± 4.1 in the greenhouse) and biotype 4 was 4.4% ± 3.2 (compared to 21% ± 4.3 in the greenhouse). This difference persisted at 35 DAP, with an average of 2.2% ± 2.1 survival for biotype 1 (compared to 60.5% ± 3.8 in the greenhouse) and 13.6% ± 6.5 for biotype 4 (compared to 52% ± 3.9 in the greenhouse). Surprisingly, aphid survival was significantly different among treated and untreated soybean at 42 DAP for biotype 4. Survival of biotype 4 on treated soybean at 42 DAP was 25% lower compared to untreated soybean (P < 0.05) (Figure 4). Significant interaction effects were detected for ‘plant age × biotype’, ‘seed treatment × plant age’, and ‘seed treatment × biotype’, along with significant main effects for ‘seed treatment’, ‘plant age’,

‘biotype’ (P < 0.05; Table 7). Mean separation on ‘seed treatment × biotype’ revealed that biotype 4 has higher survival than biotype 1 when aphids fed on untreated plants (P < 0.05), but not when fed on insecticidal seed-treated plants (Table 9).

2.4.3. Thiamethoxam concentration in soybean

In the greenhouse, thiamethoxam residues were 277.8 mg/kg at 7 DAP, decreasing to 22.8 mg/kg at 14 DAP and virtually undetectable levels at ³ 28 DAP (Figure 5A). In soybean leaves from the field experiment, we measured thiamethoxam concentrations of 50.9 mg/kg (Figure 5B) at 14

DAP, to undetectable levels by ≥ 28 DAP. Pearson’s correlation between aphid survival and thiamethoxam residues from the greenhouse showed significant negative coefficients of -0.25 (P

= 0.03). Correlation was also negative in the field (-0.31), but not significant (P = 0.18). No thiamethoxam residues were detected in soybean plants grown from untreated (i.e. washed) seeds in greenhouse and field experiments.

47

2.5. Discussion

Using greenhouse and field experiments, we compared weekly soybean aphid survival on insecticidal seed-treated and untreated soybean over the course of six weeks. We also measured the weekly concentration of thiamethoxam to determine whether 1) the control of soybean aphid decreases quickly in time in accordance with the depletion of insecticide residues in plants and 2) the survivorship of virulent aphids on insecticidal seed-treated soybean differs from that of avirulent aphids. Our study demonstrated that insecticidal seed-treated soybean significantly reduced survival of aphid biotypes 1 and 4 up to 35 DAP, which correlates with a decrease of thiamethoxam in the plant tissues based on our UPLC-MS/MS analyses. Our study also determined there was no difference in survivorship of aphid biotypes 1 and 4 on insecticidal seed-treated soybean plants; however, the virulent biotype 4 had higher survival on untreated soybean under field conditions. These findings provide new insights into the relatively short duration of seed treatment efficacy against the soybean aphid and two of its biotypes.

Much of the soybean acreage is now treated with seed treatment labelled for soybean aphid control (Douglas et al. 2015, Hurley and Mitchell 2017). By recording weekly aphid survival and measuring the concentration of thiamethoxam in soybean leaves, we showed that the increase in soybean aphid survival is related to the decrease in thiamethoxam concentration.

Our data are consistent with other studies (McCornack and Ragsdale 2006, Seagraves and

Lundgren 2012, Krupke et al. 2017), showing that aphid control is temporary, lasting between 35 and 42 DAP in both greenhouse and field experiments.

Despite the differences in conditions among greenhouses and field experiments, our data showed consistency. The greenhouse may represent the best-case scenario for protection by

48 thiamethoxam. We controlled temperatures, daylight, supply of nutrients and water.

Interestingly, though, soybean aphid survival increased earlier (21–28 DAP) in the greenhouse experiments than the field experiments (35 DAP). This may be due to our constant watering in the greenhouse (e.g. drip irrigation), which possibly led to flushing the seed treatment from the soil faster. Indeed, thiamethoxam residues in greenhouse plants at 21 DAP were slightly lower

(5.4 mg/kg) than on field plants (9.9 mg/kg). Alternatively, greenhouse conditions may have provided better conditions for soybean growth, enabling quicker metabolism of thiamethoxam and facilitating earlier increases in aphid survival. Soybean in the field could be stressed due to drier conditions and other abiotic/biotic factors, although throughout the course of the study, neither secondary insect infestations nor pathogens were observed. Nonetheless, by 42 DAP no significant difference was observed in aphid survival among treated and untreated soybean in all experiments (with the exception of biotype 4 in the field, Figure 4B). Based on our data and other studies, 35–42 DAP seems to be the limit for effective control of soybean aphid by thiamethoxam seed treatments. Assuming most soybean in the North Central region are planted during the 2nd–3rd week of May, thiamethoxam can provide protection until late June or early

July.

The biology of the soybean aphid requires 2–3 generations on their primary host buckthorn (Rhamnus canthartica) before colonizing soybean (Bahlai et al. 2007, Welsman et al.

2007). Previous researchers have documented a ‘phenological disjunction’ (Ragsdale et al. 2004,

Orantes et al. 2012) in the life history of the soybean aphid, where dispersal from buckthorn occurs with little to no soybean emerged. With no other known secondary plant host to colonize, dispersal from buckthorn causes seasonal bottlenecks (Orantes et al. 2012). However, in years with early planted soybean, there may be enough young soybean available for colonization.

49 Indeed, soybean aphids have been collected from untreated soybean as early as late-May in 2007 and June in 2008 (Orantes et al. 2012, Schmidt et al. 2012). Seed-treated soybean may extend this period of unsuitable hosts until 1st week of July, and therefore it might help explain delays in peak soybean aphid population growth (Bahlai et al. 2014, Krupke et al. 2017). Yet, despite this delay, data from multiple locations and years across North Central Region show no economic benefit from the use of insecticidal seed treatment against soybean aphid (Krupke et al. 2017).

We also observed a delay in aphid response from the time when we detected the lowest concentration of thiamethoxam and the start of soybean aphid increase. By 28 DAP, we could not detect the presence of the insecticide in foliage. Yet, at 35 DAP, aphid survival was still significantly lower in treated than untreated soybean in the field and for biotype 4 in 2015 greenhouse experiment. Why soybean remains ‘toxic’ to these aphids is still unknown, but may be related to our methods for measuring thiamethoxam. Similar delays between thiamethoxam concentration and increase in aphid survival was observed by Magalhaes et al. (2009), who estimated that thiamethoxam residues lasted up to 49 DAP, but aphid populations were significantly different from untreated at 65 DAP. Another possibility may be that the presence of thiamethoxam changes the biochemistry and physiology of soybean itself, providing limitations on soybean aphid growth, even when thiamethoxam is no longer present. Previous research on other plant-insect systems indicated changes of certain plant defense pathways when treated with neonicotinoids (Ford et al. 2010, Szczepaniec et al. 2013). Our data are consistent with other studies showing the impact of neonicotinoids altering plant physiology to the benefit of aphid control; however, we did not evaluate any impacts on non-target or secondary soybean pests.

Future studies on the impact of neonicotinoids on soybean physiology and control to other pests and off-targets are important, especially with Rag-soybean.

50 In most cases, the effect of biotypes was not significant, suggesting that virulence does not impart increased survival on seed-treated aphid-susceptible soybean (i.e. no cross-resistance).

However, on untreated soybean, biotype 4 had significantly higher survival than biotype 1.

Varenhorst et al. (2015) documented a fitness cost of biotype 4 on susceptible plants, which was not apparent in our study with untreated and insecticidal seed-treated soybean. The lack of fitness costs is likely due to the variation in response of different varieties used among studies

(susceptible isolines compared to agronomic/conventional soybean). Fitness costs are an important component to insect resistance management. Indeed, IRM models show that virulence can be managed, and durability of Rag resistance can be extended, in the presence of fitness costs (Varenhorst and O'Neal 2016). Given that both biotypes perform poorly on aphid susceptible soybean treated with thiamethoxam (< 35 DAP), any refuge strategy to manage virulent biotypes cannot include treated susceptible soybean. However, if Rag-soybean is treated in a blended refuge strategy, it may allow avirulent aphid populations to increase and establish earlier and quicker on untreated susceptible soybean, providing a greater ability to retain avirulence in the population. Early arriving aphids [as observed by Orantes et al. (2012) and

Schmidt et al. (2012)] could have a 3–4 week advantage to establish and increase on untreated susceptible plants. With obviation of resistance (where infestation of a virulent biotype on Rag- soybean improves fitness of an avirulent biotype), we might then predict greater movement of avirulent aphids on untreated susceptible plants to Rag plants, competing with virulent aphids.

However, in our case, biotype 4 had higher fitness than biotype 1 on untreated soybean. Future experiments are needed to fully understand fitness differences among soybean varieties, including those that contain Rag, and their interaction with insecticidal seed treatments. IRM modeling could explore this possibility, but results would have to be placed in context of the

51 economic benefits, as insecticidal seed treatments are not likely to provide a return on investment of aphid control (Krupke et al. 2017) as well as impacts to the environment and/or non-target organisms. The benefit of adding insecticidal seed treatments to Rag plants may not be worth the risk, especially since models show that single gene Rag resistance can be durable for 18 years and multiple gene Rag resistance can be reliable for >25 years without them (Varenhorst et al.

2015). Additional research is necessary to understand the role, if any, of insecticidal seed treatments of IRM for extending Rag durability.

52 2.6. Tables and figures

Table 4. UPLC-MS/MS parameters used for multiple reaction monitoring mode (MRM) of thiamethoxam and triphenyl phosphate (TPP) transition ions. Ion transition name Parent (m/z) Product (m/z) Dwell (s) Cone (V) Collision (V) Thiamethoxam-211 292.1 211.11 0.15 30 12 Thiamethoxam-181 292.1 181.12 0.15 30 24 Thiamethoxam-132 292.1 132.02 0.15 30 22 TPP-233 327.0 233.0 0.15 20 25 TPP-169 327.0 169.0 0.15 20 25

Table 5. Analysis of variance (ANOVA) of aphid survival values in greenhouse, 2015 experiment. Sum of Mean Source of variation df Squares Squares F P Block 1 0.9 0.9 0.42 0.5130 Plant age 5 421.1 84.2 39.64 <0.0001 Seed treatment 1 2035.8 2035.8 958.22 <0.0001 Biotype 1 0.2 0.2 0.09 0.7569 Plant age × Seed treatment 5 546.5 109.3 51.44 <0.0001 Seed treatment × Biotype 1 0 0 0.01 0.8944 Plant age × Biotype 5 25.4 5.1 2.39 0.038 Plant age × Seed treatment × Biotype 5 12.7 2.5 1.19 0.3130 Residuals 215 456.8 2.1

53

Table 6. Analysis of variance (ANOVA) of aphid survival values in greenhouse, 2016 experiment. Sum of Mean Source of variation df Squares Squares F P Block 1 23.2 23.2 8.6 0.0035 Plant age 5 187.2 37.4 14.0 <0.0001 Seed treatment 1 1690.7 1690.7 632.5 <0.0001 Biotype 1 7.7 7.7 2.8 0.0910 Plant age × Seed treatment 5 567.2 113.4 42.4 <0.0001 Seed treatment × Biotype 1 4.0 4.0 1.4 0.2223 Plant age × Biotype 5 16.7 3.3 1.2 0.2880 Plant age × Seed treatment × Biotype 5 8.5 1.7 0.6 0.6741 Residuals 215 574.7 2.7

54

Table 7. Analysis of variance (ANOVA) of aphid survival values in field experiment. Sum of Mean Source of variation df F P Squares Square Block 9 38.6 4.2 1.73 0.2120 Seed treatment 1 922.1 922.1 371.8 <0.0001 Block × Seed treatment 9 22.3 2.4 0.8 0.5850 Plant age 4 339.6 84.9 28.5 <0.0001 Biotype 1 51.8 51.8 17.4 <0.0001 Plant age × Biotype 4 31.4 7.8 2.6 0.0357 Seed treatment × Plant age 4 131.6 32.9 11.0 <0.0001 Seed treatment × Biotype 1 16.8 16.8 5.6 0.0186 Seed treatment × Plant age × Biotype 4 9.3 2.3 0.78 0.5380 Residuals 162 481.6 2.9

Table 8. Linear regression of aphid survival values (dependent variable) and days after planting (independent covariant) on untreated soybean in greenhouse (2016 experiment) and field. Soybean aphid biotype df Intercept ± SE Slope ± SE Greenhouse experiment, 2016 Biotype 1 117 95.01 ± 3.18 -0.7082 ± 0.13 Biotype 4 117 88.85 ± 3.96 -0.7082 ± 0.13 Field experiment Biotype 1 96 53.80 ± 12.42 -0.2143 ± 0.29 Biotype 4 96 37.80 ± 8.78 0.9286 ± 0.29

Table 9. Survival values (in percentage) from field experiment with soybean aphid biotypes 1 and 4 on seed-treated or untreated soybean across all plant ages (14–42 DAP). Treatments Mean ± SEM Biotype 4 on untreated soybean 63.8 ± 2.79a Biotype 1 on untreated soybean 47.8 ± 3.28b Biotype 4 on treated soybean 15.2 ± 3.55c Biotype 1 on treated soybean 10.6 ± 3.42c Means followed by different letter are statistically distinct, Tukey’s HSD (a = 0.05).

55

Figure 3. Soybean plant age and soybean aphid survival in the greenhouse on plants grown from thiamethoxam-treated seeds (solid triangles) or untreated seeds (open triangles). Ten adult aphids were placed on plants at the time point indicated and survival assessed at 72 h. A and C: 2015 experiment; B and D: 2016 experiment; A and B: biotype 1 (Rag-susceptible) aphids; and C and D: biotype 4 (Rag-resistant) aphids. Bars represent the standard error of the mean. Asterisks indicate significant differences between thiamethoxam-treated seeds and untreated plants based on Tukey’s HSD (a = 0.05).

56

Figure 4. Soybean plant age and soybean aphid survival in the field on plants grown from thiamethoxam-treated seeds (solid triangles) or untreated seeds (open triangles). Ten adult aphids were placed on plants at the time point indicated and survival assessed at 72 h. Figure A indicates survival of biotype 1 (Rag-susceptible) aphids, whereas figure B indicates survival of biotype 4 (Rag-resistant) aphids. Bars represent the standard error of the mean. Asterisks indicate significant differences between thiamethoxam-treated seeds and untreated plants based on Tukey’s HSD (a = 0.05).

57

Figure 5. Residues of thiamethoxam in insecticide seed treated soybean plant (in mg of a.i. per kilogram of dry weight of plant tissue) detected by the UPLC-MS/MS in greenhouse (Figure A) and field (Figure B) experiments. Bars represent the standard error of the mean. (Note: No residues were detected for untreated soybean and therefore are not included; see Results).

58

Figure 6. Soybean plant age and soybean aphid survival in the greenhouse on plants from thiamethoxam-treated seeds (solid figures) or untreated seeds (open figures). Ten adult aphids were placed on plants at the time point indicated and survival assessed at 24 h (circles) and 48 h (triangles). A and C: 2015 experiment; B and D: 2016 experiment; A and B: biotype 1 (Rag- susceptible) aphids; and C and D: biotype 4 (Rag-resistant) aphids. Bars represent the standard error of the mean.

59

Figure 7. Soybean plant age and soybean aphid survival in the field on plants from thiamethoxam-treated seeds (solid figures) or untreated seeds (open figures). Ten adult aphids were placed on plants at the time point indicated and survival assessed at 24 h (circles) and 48 h (triangles). Figure A indicates survival of biotype 1 (Rag-susceptible) aphids, whereas figure B indicates survival of biotype 4 (Rag-resistant) aphids. Bars represent the standard error of the mean.

60 2.7. References cited

Alt, J., and M. Ryan-Mahmutagic. 2013. Soybean aphid biotype 4 identified. Crop Science 53. Bahlai, C. A., J. A. Welsman, A. W. Schaafsma, and M. K. Sears. 2007. Development of soybean aphid (Homoptera: Aphididae) on its primary overwintering host, Rhamnus cathadica. Environmental Entomology 36: 998-1006. Bahlai, C. A., M. Colunga-Garcia, S. H. Gage, and D. A. Landis. 2014. The role of exotic ladybeetles in the decline of native ladybeetle populations: evidence from long-term monitoring. Biological Invasions 17: 1005-1024. Crowder, D. W., and Y. Carriere. 2009. Comparing the refuge strategy for managing the evolution of insect resistance under different reproductive strategies. Journal of Theoretical Biology 261: 423-430. Douglas, M. R., J. R. Rohr, and J. F. Tooker. 2015. Neonicotinoid insecticide travels through a soil food chain, disrupting biological control of non-target pests and decreasing soya bean yield. Journal of Applied Ecology 52: 250-260. Fehr, W. R., C. E. Caviness, D. T. Burmood, and J. S. Pennington. 1971. Stage of development descriptions for soybeans, Glycine max (L) Merrill. Crop Science 11: 929- 931. Ford, K. A., J. E. Casida, D. Chandran, A. G. Gulevich, R. A. Okrent, K. A. Durkin, R. Sarpong, E. M. Bunnelle, and M. C. Wildermuth. 2010. Neonicotinoid insecticides induce salicylate-associated plant defense responses. Proceedings of the National Academy of Sciences of the United States of America 107: 17527-17532. Gassmann, A. J., J. L. Petzold-Maxwell, R. S. Keweshan, and M. W. Dunbar. 2011. Field- evolved resistance to Bt maize by western corn rootworm. PLoS One 6: e22629. Hanson, A. A., J. Menger-Anderson, C. Silverstein, B. D. Potter, I. V. MacRae, E. W. Hodgson, and R. L. Koch. 2017. Evidence for soybean aphid (Hemiptera: Aphididae) resistance to pyrethroid insecticides in the upper midwestern United States. Journal of Economic Entomology 110: 2235-2246. Hesler, L. S., K. C. Allen, R. G. Luttrell, T. W. Sappington, and S. K. Papiernik. 2018. Early-season pests of soybean in the United States and factors that affect their risk of infestation. Journal of Integrated Pest Management 9. Hesler, L. S., M. V. Chiozza, M. E. O'Neal, G. C. MacIntosh, K. J. Tilmon, D. I. Chandrasena, C. D. Difonzo, N. A. Tinsley, K. Steffey, S. R. Cianzio, A. C. Costamagna, D. W. Ragsdale, E. M. Cullen, B. D. Potter, and K. J. Koehler. 2013. Performance and prospects of Rag genes for management of soybean aphid. Entomologia Experimentalis et Applicata 147: 201-216. Hill, C. B., L. Crull, T. K. Herman, D. J. Voegtlin, and G. L. Hartman. 2010. A new soybean aphid (Hemiptera: Aphididae) biotype identified. Journal of Economic Entomology 103: 509-515.

61 Hodgson, E. W., B. P. McCornack, K. Tilmon, and J. J. Knodel. 2012. Management recommendations for soybean aphid (Hemiptera: Aphididae) in the United States. Journal of Integrated Pest Management 3: E1-E10. Horwitz, W. 2000. Official methods of analysis of AOAC International, 17th ed. ed. AOAC International, Gaithersburg, Md. Hummel, N. A., A. Meszaros, D. R. Ring, J. M. Beuzelin, and M. J. Stout. 2014. Evaluation of seed treatment insecticides for management of the rice water weevil, Lissorhoptrus oryzophilus Kuschel (Coleoptera: Curculionidae), in commercial rice fields in Louisiana. Crop Protection 65: 37-42. Hurley, T., and P. Mitchell. 2017. Value of neonicotinoid seed treatments to US soybean farmers. Pest Management Science 73: 102-112. Kim, K.-S., C. B. Hill, G. L. Hartman, M. A. R. Mian, and B. W. Diers. 2008. Discovery of soybean aphid biotypes. Crop Science 48. Koch, R. L., E. W. Hodgson, J. J. Knodel, A. J. Varenhorst, and B. D. Potter. 2018. Management of insecticide-resistant soybean aphids in the upper midwest of the United States. Journal of Integrated Pest Management 9. Krell, R. K., L. P. Pedigo, J. H. Hill, and M. E. Rice. 2004. Bean leaf beetle (Coleoptera: Chrysomelidae) management for reduction of bean pod mottle virus. Journal of Economic Entomology 97: 192-202. Krupke, C. H., A. M. Alford, E. M. Cullen, E. W. Hodgson, J. J. Knodel, B. McCornack, B. D. Potter, M. I. Spigler, K. Tilmon, and K. Welch. 2017. Assessing the value and pest management window provided by neonicotinoid seed treatments for management of soybean aphid (Aphis glycines Matsumura) in the upper midwestern United States. Pest Management Science 73: 2184-2193. Magalhaes, L. C., T. E. Hunt, and B. D. Siegfried. 2009. Efficacy of neonicotinoid seed treatments to reduce soybean aphid populations under field and controlled conditions in Nebraska. Journal of Economic Entomology 102: 187-195. McCarville, M. T., and M. E. O'Neal. 2013. Soybean aphid (Aphididae: Hemiptera) population growth as affected by host plant resistance and an insecticidal seed treatment. Journal of Economic Entomology 106: 1302-1309. McCarville, M. T., E. W. Hodgson, and M. O’Neal. 2012. Soybean aphid-resistant soybean varieties for Iowa. Iowa State University Extension and Outreach, Ames. IA, USA. McCornack, B., and D. W. Ragsdale. 2006. Efficacy of thiamethoxam to suppress soybean aphid populations in Minnesota soybean. Crop management. Orantes, L. C., W. Zhang, M. A. Mian, and A. P. Michel. 2012. Maintaining genetic diversity and population panmixia through dispersal and not gene flow in a holocyclic heteroecious aphid species. Heredity (Edinb) 109: 127-134.

62 Petzold-Maxwell, J. L., L. J. Meinke, M. E. Gray, R. E. Estes, and A. J. Gassmann. 2013. Effect of Bt maize and soil insecticides on yield, injury, and rootworm survival: Implications for resistance management. Journal of Economic Entomology 106: 1941- 1951. Ragsdale, D. W., D. J. Voegtlin, and R. J. O'Neil. 2004. Soybean aphid biology in North America. Annals of the Entomological Society of America 97: 204-208. Ragsdale, D. W., D. A. Landis, J. Brodeur, G. E. Heimpel, and N. Desneux. 2011. Ecology and management of the soybean aphid in North America. Annual Review of Entomology 56: 375-399. Ragsdale, D. W., B. P. McCornack, R. C. Venette, B. D. Potter, I. V. MacRae, E. W. Hodgson, M. E. O’Neal, K. D. Johnson, R. J. O’Neil, C. D. DiFonzo, T. E. Hunt, P. A. Glogoza, and E. M. Cullen. 2007. Economic threshold for soybean aphid (Hemiptera: Aphididae). Journal of Economic Entomology 100: 1258-1267. Roush, R. T. 1998. Two-toxin strategies for management of insecticidal transgenic crops: can pyramiding succeed where pesticide mixtures have not? Philosophical Transactions of the Royal Society B 353: 1777-1786. Rutledge, C. E., and R. J. O’Neil. 2006. Soybean plant stage and population growth of soybean aphid. Journal of Economic Entomology 99: 60-66. Schmidt, N. P., M. E. O'Neal, P. F. Anderson, D. Lagos, D. Voegtlin, W. Bailey, P. Caragea, E. Cullen, C. DiFonzo, K. Elliott, C. Gratton, D. Johnson, C. H. Krupke, B. McCornack, R. O'Neil, D. W. Ragsdale, K. J. Tilmon, and J. Whitworth. 2012. Spatial distribution of Aphis glycines (Hemiptera: Aphididae): A summary of the suction trap network. Journal of Economic Entomology 105: 259-271. Schmidt-Jeffris, R. A., and B. A. Nault. 2016. Anthranilic diamide insecticides delivered via multiple approaches to control vegetable pests: A case study in snap bean. Journal of Economic Entomology 109: 2479-2488. Seagraves, M. P., and J. G. Lundgren. 2012. Effects of neonicitinoid seed treatments on soybean aphid and its natural enemies. Journal of Pest Science 85: 125-132. Szczepaniec, A., M. J. Raupp, R. D. Parker, D. Kerns, and M. D. Eubanks. 2013. Neonicotinoid insecticides alter induced defenses and increase susceptibility to spider mites in distantly related crop plants. PloS One 8. Tilmon, K. J., E. W. Hodgson, M. E. O'Neal, and D. W. Ragsdale. 2011. Biology of the soybean aphid, Aphis glycines (Hemiptera: Aphididae) in the United States. Journal of Integrated Pest Management 2: 1-7. USGS, U. S. G. S. 2014. Project: estimated annual agricultural pesticide use maps— thiamethoxam, pesticide national synthesis project. Varenhorst, A. J., and M. E. O'Neal. 2016. The effect of an interspersed refuge on Aphis glycines (Hemiptera: Aphididae), their natural enemies, and biological control. Journal of Economic Entomology 109: 406-415.

63 Varenhorst, A. J., M. T. McCarville, and M. E. O'Neal. 2015. Reduced fitness of virulent Aphis glycines (Hemiptera: Aphididae) biotypes may influence the longevity of resistance genes in soybean. PLoS One 10: e0138252. Welsman, J. A., C. A. Bahlai, M. K. Sears, and A. W. Schaafsma. 2007. Decline of soybean aphid (Homoptera: Aphididae) egg populations from autumn to spring on the primary host, Rhamnus cathartica. Environmental Entomology 36: 541-548. Wilde, G., K. Roozeboom, M. Claassen, K. Janssen, and M. Witt. 2004. Seed treatment for control of early-season pests of corn and its effect on yield. Journal of Agricultural and Urban Entomology 21: 75-85. Wilde, G., K. Roozeboom, A. Ahmad, M. Claassen, B. Gordon, W. Heer, L. Maddux, V. Martin, P. Evans, K. Kofoid, J. Long, A. Schlegel, and M. Witt. 2007. Seed treatment effects on early-season pests of corn and on corn growth and yield in the absence of insect pests. Journal of Agricultural and Urban Entomology 24: 177-193. Wilde, G. E., R. J. Whitworth, M. Claassen, and R. A. Shufran. 2001. Seed treatment for control of wheat insects and its effect on yield. Journal of Agricultural and Urban Entomology 18: 1-11.

64 Chapter 3: Evaluating the role of insecticidal seed treatment and refuge for managing

soybean aphid virulence

3.1. Abstract

Virulence of the soybean aphid to host plant resistance threatens the durability of aphid-resistant varieties. How virulent soybean aphids can overcome soybean host plant resistance is unknown.

Nonetheless, virulent soybean aphids have fitness costs on aphid-susceptible soybean that could benefit virulence management. Models show that a refuge (i.e. aphid-susceptible soybean) grown with aphid-resistant soybean can manage, or in some cases, decrease virulence frequency.

Insecticidal seed treatments could also affect the fitness of virulent soybean aphids, but how they could contribute to virulence management is unknown. Therefore, we evaluated if an insecticidal seed treatment in combination with an aphid-susceptible refuge strategy, would maintain or decrease the soybean aphid virulence frequency over time. We planted aphid-susceptible and aphid-resistant soybean in a 1:3 ratio. Prior to sowing, we seed-treated either the aphid- susceptible, the aphid-resistant, both or none of the soybeans. Independent cohorts of soybean plants were infested with avirulent and virulent soybean aphids in a 1:1 ratio at 7, 14, 21, 28, 35, and 42 days after planting. On day seven after each infestation, we counted the total number of aphids and estimated the total amount of avirulent and virulent soybean aphid by molecular approaches. We found that the use of a seed treatment in combination with aphid-susceptible refuge decreased virulence frequency and provides an additional approach to extend the durability of aphid-resistant soybean varieties. 65

3.2. Introduction

The use of host plant resistance with Rag (Resistance to Aphis glycines) genes in soybean suppresses growth and reproduction of soybean aphid (McCarville et al. 2012), an important pest of soybean in North America (Ragsdale et al. 2011). There are several known genes associated with aphid resistance (Hill et al. 2012), but only Rag1, Rag2 and their pyramid (Rag1/Rag2) are commercially grown (McCarville et al. 2012). However, the use of Rag-soybean selects rapidly towards certain aphid populations (i.e. biotypes) that can overcome hosts plant resistance (i.e. virulent) and threaten the durability of Rag genes (Hill et al. 2012, Alt and Ryan-Mahmutagic

2013, Wenger et al. 2014). The soybean aphid biotypes known are: biotype 1 is susceptible to all

Rag genes (Hill et al. 2006, Hill et al. 2007); biotype 2 is virulent to only Rag1 (Kim et al. 2008); biotype 3 is partially virulent to Rag1 and virulent to Rag2 (Hill et al. 2010); and biotype 4 is virulent to Rag1, Rag2 and Rag1/Rag2 (Alt and Ryan-Mahmutagic 2013). For the management of virulent aphid populations and to extend the durability of Rag soybean, producers need strategies to delay increases in virulence, such as non-Rag refuge (i.e. aphid-susceptible soybean).

A susceptible refuge helps manage insect resistance to genetically modified (GM) crops, and it is a critical (sometimes mandatory) component for insect resistance management (IRM)

(Bates et al. 2005, Hutchison et al. 2010, Tabashnik et al. 2013). The refuge strategy is based on several assumptions including: 1) the high-dose of the insecticide kills over 95% of the individuals (Georghiou and Taylor 1977, Gould 1998); 2) the surviving resistant individuals will mate randomly with individuals from the refuge (Bourguet et al. 2005); 3) resistance is recessive, and 4) resistant individuals have fitness costs that make them less competitive in refuge areas

(Carriere and Tabashnik 2001). In experiments resembling the refuge use in GM crops, 66 interspersed aphid-susceptible refuge in combination with Rag-soybean have shown potential to manage virulence without deteriorating yield (Wenger et al. 2014, Varenhorst and O'Neal 2016).

Although Rag-soybean may violate other assumptions of IRM (such as a lack of high-dose, or recessive virulence), maintaining avirulence in the population would be important, especially if a fitness cost to virulence could be exacerbated.

In addition to refuge, most GM crops also include a pyramid of two or more insecticidal toxins as well as insecticidal seed treatment (Tabashnik et al. 2013). Analogous to pyramid toxins in GM crops, pyramiding Rag-soybean and insecticide applications (i.e. as foliar or seed treatment) have shown additive/synergistic effects for controlling soybean aphid populations

(Ragsdale et al. 2007, McCarville and O'Neal 2013, Kandel et al. 2015, Hanson et al. 2017,

Hanson and Koch 2018, Koch et al. 2018). However, these studies 1) did not include aphid- susceptible refuge, 2) they did not evaluate whether an insecticide application can decrease virulence and extend the durability of Rag-soybean, and 3) did not determine whether an insecticide alters the fitness of virulent or avirulent soybean aphid on Rag or aphid-susceptible soybean. Understanding whether refuge and insecticide treatment alter fitness or population size of virulent and avirulent soybean aphids is critical to developing IRM programs targeting soybean aphid virulence.

Therefore, our goal was to evaluate whether an insecticidal seed treatment combined with an aphid-susceptible refuge can affect the frequency and fitness of virulent soybean aphids. For our experiments, we selected a seed treatment as the insecticidal application, since it is widely used among soybean growers in North America (Douglas and Tooker 2015, Hurley and Mitchell

2017). In brief, we planted seed-treated or untreated aphid-susceptible and Rag-soybean in a 1:3 ratio. We infested all plants with biotype 1 and biotype 4 adult aphids every week for 6 weeks

67 and evaluated aphid population and fitness of each biotype seven days after infestation. We hypothesized that 1) seed treatment of Rag-soybean and untreated aphid-susceptible soybean will decrease the biotype 4 population below the population of biotype 1; 2) fitness of biotype 4 will be significantly lower when fed on treated Rag-soybean than on untreated Rag-soybean; and 3) fitness of biotype 1 will be significantly higher when fed on the untreated refuge than on treated refuge. We found that by seed treating Rag-soybean in combination with untreated aphid- susceptible refuge we can increase the proportion of avirulent soybean aphids, while the virulent population decreases. These outcomes would begin the foundation for an IRM program to control soybean aphid virulence.

3.3. Materials and methods

3.3.1. Soybean seeds

We used the variety Wyandot as the aphid-susceptible soybean and IA3027RA12 with

Rag1/Rag2 genes as the aphid-resistant soybean for all treatments (Note: the susceptible isoline to IA3027RA12 was unavailable at the time of the experiment). Seeds of both varieties were treated with CruiserMaxx® Vibrance® (Syngenta®, Greensboro, NC) containing a total of 50 g a.i. of thiamethoxam, 7.5 g a.i. of mefenoxam, 2.5 g a.i. of fludioxonil, and 2.5 g a.i. of sedaxane per 100 kg of seed using a Wintersteiger Hege 11 (Ried im Innnkreis, Austria) seed treater. No seed treatment was applied to untreated soybean.

3.3.2. Soybean aphids

Biotype 1 and biotype 4 soybean aphids were kept in the Michel Laboratory at the Ohio

Agricultural Research and Development Center (OARDC), The Ohio State University, Wooster,

68 Ohio. Aphids were reared and age-synchronized under the same conditions as in Esquivel et al.

2019. We used only 7-day old apterae soybean aphids for all experiments.

3.3.3. Microcosm conditions and experimental design

Soybean seeds were planted in Nursery Supplies® Classic CustomTM Blow-Molded

(Chambersburg, Pennsylvania) pots (16 cm upper dimeter, 12.5 cm lower diameter, 16 cm height, 3.7854 L total volume) filled with soilless media Pro-Mix BX® (Québec, Canada). Each pot was planted in four different spots spaced 10 cm between rows and 10 cm between plants.

One of the spots was planted with two aphid-susceptible soybean seeds, and each of the remaining spots with two seeds of the Rag-soybean, making a total of 25% aphid-susceptible soybean (refuge) and 75% Rag-soybean. A single planted pot was placed into a customized polyester cage (47 cm width, 47 cm length, 88.9 cm height, with U.S. #100 white sport nylon fabric, China). Cages with pots were kept under greenhouse conditions at 23–25˚C, 16:8 hours of light:dark and 60–75% RH, using an Argus® Control System –a Conviron® Company (British

Columbia, Canada). Soybean was watered using drip irrigation with the following program: 1) days 0–15, 75 mL per pot four times per week; 2) days 16–30, 105 mL per pot per day; 3) days

31–40, 75 mL per pot two times per day; and 4) days 39–49, 105 mL per pot two times per day.

Fertilization was continuously injected to the irrigation, by diluting in 1:64 ratio a solution of:

121.13 g N, 52.49 g P2O5, and 121.13 g K2O in 7.57 L of water

The experimental unit for statistical analysis was a cage with a pot. All experimental units were arranged in a factorial randomized complete block design. Factors were: seed treatment: 1) aphid-susceptible soybean seeds untreated, Rag-soybean seeds untreated (SR); aphid-susceptible soybean seeds untreated, Rag-soybean seeds treated (SRt); aphid-susceptible

69 soybean seeds treated, Rag-soybean seeds untreated (StR); and aphid-susceptible soybean seeds treated, Rag-soybean seeds treated (StRt); and 2) plant age: 7, 14, 21, 28, 35, and 42 DAP.

Treatments were replicated 4 times. At each time point prior to infestation, one of the two plants per planting spot was removed and the remaining plant infested with a total of four biotype 1 and four biotype 4 adult soybean aphids (1:1 biotype ratio); all aphids were transferred to the newest, fully mature middle leaflet using a fine-haired paintbrush. Seven days after infestation, soybean aphid adults and nymphs on each plant were counted and then collected. Soybean aphids were stored at -20˚C for subsequent molecular biotype genotyping.

3.3.4. Molecular biotype genotyping

Molecular genotyping was used to identify biotype and estimate their percentage of biotype 1 and 4 on plants at 7 days after infestation. In brief, we randomly selected up to 24 adults or nymphs from each plant of each experimental unit. Genomic DNA was extracted by homogenizing an individual soybean aphid in 25 µL of Epicenter® QuickExtract DNA

Extraction Solution (San Diego, CA), heating at 65˚C for 6 min and then at 98˚C for 2 min. In brief, oligo primers (forward: 5’–TTG TAT CCT GGC CTT TGT CC–3’; reverse: 5’–TGA TGA

AAT GAA CGG CGA TA–3’, Sigma-Aldrich, St. Louis, MO) amplified a section of scaffold1766 from the soybean aphid genome (Wenger et al., 2017, see https://bipaa.genouest.org/sp/aphis_glycines/). Primers were purchased from Sigma-Aldrich (St.

Louis, MO). Conventional PCR was performed using 12.5 µL Promega® GoTaq Green Master

Mix (Madison, WI), 2 µL of 10 µM primer (forward and reverse), 2 µL of DNA, and 8.5 µL of nuclease-free water per reaction. The thermal cycler protocol was: denaturation for 5 min at

95˚C; 30 cycles of 30 sec at 94˚C, 30 sec at 58˚C, 30 sec at 72˚C; and 5 min at 72˚C. A total of

70 10 µL of the amplified PCR reaction was mixed with 12 µL nuclease-free water, 2.5 µL of

CutSmart Buffer and 0.5 µL of MseI enzyme (New England BioLabs, Ipswich, MA); the mix was incubated at 37˚C for 90 min and then at 65˚C for 30 min. A total of 25 µL of the incubated reaction was electrophoresed on an 3% agarose gel, including 1X TAE and GelRed® (Biotium

Inc., Fremont, CA). Electrophoresis current was set at 150 min at 75 mV. The MYECLTM Imager

(Thermo Fisher Scientific Inc., Walthman, MA) was used in UV light mode for band visualization. Biotype 1 soybean aphid DNA bands were observed at 57 and 96 base pairs (bp), whereas biotype 4 soybean aphid DNA bands were at 78, 83, and 95 bp (Figure 8).

3.3.5. Statistical analysis

The number of biotype 1 and biotype 4 aphids from all experimental units were separated by treatment and submitted to a generalized linear model (PROC GENMOD, SAS v9.4) analysis with a Poisson distribution. We then performed mean separation using least square means with

Tukey’s adjustment on the biotype (biotype 1 and biotype 4) and plant age (7, 14, 21, 28, 35, and

42 DAP) and the biotype ´ plant age interaction. Moreover, for each time point of each treatment we calculated the ‘virulence index’ by dividing the number of biotype 1 aphids by the number of biotype 4 aphids. A virulence index <1 indicates biotype 4 aphids predominate in the population.

Figures 1A–D were generated using GraphPad Prism® (version 6) GraphPad Software Inc. (La

Jolla, CA).

Moreover, we calculated the per capita progeny (pcp) as a fitness estimator of the soybean aphid biotypes on seed-treated or untreated aphid-susceptible or Rag-soybean from each treatment. The pcp was calculated by adding the total number of adults and nymphs counted on a single plant at day 7 after infestation, divided by the total number of aphids used at infestation

71 (see Wenger et al. 2014). The pcp values of each plant were then multiplied by the respective percentages of biotype 1 or biotype 4 found by our molecular approach. The pcp values of the three aphid-resistant plants within the same experimental unit were averaged. For statistical analyses, the pcp values were then analyzed with a generalized mixed model (PROC MIXED,

SAS v9.4). Mean separation on the biotype (biotype 1 and biotype 4), treatments (SR, SRt, StR, and StRt) and plant age (7, 14, 21, 28, 35, and 42 DAP) interactions was performed using the least square means with a Tukey’s adjustment.

3.4. Results

3.4.1. Effect of refuge and seed treatment on aphid population size

We observed that seed treatment has a suppressing effect on the overall aphid population. In general, we observed that the aphid population (biotype 1 and biotype 4 combined) in SR with no seed treatment (126.02±13.5 aphids per pot) was about 2 times larger than StR (59.4±12.2 aphids per pot) and SRt (50.1±9.3 aphids per pot), where seed treatment is applied to the 25% and 75% of the plants, respectively (Figure 9B and Figure 9C). Aphid population in treatment

StRt (11.9±4.4 aphids per pot) with 100% of the plants with seed treatment was 10 times lower than SR (Figure 9A and Figure 9D).

Then, we analyzed the effects of our treatments on the biotype 1 and biotype 4 population size. When no seed treatment was applied as in SR, the average gap in population size between biotype 4 (143.78±14.7 aphids per pot) and biotype 1 (108.25±11.4 aphids per pot) was 1.8-fold smaller than in treatment StR (Figure 9A and Figure 9C). Moreover, we expected that by treating

Rag-soybean and keeping the aphid-susceptible refuge untreated (as in treatment SRt), the population of biotype 4 will be lower than biotype 1. We found that the average population of

72 biotype 1 across all time points (50.69±10.1 aphids per pot) was not significantly different than biotype 4 (49.60±8.7 aphids per pot) (Figure 9B). Across all time points, the virulence index ranges from 1.01–1.61, except at 28 DAP. At each time point, we found that the population of biotype 4 was significantly lower than biotype 1 at 7 and 14 DAP (P < 0.05) (Figure 9B). In contrast, in treatment StR the population of biotype 4 (92.40±13.6 aphids per pot) was much higher than biotype 1 (25.55±5.1 aphids per pot) in the StR treatment across all time points (P <

0.05, Figure 9C). At StR treatment, virulence index ranged 0.15–0.59 (Figure 9C).

Lastly, we evaluated the effects of seed treatment and soybean host quality over time on the survival of soybean aphids. We observed in all treatments that the overall aphid population moved up and down across all time points a similar way. In detail, treatments SR, SRt, StR, and

StRt showed a depletion in aphid population size of 60.7%, 69.9%, 80% and 85.7% from 7–14

DAP, and an increase after 21 DAP (Figure 9A–D). After 35 DAP, treatments StR and StRt showed a decrease in population of 16% and 69.7% (Figure 9C and Figure 9D), respectively, whereas treatments SR and SRt showed an increase in population of 4% and 36% (Figure 9A and

Figure 9B), respectively.

3.4.2. Change in fitness of aphid biotypes on seed-treated or untreated soybean

We found that the use of aphid-susceptible refuge in combination with seed treatment caused significantly changes in the population size of both biotype 1 and biotype 4 soybean aphids. As we expected, biotype 4 soybean aphid on treated Rag-soybean had lower fitness than feeding on untreated Rag-soybean. We observed that from 7–35 DAP, biotype 4 on treated Rag-soybean of

SRt and StRt showed significantly (P < 0.05) lower pcp values than on untreated Rag-soybean

(except at 28 DAP). Although the pcp of biotype 4 was lower on treated Rag-soybean at 42 73 DAP, it was not significantly different from untreated (P ³ 0.05). On aphid-susceptible soybean, in contrast, pcp values of biotype 4 on untreated (in treatments SR and SRt) or seed-treated soybean (in treatments StR and StRt) were not significantly different at 14, 21, 28 and 35 DAP.

At 42 DAP, however, biotype 4 on aphid-susceptible in treatment SRt was significantly lower than in treatment SR (Table 11).

Moreover, we hypothesized biotype 1 feeding on untreated aphid-susceptible refuge had higher fitness than feeding on seed-treated refuge. As expected, we observed that seed treatment on aphid-susceptible soybean in StR and StRt treatments significantly reduced pcp of biotype 1 aphids at 7, 14, 21, and 28 DAP in comparison to SR and SRt (P < 0.05, Table 11). At 35 and 42

DAP, biotype 1 pcp values on aphid-susceptible soybean across all treatments (SR, SRt, StR, and

StRt) were statistically similar (P > 0.05). On Rag-soybean, the seed treatment significantly reduced pcp of biotype 1 at 7, 14, 28, and 35 DAP, in comparison with untreated Rag-soybean (P

< 0.05, Table 11).

Lastly, we compared the pcp values of biotype 1 and biotype 4 between untreated soybean types. We found that biotype 1 feeding on Rag-soybean (average pcp of 0.80±0.8) had lower fitness than biotype 4 (average pcp of 4.11±2.2). On the other hand, biotype 1 feeding on untreated aphid-susceptible (average pcp of 11.21±6.6) had higher fitness than biotype 4

(average pcp of 5.56±4.2) (Table 11). These outcomes support our predictions that: 1) without seed-treating Rag-soybean, biotype 4 fitness will surpass fitness of biotype 1; and 2) fitness of biotype 1 on untreated aphid-susceptible will be higher than biotype 4.

74 3.5. Discussion

Using agronomic and molecular approaches, we evaluated whether the use of aphid-susceptible refuge and seed treatment can manage soybean aphid virulence. Our study demonstrates that seed treatment can provide control on soybean aphid populations early during the growing season. Moreover, we showed that a seed treatment on Rag-soybeans can decrease the fitness of virulent aphids and potentially complement a refuge-based IRM strategy.

3.5.1. Seed treatment effect on aphid population size

The use of seed treatment, as in treatments StR, SRt, and StRt, decreases in general aphid population 2.1, 2.5, and 10.5 times lower than the untreated SR treatment, respectively (Figure

9A–D). The lowest aphid count was consistently observed on the StRt treatment, where all plants were grown from treated seeds (Figure 9D). In a similar study, Esquivel et al. (2019) found that by seed treating all soybean plants, both biotype 1 and biotype 4 populations remained low within the first 28 DAP. Our results suggest that seed treatment and Rag-soybean have additive effects on the control of aphid population. Additive effects between Rag-soybean and seed treatment controlling soybean aphid have also been observed in other studies (McCarville and

O'Neal 2013, Kandel et al. 2015). When Rag-soybean was seed-treated, significant reductions in number of aphids per plant (McCarville and O'Neal 2013) and higher yield (Kandel et al. 2015) were observed, in comparison with untreated or seed-treated aphid-susceptible soybean. Additive effects between insecticides and Rag-soybean have also been found with foliar applications (see

Hanson and Koch 2018).

Moreover, we observed a consistent depletion in aphid populations from 7–14 DAP, a rise from 21–35 DAP across all treatments and decrease after 35 DAP in treatments StR and

75 StRt. We speculate that the decrease in aphid survival from 7–14 DAP is related to the increase in physiological antibiosis/antixenosis effects of Rag genes and plant defenses (Hill et al. 2004).

Moreover, the decrease in aphid count after 35 DAP could be associated with the decrease in host quality as plants get older (van den Berg et al. 1997, Costamagna et al. 2007). Similar trends were observed on older non-Rag soybean plants, where virulent and avirulent soybean aphids showed a decrease in survival (Esquivel et al. 2019) or reproduction (Rutledge and O’Neil 2006).

In treatment SR, the population of biotype 4 exceeded the population of biotype 1, making the virulence index lower than 1 at all time points (Figure 9A). These results were similar to those found by Wenger et al. (2014). Our data suggest that without seed treatment, the use of aphid-susceptible refuge by itself was able to maintain some avirulence in the population, but not enough to reverse virulence. Why the refuge strategy is not capable of reverting virulent population might be associated with the proportion of virulent aphids we used for infestation

(50% of the total aphids infested). Perhaps, the aphid-susceptible refuge is enough to control soybean aphid virulence, as the frequency of virulent soybean aphids in the field is much lower than what we used in our experiments (Wenger and Michel 2013, Cooper et al. 2015). In addition, increasing the percentage of an aphid-susceptible refuge might increase the population of avirulent aphids without compromising yield (Varenhorst and O'Neal 2016). The untreated aphid-susceptible refuge may also improve control of soybean aphid by natural enemies

(Varenhorst and O'Neal 2016). However, expanding the percentage of refuge could increase the probability of soybean aphid populations reaching economic thresholds during heavy infestation years, requiring suppressive foliar applications (see Ragsdale et al. 2007).

We hypothesized that by seed-treating only Rag-soybean (treatment SRt) we could provide greater control of the virulent aphid population than only using a refuge strategy. As

76 expected, we found that the biotype 1 population was significantly higher (at 7 and 14 DAP) than biotype 4 and the virulence index consistently above 1 at 7, 14, 21, 35, and 42 DAP. Data from the SRt treatment indicate that an insecticidal seed treatment may indeed help manage the frequency of virulence, especially during years when soybean aphid arrives early to soybean

(Orantes et al. 2012, Schmidt et al. 2012). We speculate that our ability to further control biotype

4 populations with seed treatments is granted by: 1) no cross-resistance between soybean aphid virulence and thiamethoxam seed treatment, as observed by Esquivel et al. 2019; and 2) higher fitness of biotype 1 than biotype 4 aphids on aphid-susceptible soybean that maintains a predominantly avirulent population in the microcosm system (see Varenhorst et al. 2015).

However, in treatments with a treated refuge (e.g. StR, StRt), biotype 1 performed poorly compared to biotype 4. Although we did not see fixation of biotype 4, the low pcp values for biotype 1 suggest that these treatments would be highly unlikely to maintain any avirulence at later timepoints.

The use of insecticide and host plant resistance together could cause complex physiological or ecological interactions and induce detrimental antagonistic effects for pest control (e.g. changes in feeding rate affecting insecticide ingestion, activation of insecticide detoxifying enzymes when insect feed on resistant plants) (Eigenbrode and Trumble 1994,

Quisenberry and Schotzko 1994, Guedes et al. 2016). Therefore, the combination of seed treatment and Rag-soybean for soybean aphid population management requires further experimentation measuring other biological responses (e.g. feeding, life span, birth rate, geographical movement of soybean aphid) or interaction with natural enemies (see below) under various ecological conditions.

77 3.5.2. Biotype fitness by seed treatment, soybean type and plant ages

In general, we observed that from 7–28 DAP seed treatment on aphid-susceptible or Rag- soybean from either SRt, StR, or StRt treatments significantly reduced fitness of both aphid biotypes in comparison with untreated soybean plants of SR (Table 11). Their lower fitness levels probably reflect the high concentration of thiamethoxam in the treated soybean, as observed by Esquivel et al. (2019) between 7 and 35 DAP aphid-susceptible. In treatment SRt, particularly, the fitness of biotype 1 on the aphid-susceptible soybean from 7–35 was as high as the untreated aphid-susceptible soybean in SR, whereas fitness of biotype 4 on the treated Rag- soybean in SRt was significantly lower than untreated Rag-soybeans in SR (Table 11). Treatment

SRt would be the ideal scenario for soybean aphid virulence management, as we could enhance fitness of biotype 1 and restrict population growth of biotype 4, simultaneously. During years when soybean winged morph infestations occur early during the year (i.e. May–June, see Orantes et al. 2012 and Schmidt et al. 2012), virulent soybean aphids landing on seed-treated Rag- soybean would likely have lower fitness, while avirulent aphids could maintain populations and their fitness advantage on untreated aphid-susceptible soybean. In addition, if early infestations of virulent soybean aphids are controlled by seed treatment of Rag-soybean, subsequent infestations of virulent aphids are less likely to occur.

As expected in the StR treatment, biotype 1 fitness on seed-treated aphid-susceptible soybean is significantly reduced from 7–21 DAP, while biotype 4 on the untreated Rag-soybean from 7–35 DAP had significantly higher fitness than untreated Rag-soybean (Table 11). These results support our hypotheses that focused seed treatment (only to aphid-susceptible or Rag- soybean) can modify virulence ratio. Modification of the avirulent and virulent population resembles the high-dose/refuge strategy in genetically modified crops (Bates et al. 2005,

78 Hutchison et al. 2010, Tabashnik et al. 2013). First, at early stages of the crop our seed treatment keeps pcp values of virulent aphids relatively low, suggesting that seed coating kills the majority of aphids (Table 11) (see also Esquivel et al. 2019). Second, we observed that virulent aphids have fitness costs on the aphid-susceptible refuge that give them disadvantages over biotype 1

(Table 11). Third, higher number of avirulent aphids on refuge and lower virulent aphids on the seed-treated Rag-soybean might increase the probability of avirulent populations to fly back to buckthorn (Rhamnus spp) where sexual mating occurs (Ragsdale et al. 2004) and increase the avirulent aphid population in the following generations.

3.5.3. Potential interactions between aphid-susceptible refuge and seed treatment with

natural enemies

Our experiments did not consider the effects that refuge could have on natural enemies and their benefits promoting pest control and resistance management (Schellhorn et al. 2008, Onstad et al.

2011, Onstad et al. 2013, Liu et al. 2014). However, we speculate that untreated refuge may enhance the assembly of natural enemies populations for pest control (see Lee et al. 2001), avoid potential toxicity via the food chain (see Camargo et al. 2017) , and avert abrupt depletions of natural enemy populations (see Seagraves and Lundgren 2012, and Regan et al. 2017). If an untreated refuge has substantial contributions to one or more of the soybean aphid natural enemies (see Ragsdale et a. 2011) we speculate that: 1) establishment of biological control on the refuge will provide control over early-arriving virulent soybean aphid populations on the Rag- soybean; 2) the amended natural enemy population will provide soybean aphid control when insecticidal protection from seed treatment subsides in Rag-soybean, and 3) biological control could limit our ability to manage virulence, if mortality of the avirulent soybean aphid on the

79 untreated refuge exceed desirable levels. Moreover, how the refuge is deployed (block, strips, interspersed) has important effects on interactions between biological control and their prey/hosts (Wilhoit 1991, Onstad et al. 2011). To date, it is unknown how refuge and seed treatment should be deployed in the field to promote biological control in favor of soybean aphid control and virulence management.

3.6. Conclusions and significance

To our knowledge, this is the first report elucidating the effects of aphid-susceptible refuge and an insecticidal seed treatment on the virulence frequency and fitness of virulent aphids, in comparison with avirulent aphids. Under our experimental conditions using seed-treated Rag- soybean and untreated refuge (as in treatment SRt), virulence frequency and fitness of virulent aphids showed substantial decreases in comparison with other treatments. The inclusion of seed treatment in combination with refuge could improve management of soybean aphid virulence and extend the durability of Rag-soybean. However, future experiments under field conditions including natural enemies are needed for a better understanding of the economic impacts these practices could have on the control soybean aphid virulence.

80 3.7. Figures and tables

Figure 8. Band visualization of the DNA ladder (left) and the amplicon (red lines and amplicon size in bp) for the molecular genotyping of biotype 1 (middle) and biotype 4 (right).

81

Figure 9. Total aphid count of biotype 1 (black line-circles) and biotype 4 (red line-squares) one week after infestation soybean plants at 7, 14, 21, 28, 35, and 42 days after planting (DAP). All experimental units were planted with 25% aphid-susceptible an 75% Rag-soybean. Soybeans were either seed coated or remained untreated as follows: A) aphid-susceptible soybean untreated, Rag-soybean untreated (SR); B) aphid-susceptible soybean untreated, Rag-soybean treated (SRt); C) aphid-susceptible soybean treated, Rag-soybean untreated (StR); and D) aphid- susceptible soybean treated, Rag-soybean seeds treated (StRt). Bars represent the standard error of the mean. Asterisks indicate significant differences between biotype population size based on Tukey’s HSD (α = 0.05). The numbers above bars or asterisks indicate the ‘virulence index’ estimated at each time DAP time point.

82

Table 10. Analysis of variance of treatment, plant type (aphid-susceptible or Rag-soybean), biotype and plant age main effects and their interactions on the pcp values of soybean aphids.

Effect DF F-value P-value Plant age 5 10.73 < 0.05 Treatment 3 62.56 < 0.05 Plant type 1 107.18 < 0.05 Biotype 1 0.83 0.3636

Treatment ´ Plant type ´ Biotype 10 20.46 < 0.05

Plant age ´ Treatment ´ Plant type ´ Biotype 75 2.38 < 0.05

83

Table 11. Comparison of the per capita progeny (pcp) (±SEM) values of biotype 1 or biotype 4 soybean aphids between treatments (SR, SRt, StR, and StRt) when fed on aphid-susceptible (S) or Rag-soybean (R) at 7, 14, 21, 28, 35, and 42 days after planting (DAP). Soybeans were either seed coated or remained untreated as follows: A) aphid-susceptible soybean untreated, Rag- resistant soybean untreated (SR); B) aphid-susceptible soybean untreated, Rag-soybean treated (SRt); C) aphid-susceptible soybean treated, Rag-soybean untreated (StR); and D) aphid- susceptible soybean treated, Rag-soybean treated (StRt). Means within plant type (aphid- susceptible or Rag-soybean) column followed by different letter indicates significant difference between treatments (SR, SRt, StR, and StRt), Tukey’s HSD (α = 0.05). Biotype 1 Biotype 4 Treatment Aphid-susceptible Rag-soybean Aphid-susceptible Rag-soybean 7 DAP SR 19.76±2.31a 0.46±0.21b 8.80±3.42a 6.97±1.19a SRt 14.73±5.22a 0.06±0.04b 9.08±1.6a 0.08±0.04b StR 0.00±0.00b 1.48±0.31a 0.03±0.03b 8.08±0.84a StRt 0.00±0.00b 0.01±0.01b 0.03±0.03b 0.05±0.03b 14 DAP SR 7.93±2.58a 0.32±0.13a 3.50±2.20a 2.52±0.88a SRt 4.44±1.29ab 0.00±0.00b 2.84±0.93a 0.00±0.00b StR 0.00±0.00b 0.25±0.07ab 0.03±0.03a 1.57±0.12ab StRt 0.00±0.00b 0.00±0.00b 0.00±0.00a 0.01±0.01b 21 DAP SR 8.06±1.33a 0.37±0.11a 4.04±1.73a 2.22±0.50ab SRt 3.38±1.27b 0.03±0.03a 1.56±0.91a 0.33±0.24bc StR 1.17±0.89b 0.41±0.22a 1.30±1.22a 2.68±0.85a StRt 0.09±0.06b 0.00±0.00a 0.16±0.06a 0.00±0.00c 28 DAP SR 9.45±3.46a 1.38±0.57a 3.99±1.59a 5.14±0.44a SRt 2.88±0.80ab 0.14±0.05b 4.78±2.40a 2.43±1.10ab StR 2.36±0.84ab 0.22±0.08b 1.36±0.26a 3.36±1.02ab StRt 1.51±0.81b 0.02±0.02b 0.90±0.40a 0.08±0.05b 35 DAP SR 7.71±2.00a 1.78±0.41a 5.67±1.15a 4.43±0.65a SRt 4.55±1.68a 0.07±0.03b 2.70±1.27a 0.66±0.50b StR 3.51±1.10a 0.38±0.20b 3.64±1.72a 2.45±0.73ab StRt 4.43±1.67a 0.33±0.20b 1.72±0.64a 1.37±0.69b 42 DAP SR 14.38±3.87a 0.45±0.10a 7.37±1.72a 3.41±1.05a SRt 6.82±2.67ab 0.09±0.06a 1.21±1.04b 1.52±0.49a StR 4.42±2.55ab 0.47±0.30a 1.17±0.46b 2.36±1.49a StRt 0.90±0.52b 0.06±0.06a 1.76±1.23b 0.19±0.15a

84 3.8. References cited

Alt, J., and M. Ryan-Mahmutagic. 2013. Soybean aphid biotype 4 identified. Crop Science 53. Bates, S. L., J. Z. Zhao, R. T. Roush, and A. M. Shelton. 2005. Insect resistance management in GM crops: past, present and future. Nature Biotechnology 23: 57-62. Bourguet, D., M. Desquilbet, and S. Lemarie. 2005. Regulating insect resistance management: the case of non-Bt corn refuges in the US. Journal of Environmental Management 76: 210-220. Camargo, C., T. E. Hunt, L. J. Giesler, and B. D. Siegfried. 2017. Thiamethoxam toxicity and effects on consumption behavior in Orius insidiosus (Hemiptera: Anthocoridae) on soybean. Environmental Entomology 46: 693-699. Carriere, Y., and B. E. Tabashnik. 2001. Reversing insect adaptation to transgenic insecticidal plants. Proceedings of the Royal Society B: Biological Sciences 268: 1475-1480. Cooper, S. G., V. Concibido, R. Estes, D. Hunt, G.-L. Jiang, C. Krupke, B. McCornack, R. Mian, M. O’Neal, V. Poysa, D. Prischmann-Voldseth, D. Ragsdale, N. Tinsley, and D. Wang. 2015. Geographic distribution of soybean aphid biotypes in the United States and Canada during 2008–2010. Crop Science 55. Costamagna, A. C., W. van der Werf, F. J. J. A. Bianchi, and D. A. Landis. 2007. An exponential growth model with decreasing r captures bottom-up effects on the population growth of Aphis glycines Matsumura (Hemiptera: Aphididae). Agricultural and Forest Entomology 9: 297-305. Douglas, M. R., and J. F. Tooker. 2015. Large-scale deployment of seed treatments has driven rapid increase in use of neonicotinoid insecticides and preemptive pest management in US field crops. Environmental Science and Technology 49: 5088-5097. Eigenbrode, S. D., and J. T. Trumble. 1994. Host-plant resistance to insects in integrated pest- management in vegetable crops. Journal of Agricultural Entomology 11: 201-224. Esquivel, C. J., C. M. Ranger, P. L. Phelan, E. J. Martinez, W. H. Hendrix, L. A. Canas, and A. P. Michel. 2019. Weekly survivorship curves of soybean aphid biotypes 1 and 4 on insecticidal seed-treated soybean. Journal of Economic Entomology 112: 712-719. Georghiou, G. P., and C. E. Taylor. 1977. Genetic and biological influences in the evolution of insecticide resistance. Journal of Economic Entomology 70: 319-323. Gould, F. 1998. Sustainability of transgenic insecticidal cultivars: integrating pest genetics and ecology. Annual Review of Entomology 43: 701-726. Guedes, R. N., G. Smagghe, J. D. Stark, and N. Desneux. 2016. Pesticide-induced stress in arthropod pests for optimized integrated pest management programs. Annual Review of Entomology 61: 43-62. Hanson, A. A., and R. L. Koch. 2018. Interactions of host-plant resistance and foliar insecticides for soybean aphid management. Crop Protection 112: 232-238. Hanson, A. A., J. Menger-Anderson, C. Silverstein, B. D. Potter, I. V. MacRae, E. W. Hodgson, and R. L. Koch. 2017. Evidence for soybean aphid (Hemiptera: Aphididae) 85 resistance to pyrethroid insecticides in the upper midwestern United States. Journal of Economic Entomology 110: 2235-2246. Hill, C. B., L. Yan, and G. L. Hartman. 2004. Resistance to the soybean aphid in soybean germplasm. Crop Science 44. Hill, C. B., Y. Li, and G. L. Hartman. 2006. A single dominant gene for resistance to the soybean aphid in the soybean cultivar Dowling. Crop Science 46. Hill, C. B., L. Yan, and G. L. Hartman. 2007. Soybean aphid resistance in soybean Jackson is controlled by a single dominant gene. Crop Science 47. Hill, C. B., A. Chirumamilla, and G. L. Hartman. 2012. Resistance and virulence in the soybean Aphis glycines interaction. Euphytica: International Journal of Plant Breeding 186: 635-646. Hill, C. B., L. Crull, T. K. Herman, D. J. Voegtlin, and G. L. Hartman. 2010. A new soybean aphid (Hemiptera: Aphididae) biotype identified. Journal of Economic Entomology 103: 509-515. Hurley, T., and P. Mitchell. 2017. Value of neonicotinoid seed treatments to US soybean farmers. Pest Management Science 73: 102-112. Hutchison, W. D., E. C. Burkness, P. D. Mitchell, R. D. Moon, T. W. Leslie, S. J. Fleischer, M. Abrahamson, K. L. Hamilton, K. L. Steffey, M. E. Gray, R. L. Hellmich, L. V. Kaster, T. E. Hunt, R. J. Wright, K. Pecinovsky, T. L. Rabaey, B. R. Flood, and E. S. Raun. 2010. Areawide suppression of European corn borer with Bt maize reaps savings to non-Bt maize growers. Science 330: 222-225. Kandel, D. R., K. J. Tilmon, and T. L. Shuster. 2015. Effect of host plant resistance and seed treatments on soybean aphids (Hemiptera: Aphididae) and their natural enemies. Journal of Entomological Science 50: 186-205. Kim, K.-S., C. B. Hill, G. L. Hartman, M. A. R. Mian, and B. W. Diers. 2008. Discovery of soybean aphid biotypes. Crop Science 48. Koch, R. L., E. W. Hodgson, J. J. Knodel, A. J. Varenhorst, and B. D. Potter. 2018. Management of insecticide-resistant soybean aphids in the upper midwest of the United States. Journal of Integrated Pest Management 9. Lee, J. C., F. B. Menalled, and D. A. Landis. 2001. Refuge habitats modify impact of insecticide disturbance on carabid beetle communities. Journal of Applied Ecology 38: 472-483. Liu, X., M. Chen, H. L. Collins, D. W. Onstad, R. T. Roush, Q. Zhang, E. D. Earle, and A. M. Shelton. 2014. Natural enemies delay insect resistance to Bt crops. PLoS One 9: e90366. McCarville, M. T., and M. E. O'Neal. 2013. Soybean aphid (Aphididae: Hemiptera) population growth as affected by host plant resistance and an insecticidal seed treatment. Journal of Economic Entomology 106: 1302-1309.

86 McCarville, M. T., E. W. Hodgson, and M. O’Neal. 2012. Soybean aphid-resistant soybean varieties for Iowa. Iowa State University Extension and Outreach, Ames. IA, USA. Onstad, D. W., X. X. Liu, M. Chen, R. Roush, and A. M. Shelton. 2013. Modeling the integration of parasitoid, insecticide, and transgenic insecticidal crop for the long-term control of an insect pest. Journal of Economic Entomology 106: 1103-1111. Onstad, D. W., P. D. Mitchell, T. M. Hurley, J. G. Lundgren, R. P. Porter, C. H. Krupke, J. L. Spencer, C. D. Difonzo, T. S. Baute, R. L. Hellmich, L. L. Buschman, W. D. Hutchison, and J. F. Tooker. 2011. Seeds of change: corn seed mixtures for resistance management and integrated pest management. Journal of Economic Entomology 104: 343-352. Orantes, L. C., W. Zhang, M. A. Mian, and A. P. Michel. 2012. Maintaining genetic diversity and population panmixia through dispersal and not gene flow in a holocyclic heteroecious aphid species. Heredity (Edinb) 109: 127-134. Quisenberry, S. S., and D. J. Schotzko. 1994. Integration of plant-resistance with pest- management methods in crop production systems. Journal of Agricultural Entomology 11: 279-290. Ragsdale, D. W., D. J. Voegtlin, and R. J. O'Neil. 2004. Soybean aphid biology in North America. Annals of the Entomological Society of America 97: 204-208. Ragsdale, D. W., D. A. Landis, J. Brodeur, G. E. Heimpel, and N. Desneux. 2011. Ecology and management of the soybean aphid in North America. Annual Review of Entomology 56: 375-399. Ragsdale, D. W., B. P. McCornack, R. C. Venette, B. D. Potter, I. V. MacRae, E. W. Hodgson, M. E. O’Neal, K. D. Johnson, R. J. O’Neil, C. D. DiFonzo, T. E. Hunt, P. A. Glogoza, and E. M. Cullen. 2007. Economic threshold for soybean aphid (Hemiptera: Aphididae). Journal of Economic Entomology 100: 1258-1267. Regan, K., D. Ordosch, K. D. Glover, K. J. Tilmon, and A. Szczepaniec. 2017. Effects of a pyrethroid and two neonicotinoid insecticides on population dynamics of key pests of soybean and abundance of their natural enemies. Crop Protection 98: 24-32. Rutledge, C. E., and R. J. O’Neil. 2006. Soybean plant stage and population growth of soybean aphid. Journal of Economic Entomology 99: 60-66. Schellhorn, N. A., J. Bellati, C. A. Paull, and L. Maratos. 2008. Parasitoid and moth movement from refuge to crop. Basic and Applied Ecology 9: 691-700. Schmidt, N. P., M. E. O'Neal, P. F. Anderson, D. Lagos, D. Voegtlin, W. Bailey, P. Caragea, E. Cullen, C. DiFonzo, K. Elliott, C. Gratton, D. Johnson, C. H. Krupke, B. McCornack, R. O'Neil, D. W. Ragsdale, K. J. Tilmon, and J. Whitworth. 2012. Spatial distribution of Aphis glycines (Hemiptera: Aphididae): A summary of the suction trap network. Journal of Economic Entomology 105: 259-271. Seagraves, M. P., and J. G. Lundgren. 2012. Effects of neonicitinoid seed treatments on soybean aphid and its natural enemies. Journal of Pest Science 85: 125-132.

87 Tabashnik, B. E., T. Brevault, and Y. Carriere. 2013. Insect resistance to Bt crops: lessons from the first billion acres. Nature Biotechnology 31: 510-521. van den Berg, H., D. Ankasah, A. Muhammad, R. Rusli, H. A. Widayanto, H. B. Wirasto, and I. Yully. 1997. Evaluating the role of predation in population fluctuations of the soybean aphid Aphis glycines in farmers' fields in Indonesia. Journal of Applied Ecology 34: 971-984. Varenhorst, A. J., and M. E. O'Neal. 2016. The effect of an interspersed refuge on Aphis glycines (Hemiptera: Aphididae), their natural enemies, and biological control. Journal of Economic Entomology 109: 406-415. Varenhorst, A. J., M. T. McCarville, and M. E. O'Neal. 2015. Reduced fitness of virulent Aphis glycines (Hemiptera: Aphididae) biotypes may influence the longevity of resistance genes in soybean. PLoS One 10: e0138252. Wenger, J., M. Ramstad, M. A. R. Mian, and A. Michel. 2014. The use of refuge in host plant resistance systems for the control of virulent biotype adaptation in the soybean aphid (Hemiptera: Aphididae). Journal of Economic Entomology 107: 1599-1609. Wenger, J. A., and A. P. Michel. 2013. Implementing an evolutionary framework for understanding genetic relationships of phenotypically defined insect biotypes in the invasive soybean aphid (Aphis glycines). Evolutionary Applications 6: 1041-1053. Wenger, J. A., B. J. Cassone, F. Legeai, J. S. Johnston, R. Bansal, A. D. Yates, B. S. Coates, V. A. C. Pavinato, and A. Michel. 2017. Whole genome sequence of the soybean aphid, Aphis glycines. Insect Biochemistry and Molecular Biology. Wilhoit, L. R. 1991. Modeling the population-dynamics of different aphid genotypes in plant variety mixtures. Ecological Modelling 55: 257-283.

88 Chapter 4: Thiamethoxam differentially impacts longevity on insidiosus flower bug and

convergent lady beetle when exposed via the food chain

4.1. Abstract

The ecological impact of new insecticides on nontarget organisms is not well understood, especially for predators feeding on prey exposed to insecticides via the food chain. Insect predators are seldom included on toxicological trophic assessments for either older or newer insecticide chemistries. Neonicotinoids are modern systemic insecticides widely used in agriculture to control herbivore insects (e.g. aphids), but their effects on predatory insects along the food chain remains scarcely investigated. Therefore, we aimed to characterize the effects of the neonicotinoid thiamethoxam on the longevity of two important predators, the convergent lady beetle and the insidiosus flower bug, when exposed via the food chain. These predators fed on prey (i.e. aphids) exposed to thiamethoxam treated plants of different maturity (i.e. weekly for

5 weeks). We hypothesized that the life span of the two predators would be shorter when fed on thiamethoxam-exposed aphids. We found that the life span of the convergent lady beetle was not reduced, whereas the life span of the insidious flower bugs was indeed significantly decreased.

The effect was observed until 4 weeks after treatment or planting. Our work suggests that systemic applications of thiamethoxam are compatible with convergent lady beetles, but only at certain times for insidiosus flower bugs. These findings are critical for the development of future pest control programs that integrate biological and chemical control.

89 4.2. Introduction

A frequent consequence of insecticide use is their detrimental effects to non-target organisms.

Historically, older insecticides (e.g. DDT, ) have harmed several non-target predatory organisms via the food chain through contaminated prey (Risebrough et al. 1967, Hargrave et al.

1992, Vos et al. 2000). Currently, there are over 200 insecticide molecules registered in the

United States (E.P.A. 2017) that could have adverse effects on predators through the food chain for which we have limited to no information. This list includes the neonicotinoids (Group 4A,

Insecticide Resistance Action Committee), which represent around a quarter of the total insecticide sales worldwide (Casida and Durkin 2013, Simon-Delso et al. 2015). However, additional scrutiny on the off-target impacts of neonicotinoids are concurrently increasing with the popularity of this group (Pisa et al. 2015).

Thiamethoxam is a common neonicotinoid used in agriculture as either seed treatment or drench for the control of sap feeders (e.g. aphids) and other insect pests (Maienfisch et al. 2001,

Jeschke et al. 2011, North et al. 2016, Krupke et al. 2017). Previous research associated thiamethoxam to disruptive effects in predatory natural enemies via the food chain. For example, the ground beetle Chlaenius tricolor Dejean (Coleoptera: Carabidae) and the vedalia beetle

(Rodolia cardinalis) (Mulsant) (Coleoptera: Coccinellidae) showed increased mortality when fed on prey that accumulated thiamethoxam obtained from treated plants (Grafton-Cardwell and Gu

2003, Douglas et al. 2015). These studies demonstrated that prey (i.e. slug, cottony cushion scale) served as a biological bridge for thiamethoxam to move from treated plants to predators.

However, thiamethoxam residues in plants grown from treated seeds or from plants receiving soil applications remain bioactive against target pests for several weeks (Castle et al. 2005, Diez-

Rodriguez et al. 2006, McCornack and Ragsdale 2006, Seagraves and Lundgren 2012,

90 McCarville and O'Neal 2013, Qureshi et al. 2014, Krupke et al. 2017, Esquivel et al. 2019).

Intriguingly, no study has measured the longevity of the biological bridge and how the duration of this toxicity window may impact predatory natural enemies. Evaluating the consequences of residual thiamethoxam on natural enemies via the food chain could provide critical insights to integrate the use of thiamethoxam and biological control agents.

Protecting biological control is critical for pest management and minimize economic losses in natural and agricultural ecosystems (van Lenteren and Woets 1988, van Lenteren 1992,

Flint et al. 1998, Rosenheim 1998, Schlapfer et al. 1999, Cardinale et al. 2003, Losey and

Vaughan 2006, Chagnon et al. 2015). Predatory natural enemies, such as lady beetles, consume insect pests in high numbers throughout their life cycle (Weber and Lundgren 2009, Hodek et al.

2012). One of the most abundant species within the U.S. is the convergent lady beetle

Hippodamia convergens Guérin-Méneville (Coleoptera: Coccinellidae), a natural enemy of soft- bodied insects, including several aphid species (Gardiner et al. 2009). Another important group of predatory natural enemies are the anthocoridae bugs. The insidiosus flower bug, Orius insidiosus (Say) (Hemiptera: Anthocoridae), is an active predator of small pest insects such as thrips and aphids (Mccaffrey and Horsburgh 1986). As part of an integrated pest management program, lady beetles and insidiosus flower bugs mitigate the economic impact of aphids and other pests in various agricultural landscapes (Fleschner 1961, Dixon et al. 1997, Rutledge and

O'Neil 2005, Desneux et al. 2006, Harwood et al. 2007, Bahy El-Din et al. 2013).

Aphids cause considerable damage to agronomic, ornamental and vegetable crops (Yano et al. 1983, Fuchs and Minzenmayer 1995, Blackman and Eastop 2000, Song et al. 2006). Within these diverse cropping systems, natural enemies and systemic insecticides provide control of aphid populations (Sweeden and McLeod 1997, Morita et al. 2007, Jeschke et al. 2011). Without

91 proper management, aphids can quickly increase populations (due to their asexual reproduction), transmit several plant viruses, and promote fungal infections (e.g. sooty mold) (Ebert 1997,

Radcliffe and Ragsdale 2002, Ng and Perry 2004, Tilmon et al. 2011). For instance, populations of the melon aphid Aphis gossypii Glover (Hemiptera: Aphididae) can exceed hundreds of individuals per plant in few days after infestation (Obrien et al. 1993, Weathersbee and Hardee

1994, Ebert 1997). Other aphid species, such as the soybean aphid Aphis glycines Matsumura

(Hemiptera: Aphididae) and the green peach aphid Myzus persicae (Sulzer) (Hemiptera:

Aphididae) have several generations in a single growing season (Blackman and Eastop 2000,

Ragsdale et al. 2004, Holman 2009).

We investigated the effects of thiamethoxam via the food chain in the convergent lady beetle and insidiosus flower bug using the soybean aphid, the green peach aphid, and the melon aphid as prey. Aphid cohorts were exposed to thiamethoxam-treated plants every week over the course of 5 weeks. After providing the aphids, the longevity of natural enemies was recorded under the hypotheses that 1) natural enemies feeding on aphids exposed to thiamethoxam-treated plants would have shorter longevity than preying on aphids from untreated plants; and 2) aphids feeding from plants at earlier time points after thiamethoxam treatment are more toxic to natural enemies than those feeding at later time points. In general, we found that thiamethoxam toxicity via food chain negatively affected insidiosus flower bugs, but not convergent lady beetles.

Moreover, we observed that aphids feeding on plants at earlier time points after thiamethoxam treatment are more toxic to insidiosus flower bugs than when fed on older plants. Our findings are fundamental to prevent negative effects on natural enemies under production systems where thiamethoxam and biological control agents overlap.

92 4.3. Materials and methods

4.3.1. Plant material

Soybean (Glycine max) L. seeds were Mycogen® (a subsidiary of Corteva Agriscience®

Indianapolis, IN) variety 5N248R2, treated with Cruiser Maxx® (Syngenta®, Greensboro, NC) containing thiamethoxam (56.3 g of active ingredient), and the fungicides mefenoxam (3.75 g of active ingredient) and fludioxonil (2.5 g of active ingredient), per 100 kg of seed. To obtain untreated seeds, we removed the treatment following the serial washing protocol utilized by

Esquivel et al. 2019. Three soybean seeds (treated or untreated) were planted into a plastic pot

(Kord Regal®, Toronto, Canada; 10.1 cm upper diameter, 7.6 cm lower diameter, 8.9 cm height) filled with soilless media Pro-Mix BX® (Québec, Canada). Pots were placed in a greenhouse and maintained at 25˚C, 16:8 h light:dark cycle, using an Argus® Control System –a Conviron®

Company (British Columbia, Canada). Soybeans were watered every day with the following drip irrigation schedule: 1) week 1–3, 34 mL per pot; 2) week 3–4, 60 mL per pot; 3) and week 4–5,

90 mL per pot. Fertilizer was applied via irrigation by diluting, in a 1:64 ratio, a solution of

121.13 g N, 52.49 g P2O5, and 121.13 g K2O in 7.57 L of water.

Zinnia seeds (Zinnia elegans) Jacq. were Purity White variety (BFG Co., Harrisonburg,

VA). Seeds were germinated at 25˚C with a 12:10 h light:dark cycle. At 10 days after germination, seedlings (one seedling per pot) were transplanted to a greenhouse under the same agronomic and environmental conditions used for soybean. Pots were placed in cages (47 cm height, 47 cm width, 89 cm length) made with fabric mesh U.S. #100 (Casa collection®, South

Korea). At 21 days after transplanting, plants were either drench-treated with thiamethoxam or remained untreated. A treated plant received a total of 100 mL of Flagship® 25WG solution (a.i.

93 thiamethoxam) (Syngenta®, Greensboro, NC) at 170 g of a.i. per 100 L of water. Plants were watered and fertilized following the same regimen for soybean.

Green peppers (Capsicum annuum) L. seeds were the Aristotle-X3R hybrid (Tomato

Growers Supply Co., Myers, FL). Seeds were germinated in organic soil at 25˚C with a 12:10 h light:dark cycle. At 10 days after germination, individual seedlings were transplanted to black growing plastic bags with a 10 cm upper diameter, 10 cm lower diameter, 10 cm height, and filled with organic soil media. Plants were kept under greenhouse conditions (27˚C, 12:10 h light:dark cycle) throughout the experiment. At 21 days after transplanting, plants were either drench-treated with thiamethoxam or remained untreated. Each treated plant received a total of

100 mL of Actara® 25WG solution (a.i. thiamethoxam) (Syngenta®, Greensboro, NC) at 170 g of a.i. per 100 L of water. Plants were watered and fertilized following the same regimen for soybean.

Soybean, zinnias, and green pepper plants were arranged in a factorial complete randomized design. The experimental unit for soybean and zinnias was ‘a planted pot’, whereas for green pepper was a ‘planted bag’. Factors were 1) insecticide treatment: ‘treated and untreated’, and 2) days after planting (for soybean) or days after drench treatments (for zinnias and green peppers) when aphid cohorts were placed on plants: ‘7, 14, 21, 28, and 35 days’.

Treatments for all crops were replicated 10 times.

4.3.2. Aphid colonies and thiamethoxam exposure

Soybean aphids ‘biotype 1’ were reared on Williams 82 soybean in the Michel Laboratory at the

Ohio Agricultural Research and Development Center (OARDC), The Ohio State University

(OSU), Wooster, Ohio. Green peach aphids were reared on Waltham broccoli cultivar (Brassica

94 oleracea) L. (BFG Supply Co., Harrisonburg, VA) in the Canas Laboratory, OARDC, OSU,

Wooster, Ohio. The melon aphid was obtained from field collections (14˚00’29.81” N;

87˚00’12.13” W, 782 m elevation) in May of 2017 and reared at the Biological Control

Department facilities of the Escuela Agrícola Panamericana (EAP), El Zamorano, Honduras.

Melon aphids were reared on Aristotle-X3R hybrid green peppers (Capsicum annuum) L.

Soybean and green peach aphid were kept at 25˚C, with 16:8 h light:dark cycle, whereas melon aphids at 25˚C, with 12:12 h light:dark cycle. We age-synchronized all aphid species by transferring adults to detached leaves in customized petri dishes. Adults were removed 48 h later, leaving nymphs behind. Nymphs remained on the leaf until they reached 7 days of age (e.g. adult stage) at which time they were used for experiments. Petri dishes for age synchronization were

100 ´ 25 mm in size and filled ~40% with DAP® Plaster of Paris (DAP®, Baltimore, MD) and

2320 ppm of activated charcoal (Sigma-Aldrich, St. Louis, MO). The plaster surface was covered with a 9-cm diameter WhatmanTM filter paper #1 (GE Healthcare®, Chicago, IL). We added deionized water to the plaster and filter paper until saturation to preserve leaf freshness.

Aphids were then transferred to detached leaves collected from treatment plants at 7, 14, 21, 28, and 35 days after treatment/planting. Using a fine-haired paintbrush, a total of 50, 7-days old adult aphids were placed on the underside of the detached leaf. Soybean aphid, green peach aphid and melon aphids fed on leaves of soybean, zinnia, and green pepper, respectively.

Detached leaves with aphids were kept in the petri dishes for 24 h. Aphids were then transferred to insecticide-free leaves (see below) to serve as prey of the natural enemy feeding bioassay.

95 4.3.3. Natural enemy colonies

Experiments performed at OARDC used the convergent lady beetles and insidiosus flower bugs purchased from ARBICO-Organics® (Tuczon, AZ) and Rincon-Vitova® (Ventura, CA), respectively. Upon arrival to OARDC, convergent lady beetles and insidiosus flower bugs fed on green peach until needed for the experiment. Experiments at the EAP in Honduras used a colony of insidiosus flower bugs reared on eggs of the Mediterranean flour moth Ephestia kuehniella

(Zeller) (Lepidoptera: Pyralidae) at controlled conditions (21˚C, 12:12 h light:dark cycle). All colonies were constantly supplied with 10% sucrose-soaked cotton wicks.

4.3.4. Predation of aphids by natural enemies

The sugar solution and prey were removed from the predatory natural enemies 24 h prior to the experiment. Sexing of convergent lady beetles and insidiosus flower bugs adults was initiated by collecting adults with mouth-operated aspirators (BioQuip®, Rancho Dominguez, CA) and anesthetized with CO2 gas and ice for 10 min. While stunned, males and females were sorted by observing their abdominal dimorphism distinctions (note: no sexing of insidiosus flower bugs was performed for the experiment at the EAP). For the predation trials, each customized petri dish contained a soybean, zinnia, or green pepper insecticide-free leaf, on which we transferred either a female insidiosus flower bug with 20 aphids, or a female convergent lady beetle with 30 aphids. Convergent lady beetles preyed on either soybean aphids or green peach aphids, whereas insidiosus flower bugs preyed on soybean aphids or melon aphids.

After 24 h of convergent lady beetles feeding, the remaining aphids were counted to estimate predation and then removed from the petri dish. Factorial ANOVA analysis and Tukey

HSD post-hoc test with 95% family wise confidence was used to compare the number of aphids

96 eaten per convergent lady beetle. Similarly, after 24 h of insidiosus flower bugs feeding, alive and dead aphids were counted and removed from the petri dish. The number of dead aphids and aphid predation by insidiosus flower bugs were recorded only for the experiment at the OARDC

(soybean – soybean aphid). Aphid predation by insidiosus flower bugs was confirmed via molecular gut analysis since the physical aperture left by its piercing mouthparts in the soft- exoskeleton of aphids was not constantly visible. Mean comparison between treatments of soybean aphid mortality by insidiosus flower bugs was done using a Factorial ANOVA Tukey

HSD post-hoc test with 95% family wise confidence. Mean comparison between treatments of the molecular gut analysis of insidiosus flower bugs (i.e. soybean aphid predation) was done using the Student’s T-test.

After aphid removal from the leaves, the survival of both the lady beetles and the insidiosus flower bugs was recorded every day for the following 7 days. Natural enemies were considered dead if no movement was observed within 10 min after gently touched with a fine- haired paintbrush. Longevity of both natural enemies was assessed using survival analysis based on the non-parametric Kaplan-Meier estimator (Kaplan and Meier 1958) under the GraphPad

Prism Version 6 platform (GraphPad Software Inc., La Jolla, CA).

4.3.5. Molecular gut analysis of insidiosus flower bug

Insidiosus flower bugs were stored in 1.5 ml microcentrifuge tubes at -80˚C when found dead or collected after surviving 7 days. Soybean aphid predation was confirmed by a molecular gut analysis detecting the ‘soybean aphid cytochrome c oxidase 1’ (CO1) gene in insidiosus flower bugs. In brief, primers for the insidiosus flower bug and soybean aphid CO1 genes (accession numbers KR036545.1 and AY842503.1, respectively) were designed and purchased from

97 Thermo Fisher Scientific Inc. (Walthman, MA). Species specificity of primers was confirmed in silico with a standalone tBLASTx v2.2.31 (e-value <10-6) and in vitro via PCR/electrophoresis using genomic DNA from soybean aphids and insidiosus flower bugs. Insidiosus flower bug

CO1 primers generated amplicons of 230 base pairs (bp), whereas CO1 of soybean aphid primers generated amplicons of 450 bp. Samples without insidiosus flower bug CO1 amplification were discarded. Primer reverse and forward sequences are included in Table 12. Genomic DNA was extracted using the QIAGEN® DNease® Blood & Tissue Kit (Germantown, MD) following manufacturers protocol. Conventional PCR was performed by using 12.5 µL Promega® GoTaq

Green Master Mix (Madison, WI), 2 µL of 10 µM primer (forward and reverse), 2 µL of DNA, and 8.5 µL of nuclease-free water per reaction. The thermal cycler protocol was obtained from

(Harwood et al. 2007): denaturation for 4 min at 95˚C; 35 cycles of 10 sec at 95˚C, 30 sec at

55˚C, 30 sec at 72˚C; and 5 min at 72˚C. A total of 5 µL of the PCR reaction was electrophoresed on an 1.5% agarose gel, including 0.5X TAE and GelRed® (Biotium Inc.,

Fremont, CA). Electrophoresis occurred for 35 min at 75 mV. Soybean aphid CO1 amplification in insidiosus flower bug gut was confirmed by band visualization with MYECLTM Imager

(Thermo Fisher Scientific Inc., Walthman, MA).

4.4. Results

4.4.1. Predation and longevity of lady beetles

Across all treatments, convergent lady beetles consumed between 3–25 soybean aphids per female, with average of 8.93 ± 0.57 (Figure 10). We did not observe a statistical difference in the number of soybean aphids consumed between treatments (i.e. aphids fed on thiamethoxam- treated or untreated plants) at any of the time point after planting soybean (7, 14, 21, 28, and 35

98 DAP) (P-value ³ 0.05, df=90, F=0.92), with the exception of significant lower number of aphids consumed from thiamethoxam-treated soybean at 35 DAP (P-value < 0.05) (Figure 10).

Predation of green peach aphid across all treatments ranged between 4–27 green peach aphids per female. The average green peach aphid consumed per female was 17.8±0.47, nearly 2-fold higher than the average of soybean aphids eaten per individual (Figure 11). However, no statistical differences in the number of green peach aphids eaten per female was observed across all treatments (P-value ³ 0.05, df=90, F=2.26) (Figure 11).

Longevity of lady beetles preying on soybean aphids ranged between 1–7 days, with average of 6.18±0.18 days. No significant difference in the longevity of lady beetles was found between treatments (i.e. aphids fed on thiamethoxam-treated or untreated plants) across all time points (7, 14, 21, 28, and 35 DAP) (P-value ³ 0.05, Kaplan-Meier estimator) (Figure 12).

Longevity of lady beetles preying on green peach aphid across all treatments also ranged between 1–7 days, but with a slightly lower average of 5.05±0.2 days. No significant difference was observed in longevity of lady beetles feeding on green peach aphids across all treatments and time points (P-value ³ 0.05, Kaplan-Meier estimator) (Figure 13).

4.4.2. Predation and longevity of the insidiosus flower bug

Across all treatments, soybean aphid mortality after exposure to insidiosus flower bugs was between 0–90%, with an average of 20.5%±1.51. Soybean aphids from treated soybean had an average mortality of 28.4%±2.15, significantly higher than average mortality of 12.7%±1.43 observed at soybean aphids from untreated plants (P < 0.05, df=90, F=52.88) (Figure 17).

Moreover, aphid predation by insidiosus flower bugs was confirmed by molecular gut analysis,

99 but due to poor quality of DNA extracted, samples from 7 DAP were discarded. Across all treatments (i.e. aphids fed on thiamethoxam-treated or untreated plants) and time points (14, 21,

28, and 35 DAP), the percentage of insidiosus flower bugs detected with the soybean aphid CO1 ranged between 60–100%, with average of 80%±5.34 (Figure 14). We did not observe statistical differences in percentage of insidiosus flower bugs detected with soybean aphid CO1 between treatments across all time points (P ³ 0.05).

Longevity of insidiosus flower bugs on soybean aphid across all treatments ranged between 0–7 days, with an average of 3.49±0.22 days (Figure 15). Although not evaluated statistically, insidiosus flower bugs tended to have narrower longevity range of 1–5 days when preying on melon aphids, and a slightly lower average of 2.32±0.1 days than preying on soybean aphids (Figure 15 and Figure 16). We observed a significant reduction in longevity of insidiosus flower bugs when fed on aphids from treated plants, in comparison to insidiosus flower bugs feeding on aphids from untreated plants. Longevity reductions of 2.1, 3.6 and 1.3 days occurred when insidiosus flower bugs fed on soybean aphids from 14, 21, and 28 DAP treated soybean, respectively (Figure 15); whereas longevity reductions of 1.1, 1.1, and 1.6 days were observed when insidiosus flower bug fed on melon aphid from green peppers at 7, 14, and 21 days after thiamethoxam-drench treatment, respectively (P < 0.05, Kaplan-Meier estimator) (Figure 16).

No reduction in longevity of insidiosus flower bugs was observed at 35 days after treatment, regardless of the aphid species they preyed upon (P-value ³ 0.05, Kaplan-Meier estimator)

(Figure 15 and Figure 16).

100 4.5. Discussion

Most neonicotinoids, including thiamethoxam, are considered safe insecticides for biological control agents (Mizell and Sconyers 1992, Ohnesorg et al. 2009, Gontijo et al. 2014). Its application mode (e.g. seed coating, root drench) and movement within the plant typically limit insecticide exposure to insects that consume plant tissue or plant products (Mizell and Sconyers

1992, Pisa et al. 2015). Nonetheless, natural enemies (i.e. predatory insects), could be impaired when they feed upon prey that consumed thiamethoxam-treated plants (i.e. trophic food chain)

(Grafton-Cardwell and Gu 2003, Douglas et al. 2015). These studies focused on the effects of thiamethoxam on natural enemies at early time points after plant treatment, when presumably insecticide concentration within plants is still high (see Castle et al. 2005; Esquivel et al. 2019;

Krupke et a. 2017). However, thiamethoxam has several weeks of insecticidal bioactivity after treatment (Castle et al. 2005, Diez-Rodriguez et al. 2006, McCornack and Ragsdale 2006,

Seagraves and Lundgren 2012, McCarville and O'Neal 2013, Qureshi et al. 2014, Krupke et al.

2017, Esquivel et al. 2019) which may be toxic to predatory natural enemies when they feed on contaminated prey. Yet, evidence of thiamethoxam toxicity via food chain is 1) limited to few predatory natural enemy species, and 2) only available for early time points after thiamethoxam treatment. To expand our understanding the effect of thiamethoxam on natural enemies via food chain, we used aphids fed on thiamethoxam-treated plants at weekly intervals for 5 weeks as prey for the convergent lady beetle and the insidiosus flower bug. In brief, we found that aphid predation and longevity of lady beetles were not affected by consuming aphids from thiamethoxam-treated plants at any time point. Aphid predation by insidiosus flower bugs was also not affected; however, we observed significant reductions in longevity of insidiosus flower bugs when fed on aphids from early-treated plants.

101 Soybean and green peach aphid predation by convergent lady beetles did not vary significantly across treatments, suggesting that lady beetles do not discriminate between thiamethoxam-exposed or unexposed aphids. Moreover, the longevity of convergent lady beetles showed no significant difference when fed on thiamethoxam-exposed or unexposed aphids. The lack of decreased longevity could be associated with 1) limited ingestion of thiamethoxam by aphids as a result of reduced sap feeding on treated plants (see Daniels et al. 2009; Mowry et al.

2005), 2) insufficient consumption of aphids to reach a disruptive dose under bioassay conditions, considering that convergent lady beetles can consume over 30 aphids a day (Wells and McPherson 1999, Aristizábal 2014), and 3) convergent lady beetles are tolerant to thiamethoxam. Despite the fact that we do not have empirical evidence to test these possibilities, tolerance to thiamethoxam has been observed in other lady beetle species including the spotted lady beetle Coleomegilla maculata (Degeer) (Coleoptera: Coccinellidae), Asian lady beetle

Harmonia axyridis (Pallas) (Coleoptera: Coccinellidae) and the spotless lady beetle Cycloneda sanguinea (L.) (Coleoptera: Coccinellidae) (Youn et al. 2003, Bredeson et al. 2015, Fernandes et al. 2016, Wang et al. 2018). If the convergent lady beetle cannot obtain a thiamethoxam dose that causes disruptive effects via food chain, systemic applications of thiamethoxam could be performed in combination with releases of convergent lady beetles for aphid population management. The simultaneous use of insecticides and biological agents can be compatible, and even synergistic, against primary and secondary pests (see Abraham et al. 2013; Wright and

Verkerk 1995). However, to endorse whether the convergent lady beetle and thiamethoxan are compatible for pest control, it is necessary to develop further toxicological experiments through various exposure routes (e.g. topical applications, treated surfaces, injection of insecticide, releases in a treated area). Moreover, the convergent lady beetle has at least two genetically

102 distinctive populations within the U.S. (Sethuraman et al. 2015); therefore, toxicological trials should also include convergent lady beetle populations from different geographical sources, as their variation in genetics and selection pressure or exposure to thiamethoxam could provide distinctive degrees of tolerance to thiamethoxam.

In a similar manner, the percentage of insidiosus flower bugs that consumed soybean aphids did not differ among treatments, suggesting that exposure of soybean aphid to thiamethoxam-treated soybean does not induce avoidance by insidiosus flower bugs. Gut analysis was not performed for insidious flower bugs feeding on melon aphids, however, a similar non-discriminatory predation as with soybean aphid could be expected. Between treatments (i.e. aphids fed on thiamethoxam-treated or untreated plants), no significant difference was observed in longevity of insidiosus flower bugs preying on soybean aphids from 7 and 35

DAP soybean or preying on melon aphids from 28 and 35 days after treating green peppers. One factor in the lack of decreased longevity at 7 DAP could be reduced feeding on the nearly-dead soybean aphids from highly toxic treated soybean (Esquivel et al. 2019), since prey quality is critical for anthocoridae flower bug sustenance (Butler and O’Neil 2007, Sengonca et al. 2008).

At 28 and 35 DAP, the toxic window may have closed, as little to no thiamethoxam is present in plants (McCornack and Ragsdale 2006, Seagraves and Lundgren 2012, Huseth et al. 2014,

Krupke et al. 2017, Esquivel et al. 2019), longevity of insidiosus flower bugs was significantly shorter when preyed on soybean aphid from 14, 21, and 28 DAP seed-treated soybean or on melon aphid from 7, 14, 21 days after thiamethoxam-drench green peppers. The shortened longevity of insidious flower bugs feeding on aphids with thiamethoxam is likely caused by exposure to the low lethal dose needed due to their small body size and natural susceptibility to thiamethoxam. We understand, nonetheless, that the negative impact of thiamethoxam on

103 insidiosus flower bugs in our bioassay might not reflect the outcome in natural populations (see

Studebaker and Kring 2003). However, high toxicity of thiamethoxam to insidiosus flower bugs has also been documented under other experimental conditions. For instance, insidiosus flower bugs that preyed on greenbugs (Schizaphis graminum) (Rondani) (Hemiptera: Aphididae) fed on thiamethoxam-treated corn had higher mortality than greenbugs without thiamethoxam exposure

(Al-Deeb et al. 2001). Moreover, insidiosus flower bugs showed higher mortality when preyed on soybean aphids that fed on soybean leaves where the petiole was immersed in thiamethoxam solutions at 5 and 10 ng/mL of thiamethoxam for 24 h (Camargo et al. 2017). The strong consistency of our results from the two aphid systems (soybean aphid – soybean, and melon aphid – green peppers) suggests that 21–28 days after planting/treatment could be considered the toxic window for a biological bridge that transmits thiamethoxam effects to insidiosus flower bugs. Incidentally, this toxic window also resembles the duration when thiamethoxam is detected in plants after treatment in various agronomic scenarios (McCornack and Ragsdale 2006,

McCarville and O'Neal 2013, Qureshi et al. 2014, Krupke et al. 2017, Esquivel et al. 2019).

Our results suggest that convergent lady beetles and insidiosus flower bugs could be integrated with systemic applications of thiamethoxam. We suspect that early releases of convergent lady beetles, within the first 21 days after a thiamethoxam application, could complement pest management without having significant impact on their control services. At 28 days or later after thiamethoxam application, insidiosus flower bugs could be released to complement pest control, when presumably aphids no longer have lethal residues of thiamethoxam. Therefore, we consider that timing of natural enemy releases after thiamethoxam application is key to combine the benefits of biological and chemical control. Integration of pest management strategies, such as biological and chemical control, has been one of the fundamental

104 objectives of integrated pest management (Stern et al. 1959, van den Bosch and Stern 1962).

However, thiamethoxam applications and release of biological control agents should be carefully implemented and evaluated, since thiamethoxam and other systemic insecticides have been found to debilitate and/or disrupt populations of predatory natural enemies (Szczepaniec et al.

2011, Seagraves and Lundgren 2012). Other practices, such as use of untreated refugia, low pesticide dose, spatially-targeted insecticide applications, and insecticide-tolerant natural enemies are also recommended to minimize pesticide exposure to natural enemies (see Roubos et al. 2014). Conserving the invertebrate predator-prey associations is critical for the balance and sustainability of agricultural ecosystem services (Schlapfer et al. 1999, Cardinale et al. 2003,

Chagnon et al. 2015), and disturbances caused by insecticides could lead to losses in yield, aesthetics, profits and pest outbreaks (Shepard et al. 1977, Riley 1988, Hardin et al. 1995,

Dutcher 2007, Bommarco et al. 2011, Guedes et al. 2016, Hill et al. 2017).

105 4.6. Figures and tables

Figure 10. Number of soybean aphids eaten (± SEM) by convergent lady beetles within the first 24 h after feeding on soybean leaflets from untreated (U, white bar) or thiamethoxam-treated soybean (T, black bar). The 7, 14, 21, 28, and 35 at the ‘x axis’ are the time points, in days after planting, when soybean leaflets were collected for aphid feeding. Bars within the same time point followed by the same letter means no significant difference in number of aphids eaten by convergent lady beetles (Tukey HSD post-hoc test with a 95% family-wise confidence level, P- value ³ 0.05).

106

Figure 11. Number of green peach aphids eaten (± SEM) by convergent lady beetles within the first 24 h after feeding on zinnias leaves from untreated (U, white bars) or with thiamethoxam- treated plants (T, black bars). The 7, 14, 21, 28, and 35 at the ‘x axis’ are the time points, in days after treatment, when leaves from zinnias were collected for aphid feeding. Bars within the same time point followed by the same letter means no significant difference in number of aphids eaten by convergent lady beetles (Tukey HSD post-hoc test with a 95% family-wise confidence level, P-value ³ 0.05).

107

Figure 12. Longevity of convergent lady beetles (in days, ± SEM) when they preyed upon soybean aphids that fed on soybean plants from untreated-seeds (U, white bar) or from thiamethoxam-treated seeds (T, black bar). The 7, 14, 21, 28, and 35 at the ‘x axis’ are the time points, in days after planting, when soybean leaflets were collected for aphid feeding. Bars within the same time point followed by the same letter means no significant difference was found in convergent lady beetle longevity (Kaplan-Meier estimator, P-value ³ 0.05).

108

Figure 13. Longevity of convergent lady beetles (in days, ± SEM) when they preyed upon green peach aphids that fed on untreated (U, white bar) or thiamethoxam-treated zinnias (T, black bar). The 7, 14, 21, 28, and 35 at the ‘x axis’ are the time points, in days after treatment, when leaves from zinnias were collected for aphid feeding. Bars within the same time point followed by the same letter means no significant difference was found in convergent lady beetle longevity (Kaplan-Meier estimator, P-value ³ 0.05).

109

Figure 14. Percentages of insidiosus flower bugs within each treatment detected positive by molecular gut analysis for ‘soybean aphid CO1’ when fed on soybean aphids from untreated (U, white bars) or thiamethoxam-treated soybean (T, black bars). The 14, 21, 28, and 35 at the ‘x axis’ are the time points, in days after planting, when soybean leaflets were collected for aphid feeding. No SEM ranges are shown, since values of each bar represents the amount of insidiosus flower bugs positive with soybean aphid CO1. Bars within the same time point followed by the same letter means no significant difference in number of positive samples (Student’s T-test, P- value ³ 0.05).

110

Figure 15. Longevity of insidiosus flower bugs (in days, ± SEM) when they preyed upon soybean aphids that fed on soybean plants from thiamethoxam-treated seeds (T, black bar) or from untreated-seeds (U, white bar). The 7, 14, 21, 28, and 35 at the ‘x axis’ are the time points, in days after planting, when soybean leaflets were collected for aphid feeding. Bars within the same time point followed by the same letter means no significant difference was found in insidiosus flower bug longevity (Kaplan-Meier estimator, P-value ³ 0.05).

111

Figure 16. Longevity of insidiosus flower bugs (in days, ± SEM) when they preyed upon melon aphids that fed on untreated (U, white bar) or thiamethoxam-treated green pepper plants (T, black bar). The 7, 14, 21, 28, and 35 at the ‘x axis’ are the time points, in days after treatment, when leaves from green peppers were collected for aphid feeding. Bars within the same time point followed by the same letter means no significant difference was found in insidiosus flower bug longevity (Kaplan-Meier estimator, P-value ³ 0.05).

112

Figure 17. Percentage of soybean aphid mortality (± SEM) after feeding on soybean from untreated (U, white bar) or thiamethoxam-treated soybean (T, black bar) for 24 h and be then exposed to insidiosus flower bugs for another period of 24 h. Bars followed by the same letter means no significant difference in percentage of mortality (Tukey HSD post-hoc test with a 95% family-wise confidence level, P-value ³ 0.05).

Table 12. Forward and reverse oligo primers to amplify ‘cytochrome c oxidase 1’ (CO1) of insidiosus flower bug and soybean aphid. Oligo Primer Sequence Insidiosus flower bug CO1 Forward 5’–CACATAGAGGAGCATCAGTAG–3’ Insidiosus flower bug CO1 Reverse 5’–AGTTTCGATCTGTTAGGAGTATAG–3’ Soybean aphid CO1 Forward 5’–TTCTTCCAGGATTTGGATTA–3’ Soybean aphid CO1 Reverse 5’–CAGTGAATTAAACTGGCAAT–3’

113 4.7. References cited

Abraham, C. M., S. K. Braman, R. D. Oetting, and N. C. Hinkle. 2013. Pesticide compatibility with natural enemies for pest management in greenhouse gerbera daisies. Journal of Economic Entomology 106: 1590-1601. Al-Deeb, M. A., G. E. Wilde, and K. Y. Zhu. 2001. Effect of insecticides used in corn, sorghum, and alfalfa on the predator Orius insidiosus (Hemiptera: Anthocoridae). Journal of Economic Entomology 94: 1353-1360. Aristizábal, L. F. 2014. The convergetn lady beetle, Hippodamia convergens Guérin-Méneville (Insecta: Coleoptera: Coccinellidae), Featured Creatures. Department of Entomology and Nematology, University of Florida. Bahy El-Din, I. A., A. H. El-Heneidy, F. F. Shalaby, and A. A. Hafez. 2013. Evaluation of releasing the predator, Hippodamia convergens (geur.) (Coleoptera: Coccinellidae) against the cotton aphid, Aphis gossypii glover, infesting squash plants under semi-field conditions. Egyptian Journal of 23: 175-179. Blackman, R. L., and V. F. Eastop. 2000. Aphids on the world's crops: an identification and information guide, 2nd ed. ed. Wiley, Chichester, West Sussex, England. Bommarco, R., F. Miranda, H. Bylund, and C. Bjorkman. 2011. Insecticides suppress natural enemies and increase pest damage in cabbage. Journal of Economic Entomology 104: 782-791. Bredeson, M. M., R. N. Reese, and J. G. Lundgren. 2015. The effects of insecticide dose and herbivore density on tri-trophic effects of thiamethoxam in a system involving wheat, aphids, and ladybeetles. Crop Protection 69: 70-76. Butler, C. D., and R. J. O’Neil. 2007. Life history characteristics of Orius insidiosus (Say) fed Aphis glycines Matsumura. Biological Control 40: 333-338. Camargo, C., T. E. Hunt, L. J. Giesler, and B. D. Siegfried. 2017. Thiamethoxam toxicity and effects on consumption behavior in Orius insidiosus (Hemiptera: Anthocoridae) on soybean. Environmental Entomology 46: 693-699. Cardinale, B. J., C. T. Harvey, K. Gross, and A. R. Ives. 2003. Biodiversity and biocontrol: emergent impacts of a multi-enemy assemblage on pest suppression and crop yield in an agroecosystem. Ecology Letters 6: 857-865. Casida, J. E., and K. A. Durkin. 2013. Neuroactive insecticides: targets, selectivity, resistance, and secondary effects. Annual Review of Entomology 58: 99-117. Castle, S. J., F. J. Byrne, J. L. Bi, and N. C. Toscano. 2005. Spatial and temporal distribution of imidacloprid and thiamethoxam in citrus and impact on Homalodisca coagulata populations. Pest Management Science 61: 75-84. Chagnon, M., D. Kreutzweiser, E. A. Mitchell, E. A. Mitchell, C. A. Morrissey, D. A. Noome, D. A. Noome, J. P. Van der Sluijs, and J. P. Van der Sluijs. 2015. Risks of large-scale use of systemic insecticides to ecosystem functioning and services. Environmental Science and Pollution Research 22: 119-134.

114 Desneux, N., R. J. O'Neil, and H. J. S. Yoo. 2006. Suppression of population growth of the soybean aphid, Aphis glycines Matsumura, by predators: The identification of a key predator and the effects of prey dispersion, predator abundance, and temperature. Environmental Entomology 35: 1342-1349. Diez-Rodriguez, G. I., G. C. De Baptista, L. R. P. Trevizan, M. L. Haddad, and D. E. Nava. 2006. Residues of thiamethoxam, and its metabolites in coffee leaves and effect on the control of Leucoptera coffeella (Guerin-Meneville) (Lepidoptera: Lyonetiidae). Neotropical Entomology 35: 257-263. Dixon, A. F. G., J. L. Hemptinne, and P. Kindlmann. 1997. Effectiveness of ladybirds as biological control agents: Patterns and processes. Entomophaga 42: 71-83. Douglas, M. R., J. R. Rohr, and J. F. Tooker. 2015. Neonicotinoid insecticide travels through a soil food chain, disrupting biological control of non-target pests and decreasing soya bean yield. Journal of Applied Ecology 52: 250-260. Dutcher, J. D. 2007. A review of resurgence and replacement causing pest outbreaks in IPM, pp. 27-43. In A. Ciancio and K. G. Mukerji (eds.), General Concepts in Integrated Pest and Disease Management. Springer Netherlands, Dordrecht. E.P.A. 2017. Registration division conventional pesticides - Branch and product manager (PM) assignments. E.P.A. Ebert, T. A. 1997. Biology and ecology of Aphis gossypii Glover (Homoptera: Aphididae). The Southwestern Entomologist 22: 116-153. Esquivel, C. J., C. M. Ranger, P. L. Phelan, E. J. Martinez, W. H. Hendrix, L. A. Canas, and A. P. Michel. 2019. Weekly survivorship curves of soybean aphid biotypes 1 and 4 on insecticidal seed-treated soybean. Journal of Economic Entomology 112: 712-719. Fernandes, M. E. S., F. M. Alves, R. C. Pereira, L. A. Aquino, F. L. Fernandes, and J. C. Zanuncio. 2016. Lethal and sublethal effects of seven insecticides on three beneficial insects in laboratory assays and field trials. Chemosphere 156: 45-55. Fleschner, C. A. 1961. Biological control of insect pests. Journal of Applied Nutritrion 14: 154- &. Flint, M. L., S. H. Dreistadt, and J. K. Clark. 1998. Natural enemies handbook: the illustrated guide to biological pest control, UC Division of Agriculture and Natural Sciences; University of California Press, Oakland, Calif. Berkeley. Fuchs, T. W., and R. Minzenmayer. 1995. Effect of Aphis gossypii Homopera, Aphididae on cotton development and yield in west Texas. Southwestern Entomology 20: 341-349. Gardiner, M. M., D. A. Landis, C. Gratton, N. Schmidt, M. O'Neal, E. Mueller, J. Chacon, G. E. Heimpel, and C. D. DiFonzo. 2009. Landscape composition influences patterns of native and exotic lady beetle abundance. Diversity and Distributions 15: 554-564. Gontijo, P. C., V. F. Moscardini, J. P. Michaud, and G. A. Carvalho. 2014. Non-target effects of chlorantraniliprole and thiamethoxam on Chrysoperla carnea when employed as sunflower seed treatments. Journal of Pest Science 87: 711-719.

115 Grafton-Cardwell, E. E., and P. Gu. 2003. Conserving vedalia beetle, Rodolia cardinalis (Mulsant) (Coleoptera: Coccinellidae), in citrus: A continuing challenge as new insecticides gain registration. Journal of Economic Entomology 96: 1388-1398. Guedes, R. N., G. Smagghe, J. D. Stark, and N. Desneux. 2016. Pesticide-induced stress in arthropod pests for optimized integrated pest management programs. Annual Review of Entomology 61: 43-62. Hardin, M. R., B. Benrey, M. Coll, W. O. Lamp, G. K. Roderick, and P. Barbosa. 1995. Arthropod pest resurgence: An overview of potential mechanisms. Crop Protection 14: 3- 18. Hargrave, B. T., G. C. Harding, W. P. Vass, P. E. Erickson, B. R. Fowler, and V. Scott. 1992. Organochlorine pesticides and polychlorinated-biphenyls in the arctic-ocean food web. Archives of Environmental Contamination and Toxicology 22: 41-54. Harwood, J. D., N. Desneux, H. J. S. Yoo, D. L. Rowley, M. H. Greenstone, J. J. Obrycki, and R. J. O'Neil. 2007. Tracking the role of alternative prey in soybean aphid predation by Orius insidiosus: A molecular approach. Molecular Ecology 16: 4390-4400. Hill, M. P., S. Macfadyen, and M. A. Nash. 2017. Broad spectrum pesticide application alters natural enemy communities and may facilitate secondary pest outbreaks. Peerj 5. Hodek, I., A. Honěk, and H. F. Van Emden. 2012. Ecology and behaviour of the ladybird beetles (coccinellidae). John Wiley & Sons, Hoboken. Holman, J. 2009. Host plant catalog of aphids: Palaearctic region, Springer. Huseth, A. S., J. Lindholm, C. L. Groves, and R. L. Groves. 2014. Variable concentration of soil-applied insecticides in potato over time: implications for management of Leptinotarsa decemlineata. Pest Management Science 70: 1863-1871. Jeschke, P., R. Nauen, M. Schindler, and A. Elbert. 2011. Overview of the status and global strategy for neonicotinoids. Journal of Agricultural and Food Chemistry 59: 2897-2908. Kaplan, E. L., and P. Meier. 1958. Nonparametric-estimation from incomplete observations. Journal of the American Statsitical Association 53: 457-481. Krupke, C. H., A. M. Alford, E. M. Cullen, E. W. Hodgson, J. J. Knodel, B. McCornack, B. D. Potter, M. I. Spigler, K. Tilmon, and K. Welch. 2017. Assessing the value and pest management window provided by neonicotinoid seed treatments for management of soybean aphid (Aphis glycines Matsumura) in the upper midwestern United States. Pest Management Science 73: 2184-2193. Losey, J. E., and M. Vaughan. 2006. The economic value of ecological services provided by insects. Bioscience 56: 311-323. Maienfisch, P., M. Angst, F. Brandl, W. Fischer, D. Hofer, H. Kayser, W. Kobel, A. Rindlisbacher, R. Senn, A. Steinemann, and H. Widmer. 2001. Chemistry and biology of thiamethoxam: a second generation neonicotinoid. Pest Management Science 57: 906- 913.

116 Mccaffrey, J. P., and R. L. Horsburgh. 1986. Biology of Orius insidiosus (Heteroptera: Anthocoridae): A predator in Virginia apple orchards. Environmental Entomology 15: 984-988. McCarville, M. T., and M. E. O'Neal. 2013. Soybean aphid (Aphididae: Hemiptera) population growth as affected by host plant resistance and an insecticidal seed treatment. Journal of Economic Entomology 106: 1302-1309. McCornack, B., and D. W. Ragsdale. 2006. Efficacy of thiamethoxam to suppress soybean aphid populations in Minnesota soybean. Crop management. Mizell, R. F., and M. C. Sconyers. 1992. Toxicity of imidacloprid to selected arthropod predators in the laboratory. Florida Entomologist 75: 277-280. Morita, M., T. Ueda, T. Yoneda, T. Koyanagi, and T. Haga. 2007. Flonicamid, a novel insecticide with a rapid inhibitory effect on aphid feeding. Pest Management Science 63: 969-973. Mowry, T. M. 2005. Insecticidal reduction of Potato leafroll virus transmission by Myzus persicae. Annals of Applied Biology 146: 81-88. Ng, J. C. K., and K. L. Perry. 2004. Transmission of plant viruses by aphid vectors. Molecular Plant Pathology 5: 505-511. North, J. H., J. Gore, A. L. Catchot, S. D. Stewart, G. M. Lorenz, F. R. Musser, D. R. Cook, D. L. Kerns, and D. M. Dodds. 2016. Value of neonicotinoid insecticide seed treatments in mid-south soybean (Glycine max) production systems. Journal of Economic Entomology. Obrien, P. J., M. B. Stoetzel, R. C. Navasero, and J. B. Graves. 1993. Field biology studies of the cotton aphid, Aphis gossypii Glover (Homoptera, Aphididae). Southwestern Entomology 18: 25-35. Ohnesorg, W. J., K. D. Johnson, and M. E. O'Neal. 2009. Impact of reduced-risk insecticides on soybean aphid and associated natural enemies. Journal of Economic Entomology 102: 1816-1826. Pisa, L. W., V. Amaral-Rogers, L. P. Belzunces, J. M. Bonmatin, C. A. Downs, D. Goulson, D. P. Kreutzweiser, C. Krupke, M. Liess, M. McField, C. A. Morrissey, D. A. Noome, J. Settele, N. Simon-Delso, J. D. Stark, J. P. Van der Sluijs, H. Van Dyck, and M. Wiemers. 2015. Effects of neonicotinoids and fipronil on non-target invertebrates. Environmental Science and Pollution R 22: 68-102. Qureshi, J. A., B. C. Kostyk, and P. A. Stansly. 2014. Insecticidal suppression of Asian citrus psyllid Diaphorina citri (Hemiptera: Liviidae) vector of huanglongbing pathogens. PLoS One 9: e112331. Radcliffe, E. B., and D. W. Ragsdale. 2002. Aphid-transmitted potato viruses: The importance of understanding vector biology. American Journal of Potato Research 79: 353-386. Ragsdale, D. W., D. J. Voegtlin, and R. J. O'Neil. 2004. Soybean aphid biology in North America. Annals of the Entomological Society of America 97: 204-208.

117 Riley, T. J. 1988. Plant stress from arthropods: insecticide and acaricide effects on insect, mite and host plant biology, pp. 187-188. In E. A. Heinrichs (ed.), Plant Stress-Insect Interactions. Wiley, New York. Risebrough, R. W., D. B. Menzel, D. J. Martin, and H. S. Olcott. 1967. DDT residues in pacific sea birds: A persistent insecticide in marine food chains. Nature 216: 589-591. Rosenheim, J. A. 1998. Higher-order predators and the regulation of insect herbivore populations. Annual Review of Entomology 43: 421-447. Roubos, C. R., C. Rodriguez-Saona, and R. Isaacs. 2014. Mitigating the effects of insecticides on arthropod biological control at field and landscape scales. Biological Control 75: 28- 38. Rutledge, C. E., and R. J. O'Neil. 2005. Orius insidiosus (Say) as a predator of the soybean aphid, Aphis glycines Matsumura. Biological Control 33: 56-64. Schlapfer, F., B. Schmid, and I. Seidl. 1999. Expert estimates about effects of biodiversity on ecosystem processes and services. Oikos 84: 346-352. Seagraves, M. P., and J. G. Lundgren. 2012. Effects of neonicitinoid seed treatments on soybean aphid and its natural enemies. Journal of Pest Science 85: 125-132. Sengonca, C., K. Ahmadi, and P. Blaeser. 2008. Biological characteristics of Orius similis Zheng (Heteroptera, Anthocoridae) by feeding on different aphid species as prey. Journal of Plant Diseases and Protection 115: 32-38. Sethuraman, A., F. J. Janzen, and J. Obrycki. 2015. Population genetics of the predatory lady beetle Hippodamia convergens. Biological Control 84: 1-10. Shepard, M., G. R. Carner, and S. G. Turnipseed. 1977. Colonization and resurgence of insect pests of soybean in response to insecticides and field isolation. Environmental Entomology 6: 501-506. Simon-Delso, N., V. Amaral-Rogers, L. P. Belzunces, J. M. Bonmatin, M. Chagnon, C. Downs, L. Furlan, D. W. Gibbons, C. Giorio, V. Girolami, D. Goulson, D. P. Kreutzweiser, C. H. Krupke, M. Liess, E. Long, M. McField, P. Mineau, E. A. Mitchell, C. A. Morrissey, D. A. Noome, L. Pisa, J. Settele, J. D. Stark, A. Tapparo, H. Van Dyck, J. Van Praagh, J. P. Van der Sluijs, P. R. Whitehorn, and M. Wiemers. 2015. Systemic insecticides (neonicotinoids and fipronil): trends, uses, mode of action and metabolites. Environmental Science Pollution Research International 22: 5- 34. Song, F., S. M. Swinton, C. DiFonzo, M. E. O'Neal, and D. Ragsdale. 2006. Profitability analysis of soybean aphid control treatments in three north-central States. Michigan State University, Department of Agricultural, Food, and Resource Economics Staff Paper Series 11489. Stern, V. M., R. F. Smith, R. van den Bosch, and K. S. Hagen. 1959. The integration of chemical and biological control of the spotted alfalfa aphid: The integrated control concept. Hilgardia 29: 81-101.

118 Studebaker, G. E., and T. J. Kring. 2003. Effects of insecticides on Orius insidiosus (Hemiptera: Anthocoridae), measured by field, greenhouse and petri dish bioassays. The Florida Entomologist 86: 178-185. Sweeden, M. B., and P. J. McLeod. 1997. Systemic toxicity and field efficacy of imidacloprid, pymetrozine, and triazamate against Myzus persicae (Homoptera: Aphididae) on spinach. Journal of Agricultural Entomology 14: 421-433. Szczepaniec, A., S. F. Creary, K. L. Laskowski, J. P. Nyrop, and M. J. Raupp. 2011. Neonicotinoid insecticide imidacloprid causes outbreaks of spider mites on elm trees in urban landscapes. PloS One 6. Tilmon, K. J., E. W. Hodgson, M. E. O'Neal, and D. W. Ragsdale. 2011. Biology of the soybean aphid, Aphis glycines (Hemiptera: Aphididae) in the United States. Journal of Integrated Pest Management 2: 1-7. van den Bosch, R., and V. M. Stern. 1962. The Integration of Chemical and Biological Control of Arthropod Pests. Annual Review of Entomology 7: 367-386. van Lenteren, J. C. 1992. Biological control in protected crops: Where do we go? Pesticide Science 36: 321-327. van Lenteren, J. C., and J. Woets. 1988. Biological and integrated pest-control in greenhouses. Annual Review of Entomology 33: 239-269. Vos, J. G., E. Dybing, H. A. Greim, O. Ladefoged, C. Lambre, J. V. Tarazona, I. Brandt, and A. D. Vethaak. 2000. Health effects of endocrine-disrupting chemicals on wildlife, with special reference to the European situation. Critcal Reviews in Toxicology 30: 71- 133. Wang, P., L. L. Zhou, F. Yang, X. M. Liu, Y. Wang, C. L. Lei, and S. Y. Si. 2018. Lethal and behavioral sublethal side effects of thiamethoxam on the predator Harmonia axyridis. Entomologia Experimentalis Et Applicata 166: 703-712. Weathersbee, A. A., and D. D. Hardee. 1994. Abundance of cotton aphids (Homoptera: Aphididae) and associated biological-control agents on 6 cotton cultivars. Journal of Economic Entomology 87: 258-265. Weber, D. C., and J. G. Lundgren. 2009. Assessing the trophic ecology of the Coccinellidae: Their roles as predators and as prey. Biological Control 51: 199-214. Wells, M. L., and R. M. McPherson. 1999. Population dynamics of three coccinellids in flue- cured tobacco and functional response of Hippodamia convergens (Coleoptera: Coccinellidae) feeding on tobacco aphids (Homoptera: Aphididae). Environmental Entomology 28: 768-773. Wright, D. J., and R. H. J. Verkerk. 1995. Integration of chemical and biological-control systems for arthropods: Evaluation in a multitrophic context. Pesticide Science 44: 207- 218. Yano, K., T. Miyake, and V. F. Eastop. 1983. The biology and economic importance of rice aphids (Hemiptera: Aphididae): A review. Bulleting of Entomological Research 73: 539- 566. 119 Youn, Y. N., M. J. Seo, J. G. Shin, C. Jang, and Y. M. Yu. 2003. Toxicity of greenhouse pesticides to multicolored Asian lady beetles, Harmonia axyridis (Coleoptera: Coccinellidae). Biological Control 28: 164-170.

120 Chapter 5: Acute toxicity of insecticides on the convergent lady beetle and insidiosus

flower bug

5.1. Abstract

The use of insecticides typically has negative impacts on insect natural enemies, though, there are few exceptions when natural enemies are not significantly affected by the insecticide. In particular, we observed in Chapter 4 that convergent lady beetles (Hippodamia convergens)

Guérin-Méneville (Coleoptera: Coccinellidae) are not affected by thiamethoxam via the food chain, whereas thiamethoxam significantly increases mortality of the insidiosus flower bug

(Orius insidiosus) (Say) (Hemiptera: Anthocoridae). However, our understanding of the acute toxicity of thiamethoxam on these natural enemies is limited, as they are typically neglected in toxicological trials. Therefore, we aimed to evaluate the acute toxicity of thiamethoxam via topical application on the convergent lady beetle and insidiosus flower bug. We hypothesized that convergent lady beetles are tolerant to thiamethoxam, whereas insidiosus flower bugs are more susceptible to thiamethoxam in comparison with other insecticides (i.e. acetamiprid, clothianidin, carbofuran, lambda-cyhalothrin, chlorantraniliprole, chlorpyrifos, flupyradifurone).

All insecticides were also applied in combination with PBO, one of the most widely used insecticide synergists. We hypothesized that PBO synergizes the toxicity of insecticides on our natural enemies. As expected, we found that thiamethoxam has low toxicity on convergent lady beetles but high toxicity on insidiosus flower bug. Furthermore, we observed that the inclusion of

PBO increases the toxicity of several insecticides for both natural enemies. Our results provide 121 key insights for the development of pest control practices where chemical and biological control are combined.

5.2. Introduction

The use of insecticides typically has negative consequences on insect natural enemies (van den

Bosch et al. 1982, Hardin et al. 1995). Natural enemies can be exposed to insecticides when they prey on insects with insecticide residues (i.e. via food chain) (Elzen 2001, Grafton-Cardwell and

Gu 2003, Douglas et al. 2015), encountering treated surfaces (Mizell and Sconyers 1992,

Naranjo and Akey 2005, Barbosa et al. 2017a), consuming plant tissues/products with insecticide residues (Stapel et al. 2000) or by direct spraying (Youn et al. 2003, Desneux et al. 2006). When natural enemies are exposed to insecticides, lethal and sublethal outcomes are usually observed

(Desneux et al. 2007, Cloyd and Bethke 2011, Douglas and Tooker 2016). However, there are a few exceptions where natural enemies are not significantly affected by the insecticide (Torres and Bueno 2018). In particular, we observed in Chapter 4 that convergent lady beetles

(Hippodamia convergens) Guérin-Méneville (Coleoptera: Coccinellidae) are not affected by thiamethoxam via the food chain, whereas thiamethoxam significantly increases the mortality of the insidiosus flower bug (Orius insidiosus) (Say) (Hemiptera: Anthocoridae) when fed on toxic prey.

Differences in toxicity among natural enemies might be related with the physiological selectivity of insecticides (Torres and Bueno 2018) or insecticide tolerance by the natural enemies (Wilkinson 1976). Elucidating which insecticides are less toxic to natural enemies is fundamental to integrate biological and chemical for pest management programs (Stern et al.

1959, Bosch and Stern 1962). Moreover, understanding the intrinsic toxicity of insecticides on

122 biological control agents is essential for developing integrated pest management programs that minimize their impact on natural enemies (Hagen et al. 1959, Bosch and Stern 1962, Desneux et al. 2007) and to develop a stable, long-term pest control management strategy (van Lenteren and

Woets 1988, van Lenteren 1992, Flint et al. 1998, Rosenheim 1998, Schlapfer et al. 1999,

Cardinale et al. 2003, Losey and Vaughan 2006, Chagnon et al. 2015).

One of the standardized methods to assess insecticide toxicity on non-target organisms is via topical application (F.A.O. 1979). Topical application is used to estimate the lethal concentration (LC) that causes acute toxicity to 50% of the insect population under treatment

(i.e. LC50) (Finney 1971). The acute toxicity could indicate whether natural enemy species have distinct susceptibility to an insecticide (i.e. physiological selection), or whether a natural enemy has tolerance to the insecticide (Torres and Bueno 2018). Furthermore, topical applications simulate the toxicity insects could have during field applications (Smart and Stevenson 1982).

Despite significant efforts elucidating toxicity of insecticide on non-target insects (Croft and

Brown 1975, Croft and Whalon 1982, Desneux et al. 2007, Gentz et al. 2010, Cloyd and Bethke

2011, Torres and Bueno 2018), new insecticides are continuously added to the insecticide portfolio (Sparks and Nauen 2015, E.P.A. 2017). In addition, insecticides are frequently mixed with synergist compounds, such as piperonyl butoxide (PBO) that blocks cytochrome P450 of insects (Panini et al. 2017), increasing the number of outcomes insecticides could have on natural enemies.

In particular, the predatory convergent lady beetle and the insidiosus flower bug are usually neglected in toxicological trials. The protection of these predators lays on their importance as biological control agents of various soft-bodied insects, including several aphid species (Mccaffrey and Horsburgh 1986, Dixon et al. 1997, Rutledge and O'Neil 2005, Harwood

123 et al. 2007, Gardiner et al. 2009, Obrycki et al. 2009, Bahy El-Din et al. 2013). To date, however, there is a limited number of toxicological experiments that estimate the LC50 of insecticides

(Fernandes et al. 2016, Barbosa et al. 2017b, Prabhaker et al. 2017). The majority of trials assess the abundance or mortality of these natural enemies when exposed to treated surfaces (Al-Deeb et al. 2001, Seagraves and Lundgren 2012, Roubos et al. 2014, Pezzini and Koch 2015,

Rodriguez-Saona et al. 2016, Herrick and Cloyd 2017, Cloyd and Herrick 2018, Koch et al.

2019) or direct spray (Studebaker and Kring 2000, Tillman and Mulrooney 2000, Studebaker and

Kring 2003, Naranjo and Akey 2005, Mills et al. 2016, Colares et al. 2017, Santos et al. 2017) using recommended dose from formulated products. Despite the contribution of these studies in providing important insights of insecticide toxicity, they have limited application in estimating insecticide toxicity on convergent lady beetles or insidiosus flower bugs.

Therefore, we aimed to evaluate the acute toxicity of thiamethoxam via topical application on the convergent lady beetle and insidiosus flower bug. Based on our observations in Chapter 4, we hypothesized that convergent lady beetles are tolerant to thiamethoxam, whereas insidiosus flower bugs are susceptible to thiamethoxam, in comparison with other insecticides (i.e. acetamiprid, clothianidin, carbofuran, lambda-cyhalothrin, chlorantraniliprole, chlorpyrifos, flupyradifurone). All insecticides were also applied in combination with PBO. We hypothesized that PBO synergizes the toxicity of insecticides on our natural enemies. A series of insecticide concentrations were applied on the natural enemies to estimate the LC50. We found insights of thiamethoxam tolerance and susceptibility on the convergent lady beetle and insidiosus flower bug, respectively. Furthermore, we observed that the inclusion of PBO could increase the toxicity of several insecticides for both natural enemies. Evaluating the toxicity of

124 insecticides is fundamental to predict and mitigate the impact of insecticides on adult females of the convergent lady beetle and insidiosus flower bug.

5.3. Materials and methods

5.3.1. Natural enemy colonies

Convergent lady beetles (Hippodamia convergens) Guérin-Méneville (Coleoptera:

Coccinellidae) and insidiosus flower bugs (Orius insidiosus) (Say) (Hemiptera: Anthocoridae) were purchased from ARBICO-Organics® (Tuczon, AZ) and Rincon-Vitova® (Ventura, CA), respectively. Convergent lady beetles were obtained from collection at the foothills of

Sacramento, CA, whereas insidiosus flower bugs were reared under laboratory conditions by the providers. Upon arrival, natural enemies were fed with a 10% sucrose-soaked cotton wicks and maintained at controlled conditions (21˚C, 16:8 h light:dark). Sexing was performed by collecting adults with mouth-operated aspirators (BioQuip®, Rancho Dominguez, CA) and anesthetized with CO2 gas and ice for 10 min. While paralyzed, females were selected by their abdominal dimorphism and transferred to their respective microcosm arenas for topical applications.

5.3.2. Microcosm arenas

We performed all topical applications in 100 ´ 25 mm petri dishes. Petri dishes were filled 40% with a mix of DAP® Plaster of Paris (DAP®, Baltimore, MD), 2320 ppm of activated charcoal

(Sigma-Aldrich, St. Louis, MO) and deionized water. Once the mix hardened, the plaster surface was covered with a 9-cm diameter WhatmanTM filter paper #1 (GE Healthcare®, Chicago, IL).

Plaster and filter paper were moisturized with deionized water. Anesthetized females were

125 transferred to the microcosm arena with fine-haired paint brushes for insecticide topical application.

5.3.3. Chemicals used for topical applications

Technical grade of acetamiprid, thiamethoxam, clothianidin, carbofuran, lambda-cyhalothrin, chlorantraniliprole, and chlorpyrifos were purchased from Sigma-Aldrich (St. Louis, MO). The formulated insecticide AltusTM (a.i. flupyradifurone) was obtained from ® (Leverkusen,

Germany). Piperonyl butoxide (PBO) technical grade was obtained from Sigma-Aldrich (St.

Louis, MO). All insecticides were diluted in acetone or in a mix of acetone and PBO. The amount of PBO used resembles concentrations used for field applications (e.g. Exponent®,

Valent®, 584.4 mL of formulated product per hectare, using 1416.2 L of total volume applied per hectare). All insecticides had a total of eight concentrations, where the maximum concentration caused nearly 100% mortality on the convergent lady beetles and insidiosus flower bug. For thiamethoxam only, the maximum concentration that kept in solution was 12,800 mg/L.

As a control, we used acetone only (for applications without PBO) or acetone+PBO. All insecticide solutions were kept at -20˚C to avoid acetone evaporation.

5.3.4. Insecticide topical application

Topical applications were initiated by transferring anesthetized females with mouth-operated aspirators (BioQuip®, Rancho Dominguez, CA) to the microcosm arena. Per experimental unit, we applied a total of 5 convergent lady beetles and 10 insidiosus flower bugs. All insecticide applications were performed topically on the ventral abdominal region. Applications were performed using repeating micro-applicators Hamilton® PB-600 and 10 µL or 25 µL syringes

126 (Reno, NV) for the convergent lady beetles or insidiosus flower bugs, respectively. A total of

200 nL or 500 nL of the insecticide solution was applied on each insidiosus flower bug or convergent lady beetle female, respectively. Prior to closing petri dishes and sealing with

BemisTM ParafilmTM M (Neenah, WI), a 1.5 mL microtube with 10% sucrose-soaked cotton wick was placed inside of the petri dish as food source for the natural enemies.

5.3.5. Mortality assessment and statistical analyses

Mortality of insidiosus flower bug and convergent lady beetles was evaluated at 24 h and 72 h after topical application, respectively. Insects were considered dead if no movement was observed within 10 min after gently touched with a fine-haired paintbrush. Mortality of natural enemies treated with insecticides was adjusted by the Abbot correction (Finney 1971) when the control (treated with acetone or acetone+PBO) was between 5%–15%. The adjusted mortality and insecticide dose were probit and log transformed, respectively. Using PROC PROBIT in

SAS® software (version 9.4), data were fitted into a regression using a logistic distribution. The

LC50 values and their respective 95% confidence intervals were calculated using the Fieller’s method (Finney 1971).

Moreover, we estimated the effects of PBO by calculating the likelihood ratio of the pairwise comparison between the toxicity of the insecticide with and without PBO (Savin et al.

1977, Robertson et al. 2017). We evaluated the synergistic or antagonistic effects of PBO on the toxicity of insecticides by comparing the slope (hypothesis of parallelism) and intercept values

(hypothesis of equality). Higher slopes are associated with fewer individuals that survive at higher insecticide concentrations (Robertson et al. 1995). Lower intercept values are associated with synergistic effects, whereas higher intercept values are associated with antagonistic effects

127 (Robertson and Rappaport 1979). Because lower intercept values result in higher LC50, we analyzed synergy or antagonism of PBO based on LC50 values. The hypothesis of parallelism and equality were calculated using R (version 3.6.1) statistical package (R Core Team 2018).

5.4. Results

5.4.1. Insecticide toxicity on convergent lady beetles

We hypothesized that the convergent lady beetle is tolerant to thiamethoxam. As expected, thiamethoxam had the lowest toxicity (LC50: 935.42 mg/L) among the insecticides tested. Within the neonicotinoid group, the least toxic insecticides were clothianidin (LC50: 320.06 mg/L) and acetamiprid (LC50: 101.40 mg/L) (Table 13). Among the acetylcholinesterase inhibitors, carbofuran had lower toxicity (LC50: 253.79 mg/L) than chlorpyrifos (LC50: 109.63 mg/L). The two most toxic insecticides were chlorantraniliprole (LC50: 86.81 mg/L) and lambda-cyhalothrin

(LC50: 35.57 mg/L) (Table 13).

With the addition of PBO, we hypothesized that PBO synergizes the toxicity of insecticides on our natural enemies (i.e. higher slope and/or lower LC50). In accordance with our hypothesis, the addition of PBO significantly increased the slope of lambda-cyhalothrin (slope:

5.2363, P < 0.05) in comparison to applied with acetone only (slope: 4.22) (Table 13, Figure

18C). Contrary to our hypothesis, mixing PBO with acetamiprid, carbofuran, chlorpyrifos, clothianidin, thiamethoxam or chlorantraniliprole does not change the slope of the LC50 curves

(Table 1). Notably, chlorantraniliprole with PBO had a significant lower slope of 2.8654 than applied with acetone only (slope: 4.0426, P < 0.05) (Table 13, Figure 18A).

In accordance with our hypothesis we also found that the toxicity of chlorantraniliprole

(LC50: 12.20 mg/L) and lambda-cyhalothrin (LC50: 1.99 mg/L) mixed with PBO were

128 significantly higher than without PBO, LC50: 86.81 mg/L and LC50: 35.57 mg/L, respectively

(Table 13, Figure 18A and 18C). Contrary to our hypothesis, the addition of PBO, however, does not increase the toxicity of acetamiprid (LC50: 113.98 mg/L) and carbofuran (LC50: 201.17 mg/L). In addition, we found that thiamethoxam, clothianidin and chlorpyrifos decreased their toxicity when mixed with PBO. Clothianidin (LC50: 768.54 mg/L) had significant lower toxicity

(P < 0.05) in combination with PBO (LC50: 320.06 mg/L) (Figure 18B). Chlorpyrifos with PBO

(LC50: 2284 mg/L) was 20.8 times less toxic than without it (LC50: 109.63 mg/L), although neither the slopes nor intercepts of chlorpyrifos were significantly different from each other (P ³

0.05) (Table 13). Moreover, we observed that the addition of PBO has antagonistic effects in the toxicity of thiamethoxam on convergent lady beetles. Without PBO, thiamethoxam LC50 was

935.42. mg/L, whereas by adding PBO, no LC50 could be calculated (see Figure 19D). Our inability to calculate LC50 was due to the low mortality in convergent lady beetle across all thiamethoxam concentrations tested (Figure 18 and Figure 19).

5.4.2. Insecticide toxicity on insidiosus flower bug

We hypothesized that insidiosus flower bugs were susceptible to thiamethoxam. As expected, thiamethoxam (LC50: 0.108 mg/L) was one of the most toxic among insecticides tested, only surpassed by clothianidin (LC50: 0.103 mg/L) (Table 14). Lambda-cyhalothrin (LC50: 0.461 mg/L), acetamiprid (LC50: 1.048 mg/L) and flupyradifurone (LC50: 1.118 mg/L) showed lower toxicity than thiamethoxam. In contrast, carbofuran (LC50: 3.62 mg/L), chlorantraniliprole (LC50:

7.93 mg/L) and chlorpyrifos (LC50: 28.44 mg/L) showed the lowest toxicity levels (Table 14).

When insecticides are mixed with PBO, we hypothesized that PBO synergizes the toxicity of insecticides on insidiosus flower bugs (i.e. higher slope and/or lower LC50).

129 Flupyradifurone with PBO was the only mixture that significantly increased slope (slope: 4.1656,

P ³ 0.05) (Table 14, Figure 20C). Contrary to our hypothesis, mixing PBO with acetamiprid, carbofuran, chlorantraniliprole, chlorpyrifos, clothianidin, lambda-cyhalothrin, and thiamethoxam does not affect the slope of insecticides on insidiosus flower bugs (Table 14).

Notably, acetamiprid (slope: 3.9525) and clothianidin (slope: 3.4777) mixed with PBO had significantly lower slopes (P < 0.05) than applied with acetone only (slopes: 6.2259 and 3.6764, respectively) (Figure 20A and 20B). Lambda-cyhalothrin (slope: 3.9264) was also lower than without PBO (slope: 4.2433), though, their comparison was at the edge of significance (P =

0.058) (Table 14).

In addition, we hypothesized that the addition of PBO would increase the toxicity of insecticides on insidiosus flower bugs. In accordance with our hypothesis, we found that acetamiprid (LC50: 0.189), clothianidin (LC50: 0.077 mg/L) and flupyradifurone (LC50: 0.903 mg/L) mixed with PBO had significantly higher toxicity than applied only with acetone (P <

0.05) (Figure 20A–C). In contrast, the addition of PBO does not affect the toxicity of carbofuran, chlorpyrifos, lambda-cyhalothrin, thiamethoxam and chlorantraniliprole (P ³ 0.05). However, the LC50 values of chlorantraniliprole with and without PBO were marginally significant (P =

0.057) (Table 14).

5.5. Discussion

The use of insecticides is usually associated with negative consequences on insect natural enemies (van den Bosch et al. 1982, Hardin et al. 1995). However, certain natural enemies might not be affected by insecticides, as they are tolerant to the insecticide mode of action (Gentz et al.

2010, Torres and Bueno 2018, Wu et al. 2018). In particular, we observed in Chapter 4 that

130 convergent lady beetles are not affected by thiamethoxam via the food chain, whereas thiamethoxam significantly increased mortality of insidiosus flower bug when fed on toxic prey.

To date, however, the intrinsic toxicity of thiamethoxam on these two natural enemies is unknown. Moreover, the toxicity of other insecticides is also unexplored as the convergent lady beetle and insidiosus flower bug are not typically included in toxicological trials. To expand our understanding about the off-target effects of insecticides, we evaluated the toxicity of several insecticides in combination with PBO (an insecticide synergist) on adult females of the convergent lady beetle and insidiosus flower bug. Our results provided key insights on the acute toxicity of several insecticides on the convergent lady beetle and insidiosus flower bug as we explain below.

5.5.1. Insecticide toxicity on lady beetles

We hypothesized that convergent lady beetles were tolerant of thiamethoxam. As expected, we found that thiamethoxam had the lowest toxicity among all insecticides tested. Convergent lady beetles have also showed tolerance when exposed to thiamethoxam-treated surfaces (Santos et al.

2017). Thiamethoxam tolerance has also been observed in the multicolored Asian lady beetle

Harmonia axyridis (Coleoptera: Coccinellidae), Adalia bipunctata L. (Coleoptera:

Coccinellidae) and Coccinella undecimpunctata aegyptiaca Reiche (Coleoptera: Coccinellidae)

(Youn et al. 2003, Amirzade et al. 2014). Notably, tolerance to thiamethoxam might not be a generalized element across all lady beetles, as certain species such as Cycloneda sanguinea

(Linnaeus) (Coleoptera: Coccinellidae) and Tenuisvalvae notata (Mulsant) (Coleoptera:

Coccinellidae) are susceptible to thiamethoxam (Fernandes et al. 2016, Barbosa et al. 2018).

Moreover, tolerance of lady beetles to thiamethoxam might vary based their phenological state

131 (Moscardini et al. 2015) or how they are exposed to residues (e.g. treated-surface, topical) (Wang et al. 2018). The molecular mechanisms that contribute to thiamethoxam tolerance in convergent lady beetles are unknown, but other coleopteran species such as the has quickly developed resistance to neonicotinoids (i.e. imidacloprid) by the overexpression of mono-oxidases and esterases (Zhao et al. 2000).

In addition to thiamethoxam, we also observed that clothianidin has low toxicity (LC50:

320.06 mg/L) in comparison to other insecticides tested (Table 13). Low toxicity to clothianidin was expected, since clothianidin is a prevailing metabolite of thiamethoxam during the biochemical breakdown within insect body (Nauen et al. 2003). Intriguingly, acetamiprid (LC50:

101.40 mg/L) showed about 9.2 and 3.1 times more toxicity than thiamethoxam and clothianidin, respectively, despite all three insecticides having the same mode of action. High toxicity to acetamiprid has also been observed when convergent lady beetles and the multicolor Asian lady beetle are exposed to treated surfaces or field doses (Youn et al. 2003, Naranjo and Akey 2005,

Roubos et al. 2014). Moreover, carbofuran (LC50 of 253.79 mg/L) and chlorpyrifos (109.63 mg/L) also had high toxicity in comparison to the other insecticides (Table 13). Chlorpyrifos, in particular, is known to cause significant mortality of convergent lady beetles and the multicolor

Asian lady beetle when a field dose is applied (Galvan et al. 2005, Santos et al. 2017).

The two most toxic insecticides on the convergent lady beetle were chlorantraniliprole

(LC50: 86.81 mg/L) and lambda-cyhalothrin (LC50: 35.57 mg/L). Our results on chlorantraniliprole contrast with those found by Mills et al. 2016 (15% mortality at 118 mg/L) and Barbosa et al. 2017b (LC50: 706.2 mg/L), although the application methods differed, specifically in the solvents and surfactants. High toxicity of lambda-cyhalothrin on convergent lady beetle has also been observed when exposed to treated surfaces (Pezzini and Koch 2015,

132 Koch et al. 2019) or when applied topically (Tillman and Mulrooney 2000). These highly toxic insecticides might affect the performance of convergent lady beetles as biological control agents

(see Compatibility of insecticides with convergent lady beetle and insidiosus flower bug below).

5.5.2. Insecticide toxicity on insidiosus flower bug

We hypothesized that insidiosus flower bugs were susceptible to thiamethoxam. As expected, we found that thiamethoxam was one of the most toxic insecticides (LC50: 0.1089 mg/L), surpassed only by clothianidin (LC50: 0.1031 mg/L). High toxicity of thiamethoxam and clothianidin for the insidiosus flower bug has also been observed when exposed to treated surfaces with any of these insecticides (Prabhaker et al. 2011, Herrick and Cloyd 2017, Prabhaker et al. 2017). In addition, lambda-cyhalothrin showed high levels of toxicity (LC50: 0.4614 mg/L), similar to those observed after a field spray (Studebaker and Kring 2000, Studebaker and Kring 2003) or when expose to treated surfaces (Pezzini and Koch 2015, Koch et al. 2019). Due to their high toxicity, the use of thiamethoxam, clothianidin and lambda-cyhalothrin is likely to be incompatible with the insidiosus flower bug. In contrast, acetamiprid (LC50: 1.048 mg/L), flupyradifurone (LC50: 1.1186 mg/L) and carbofuran (LC50: 3.6251 mg/L) were found to have slightly lower toxicity than lambda-cyhalothrin, thiamethoxam and clothianidin (Table 14).

Acetamiprid or carbofuran treated surfaces at field application rates cause intermediate levels of mortality to insidiosus flower bugs (i.e. 50–80%) (Al-Deeb et al. 2001, Rodriguez-Saona et al.

2016, Herrick and Cloyd 2017), whereas treated surfaces with flupyradifurone have shown higher mortality (i.e. 95–100%) (Barbosa et al. 2017a, Cloyd and Herrick 2018). Acetamiprid, flupyradifurone and carbofuran, therefore, might be less likely to harm insidiosus flower bug than highly toxic insecticides.

133 One of the least toxic insecticides on insidiosus flower bug was chlorantraniliprole (LC50:

7.9375 mg/L) (Table 14). Chlorantraniliprole is categorized as a reduced risk insecticide for off- target organisms (E.P.A. 2010). Empirical evidence shows that insidiosus flower bugs exposed to surfaces treated with 77–280 g a.i./ha dose can cause mortality up to 50% of the population

(Roubos et al. 2014, Rodriguez-Saona et al. 2016). Thus, we speculate that if chlorantraniliprole is applied as seed treatment (see Carscallen et al. 2019), lower toxicity via the food chain (e.g. feeding on toxic aphids as performed in Chapter 4) on insidiosus flower bug could be expected.

Surpassing chlorantraniliprole, intriguingly, the least toxic insecticide we found on insidiosus flower bug was chlorpyrifos (LC50: 28.4453 mg/L). Chlorpyrifos has a broad-spectrum control and it is usually associated with negative consequences on non-target insects (Prischmann et al.

2005, Hill et al. 2017). Toxicological studies have found chlorpyrifos is highly toxic on insidiosus flower bugs, in comparison with other insecticides (Fernandes et al. 2016, Rodriguez-

Saona et al. 2016). Though, these studies used formulated insecticides and field dose to assess toxicity of chlorpyrifos, which differ from our application methods.

5.5.3. Effects of PBO in the toxicity of insecticides on the convergent lady beetle and

insidiosus flower bug

We hypothesized that PBO synergizes the toxicity (i.e. higher slope and/or lower LC50) of insecticides on the convergent lady beetle and insidiosus flower bug. Higher slopes are associated with fewer individuals that survive at higher insecticide concentrations (Robertson et al. 1995), whereas lower LC50 values are associated to synergistic effects (Robertson and

Rappaport 1979). In brief, we found that the addition of PBO increased the slope of lambda- cyhalothrin (Figure 18C) and flupyradifurone (Figure 20C) on convergent lady beetle and

134 insidiosus flower bug, respectively. In contrast, decreases in slope by mixing PBO was observed with chlorantraniliprole on convergent lady beetles (Table 13, Figure 18A), and with acetamiprid and clothianidin on insidiosus flower bug (Table 14, Figure 20A and 20B). The irregular synergism of PBO among insecticides has also been observed by Demkovich et al. 2015 and

Valles et al. 1997 on agricultural and urban pests. This inconsistent outcome suggests that PBO synergism might be the result of a convoluted interaction of various factors such as: 1) the inhibition of enzymes (i.e. cytochrome P450) for the detoxification of certain insecticides

(Robertson and Rappaport 1979, Scott 1999, Feyereisen 2012, Robertson et al. 2017); 2) interference of the insecticide bioactivation in the insect body (Feyereisen 1999); or 3) interactions of PBO with other xenobiotic-interacting proteins such as glutathione-S-transferase

(Willoughby et al. 2007) and esterases (Young et al. 2005, Khot et al. 2008).

In relation with the LC50 values, we found that PBO synergized the toxicity of chlorantraniliprole and lambda-cyhalothrin on convergent lady beetles (Figure 18A and 18B) and acetamiprid, clothianidin, and flupyradifurone on insidiosus flower bugs (Figure 20A–C) (Table

13 and Table 14). Synergistic interactions between PBO and acetamiprid and lambda-cyhalothrin have also been observed on various insect species (Ninsin and Tanaka 2005, Young et al. 2006,

Romero et al. 2009, Demkovich et al. 2015). Although we do not know the causes of PBO synergism (lower LC50), it could be related to an enhanced insecticide penetration through the cuticle (Bingham et al. 2011) or inhibition of the degradation of insecticides by CYP (Pasay et al.

2009). In contrast, on convergent lady beetles we found PBO mixed with clothianidin (Figure

18B) and thiamethoxam (Figure 18D and Figure 19) to be antagonistic (higher LC50) (Table 13).

Why PBO lowers the toxicity of clothianidin and thiamethoxam might be associated to the decreasing in insecticide penetration through the cuticle or inhibiting the insecticide

135 bioactivation, as observed on other insects (Valles et al. 1997, Sanchez-Arroyo et al. 2001).

However, our conclusions about PBO synergism or antagonism are merely speculative and further pharmacological and kinetical research with insect cuticle and enzymes interacting with

PBO must be executed.

5.5.4. Compatibility of insecticides with convergent lady beetle and insidiosus flower bug

We found that thiamethoxam, clothianidin and carbofuran have the lowest toxicity on convergent lady adult beetles, whereas chlorantraniliprole, carbofuran, and flupyradifurone have low toxicity on insidiosus flower bugs. Comparing our LC50 with the recommended insecticide dose of formulated insecticides (see Table 15), the LC50 on convergent lady beetles are generally higher than the dose of commercial formulations (Table 13). If thiamethoxam or clothianidin are applied as indicated in label, low mortality of convergent lady beetles could be expected. In contrast, all formulated insecticides have higher concentrations for field rates than the LC50 of insidiosus flower bug (Table 14). Even if chlorantraniliprole, carbofuran or flupyradifurone are applied at the lowest recommended concentration, significant mortality might still occur for the insidiosus flower bug. Moreover, the use of insecticides with low toxicity could also cause sublethal adverse effects on the biology (Studebaker and Kring 2000, Xiao et al. 2016) or control services of natural enemies (Stapel et al. 2000, Desneux et al. 2007). Because sublethal effects are usually not detected in acute toxicity test, we advise caution to use low-toxicity insecticides in combination with natural enemies. In addition, we observed that lambda-cyhalothrin, chlorantraniliprole, acetamiprid and chlorpyrifos on convergent lady beetles and clothianidin, lambda-cyhalothrin and thiamethoxam on insidiosus flower bug are highly toxic. In comparison with recommended dose in formulated insecticides (Table 15), the LC50 observed on our natural

136 enemies are generally lower (Table 13 and Table 14). Therefore, we recommend that the use of these insecticides must be minimized when natural enemies are present in area to treat.

Our experiments revealed that insecticides could be highly toxic on convergent lady beetles or insidiosus flower bugs. We also found that certain insecticides might have low toxicity on natural enemies. Insecticides with low toxicity on natural enemies could be promising candidates to integrate biological and chemical for pest control. Integration of biological and chemical control is one of the fundamental objectives of integrated pest management (Stern et al.

1959, van den Bosch and Stern 1962). Insecticide applications and the release of biological control agents, however, should be carefully implemented as insecticides could debilitate and/or disrupt natural enemy populations (Szczepaniec et al. 2011, Seagraves and Lundgren 2012).

Disruption of these populations might cause damage to the ecology and control services provided

(Schlapfer et al. 1999, Cardinale et al. 2003, Chagnon et al. 2015).

137 5.5.5. Tables and figures

Table 13. Estimated LC50 of insecticides on convergent lady beetles and pairwise comparison of the slope (hypothesis of parallelism) and intercept (hypothesis of equality) of insecticides with and without PBO. Pairwise comparison between no PBO and with PBO Hypothesis of Hypothesis 2 Insecticide n Slope ± (SEM) X LC50 (mg/L) ± (95% CI) parallelism of equality Without PBO Acetamiprid 400 6.2152±(5.90–6.52) 1539.2332 101.4036±(98.48–104.29) ≥0.05 ≥0.05 Carbofuran 400 2.6799±(2.52–2.83) 1148.8356 253.7943±(242.58–265.69) ≥0.05 ≥0.05 Chlorantraniliprole 400 4.0426±(3.82–4.82) 1274.0904 86.8196±(83.08–90.46) <0.05 <0.05 Chlorpyrifos 400 3.4353±(3.22–3.64) 1062.025 109.63±(104.39–114.73) ≥0.05 ≥0.05 Clothianidin 400 1.9067±(1.77–2.03) 824.4296 320.0666±(291.30–349.08) ≥0.05 <0.05 Lambda-cyhalothrin 400 4.22±(4.00–4.43) 1474.2573 35.5733±(34.56–36.58) <0.05 <0.05 Thiamethoxam 400 2.2735±(2.09–2.45) 617.8498 935.4297±(846.17–1023) ≥0.05 ≥0.05 With PBO Acetamiprid 400 5.1899±(4.89–5.48) 1207.1898 110.7863±(105.51–116.01) Carbofuran 400 2.5275±(2.38–2.67) 1201.742 202.7745±(189.91–215.61) Chlorantraniliprole 400 2.8654±(2.70–3.02) 1250.3351 12.2052±(11.08–13.36) Chlorpyrifos 400 3.9516±(3.73–4.16) 1272.8201 2284±(2187–2379) Clothianidin 400 3.0870±(2.91–3.25) 1311.7849 768.5448±(722.30–814.78) Flupyradifurone 400 3.4673±(3.20–3.73) 667.4638 907.0157±(818.15–993.03) Lambda-cyhalothrin 400 5.2363±(4.83–5.63) 661.8964 1.9949±(1.90–2.08) Thiamethoxam 400 0.66±(0.40–0.91) 25.4291

138

Table 14. Estimated LC50 of insecticides on insidiosus flower bugs and pairwise comparison of the slope (hypothesis of parallelism) and intercept (hypothesis of equality) of insecticides with and without PBO. Pairwise comparison between no PBO and with PBO Hypothesis of Hypothesis Insecticide n Slope ± (SEM) X2 LC50 (mg/L) ± (95% CI) parallelism of equality Without PBO Acetamiprid 400 6.2259±(5.78–6.66) 778.8538 1.04844±(1.00–1.09) <0.05 <0.05 Carbofuran 400 5.8668±(5.47–6.26) 843.6626 3.6251±(3.46–3.78) ≥0.05 ≥0.05 Chlorantraniliprole 400 3.8445±(3.59–4.09) 926.2595 7.9375±(7.38–8.48) ≥0.05 ≥0.05 Chlorpyrifos 400 4.2038±(3.94–4.45) 1037.1547 28.4453±(27.00–29.94) ≥0.05 ≥0.05 Clothianidin 400 3.6764±(3.44–3.90) 996.3745 0.10315±(0.09–0.10) <0.05 <0.05 Flupyradifurone 400 2.1942±(2.04–2.34) 863.4967 1.11860±(0.99–1.24) <0.05 <0.05 Lambda-cyhalothrin 400 4.2433±(3.97–4.51) 950.4715 0.46143±(0.43–0.48) ≥0.05 ≥0.05 Thiamethoxam 400 3.2166±(3.01–3.41) 1002.9753 0.1089±(0.10–0.11) ≥0.05 ≥0.05 With PBO Acetamiprid 400 3.9526±(3.64–4.25) 639.6263 0.1891±(0.17–0.20) Carbofuran 400 6.2792±(5.86–6.69) 862.8244 3.6622±(3.50–3.81) Chlorantraniliprole 400 3.6492±(3.42–3.87) 1008.1359 0.6055±(0.57–0.64) Chlorpyrifos 400 8.1016±(7.41–8.78) 539.0525 63.9465±(61.93–66.00) Clothianidin 400 3.4777±(3.25–3.70) 922.0757 0.0771±(0.07–0.08) Flupyradifurone 400 4.1656±(3.87–4.45) 785.4687 0.9037±(0.85–0.95) Lambda-cyhalothrin 400 3.9264±(3.66–4.18) 872.6876 0.0304±(0.028–0.032) Thiamethoxam 400 3.6089±(3.36–3.85) 842.8141 0.6475±(0.60–0.68)

139

Table 15. Lowest and highest dose (mg a.i./L) recommended on labels of several formulated insecticides. Insecticide dose are based on 935 liters of water per hectare. Commercial Lowest dose Highest dose Insecticide name Manufacturer (mg a.i./L) (mg a.i./L) Acetamiprid Assail 70 WP Aventis 30.0 299.8 TriStar 8.5 SL Nufarm 25.5 161.2 Carbofuran Furadan 4 FMC Corporation 149.9 1199.3 ADAMA South Carbodan Africa 2670.8 3207.1 Curaterr 10 GR Bayer CropScience 2670.8 3207.1 Chlorantraniliprole Acelepryn Syngenta 31.3 500.7 Coragen FMC Corporation 31.2 117.5 Chlorpyrifos Lorsban 4 E Corteva Agriscience 599.7 7196.1 Dursban 50 W Corteva Agriscience 18.7 1199.3 Clothianidin Belay 50 WG Valent 60.0 239.9 Arena 50 WDG Valent 5.2 479.7 Flupyradifurone Altus Bayer CropScience 109.5 438.1 Sivanto 200 SL Bayer CropScience 109.5 438.1 Lambda- cyhalothrin Warrior II Syngenta 18.0 48.0 Karate Syngenta 18.0 48.0 Lamcap Syngenta 18.0 48.0 Thiamethoxam Flagship 25 WG Syngenta 37.5 159.3 Centric 40 WG Syngenta 37.5 75.0 Actara Syngenta 28.1 103.1

140

Figure 18. Probit curves of convergent lady beetle adult females when exposed to topical applications of chlorantraniliprole (A), clothianidin (B), lambda-cyhalothrin (C) and thiamethoxam (D) without PBO (dashed black line) or with PBO (solid red line).

141

Figure 19. Mortality (in percentage) of convergent lady beetle adult females when exposed to topical applications of thiamethoxam without PBO (red line, circles) and with PBO (black line, squares).

Figure 20. Probit curves of insidiosus flower bug adult females when exposed to topical applications of acetamiprid (A), clothianidin (B) or flupyradifurone (C) without PBO (dashed black line) or with PBO (solid red line).

142 5.6. References cited

Al-Deeb, M. A., G. E. Wilde, and K. Y. Zhu. 2001. Effect of insecticides used in corn, sorghum, and alfalfa on the predator Orius insidiosus (Hemiptera: Anthocoridae). Journal of Economic Entomology 94: 1353-1360. Amirzade, N., H. Izadi, M. A. Jalali, and H. Zohdi. 2014. Evaluation of three neonicotinoid insecticides against the common pistachio psylla, Agonoscena pistaciae, and its natural enemies. Journal of Insect Science 14. Bahy El-Din, I. A., A. H. El-Heneidy, F. F. Shalaby, and A. A. Hafez. 2013. Evaluation of releasing the predator, Hippodamia convergens (geur.) (Coleoptera: Coccinellidae) against the cotton aphid, Aphis gossypii glover, infesting squash plants under semi-field conditions. Egyptian Journal of Biological Pest Control 23: 175-179. Barbosa, P. R. R., J. P. Michaud, C. L. Bain, and J. B. Torres. 2017a. Toxicity of three aphicides to the generalist predators Chrysoperla carnea (Neuroptera: Chrysopidae) and Orius insidiosus (Hemiptera: Anthocoridae). Ecotoxicology 26: 589-599. Barbosa, P. R. R., J. B. Torres, J. P. Michaud, and A. R. S. Rodrigues. 2017b. High concentrations of chlorantraniliprole reduce its compatibility with a key predator, Hippodamia convergens (Coleoptera: Coccinellidae). Journal of Economic Entomology 110: 2039-2045. Barbosa, P. R. R., M. D. Oliveira, E. M. Barros, J. P. Michaud, and J. B. Torres. 2018. Differential impacts of six insecticides on a mealybug and its coccinellid predator. Ecotoxicology Environmental Safety 147: 963-971. Bingham, G., C. Strode, L. Tran, P. T. Khoa, and H. P. Jamet. 2011. Can piperonyl butoxide enhance the efficacy of pyrethroids against pyrethroid-resistant Aedes aegypti? Tropical Medicine and International Health 16: 492-500. Bosch, R. V. D., and V. M. Stern. 1962. The integration of chemical and biological control of arthropod pests. Annual Review of Entomology 7: 367-386. Cardinale, B. J., C. T. Harvey, K. Gross, and A. R. Ives. 2003. Biodiversity and biocontrol: emergent impacts of a multi-enemy assemblage on pest suppression and crop yield in an agroecosystem. Ecological Letters 6: 857-865. Carscallen, G. E., S. V. Kher, and M. L. Evenden. 2019. Efficacy of chlorantraniliprole seed treatments against armyworm (Mythimna unipuncta [Lepidoptera: Noctuidae]) larvae on corn (Zea mays). Journal of Economic Entomology 112: 188-195. Chagnon, M., D. Kreutzweiser, E. A. Mitchell, E. A. Mitchell, C. A. Morrissey, D. A. Noome, D. A. Noome, J. P. Van der Sluijs, and J. P. Van der Sluijs. 2015. Risks of large-scale use of systemic insecticides to ecosystem functioning and services. Environmental Science Pollution R 22: 119-134. Cloyd, R. A., and J. A. Bethke. 2011. Impact of neonicotinoid insecticides on natural enemies in greenhouse and interiorscape environments. Pest Management Science 67: 3-9.

143 Cloyd, R. A., and N. J. Herrick. 2018. Effects of pesticides on the survival of rove beetle (Coleoptera: Staphylinidae) and insidious flower bug (Hemiptera: Anthocoridae) adults. Journal of Economic Entomology 111: 78-88. Colares, F., J. P. Michaud, C. L. Bain, and J. B. Torres. 2017. Relative toxicity of two aphicides to Hippodamia convergens (Coleoptera: Coccinellidae): implications for integrated management of sugarcane aphid, Melanaphis sacchari (Hemiptera: Aphididae). Journal of Economic Entomology 110: 52-58. Croft, B. A., and A. W. Brown. 1975. Responses of arthropod natural enemies to insecticides. Annual Review of Entomology 20: 285-335. Croft, B. A., and M. E. Whalon. 1982. Selective toxicity of pyrethroid insecticides to arthropod natural enemies and pests of agricultural crops. Entomophaga 27: 3-21. Demkovich, M., C. E. Dana, J. P. Siegel, and M. R. Berenbaum. 2015. Effect of piperonyl butoxide on the toxicity of four classes of insecticides to navel orange worm (Amyelois transitella) (Lepidoptera: Pyralidae). Journal of Economic Entomology 108: 2753-2760. Desneux, N., R. Denoyelle, and L. Kaiser. 2006. A multi-step bioassay to assess the effect of the on the parasitic wasp Aphidius ervi. Chemosphere 65: 1697-1706. Desneux, N., A. Decourtye, and J. M. Delpuech. 2007. The sublethal effects of pesticides on beneficial arthropods. Annual Review of Entomology 52: 81-106. Dixon, A. F. G., J. L. Hemptinne, and P. Kindlmann. 1997. Effectiveness of ladybirds as biological control agents: Patterns and processes. Entomophaga 42: 71-83. Douglas, M. R., and J. F. Tooker. 2016. Meta-analysis reveals that seed-applied neonicotinoids and pyrethroids have similar negative effects on abundance of arthropod natural enemies. PeerJ 4: e2776. Douglas, M. R., J. R. Rohr, and J. F. Tooker. 2015. Neonicotinoid insecticide travels through a soil food chain, disrupting biological control of non-target pests and decreasing soya bean yield. Journal of Applied Ecology 52: 250-260. E.P.A. 2010. Chlorantraniliprole: Pesticide tolerances, pp. 5526-5535. Environmental Protection Agency. E.P.A. 2017. Registration division conventional pesticides - Branch and product manager (PM) assignments. E.P.A. Elzen, G. W. 2001. Lethal and sublethal effects of insecticide residues on Orius insidiosus (Hemiptera: Anthocoridae) and Geocoris punctipes (Hemiptera: Lygaeidae). Journal of Economic Entomology 94: 55-59. F.A.O. 1979. Recommended methods for the detection and measurement of resistance of agricultural pests to pesticides - method for adult aphids. F.A.O. Plant Protection Bulletin 27: 29-32. Fernandes, M. E. S., F. M. Alves, R. C. Pereira, L. A. Aquino, F. L. Fernandes, and J. C. Zanuncio. 2016. Lethal and sublethal effects of seven insecticides on three beneficial insects in laboratory assays and field trials. Chemosphere 156: 45-55.

144 Feyereisen, R. 1999. Insect P450 enzymes. Annual Review of Entomology 44: 507-533. Feyereisen, R. 2012. Insect CYP genes and P450 enzymes. Insect Molecular Biology and Biochemistry: 236-316. Finney, D. J. 1971. Probit analysis, 3rd ed. ed. University Press, Cambridge [England]. Flint, M. L., S. H. Dreistadt, and J. K. Clark. 1998. Natural enemies handbook: the illustrated guide to biological pest control, UC Division of Agriculture and Natural Sciences; University of California Press, Oakland, Calif. Berkeley. Galvan, T. L., R. L. Koch, and W. D. Hutchison. 2005. Toxicity of commonly used insecticides in sweet corn and soybean to multicolored Asian lady beetle (Coleoptera: Coccinellidae). Journal of Economic Entomology 98: 780-789. Gardiner, M. M., D. A. Landis, C. Gratton, N. Schmidt, M. O'Neal, E. Mueller, J. Chacon, G. E. Heimpel, and C. D. DiFonzo. 2009. Landscape composition influences patterns of native and exotic lady beetle abundance. Diversity and Distributions 15: 554-564. Gentz, M. C., G. Murdoch, and G. F. King. 2010. Tandem use of selective insecticides and natural enemies for effective, reduced-risk pest management. Biological Control 52: 208- 215. Grafton-Cardwell, E. E., and P. Gu. 2003. Conserving vedalia beetle, Rodolia cardinalis (Mulsant) (Coleoptera: Coccinellidae), in citrus: A continuing challenge as new insecticides gain registration. Journal of Economic Entomology 96: 1388-1398. Hagen, K. S., R. van den Bosch, R. F. Smith, and V. M. Stern. 1959. The integration of chemical and biological control of the spotted alfalfa aphid: The integrated control concept. Hilgardia 29: 81-101. Hardin, M. R., B. Benrey, M. Coll, W. O. Lamp, G. K. Roderick, and P. Barbosa. 1995. Arthropod pest resurgence: An overview of potential mechanisms. Crop Protection 14: 3- 18. Harwood, J. D., N. Desneux, H. J. S. Yoo, D. L. Rowley, M. H. Greenstone, J. J. Obrycki, and R. J. O'Neil. 2007. Tracking the role of alternative prey in soybean aphid predation by Orius insidiosus: A molecular approach. Molecular Ecology 16: 4390-4400. Herrick, N. J., and R. A. Cloyd. 2017. Direct and indirect effects of pesticides on the insidious flower bug (Hemiptera: Anthocoridae) under laboratory conditions. Journal of Economic Entomology 110: 931-940. Hill, M. P., S. Macfadyen, and M. A. Nash. 2017. Broad spectrum pesticide application alters natural enemy communities and may facilitate secondary pest outbreaks. Peerj 5. Khot, A. C., G. Bingham, L. M. Field, and G. D. Moores. 2008. A novel assay reveals the blockade of esterases by piperonyl butoxide. Pest Management Science 64: 1139-1142. Koch, R. L., O. da Silva Queiroz, R. C. Aita, E. W. Hodgson, B. D. Potter, T. Nyoike, and C. D. Ellers-Kirk. 2019. Efficacy of afidopyropen against soybean aphid (Hemiptera: Aphididae) and toxicity to natural enemies. Pest Management Science.

145 Losey, J. E., and M. Vaughan. 2006. The economic value of ecological services provided by insects. Bioscience 56: 311-323. Mccaffrey, J. P., and R. L. Horsburgh. 1986. Biology of Orius insidiosus (Heteroptera: Anthocoridae): A predator in Virginia apple orchards. Environmental Entomology 15: 984-988. Mills, N. J., E. H. Beers, P. W. Shearer, T. R. Unruh, and K. G. Amarasekare. 2016. Comparative analysis of pesticide effects on natural enemies in western orchards: A synthesis of laboratory bioassay data. Biological Control 102: 17-25. Mizell, R. F., and M. C. Sconyers. 1992. Toxicity of imidacloprid to selected arthropod predators in the laboratory. Florida Entomologist 75: 277-280. Moscardini, V. F., P. C. Gontijo, J. P. Michaud, and G. A. Carvalho. 2015. Sublethal effects of insecticide seed treatments on two nearctic lady beetles (Coleoptera: Coccinellidae). Ecotoxicology 24: 1152-1161. Naranjo, S. E., and D. H. Akey. 2005. Conservation of natural enemies in cotton: comparative selectivity of acetamiprid in the management of Bemisia tabaci. Pest Management Science 61: 555-566. Nauen, R., U. Ebbinghaus-Kintscher, V. L. Salgado, and M. Kaussmann. 2003. Thiamethoxam is a neonicotinoid precursor converted to clothianidin in insects and plants. Pesticide Biochemistry and Physiology 76: 55-69. Ninsin, K. D., and T. Tanaka. 2005. Synergism and stability of acetamiprid resistance in a laboratory colony of Plutella xylostella. Pest Management Science 61: 723-727. Obrycki, J. J., J. D. Harwood, T. J. Kring, and R. J. O'Neil. 2009. Aphidophagy by coccinellidae: Application of biological control in agroecosystems. Biological Control 51: 244-254. Panini, M., F. Tozzi, C. Bass, C. T. Zimmer, L. Field, V. Borzatta, E. Mazzoni, and G. Moores. 2017. The interactions of piperonyl butoxide and analogues with the metabolic enzymes FE4 and CYP6CY3 of the green peach aphid Myzus persicae (Hemiptera: Aphididae). Pest Management Science 73: 371-379. Pasay, C., L. Arlian, M. Morgan, R. Gunning, L. Rossiter, D. Holt, S. Walton, S. Beckham, and J. McCarthy. 2009. The effect of insecticide synergists on the response of scabies mites to pyrethroid acaricides. Plos Neglected Tropical Diseases 3. Pezzini, D. T., and R. L. Koch. 2015. Compatibility of flonicamid and a formulated mixture of pyrethrins and azadirachtin with predators for soybean aphid (Hemiptera: Aphididae) management. Biocontrol Science and Technology 25: 1024-1035. Prabhaker, N., S. Naranjo, T. Perring, and S. Castle. 2017. Comparative toxicities of newer and conventional insecticides: Against four generalist predator species. Journal of Economic Entomology 110: 2630-2636.

146 Prabhaker, N., S. J. Castle, S. E. Naranjo, N. C. Toscano, and J. G. Morse. 2011. Compatibility of two systemic neonicotinoids, imidacloprid and thiamethoxam, with various natural enemies of agricultural pests. Journal of Economic Entomology 104: 773- 781. Prischmann, D. A., D. G. James, L. C. Wright, R. D. Teneyck, and W. E. Snyder. 2005. Effects of chlorpyrifos and sulfur on spider mites (Acari: Tetranychidae) and their natural enemies. Biological Control 33: 324-334. R Core Team. 2018. R: A language and environment for statistical computing. R Foundation for Statistical Computing, Vienna, Austria. Robertson, J. L., and N. G. Rappaport. 1979. Direct, indirect, and residual toxicities of insecticide sprays to western spruce budworm, Choristoneura occidentalis (Lepidoptera: Tortricidae). Canadian Entomologist 111: 1219-1226. Robertson, J. L., M. M. Jones, E. Olguin, and B. Alberts. 2017. Bioassays with arthropods. CRC Press, Boca Raton. Robertson, J. L., H. K. Preisler, S. S. Ng, L. A. Hickle, and W. D. Gelernter. 1995. Natural variation: A complicating factor in bioassays with chemical and microbial pesticides. Journal of Economic Entomology 88: 1-10. Rodriguez-Saona, C., A. C. Wanumen, J. Salamanca, R. Holdcraft, and V. Kyryczenko- Roth. 2016. Toxicity of insecticides on various life stages of two tortricid pests of cranberries and on a non-target predator. Insects 7. Romero, A., M. F. Potter, and K. F. Haynes. 2009. Evaluation of piperonyl butoxide as a deltamethrin synergist for pyrethroid-resistant bed bugs. Journal of Economic Entomology 102: 2310-2315. Rosenheim, J. A. 1998. Higher-order predators and the regulation of insect herbivore populations. Annual Review of Entomology 43: 421-447. Roubos, C. R., C. Rodriguez-Saona, R. Holdcraft, K. S. Mason, and R. Isaacs. 2014. Relative toxicity and residual activity of insecticides used in blueberry pest management: mortality of natural enemies. Journal of Economic Entomology 107: 277-285. Rutledge, C. E., and R. J. O'Neil. 2005. Orius insidiosus (Say) as a predator of the soybean aphid, Aphis glycines Matsumura. Biological Control 33: 56-64. Sanchez-Arroyo, H., P. G. Koehler, and S. M. Valles. 2001. Effects of the synergists piperonyl butoxide and S,S,S-tributyl phosphorotrithioate on pharmacokinetics in Blattella germanica (Blattodea: Blattellidae). Journal of Economic Entomology 94: 1209- 1216. Santos, K. F. A., O. Z. Zanardi, M. R. de Morais, C. R. O. Jacob, M. B. de Oliveira, and P. T. Yamamoto. 2017. The impact of six insecticides commonly used in control of agricultural pests on the generalist predator Hippodamia convergens (Coleoptera: Coccinellidae). Chemosphere 186: 218-226.

147 Savin, N. E., J. L. Robertson, and R. M. Russell. 1977. A critical evaluation of bioassay in insecticide research: Likelihood ratio tests of dose-mortality regression. Bulletin of the Entomological Society of America 23: 257-266. Schlapfer, F., B. Schmid, and I. Seidl. 1999. Expert estimates about effects of biodiversity on ecosystem processes and services. Oikos 84: 346-352. Scott, J. G. 1999. Cytochromes P450 and insecticide resistance. Insect Biochemistry and Molecular Biology 29: 757-777. Seagraves, M. P., and J. G. Lundgren. 2012. Effects of neonicitinoid seed treatments on soybean aphid and its natural enemies. Journal of Pest Science 85: 125-132. Smart, L. E., and J. H. Stevenson. 1982. Laboratory estimation of toxicity of pyrethroid insecticides to honeybees: Relevance to hazard in the field. World 63: 150-152. Sparks, T. C., and R. Nauen. 2015. IRAC: Mode of action classification and insecticide resistance management. Pesticide Biochemistry and Physiology 121: 122-128. Stapel, J. O., A. M. Cortesero, and W. J. Lewis. 2000. Disruptive sublethal effects of insecticides on biological control: Altered foraging ability and life span of a parasitoid after feeding on extrafloral nectar of cotton treated with systemic insecticides. Biological Control 17: 243-249. Stern, V. M., R. F. Smith, R. van den Bosch, and K. S. Hagen. 1959. The integration of chemical and biological control of the spotted alfalfa aphid: The integrated control concept. Hilgardia 29: 81-101. Studebaker, G. E., and T. J. Kring. 2000. Lethal and sublethal effects of early-season insecticides on insidious flower bug (Orius insidiosus): An important predator in cotton, pp. 221-225. In D. M. Oosterhuis (ed.), Proceedings of the 2000 Cotton Research Meeting and Summaries of Cotton Research in Progress. Arkansas Agricultural Experiment Station, Fayetteville. Studebaker, G. E., and T. J. Kring. 2003. Effects of insecticides on Orius insidiosus (Hemiptera: Anthocoridae), measured by field, greenhouse and petri dish bioassays. The Florida Entomologist 86: 178-185. Szczepaniec, A., S. F. Creary, K. L. Laskowski, J. P. Nyrop, and M. J. Raupp. 2011. Neonicotinoid insecticide imidacloprid causes outbreaks of spider mites on elm trees in urban landscapes. PloS One 6. Tillman, P. G., and J. E. Mulrooney. 2000. Effect of selected insecticides on the natural enemies Coleomegilla maculata and Hippodamia convergens (Coleoptera: Coccinellidae), Geocoris punctipes (Hemiptera: Lygaeidae), and Bracon mellitor, Cardiochiles nigriceps, and Cotesia marginiventris (Hymenoptera: Braconidae) in cotton. Journal of Economic Entomology 93: 1638-1643. Torres, J. B., and A. d. F. Bueno. 2018. Conservation biological control using selective insecticides - A valuable tool for IPM. Biological Control 126: 53-64.

148 Valles, S. M., P. G. Koehler, and R. J. Brenner. 1997. Antagonism of fipronil toxicity by piperonyl butoxide and S,S,S-tributyl phosphorotrithioate in the German cockroach (Dictyoptera: Blattellidae). Journal of Economic Entomology 90: 1254-1258. van den Bosch, R., and V. M. Stern. 1962. The Integration of Chemical and Biological Control of Arthropod Pests. Annual Review of Entomology 7: 367-386. van den Bosch, R., P. S. Messenger, and A. P. Gutierrez. 1982. An introduction to biological control, Springer, Boston, MA, Division of Biological Control, University of California, Berkeley, Albany, USA. van Lenteren, J. C. 1992. Biological control in protected crops: Where do we go? Pesticide Science 36: 321-327. van Lenteren, J. C., and J. Woets. 1988. Biological and integrated pest-control in greenhouses. Annual Review of Entomology 33: 239-269. Wang, P., L. L. Zhou, F. Yang, X. M. Liu, Y. Wang, C. L. Lei, and S. Y. Si. 2018. Lethal and behavioral sublethal side effects of thiamethoxam on the predator Harmonia axyridis. Entomologia Experimentalis Et Applicata 166: 703-712. Wilkinson, C. F. 1976. Insecticide biochemistry and physiology, Plenum Press, New York. Willoughby, L., P. Batterham, and P. J. Daborn. 2007. Piperonyl butoxide induces the expression of cytochrome P450 and glutathione S-transferase genes in Drosophila melanogaster. Pest Management Science 63: 803-808. Wu, G., Y. Wang, J. N. Wang, X. Z. Chen, Q. X. Hu, Y. F. Yang, and Q. Q. Liu. 2018. Vitality and stability of insecticide resistance in adult Propylaea japonica (Coleoptera: Coccinellidae). Journal of Insect Science 18. Xiao, D., J. Zhao, X. Guo, H. Chen, M. Qu, W. Zhai, N. Desneux, A. Biondi, F. Zhang, and S. Wang. 2016. Sublethal effects of imidacloprid on the predatory seven-spot ladybird beetle Coccinella septempunctata. Ecotoxicology 25: 1782-1793. Youn, Y. N., M. J. Seo, J. G. Shin, C. Jang, and Y. M. Yu. 2003. Toxicity of greenhouse pesticides to multicolored Asian lady beetles, Harmonia axyridis (Coleoptera: Coccinellidae). Biological Control 28: 164-170. Young, S. J., R. V. Gunning, and G. D. Moores. 2005. The effect of piperonyl butoxide on pyrethroid-resistance-associated esterases in Helicoverpa armigera (Hubner) (Lepidoptera: Noctuidae). Pest Management Science 61: 397-401. Young, S. J., R. V. Gunning, and G. D. Moores. 2006. Effect of pretreatment with piperonyl butoxide on pyrethroid efficacy against insecticide-resistant Helicoverpa armigera (Lepidoptera: Noctuidae) and Bemisia tabaci (: Aleyrodidae). Pest Management Science 62: 114-119. Zhao, J. Z., B. A. Bishop, and E. J. Grafius. 2000. Inheritance and synergism of resistance to imidacloprid in the Colorado potato beetle (Coleoptera: Chrysomelidae). Journal of Economic Entomology 93: 1508-1514.

149 Chapter 6: Summary and future directions

Insecticides are important tools in agriculture for pest control. However, insecticides could cause significant negative effects on off-target organisms if they are not properly used. The ultimate goals of this dissertation were to evaluate whether thiamethoxam seed treatment can be used for the management of soybean aphid virulence and to evaluate the potential effects of thiamethoxam on aphidophagous predatory natural enemies. In brief, I assessed mortality of avirulent and virulent soybean aphids on soybean from untreated or thiamethoxam-treated seeds.

I also estimated the mortality of convergent lady beetle and insidiosus flower bug when exposed to thiamethoxam via the food chain and topically. In general, I found that thiamethoxam could have a promising role for soybean aphid virulence management, but detrimental consequences on natural enemies as we summarized below.

Chapter 2 describes the survival of soybean aphid (i.e. biotype 1 and biotype 4) when exposed to thiamethoxam seed-treated soybean every week for the course of six weeks. Biotype

1 aphids are avirulent whereas biotype 4 are virulent to soybean host plant resistance. Along with soybean aphid survival, I estimated thiamethoxam residues in soybean plants. I found that thiamethoxam residues quickly declined within the first 28 days after planting, which correlates closely to the capacity of seed treatment to control soybean aphid up to 35–42 days after planting. Moreover, I found that soybean aphid virulence does not impart increased survival on seed-treated aphid-susceptible soybean (i.e. no cross-resistance), but on untreated soybean, biotype 4 had significantly higher survival than biotype 1. Given that both biotypes perform 150 poorly on aphid susceptible soybean treated with thiamethoxam, in Chapter 3 I evaluated whether seed treatments could be implemented for the control of virulent soybean aphids.

Chapter 3 provides additional insights whether a seed treatment could help in reducing the frequency of virulent aphids. In addition to a seed treatment, I also included an aphid- susceptible soybean refuge into the experimental design. Seed treatment was applied to either the aphid-resistant soybean (i.e. Rag-soybean) and/or to the aphid-susceptible soybeans. Soybean plants were infested with biotype 1 and biotype 4 soybean aphids in a 1:1 ratio every week over the course of six weeks. I found that when no seed treatment was applied, biotype 4 surpassed the biotype 1 population. However, by treating only the Rag-soybean but not the aphid- susceptible refuge, the population size of biotype 4 was lower than the avirulent population.

Therefore, I found that seed treatment in combination with an aphid-susceptible soybean refuge could contribute to the management of soybean aphid virulence. The chemical control of soybean aphid in Chapters 2 and 3, however, did not consider any potential effects thiamethoxam could have on biological control agents. Thus, in Chapter 4 we provided insights whether aphid control with thiamethoxam could affect predatory natural enemies.

In Chapter 4, I evaluated the effects of thiamethoxam via the food chain on the longevity of the predatory convergent lady beetle and insidiosus flower bug. As prey of natural enemies, we used the soybean aphid, the green peach aphid, and the melon aphid from thiamethoxam- treated soybean, zinnias, and green peppers, respectively. I found that thiamethoxam toxicity via food chain negatively affected insidiosus flower bug longevity, but not convergent lady beetles. I speculated that the lack of toxicity on convergent lady beetles could be caused by their tolerance to thiamethoxam, whereas the significant decrease in longevity of insidiosus flower might be associated to their susceptibility to thiamethoxam. In Chapter 5, therefore, I assessed via acute

151 toxicity trials (topical application) whether convergent lady beetle and insidiosus flower bug are tolerant or susceptible thiamethoxam.

In Chapter 5, I evaluated whether lady beetles are tolerant to thiamethoxam by performing topical applications to estimate the acute lethal concentration (LC50). Thiamethoxam

LC50 values were compared with acetamiprid, clothianidin, carbofuran, lambda-cyhalothrin, chlorantraniliprole, chlorpyrifos and flupyradifurone. LC50 of all insecticides were also estimated with the addition of piperonyl butoxide (PBO). In a similar way, LC50 of all insecticides with

PBO were also estimated for the insidiosus flower bug. I found that thiamethoxam has limited negative effects on convergent lady beetles. On the other hand, thiamethoxam was highly toxic to insidiosus flower bugs. I also observed that the inclusion of PBO does not always increase the toxicity of insecticides on both natural enemies.

6.1. Future directions of research

The chapters of this dissertation provide the fundamental insights to improve the soybean aphid virulence management and to mitigate the effects of insecticides on the convergent lady beetle and insidiosus flower bug. However, I consider the following cases are relevant to undertake for future research:

• In Chapter 2 I found that mortality of biotype 1 and biotype 4 aphids on thiamethoxam-

treated soybean are similar (Figure 3 and Figure 4). However, it is unknown at the

transcriptomic level if biotypes have similar gene expression profiles when they are

exposed to untreated or treated plants. Describing the transcriptomic patterns that occur

after feeding on a thiamethoxam-treated plant might reveal: 1) the mechanisms associated

to thiamethoxam detoxification in the soybean aphid in each biotype; 2) the potential

152 mechanisms associated to decreases in thiamethoxam susceptibility in soybean aphid

(Ribeiro et al. 2018); or 3) reveal biological mechanisms on the avirulent or virulent

aphids that benefit or obstruct their survival on thiamethoxam-treated plants.

• In Chapter 2 I observed an extended aphid control on soybean from insecticide-treated

seeds, despite the lack of seed treatment residue detection (Figure 3, Figure 4 and Figure

5). Under field conditions, seed treated soybean has also been observed to create delays

in peak soybean aphid population growth (Bahlai et al. 2015, Krupke et al. 2017),

however, it is still ambiguous how it occurs. Therefore, I propose to increase the time

window to evaluate aphid control by seed treatment from 42 to 120 days after planting.

Moreover, I suggest analyzing whether thiamethoxam treatment modifies the defenses or

physiology of soybean in comparison to untreated soybean. Thiamethoxam has been

observed to alter the plant chemistry, vigor and plant interaction with insects (Macedo

and Castro 2011, Almeida et al. 2014, Stamm et al. 2014).

• In Chapter 3 I found that by seed-treating Rag-soybean in combination with untreated

aphid-susceptible refuge, population of biotype 4 aphids stays lower than biotype 1.

However, I did not evaluate the effects the untreated refuge could have maintaining

populations of natural enemies, nor the effects of natural enemies on virulence

management. Therefore, for future experiments we propose to include natural enemies

(i.e. predators, parasitoids) into our experiments under the hypotheses that: 1) the

untreated refuge might promote the sustainability of natural enemies throughout the

growing season (see Lee et al. 2001); and 2) the action of natural enemies on the

untreated refuge might limit our ability to control soybean aphid virulence.

153 • In Chapter 4 I found that convergent lady beetles are not affected by thiamethoxam

insecticide accumulated in aphids (via the food chain), whereas insidiosus flower bugs

showed significantly shorter longevity. However, the effects of other systemic

insecticides (e.g. acetamiprid, clothianidin, flupyradifurone) could have via the food

chain are unknown. Therefore, I propose to evaluate whether convergent lady beetle or

insidiosus flower bug are affected by the accumulation of other systemic insecticides in

aphids. Moreover, I propose to evaluate not only longevity but also other biological

measurements (e.g. body weight, number of offspring per female, predation ability).

• In Chapter 5 I observed that the addition of piperonyl butoxide (PBO) synergized or

antagonized the toxicity of insecticides. I suspect that the addition of PBO might affect

the penetration of the insecticide through the insect cuticle (Sanchez-Arroyo et al. 2001,

Bingham et al. 2011) or modifying the bioactivation of the insecticides (Valles et al.

1997). Therefore, I propose: 1) to evaluate whether PBO modifies insecticide movement

through cuticle by performing penetration assessment (see Argentine et al. 1994); and 2)

to evaluate the whether the bioactivation of insecticides occur enzymatically (Brooks

1986, Fukuto 1990), chemically (Hayashi et al. 2013), or physically (Crombie et al. 1990,

Ujváry 2003). Elucidating whether PBO modifies the penetration or bioactivation of

insecticides will provide critical information to understand the potential effects

insecticides could cause on non-target organisms.

My proposed experiments could contribute with to the improvement of soybean aphid control and virulence management, as well as protecting natural enemies from insecticide applications.

154 6.2. References cited

Almeida, A. D., C. Deuner, C. T. Borges, G. E. Meneghello, A. Jauer, and F. A. Villela. 2014. Treatment of rice seeds with thiamethoxam: reflections on physiological performance. J Seed Sci 36: 458-464. Bahlai, C. A., W. vander Werf, M. O'Neal, L. Hemerik, and D. A. Landis. 2015. Shifts in dynamic regime of an invasive lady beetle are linked to the invasion and insecticidal management of its prey. Ecol Appl 25: 1807-1818. Bingham, G., C. Strode, L. Tran, P. T. Khoa, and H. P. Jamet. 2011. Can piperonyl butoxide enhance the efficacy of pyrethroids against pyrethroid-resistant Aedes aegypti? Trop Med Int Health 16: 492-500. Brooks, G. T. 1986. Insecticide metabolism and selective toxicity. Xenobiotica 16: 989-1002. Crombie, L., C. Royal Society of Chemistry . Fine, G. Medicinals, and G. Society of Chemical Industry . Pesticides. 1990. Recent advances in the chemistry of insect control II : the proceedings of the second international symposium, Royal Society of Chemistry, Cambridge [England]. Fukuto, T. R. 1990. Mechanism of action of organophosphorus and insecticides. Environ Health Persp 87: 245-254. Hayashi, N., Y. Sasama, N. Takahashi, and N. Ikemi. 2013. Cyflumetofen, a novel acaricide - its mode of action and selectivity. Pest Management Science 69: 1080-1084. Krupke, C. H., A. M. Alford, E. M. Cullen, E. W. Hodgson, J. J. Knodel, B. McCornack, B. D. Potter, M. I. Spigler, K. Tilmon, and K. Welch. 2017. Assessing the value and pest management window provided by neonicotinoid seed treatments for management of soybean aphid (Aphis glycines Matsumura) in the upper midwestern United States. Pest Management Science 73: 2184-2193. Lee, J. C., F. B. Menalled, and D. A. Landis. 2001. Refuge habitats modify impact of insecticide disturbance on carabid beetle communities. Journal of Applied Ecology 38: 472-483. Macedo, W. R., and P. R. D. E. Castro. 2011. Thiamethoxam: Molecule moderator of growth, metabolism and production of spring wheat. Pesticide Biochemistry and Physiology 100: 299-304. Ribeiro, M. G. P. D., T. E. Hunt, and B. D. Siegfried. 2018. Acute-contact and chronic- systemic in vivo bioassays: Regional monitoring of susceptibility to thiamethoxam in soybean aphid (Hemiptera: Aphididae) populations from the north central United States. Journal of Economic Entomology 111: 337-347. Sanchez-Arroyo, H., P. G. Koehler, and S. M. Valles. 2001. Effects of the synergists piperonyl butoxide and S,S,S-tributyl phosphorotrithioate on propoxur pharmacokinetics in Blattella germanica (Blattodea: Blattellidae). Journal of Economic Entomology 94: 1209- 1216.

155 Stamm, M. D., L. S. Enders, T. J. Donze-Reiner, F. P. Baxendale, B. D. Siegfried, and T. M. Heng-Moss. 2014. Transcriptional response of soybean to thiamethoxam seed treatment in the presence and absence of drought stress. Bmc Genomics 15. Ujváry, I. n. 2003. Propesticides. In J. R. Plimmer, D. W. Gammin and D. W. Ragsdale (eds.), Encyclopedia of Agrochemicals. Valles, S. M., P. G. Koehler, and R. J. Brenner. 1997. Antagonism of fipronil toxicity by piperonyl butoxide and S,S,S-tributyl phosphorotrithioate in the German cockroach (Dictyoptera: Blattellidae). Journal of Economic Entomology 90: 1254-1258.

156 Bibliography

Abraham, C. M., S. K. Braman, R. D. Oetting, and N. C. Hinkle. 2013. Pesticide compatibility with natural enemies for pest management in greenhouse gerbera daisies. Journal of Economic Entomology 106: 1590-1601. Al-Deeb, M. A., G. E. Wilde, and K. Y. Zhu. 2001. Effect of insecticides used in corn, sorghum, and alfalfa on the predator Orius insidiosus (Hemiptera: Anthocoridae). Journal of Economic Entomology 94: 1353-1360. Alleman, R. J., C. R. Grau, and D. B. Hogg. 2002. Soybean aphid host range and virus transmission efficiency, Proceedins of the Wisconsin Fertilizer, Aglime, and Pest Management Conference. University of Wisconsin-Madison. Almeida, A. D., C. Deuner, C. T. Borges, G. E. Meneghello, A. Jauer, and F. A. Villela. 2014. Treatment of rice seeds with thiamethoxam: reflections on physiological performance. Journal of Seed Science 36: 458-464. Alt, J., and M. Ryan-Mahmutagic. 2013. Soybean aphid biotype 4 identified. Crop Science 53. Amirzade, N., H. Izadi, M. A. Jalali, and H. Zohdi. 2014. Evaluation of three neonicotinoid insecticides against the common pistachio psylla, Agonoscena pistaciae, and its natural enemies. Journal of Insect Science 14. Aristizábal, L. F. 2014. The convergetn lady beetle, Hippodamia convergens Guérin-Méneville (Insecta: Coleoptera: Coccinellidae), Featured Creatures. Department of Entomology and Nematology, University of Florida. B-Bernard, C., and B. J. R. Philogene. 1993. Insecticide synergists: Role, importance, and perspectives. Journal of Toxicology and Environmental Health 38: 199-223. Bahlai, C. A., J. A. Welsman, A. W. Schaafsma, and M. K. Sears. 2007. Development of soybean aphid (Homoptera: Aphididae) on its primary overwintering host, Rhamnus cathadica. Environmental Entomology 36: 998-1006. Bahlai, C. A., M. Colunga-Garcia, S. H. Gage, and D. A. Landis. 2014. The role of exotic ladybeetles in the decline of native ladybeetle populations: evidence from long-term monitoring. Biological Invasions 17: 1005-1024. Bahlai, C. A., W. vander Werf, M. O'Neal, L. Hemerik, and D. A. Landis. 2015. Shifts in dynamic regime of an invasive lady beetle are linked to the invasion and insecticidal management of its prey. Ecolological Applications 25: 1807-1818.

157 Bahy El-Din, I. A., A. H. El-Heneidy, F. F. Shalaby, and A. A. Hafez. 2013. Evaluation of releasing the predator, Hippodamia convergens (geur.) (Coleoptera: Coccinellidae) against the cotton aphid, Aphis gossypii glover, infesting squash plants under semi-field conditions. Egyptian Journal of Biological Pest Control 23: 175-179. Barbosa, P. R. R., J. P. Michaud, C. L. Bain, and J. B. Torres. 2017a. Toxicity of three aphicides to the generalist predators Chrysoperla carnea (Neuroptera: Chrysopidae) and Orius insidiosus (Hemiptera: Anthocoridae). Ecotoxicology 26: 589-599. Barbosa, P. R. R., J. B. Torres, J. P. Michaud, and A. R. S. Rodrigues. 2017b. High concentrations of chlorantraniliprole reduce its compatibility with a key predator, Hippodamia convergens (Coleoptera: Coccinellidae). Journal of Economic Entomology 110: 2039-2045. Barbosa, P. R. R., M. D. Oliveira, E. M. Barros, J. P. Michaud, and J. B. Torres. 2018. Differential impacts of six insecticides on a mealybug and its coccinellid predator. Ecotoxicology and Environmental Safety 147: 963-971. Barry, J. D., H. E. Portillo, I. B. Annan, R. A. Cameron, D. G. Clagg, R. F. Dietrich, L. J. Watson, R. M. Leighty, D. L. Ryan, J. A. McMillan, R. S. Swain, and R. A. Kaczmarczyk. 2015. Movement of cyantraniliprole in plants after foliar applications and its impact on the control of sucking and chewing insects. Pest Management Science 71: 395-403. Bass, C., I. Denholm, M. S. Williamson, and R. Nauen. 2015. The global status of insect resistance to neonicotinoid insecticides. Pesticidie Biochemistry of Physiology 121: 78- 87. Bass, C., A. M. Puinean, C. T. Zimmer, I. Denholm, L. M. Field, S. P. Foster, O. Gutbrod, R. Nauen, R. Slater, and M. S. Williamson. 2014. The evolution of insecticide resistance in the peach potato aphid, Myzus persicae. Insect Biochemistry and Molecular Biology 51: 41-51. Bass, C., A. M. Puinean, M. Andrews, P. Cutler, M. Daniels, J. Elias, V. L. Paul, A. J. Crossthwaite, I. Denholm, L. M. Field, S. P. Foster, R. Lind, M. S. Williamson, and R. Slater. 2011. Mutation of a nicotinic acetylcholine receptor beta subunit is associated with resistance to neonicotinoid insecticides in the aphid Myzus persicae. BMC Neuroscience 12: 51. Bates, S. L., J. Z. Zhao, R. T. Roush, and A. M. Shelton. 2005. Insect resistance management in GM crops: past, present and future. Nature Biotechnology 23: 57-62. Beirne, B. P. 1972. Pest Insects of annual crop plants in Canada. IV. Hemiptera-Homoptera. V. Orthoptera. VI. Other Groups. Memoirs of the Entomological Society of Canada: 1-73. Bingham, G., C. Strode, L. Tran, P. T. Khoa, and H. P. Jamet. 2011. Can piperonyl butoxide enhance the efficacy of pyrethroids against pyrethroid-resistant Aedes aegypti? Tropical Medicine and International Health 16: 492-500. Bishop, G. W., and J. W. Guthrie. 1964. Home gardens as a source of the green peach aphid and virus diseases in Idaho. American Potato Journal 41: 28-34.

158 Blackman, R. L., and V. F. Eastop. 2000. Aphids on the world's crops: an identification and information guide, 2nd ed. ed. Wiley, Chichester, West Sussex, England. Bloomquist, J. R. 1996. Ion channels as targets for insecticides. Annual Review of Entomology 41: 163-190. Bodenheimer, F. S., and E. Swirski. 1957. The aphidoidea of the Middle East, Weizmann Science Press of Israel, Jerusalem. Bommarco, R., F. Miranda, H. Bylund, and C. Bjorkman. 2011. Insecticides suppress natural enemies and increase pest damage in cabbage. Journal of Economic Entomology 104: 782-791. Bosch, R. V. D., and V. M. Stern. 1962. The integration of chemical and biological control of arthropod pests. Annual Review of Entomology 7: 367-386. Bourguet, D., M. Desquilbet, and S. Lemarie. 2005. Regulating insect resistance management: the case of non-Bt corn refuges in the US. Journal of Environmental Management 76: 210-220. Brace, R. C., and W. R. Fehr. 2012. Impact of combining the Rag1 and Rag2 alleles for aphid resistance on agronomic and seed traits of soybean. Crop Science 52: 2070-2074. Bredeson, M. M., R. N. Reese, and J. G. Lundgren. 2015. The effects of insecticide dose and herbivore density on tri-trophic effects of thiamethoxam in a system involving wheat, aphids, and ladybeetles. Crop Protection 69: 70-76. Brewer, M. J., and T. Noma. 2010. Habitat affinity of resident natural enemies of the invasive Aphis glycines (Hemiptera: Aphididae), on soybean, with comments on biological control. Journal of Economic Entomology 103: 583-596. Brooks, G. T. 1986. Insecticide metabolism and selective toxicity. Xenobiotica 16: 989-1002. Bueno, V. H. P., and J. C. Van Lenteren. 2012. Predatory bugs (Heteroptera), pp. 539-569. In A. R. Panizzi and J. R. P. Parra (eds.), Insect Bioecology and Nutrition for Integrated Pest Management. Crc Press-Taylor & Francis Group, Boca Raton. Bünzli, G. H., and W. W. G. Büttiker. 1959. Host-plants of Myzus persicae Sulz., with a list of aphids of common occurrence in the tobacco growing districts of S. Rhodesia. Journal of the Entomological Society of Southern Africa 22: 35-50. Butler, C. D., and R. J. O’Neil. 2007. Life history characteristics of Orius insidiosus (Say) fed Aphis glycines Matsumura. Biological Control 40: 333-338. Camargo, C., T. E. Hunt, L. J. Giesler, and B. D. Siegfried. 2017. Thiamethoxam toxicity and effects on consumption behavior in Orius insidiosus (Hemiptera: Anthocoridae) on soybean. Environmental Entomology 46: 693-699. Capinera, J. L. 2001. Handbook of vegetable pests. Academic Press, San Diego, Calif. Cardinale, B. J., C. T. Harvey, K. Gross, and A. R. Ives. 2003. Biodiversity and biocontrol: emergent impacts of a multi-enemy assemblage on pest suppression and crop yield in an agroecosystem. Ecology Letters 6: 857-865.

159 Carriere, Y., and B. E. Tabashnik. 2001. Reversing insect adaptation to transgenic insecticidal plants. Proceedings of the Royal Society B: Biological Sciences 268: 1475-1480. Carscallen, G. E., S. V. Kher, and M. L. Evenden. 2019. Efficacy of chlorantraniliprole seed treatments against armyworm (Mythimna unipuncta [Lepidoptera: Noctuidae]) larvae on corn (Zea mays). Journal of Economic Entomology 112: 188-195. Casida, J. E. 1963. Mode of action of carbamates. Annual Review of Entomology 8: 39-58. Casida, J. E., and K. A. Durkin. 2013. Neuroactive insecticides: targets, selectivity, resistance, and secondary effects. Annual Review of Entomology 58: 99-117. Castle, S. J., F. J. Byrne, J. L. Bi, and N. C. Toscano. 2005. Spatial and temporal distribution of imidacloprid and thiamethoxam in citrus and impact on Homalodisca coagulata populations. Pest Management Science 61: 75-84. Chagnon, M., D. Kreutzweiser, E. A. Mitchell, E. A. Mitchell, C. A. Morrissey, D. A. Noome, D. A. Noome, J. P. Van der Sluijs, and J. P. Van der Sluijs. 2015. Risks of large-scale use of systemic insecticides to ecosystem functioning and services. Environmental Science and Pollution Research 22: 119-134. Cloyd, R. A., and J. A. Bethke. 2011. Impact of neonicotinoid insecticides on natural enemies in greenhouse and interiorscape environments. Pest Management Science 67: 3-9. Cloyd, R. A., and N. J. Herrick. 2018. Effects of pesticides on the survival of rove beetle (Coleoptera: Staphylinidae) and insidious flower bug (Hemiptera: Anthocoridae) adults. Journal of Economic Entomology 111: 78-88. Colares, F., J. P. Michaud, C. L. Bain, and J. B. Torres. 2017. Relative toxicity of two aphicides to Hippodamia convergens (Coleoptera: Coccinellidae): implications for integrated management of sugarcane aphid, Melanaphis sacchari (Hemiptera: Aphididae). Journal of Economic Entomology 110: 52-58. Cooper, S. G., V. Concibido, R. Estes, D. Hunt, G.-L. Jiang, C. Krupke, B. McCornack, R. Mian, M. O’Neal, V. Poysa, D. Prischmann-Voldseth, D. Ragsdale, N. Tinsley, and D. Wang. 2015. Geographic distribution of soybean aphid biotypes in the United States and Canada during 2008–2010. Crop Science 55. Costamagna, A. C., and D. A. Landis. 2006. Predators exert top-down control of soybean aphid across a gradient of agricultural management systems. Ecological Applications 16: 1619-1628. Costamagna, A. C., W. van der Werf, F. J. J. A. Bianchi, and D. A. Landis. 2007. An exponential growth model with decreasing r captures bottom-up effects on the population growth of Aphis glycines Matsumura (Hemiptera: Aphididae). Agricultural and Forest Entomology 9: 297-305. Croft, B. A., and A. W. Brown. 1975. Responses of arthropod natural enemies to insecticides. Annual Review of Entomology 20: 285-335. Croft, B. A., and M. E. Whalon. 1982. Selective toxicity of pyrethroid insecticides to arthropod natural enemies and pests of agricultural crops. Entomophaga 27: 3-21.

160 Crombie, L., C. Royal Society of Chemistry . Fine, G. Medicinals, and G. Society of Chemical Industry . Pesticides. 1990. Recent advances in the chemistry of insect control II : the proceedings of the second international symposium, Royal Society of Chemistry, Cambridge [England]. Crowder, D. W., and Y. Carriere. 2009. Comparing the refuge strategy for managing the evolution of insect resistance under different reproductive strategies. Journal Theoretical Biology 261: 423-430. Davies, T. G. E., L. M. Field, P. N. R. Usherwood, and M. S. Williamson. 2007. DDT, pyrethrins, pyrethroids and insect sodium channels. IUBMB Life 59: 151-162. Davis, J. R., and R. L. Kirkland. 1982. Physiological and environmental factors related to the dispersal flight of the convergent lady beetle, Hippodamia convergens (Guerin- Meneville). Journal of the Kansas Entomological Society 55: 187-196. Demkovich, M., C. E. Dana, J. P. Siegel, and M. R. Berenbaum. 2015. Effect of piperonyl butoxide on the toxicity of four classes of insecticides to navel orange worm (Amyelois transitella) (Lepidoptera: Pyralidae). Journal of Economic Entomology 108: 2753-2760. Desneux, N., R. J. O'Neil, and H. J. S. Yoo. 2006a. Suppression of population growth of the soybean aphid, Aphis glycines Matsumura, by predators: The identification of a key predator and the effects of prey dispersion, predator abundance, and temperature. Environmental Entomology 35: 1342-1349. Desneux, N., R. Denoyelle, and L. Kaiser. 2006b. A multi-step bioassay to assess the effect of the deltamethrin on the parasitic wasp Aphidius ervi. Chemosphere 65: 1697-1706. Desneux, N., A. Decourtye, and J. M. Delpuech. 2007. The sublethal effects of pesticides on beneficial arthropods. Annual Review of Entomology 52: 81-106. Diehl, S. R., and G. L. Bush. 1984. An evolutionary and applied perspective of insect biotypes. Annual Review of Entomology 29: 471-504. Diez-Rodriguez, G. I., G. C. De Baptista, L. R. P. Trevizan, M. L. Haddad, and D. E. Nava. 2006. Residues of thiamethoxam, aldicarb and its metabolites in coffee leaves and effect on the control of Leucoptera coffeella (Guerin-Meneville) (Lepidoptera: Lyonetiidae). Neotropical Entomology 35: 257-263. Dixon, A. F. G., J. L. Hemptinne, and P. Kindlmann. 1997. Effectiveness of ladybirds as biological control agents: Patterns and processes. Entomophaga 42: 71-83. Douglas, M. R., and J. F. Tooker. 2015. Large-scale deployment of seed treatments has driven rapid increase in use of neonicotinoid insecticides and preemptive pest management in US field crops. Environmental Science and Technology 49: 5088-5097. Douglas, M. R., and J. F. Tooker. 2016. Meta-analysis reveals that seed-applied neonicotinoids and pyrethroids have similar negative effects on abundance of arthropod natural enemies. PeerJ 4: e2776. Douglas, M. R., J. R. Rohr, and J. F. Tooker. 2015. Neonicotinoid insecticide travels through a soil food chain, disrupting biological control of non-target pests and decreasing soya bean yield. Journal of Applied Ecology 52: 250-260. 161 Dreistadt, S. H., and M. L. Flint. 1996. Melon Aphid (Homoptera: Aphididae) control by inundative convergent lady beetle (Coleoptera: Coccinellidae) release on chrysanthemum. Environmental Entomology 25: 688-697. Dutcher, J. D. 2007. A review of resurgence and replacement causing pest outbreaks in IPM, pp. 27-43. In A. Ciancio and K. G. Mukerji (eds.), General Concepts in Integrated Pest and Disease Management. Springer Netherlands, Dordrecht. E.P.A. 2010. Chlorantraniliprole: Pesticide tolerances, pp. 5526-5535. Environmental Protection Agency. E.P.A. 2017. Registration division conventional pesticides - Branch and product manager (PM) assignments. E.P.A. Ebert, T. A. 1997. Biology and ecology of Aphis gossypii Glover (Homoptera: Aphididae). The Southwestern Entomologist 22: 116-153. Eigenbrode, S. D., and J. T. Trumble. 1994. Host-plant resistance to insects in integrated pest- management in vegetable crops. Journal of Agricultural Entomology 11: 201-224. Elzen, G. W. 2001. Lethal and sublethal effects of insecticide residues on Orius insidiosus (Hemiptera: Anthocoridae) and Geocoris punctipes (Hemiptera: Lygaeidae). Journal of Economic Entomology 94: 55-59. Esquivel, C. J., C. M. Ranger, P. L. Phelan, E. J. Martinez, W. H. Hendrix, L. A. Canas, and A. P. Michel. 2019. Weekly survivorship curves of soybean aphid biotypes 1 and 4 on insecticidal seed-treated soybean. Journal of Economic Entomology 112: 712-719. F.A.O. 1979. Recommended methods for the detection and measurement of resistance of agricultural pests to pesticides - method for adult aphids. F.A.O. Plant Protection Bulletin 27: 29-32. FAOSTAT 1997. FAOSTAT statistical database computer program, version By FAOSTAT, Rome, Italy. Fehr, W. R., C. E. Caviness, D. T. Burmood, and J. S. Pennington. 1971. Stage of development descriptions for soybeans, Glycine max (L) Merrill. Crop Science 11: 929- 931. Fereres, A., M. J. Blua, and T. M. Perring. 1992. Retention and transmission characteristics of zucchini yellow mosaic virus by Aphis gossypii and Myzus persicae (Homoptera: Aphididae). Journal of Economic Entomology 85: 759-765. Fernandes, M. E. S., F. M. Alves, R. C. Pereira, L. A. Aquino, F. L. Fernandes, and J. C. Zanuncio. 2016. Lethal and sublethal effects of seven insecticides on three beneficial insects in laboratory assays and field trials. Chemosphere 156: 45-55. Feyereisen, R. 1999. Insect P450 enzymes. Annual Review of Entomology 44: 507-533. Feyereisen, R. 2012. Insect CYP genes and P450 enzymes. Insect Molecular Biology and Biochemistry: 236-316.

162 Field, L. M., R. L. Blackman, C. Tyler-Smith, and A. L. Devonshire. 1999. Relationship between amount of esterase and gene copy number in insecticide-resistant Myzus persicae (Sulzer). Biochemical Journal 339: 737-742. Finney, D. J. 1971. Probit analysis, 3rd ed. ed. University Press, Cambridge [England]. Flanders, K. L., E. B. Radcliffe, and D. W. Ragsdale. 1991. Potato leafroll virus spread in relation to densities of green peach aphid (Homoptera: Aphididae): Implications for management thresholds for Minnesota seed potatoes. Journal of Economic Entomology 84: 1028-1036. Fleschner, C. A. 1961. Biological control of insect pests. Journal of Applied Nutrition 14: 154- 162. Flint, M. L., and S. H. Dreistadt. 2005. Interactions among convergent lady beetle (Hippodamia convergens) releases, aphid populations, and rose cultivar. Biological Control 34: 38-46. Flint, M. L., S. H. Dreistadt, and J. K. Clark. 1998. Natural enemies handbook: the illustrated guide to biological pest control, UC Division of Agriculture and Natural Sciences; University of California Press, Oakland, Calif. Berkeley. Ford, K. A., J. E. Casida, D. Chandran, A. G. Gulevich, R. A. Okrent, K. A. Durkin, R. Sarpong, E. M. Bunnelle, and M. C. Wildermuth. 2010. Neonicotinoid insecticides induce salicylate-associated plant defense responses. Proceedings of the National Academy of Sciences of the United States of America 107: 17527-17532. Fox, T. B., D. A. Landis, F. F. Cardoso, and C. D. Difonzo. 2004. Predators suppress Aphis glycines Matsumura population growth in soybean. Environmental Entomology 33: 608- 618. Fuchs, T. W., and R. Minzenmayer. 1995. Effect of Aphis gossypii Homopera, Aphididae on cotton development and yield in west Texas. Southwestern Entomology 20: 341-349. Fukuto, T. R. 1990. Mechanism of action of organophosphorus and carbamate insecticides. Environmental Health Perspectives 87: 245-254. Gaber, A. S., A. A. Abd-Ella, G. H. Abou-Elhagag, and Y. A. Abdel-Rahman. 2015. Field efficiency and selectivity effects of selected insecticides on cotton aphid, Aphis gossypii Glover (Homoptera: Aphididea) and its predators. Journal of Phytopathology and Pest Management 2. Galvan, T. L., R. L. Koch, and W. D. Hutchison. 2005. Toxicity of commonly used insecticides in sweet corn and soybean to multicolored Asian lady beetle (Coleoptera: Coccinellidae). Journal of Economic Entomology 98: 780-789. Gardiner, M. M., D. A. Landis, C. Gratton, N. Schmidt, M. O'Neal, E. Mueller, J. Chacon, G. E. Heimpel, and C. D. DiFonzo. 2009. Landscape composition influences patterns of native and exotic lady beetle abundance. Diversity and Distributions 15: 554-564. Gassmann, A. J., J. L. Petzold-Maxwell, R. S. Keweshan, and M. W. Dunbar. 2011. Field- evolved resistance to Bt maize by western corn rootworm. PLoS One 6: e22629.

163 Gentz, M. C., G. Murdoch, and G. F. King. 2010. Tandem use of selective insecticides and natural enemies for effective, reduced-risk pest management. Biological Control 52: 208- 215. Georghiou, G. P., and C. E. Taylor. 1977. Genetic and biological influences in the evolution of insecticide resistance. Journal of Economic Entomology 70: 319-323. Gilkeson, L. A., and S. B. Hill. 1987. Release rates for control of green peach aphid (Homoptera: Aphidae) by the predatory midge Aphidoletes aphidimyza (Diptera: Cecidomyiidae) under winter greenhouse conditions. Journal of Economic Entomology 80: 147-150. Gontijo, P. C., V. F. Moscardini, J. P. Michaud, and G. A. Carvalho. 2014. Non-target effects of chlorantraniliprole and thiamethoxam on Chrysoperla carnea when employed as sunflower seed treatments. Journal of Pest Science 87: 711-719. Gore, J., D. Cook, A. Catchot, B. R. Leonard, S. D. Stewart, G. Lorenz, and D. Kerns. 2013. Cotton aphid (Heteroptera: Aphididae) susceptibility to commercial and experimental insecticides in the southern United States. Journal of Economic Entomology 106: 1430- 1439. Gould, F. 1998. Sustainability of transgenic insecticidal cultivars: integrating pest genetics and ecology. Annual Review of Entomology 43: 701-726. Grafton-Cardwell, E. E., and P. Gu. 2003. Conserving vedalia beetle, Rodolia cardinalis (Mulsant) (Coleoptera: Coccinellidae), in citrus: A continuing challenge as new insecticides gain registration. Journal of Economic Entomology 96: 1388-1398. Guedes, R. N., G. Smagghe, J. D. Stark, and N. Desneux. 2016. Pesticide-induced stress in arthropod pests for optimized integrated pest management programs. Annual Review of Entomology 61: 43-62. Hagen, K. S. 1962. Biology and ecology of predaceous coccinellidae. Annual Review of Entomology 7: 289-326. Hagen, K. S., R. van den Bosch, R. F. Smith, and V. M. Stern. 1959. The integration of chemical and biological control of the spotted alfalfa aphid: The integrated control concept. Hilgardia 29: 81-101. Hagler, J. 2009. Comparative studies of predation among feral, commercially-purchased, and laboratory-reared predators. Journal of the International Organization for Biological Control 54: 351-361. Hanson, A. A., and R. L. Koch. 2018. Interactions of host-plant resistance and foliar insecticides for soybean aphid management. Crop Protection 112: 232-238. Hanson, A. A., J. Menger-Anderson, C. Silverstein, B. D. Potter, I. V. MacRae, E. W. Hodgson, and R. L. Koch. 2017. Evidence for soybean aphid (Hemiptera: Aphididae) resistance to pyrethroid insecticides in the upper midwestern United States. Journal of Economic Entomology 110: 2235-2246.

164 Hardin, M. R., B. Benrey, M. Coll, W. O. Lamp, G. K. Roderick, and P. Barbosa. 1995. Arthropod pest resurgence: An overview of potential mechanisms. Crop Protection 14: 3- 18. Hargrave, B. T., G. C. Harding, W. P. Vass, P. E. Erickson, B. R. Fowler, and V. Scott. 1992. Organochlorine pesticides and polychlorinated-biphenyls in the arctic-ocean food web. Archives of Environmental Contamination and Toxicology 22: 41-54. Harwood, J. D., N. Desneux, H. J. S. Yoo, D. L. Rowley, M. H. Greenstone, J. J. Obrycki, and R. J. O'Neil. 2007. Tracking the role of alternative prey in soybean aphid predation by Orius insidiosus: A molecular approach. Molecular Ecology 16: 4390-4400. Hayashi, N., Y. Sasama, N. Takahashi, and N. Ikemi. 2013. Cyflumetofen, a novel acaricide - its mode of action and selectivity. Pest Management Science 69: 1080-1084. Heathcote, G. D. 1962. The suitability of some plant hosts for the development of the peach- potato aphid, Myzus persicae (Sulzer). Entomologia Experimentalis et Applicata 5: 114- 118. Heinz, K. M., R. Van Driesche, and M. P. Parrella. 2004. Biocontrol in protected culture, Ball Pub., Batavia, Ill. Herrick, N. J., and R. A. Cloyd. 2017. Direct and indirect effects of pesticides on the insidious flower bug (Hemiptera: Anthocoridae) under laboratory conditions. Journal of Economic Entomology 110: 931-940. Herron, G. A., and L. J. Wilson. 2011. Neonicotinoid resistance in Aphis gossypii Glover (Aphididae: Hemiptera) from Australian cotton. Australian Journal of Entomology 50: 93-98. Hesler, L. S., K. C. Allen, R. G. Luttrell, T. W. Sappington, and S. K. Papiernik. 2018. Early-season pests of soybean in the United States and factors that affect their risk of infestation. Journal of Integrated Pest Management 9. Hesler, L. S., M. V. Chiozza, M. E. O'Neal, G. C. MacIntosh, K. J. Tilmon, D. I. Chandrasena, C. D. Difonzo, N. A. Tinsley, K. Steffey, S. R. Cianzio, A. C. Costamagna, D. W. Ragsdale, E. M. Cullen, B. D. Potter, and K. J. Koehler. 2013. Performance and prospects of Rag genes for management of soybean aphid. Entomologia Experimentalis et Applicata 147: 201-216. Hill, C. B., L. Yan, and G. L. Hartman. 2004. Resistance to the soybean aphid in soybean germplasm. Crop Science 44. Hill, C. B., Y. Li, and G. L. Hartman. 2006. A single dominant gene for resistance to the soybean aphid in the soybean cultivar Dowling. Crop Science 46. Hill, C. B., L. Yan, and G. L. Hartman. 2007. Soybean aphid resistance in soybean Jackson is controlled by a single dominant gene. Crop Science 47. Hill, C. B., A. Chirumamilla, and G. L. Hartman. 2012. Resistance and virulence in the soybean Aphis glycines interaction. Euphytica: International Journal of Plant Breeding 186: 635-646.

165 Hill, C. B., L. Crull, T. K. Herman, D. J. Voegtlin, and G. L. Hartman. 2010. A new soybean aphid (Hemiptera: Aphididae) biotype identified. Journal of Economic Entomology 103: 509-515. Hill, M. P., S. Macfadyen, and M. A. Nash. 2017. Broad spectrum pesticide application alters natural enemy communities and may facilitate secondary pest outbreaks. Peerj 5. Hodek, I. 1973. Biology of Coccinellidae, 1 ed. Springer Netherlands, The Hague. Hodek, I., A. Honěk, and H. F. Van Emden. 2012. Ecology and behaviour of the ladybird beetles (coccinellidae). John Wiley & Sons, Hoboken. Hodgson, E. W., G. VanNostrand, and M. E. O’Neal. 2010. 2010 yellow book: report of insecticide evaluation for soybean aphid. Iowa State University. Hodgson, E. W., B. P. McCornack, K. Tilmon, and J. J. Knodel. 2012. Management recommendations for soybean aphid (Hemiptera: Aphididae) in the United States. Journal of Integrated Pest Management 3: E1-E10. Holman, J. 2009. Host plant catalog of aphids: Palaearctic region, Springer. Horwitz, W. 2000. Official methods of analysis of AOAC International, 17th ed. ed. AOAC International, Gaithersburg, Md. Hummel, N. A., A. Meszaros, D. R. Ring, J. M. Beuzelin, and M. J. Stout. 2014. Evaluation of seed treatment insecticides for management of the rice water weevil, Lissorhoptrus oryzophilus Kuschel (Coleoptera: Curculionidae), in commercial rice fields in Louisiana. Crop Protection 65: 37-42. Hurley, T., and P. Mitchell. 2017. Value of neonicotinoid seed treatments to US soybean farmers. Pest Management Science 73: 102-112. Huseth, A. S., J. Lindholm, C. L. Groves, and R. L. Groves. 2014. Variable concentration of soil-applied insecticides in potato over time: implications for management of Leptinotarsa decemlineata. Pest Management Science 70: 1863-1871. Hutchison, W. D., E. C. Burkness, P. D. Mitchell, R. D. Moon, T. W. Leslie, S. J. Fleischer, M. Abrahamson, K. L. Hamilton, K. L. Steffey, M. E. Gray, R. L. Hellmich, L. V. Kaster, T. E. Hunt, R. J. Wright, K. Pecinovsky, T. L. Rabaey, B. R. Flood, and E. S. Raun. 2010. Areawide suppression of European corn borer with Bt maize reaps savings to non-Bt maize growers. Science 330: 222-225. Ioannides, C. 1991. Public health impact of pesticides ssed in agriculture. Journal of the Royal Society of Health 111: 206-206. Jacobson, R. J., and P. Croft. 1998. Strategies for the control of Aphis gossypii Glover (Hom.: Aphididae) with Aphidius colemani Viereck (Hym.: Braconidae) in protected cucumbers. Biocontrol Science and Technology 8: 377-387. Jansson, R. K., and Z. Smilowitz. 1986. Influence of nitrogen on population parameters of potato insects: Abundance, population growth, and within-plant distribution of the green peach aphid, Myzus persicae (Homoptera: Aphididae). Environmental Entomology 15: 49-55.

166 Jeschke, P., R. Nauen, M. Schindler, and A. Elbert. 2011. Overview of the status and global strategy for neonicotinoids. Journal of Agricultural and Food Chemistry 59: 2897-2908. Jyoti, J. L., and J. P. Michaud. 2005. Comparative biology of a novel strain of russian wheat aphid (Homoptera: Aphididae) on three wheat cultivars. Journal of Economic Entomology 98: 1032-1039. Kandel, D. R., K. J. Tilmon, and T. L. Shuster. 2015. Effect of host plant resistance and seed treatments on soybean aphids (Hemiptera: Aphididae) and their natural enemies. Journal of Entomological Science 50: 186-205. Kaplan, E. L., and P. Meier. 1958. Nonparametric-estimation from incomplete observations. Journal of the American Statistical Association 53: 457-481. Kasai, S., I. S. Weerashinghe, and T. Shono. 1998. P450 monooxygenases are an important mechanism of permethrin resistance in Culex quinquefasciatus Say larvae. Archives of Insect Biochemistry and Physiology 37: 47-56. Kennedy, J. S., M. F. Day, and V. F. Eastop. 1962. A conspectus of aphids as vectors of plant viruses, Commonwealth Institute of Entomology, London. Khot, A. C., G. Bingham, L. M. Field, and G. D. Moores. 2008. A novel assay reveals the blockade of esterases by piperonyl butoxide. Pest Management Science 64: 1139-1142. Kim, K.-S., C. B. Hill, G. L. Hartman, M. A. R. Mian, and B. W. Diers. 2008. Discovery of soybean aphid biotypes. Crop Science 48. Kiman, Z. B., and K. V. Yeargan. 1985. Development and reproduction of the predator Orius insidiosus (Hemiptera: Anthocoridae) reared on diets of selected plant material and arthropod prey. Annals of the Entomological Society of America 78: 464-467. Koch, K. A., B. D. Potter, and D. W. Ragsdale. 2010. Non-target impacts of soybean rust fungicides on the fungal entomopathogens of soybean aphid. Journal of Invertebrate Pathology 103: 156-164. Koch, R. L., E. W. Hodgson, J. J. Knodel, A. J. Varenhorst, and B. D. Potter. 2018. Management of insecticide-resistant soybean aphids in the upper midwest of the United States. Journal of Integrated Pest Management 9. Koch, R. L., O. da Silva Queiroz, R. C. Aita, E. W. Hodgson, B. D. Potter, T. Nyoike, and C. D. Ellers-Kirk. 2019. Efficacy of afidopyropen against soybean aphid (Hemiptera: Aphididae) and toxicity to natural enemies. Pest Management Science. Komazaki, S. 1994. Ecology of citrus aphids and their importance to virus transmission. Japan Agricultural Research Quarterly 28: 177. Krell, R. K., L. P. Pedigo, J. H. Hill, and M. E. Rice. 2004. Bean leaf beetle (Coleoptera: Chrysomelidae) management for reduction of bean pod mottle virus. Journal of Economic Entomology 97: 192-202. Kring, J. B. 1959. The Life cycle of the melon aphid, Aphis gossypii Glover, an example of facultative migration. Annals of the Entomological Society of America 52: 284-286.

167 Krupke, C. H., A. M. Alford, E. M. Cullen, E. W. Hodgson, J. J. Knodel, B. McCornack, B. D. Potter, M. I. Spigler, K. Tilmon, and K. Welch. 2017. Assessing the value and pest management window provided by neonicotinoid seed treatments for management of soybean aphid (Aphis glycines Matsumura) in the upper midwestern United States. Pest Management Science 73: 2184-2193. Lahm, G. P., D. Cordova, and J. D. Barry. 2009. New and selective ryanodine receptor activators for insect control. Bioorganic and Medical Chemistry 17: 4127-4133. Lee, J. C., F. B. Menalled, and D. A. Landis. 2001. Refuge habitats modify impact of insecticide disturbance on carabid beetle communities. Journal of Applied Ecology 38: 472-483. Lee, J. H., N. C. Elliott, S. D. Kindler, B. W. French, C. B. Walker, and R. D. Eikenbary. 2005. Natural enemy impact on the russian wheat aphid in southeastern Colorado. Environmental Entomology 34: 115-123. Legind, C. N., C. M. Kennedy, A. Rein, N. Snyder, and S. Trapp. 2011. Dynamic plant uptake model applied for drip irrigation of an insecticide to pepper fruit plants. Pest Management Science 67: 521-527. Liu, X., M. Chen, H. L. Collins, D. W. Onstad, R. T. Roush, Q. Zhang, E. D. Earle, and A. M. Shelton. 2014. Natural enemies delay insect resistance to Bt crops. PLoS One 9: e90366. Losey, J. E., and M. Vaughan. 2006. The economic value of ecological services provided by insects. Bioscience 56: 311-323. Lundgren, J. G., and J. K. Fergen. 2006. The oviposition behavior of the predator Orius insidiosus: Acceptability and preference for different plants. Biocontrol 51: 217-227. Macedo, W. R., and P. R. D. E. Castro. 2011. Thiamethoxam: Molecule moderator of growth, metabolism and production of spring wheat. Pesticide Biochemistry and Physiology 100: 299-304. Mackauer, M. 1968. Insect parasites of the green peach aphid, Myzus persicae Sulz, and their control potential. Entomophaga 13: 91-106. Magalhaes, L. C., T. E. Hunt, and B. D. Siegfried. 2009. Efficacy of neonicotinoid seed treatments to reduce soybean aphid populations under field and controlled conditions in Nebraska. Journal of Economic Entomology 102: 187-195. Maienfisch, P., M. Angst, F. Brandl, W. Fischer, D. Hofer, H. Kayser, W. Kobel, A. Rindlisbacher, R. Senn, A. Steinemann, and H. Widmer. 2001. Chemistry and biology of thiamethoxam: a second generation neonicotinoid. Pest Management Science 57: 906- 913. Malais, M., W. J. Ravensberg, S. King, G.-J. Terwolde, P. Walker, and S. Koppert Biological. 1992. Knowing and recognizing: the biology of glasshouse pests and their natural enemies, 1st ed. ed. Koppert Biological Systems, Berkel en Rodenrijs, the Netherlands.

168 Martinez-Torres, D., S. P. Foster, L. M. Field, A. L. Devonshire, and M. S. Williamson. 1999. A sodium channel point mutation is associated with resistance to DDT and pyrethroid insecticides in the peach-potato aphid, Myzus persicae (Sulzer) (Hemiptera: Aphididae). Insect Molecular Biology 8: 339-346. Mccaffrey, J. P., and R. L. Horsburgh. 1986. Biology of Orius insidiosus (Heteroptera: Anthocoridae): A predator in Virginia apple orchards. Environmental Entomology 15: 984-988. McCarville, M. T., and M. E. O'Neal. 2013. Soybean aphid (Aphididae: Hemiptera) population growth as affected by host plant resistance and an insecticidal seed treatment. Journal of Economic Entomology 106: 1302-1309. McCarville, M. T., E. W. Hodgson, and M. O’Neal. 2012. Soybean aphid-resistant soybean varieties for Iowa. Iowa State University Extension and Outreach, Ames. IA, USA. McCarville, M. T., M. E. O'Neal, B. D. Potter, K. J. Tilmon, E. M. Cullen, B. P. McCornack, J. F. Tooker, and D. A. Prischmann-Voldseth. 2014. One gene versus two: A regional study on the efficacy of single gene versus pyramided resistance for soybean aphid management. Journal of Economic Entomology 107: 1680-1687. McCornack, B., and D. W. Ragsdale. 2006. Efficacy of thiamethoxam to suppress soybean aphid populations in Minnesota soybean. Crop management. Mignault, M.-P., M. l. Roy, and J. Brodeur. 2006. Soybean aphid predators in Québec and the suitability of Aphis glycines as prey for three coccinellidae. BioControl 51: 89-106. Mills, N. J., E. H. Beers, P. W. Shearer, T. R. Unruh, and K. G. Amarasekare. 2016. Comparative analysis of pesticide effects on natural enemies in western orchards: A synthesis of laboratory bioassay data. Biological Control 102: 17-25. Milner, R. J., and G. G. Lutton. 1986. Dependence of Verticillium lecanii (Fungi: Hyphomycetes) on high humidities for infection and sporulation using Myzus persicae (Homoptera: Aphididae) as host. Environmental Entomology 15: 380-382. Mizell, R. F., and M. C. Sconyers. 1992. Toxicity of imidacloprid to selected arthropod predators in the laboratory. Florida Entomologist 75: 277-280. Moores, G. D., G. J. Devine, and A. L. Devonshire. 1994. Insecticide-insensitive acetylcholinesterase can enhance esterase-based resistance in Myzus persicae and Myzus nicotianae. Pesticide Biochemistry and Physiology 49: 114-120. Morita, M., T. Ueda, T. Yoneda, T. Koyanagi, and T. Haga. 2007. Flonicamid, a novel insecticide with a rapid inhibitory effect on aphid feeding. Pest Management Science 63: 969-973. Moscardini, V. F., P. C. Gontijo, J. P. Michaud, and G. A. Carvalho. 2015. Sublethal effects of insecticide seed treatments on two nearctic lady beetles (Coleoptera: Coccinellidae). Ecotoxicology 24: 1152-1161. Mowry, T. M. 2005. Insecticidal reduction of Potato leafroll virus transmission by Myzus persicae. Annals of Applied Biology 146: 81-88.

169 Myers, S. W., D. B. Hogg, and J. L. Wedberg. 2005. Determining the optimal timing of foliar insecticide applications for control of soybean aphid (Hemiptera: Aphididae) on soybean. Journal of Economic Entomology 98: 2006-2012. Namba, R., and E. S. Sylvester. 1981. Transmission of cauliflower mosaic virus by the green peach, turnip, cabbage, and pea aphids (Homoptera: Aphididae). Journal of Economic Entomology 74: 546-551. Naranjo, S. E., and D. H. Akey. 2005. Conservation of natural enemies in cotton: comparative selectivity of acetamiprid in the management of Bemisia tabaci. Pest Management Science 61: 555-566. Nauen, R., and A. Elbert. 2003. European monitoring, of resistance to insecticides in Myzus persicae and Aphis gossypii (Hemiptera: Aphididae) with special reference to imidacloprid. Bulletin of Entomological Research 93: 47-54. Nauen, R., U. Ebbinghaus-Kintscher, V. L. Salgado, and M. Kaussmann. 2003. Thiamethoxam is a neonicotinoid precursor converted to clothianidin in insects and plants. Pesticide Biochemistry and Physiology 76: 55-69. Nauen, R., P. Jeschke, R. Velten, M. E. Beck, U. Ebbinghaus-Kintscher, W. Thielert, K. Wolfel, M. Haas, K. Kunz, and G. Raupach. 2015. Flupyradifurone: a brief profile of a new butenolide insecticide. Pest Management Science 71: 850-862. Ng, J. C. K., and K. L. Perry. 2004. Transmission of plant viruses by aphid vectors. Molecular Plant Pathology 5: 505-511. Nielsen, C., and A. E. Hajek. 2005. Control of invasive soybean aphid, Aphis glycines (Hemiptera: Aphididae), populations by existing natural enemies in New York state, with emphasis on entomopathogenic fungi. Environmental Entomology 34: 1036-1047. Ninsin, K. D., and T. Tanaka. 2005. Synergism and stability of acetamiprid resistance in a laboratory colony of Plutella xylostella. Pest Management Science 61: 723-727. North, J. H., J. Gore, A. L. Catchot, S. D. Stewart, G. M. Lorenz, F. R. Musser, D. R. Cook, D. L. Kerns, and D. M. Dodds. 2016. Value of neonicotinoid insecticide seed treatments in mid-south soybean (Glycine max) production systems. Journal of Economic Entomology. Obrien, P. J., M. B. Stoetzel, R. C. Navasero, and J. B. Graves. 1993. Field biology studies of the cotton aphid, Aphis gossypii Glover (Homoptera, Aphididae). Southwestern Entomology 18: 25-35. Obrycki, J. J., J. D. Harwood, T. J. Kring, and R. J. O'Neil. 2009. Aphidophagy by coccinellidae: Application of biological control in agroecosystems. Biological Control 51: 244-254. Ohnesorg, W. J., K. D. Johnson, and M. E. O'Neal. 2009. Impact of reduced-risk insecticides on soybean aphid and associated natural enemies. Journal of Economic Entomology 102: 1816-1826.

170 Onstad, D. W., X. X. Liu, M. Chen, R. Roush, and A. M. Shelton. 2013. Modeling the integration of parasitoid, insecticide, and transgenic insecticidal crop for the long-term control of an insect pest. Journal of Economic Entomology 106: 1103-1111. Onstad, D. W., P. D. Mitchell, T. M. Hurley, J. G. Lundgren, R. P. Porter, C. H. Krupke, J. L. Spencer, C. D. Difonzo, T. S. Baute, R. L. Hellmich, L. L. Buschman, W. D. Hutchison, and J. F. Tooker. 2011. Seeds of change: corn seed mixtures for resistance management and integrated pest management. Journal of Economic Entomology 104: 343-352. Orantes, L. C., W. Zhang, M. A. Mian, and A. P. Michel. 2012. Maintaining genetic diversity and population panmixia through dispersal and not gene flow in a holocyclic heteroecious aphid species. Heredity (Edinb) 109: 127-134. Panini, M., F. Tozzi, C. Bass, C. T. Zimmer, L. Field, V. Borzatta, E. Mazzoni, and G. Moores. 2017. The interactions of piperonyl butoxide and analogues with the metabolic enzymes FE4 and CYP6CY3 of the green peach aphid Myzus persicae (Hemiptera: Aphididae). Pest Management Science 73: 371-379. Pasay, C., L. Arlian, M. Morgan, R. Gunning, L. Rossiter, D. Holt, S. Walton, S. Beckham, and J. McCarthy. 2009. The effect of insecticide synergists on the response of scabies mites to pyrethroid acaricides. Plos Neglected Tropical Diseases 3. Patch, E. M. 1938. Food-plant catalogue of the aphids of the world: including the Phylloxeridae, Maine Agricultural Experiment Station, Orono. Perring, T. M., C. A. Farrar, M. Blua, and K. Mayberry. 1992. Management strategies outlined: Research reveals pattern of cucurbit virus spread. California Agriculture 46: 35- 40. Petitt, F. L., and Z. Smilowitz. 1982. Green peach aphid feeding damage to potato at various plant growth stages. Journal of Economic Entomology 75: 431-435. Petzold-Maxwell, J. L., L. J. Meinke, M. E. Gray, R. E. Estes, and A. J. Gassmann. 2013. Effect of Bt maize and soil insecticides on yield, injury, and rootworm survival: Implications for resistance management. Journal of Economic Entomology 106: 1941- 1951. Pezzini, D. T., and R. L. Koch. 2015. Compatibility of flonicamid and a formulated mixture of pyrethrins and azadirachtin with predators for soybean aphid (Hemiptera: Aphididae) management. Biocontrol Science and Technology 25: 1024-1035. Philippou, D., L. Field, and G. Moores. 2010. Metabolic enzyme(s) confer imidacloprid resistance in a clone of Myzus persicae (Sulzer) (Hemiptera: Aphididae) from Greece. Pest Management Science 66: 390-395. Pisa, L. W., V. Amaral-Rogers, L. P. Belzunces, J. M. Bonmatin, C. A. Downs, D. Goulson, D. P. Kreutzweiser, C. Krupke, M. Liess, M. McField, C. A. Morrissey, D. A. Noome, J. Settele, N. Simon-Delso, J. D. Stark, J. P. Van der Sluijs, H. Van Dyck, and M. Wiemers. 2015. Effects of neonicotinoids and fipronil on non-target invertebrates. Environmental Science and Pollution R 22: 68-102.

171 Popp, J., K. Peto, and J. Nagy. 2013. Pesticide productivity and food security. A review. Agronomy for Sustainable Development 33: 243-255. Powell, D. M., and W. T. Mondor. 1976. Area control of the green peach aphid on peach and the reduction of potato leaf roll virus. American Potato Journal 53: 123-139. Prabhaker, N., S. Naranjo, T. Perring, and S. Castle. 2017. Comparative toxicities of newer and conventional insecticides: Against four generalist predator species. Journal of Economic Entomology 110: 2630-2636. Prabhaker, N., S. J. Castle, S. E. Naranjo, N. C. Toscano, and J. G. Morse. 2011. Compatibility of two systemic neonicotinoids, imidacloprid and thiamethoxam, with various natural enemies of agricultural pests. Journal of Economic Entomology 104: 773- 781. Prischmann, D. A., D. G. James, L. C. Wright, R. D. Teneyck, and W. E. Snyder. 2005. Effects of chlorpyrifos and sulfur on spider mites (Acari: Tetranychidae) and their natural enemies. Biological Control 33: 324-334. Quisenberry, S. S., and D. J. Schotzko. 1994. Integration of plant-resistance with pest- management methods in crop production systems. Journal of Agricultural Entomology 11: 279-290. Qureshi, J. A., B. C. Kostyk, and P. A. Stansly. 2014. Insecticidal suppression of Asian citrus psyllid Diaphorina citri (Hemiptera: Liviidae) vector of huanglongbing pathogens. PLoS One 9: e112331. R Core Team. 2018. R: A language and environment for statistical computing. R Foundation for Statistical Computing, Vienna, Austria. Radcliffe, E. B., and D. W. Ragsdale. 2002. Aphid-transmitted potato viruses: The importance of understanding vector biology. American Journal of Potato Research 79: 353-386. Ragsdale, D. W., D. J. Voegtlin, and R. J. O'Neil. 2004. Soybean aphid biology in North America. Annals of the Entomological Society of America 97: 204-208. Ragsdale, D. W., D. A. Landis, J. Brodeur, G. E. Heimpel, and N. Desneux. 2011. Ecology and management of the soybean aphid in North America. Annual Review of Entomology 56: 375-399. Ragsdale, D. W., B. P. McCornack, R. C. Venette, B. D. Potter, I. V. MacRae, E. W. Hodgson, M. E. O’Neal, K. D. Johnson, R. J. O’Neil, C. D. DiFonzo, T. E. Hunt, P. A. Glogoza, and E. M. Cullen. 2007. Economic threshold for soybean aphid (Hemiptera: Aphididae). Journal of Economic Entomology 100: 1258-1267. Regan, K., D. Ordosch, K. D. Glover, K. J. Tilmon, and A. Szczepaniec. 2017. Effects of a pyrethroid and two neonicotinoid insecticides on population dynamics of key pests of soybean and abundance of their natural enemies. Crop Protection 98: 24-32. Ribeiro, M. G. P. D., T. E. Hunt, and B. D. Siegfried. 2018. Acute-contact and chronic- systemic in vivo bioassays: Regional monitoring of susceptibility to thiamethoxam in soybean aphid (Hemiptera: Aphididae) populations from the north central United States. Journal of Economic Entomology 111: 337-347. 172 Riley, T. J. 1988. Plant stress from arthropods: insecticide and acaricide effects on insect, mite and host plant biology, pp. 187-188. In E. A. Heinrichs (ed.), Plant Stress-Insect Interactions. Wiley, New York. Risebrough, R. W., D. B. Menzel, D. J. Martin, and H. S. Olcott. 1967. DDT residues in pacific sea birds: A persistent insecticide in marine food chains. Nature 216: 589-591. Robertson, J. L., and N. G. Rappaport. 1979. Direct, indirect, and residual toxicities of insecticide sprays to western spruce budworm, Choristoneura occidentalis (Lepidoptera: Tortricidae). Canadian Entomologist 111: 1219-1226. Robertson, J. L., M. M. Jones, E. Olguin, and B. Alberts. 2017. Bioassays with arthropods. CRC Press, Boca Raton. Robertson, J. L., H. K. Preisler, S. S. Ng, L. A. Hickle, and W. D. Gelernter. 1995. Natural variation: A complicating factor in bioassays with chemical and microbial pesticides. Journal of Economic Entomology 88: 1-10. Rodrigues, A. R. S., J. R. Ruberson, J. B. Torres, H. A. A. Siqueira, and J. G. Scott. 2013. Pyrethroid resistance and its inheritance in a field population of Hippodamia convergens (Guerin-Meneville) (Coleoptera: Coccinellidae). Pesticide Biochemistry and Physiology 105: 135-143. Rodriguez-Saona, C., A. C. Wanumen, J. Salamanca, R. Holdcraft, and V. Kyryczenko- Roth. 2016. Toxicity of insecticides on various life stages of two tortricid pests of cranberries and on a non-target predator. Insects 7. Romero, A., M. F. Potter, and K. F. Haynes. 2009. Evaluation of piperonyl butoxide as a deltamethrin synergist for pyrethroid-resistant bed bugs. Journal of Economic Entomology 102: 2310-2315. Rosenheim, J. A. 1998. Higher-order predators and the regulation of insect herbivore populations. Annual Review of Entomology 43: 421-447. Roser, M., and H. Ritchie. 2019. Fertilizer and pesticides. Our World in Data, Published online at OurWorldInData.org. Roubos, C. R., C. Rodriguez-Saona, and R. Isaacs. 2014a. Mitigating the effects of insecticides on arthropod biological control at field and landscape scales. Biological Control 75: 28-38. Roubos, C. R., C. Rodriguez-Saona, R. Holdcraft, K. S. Mason, and R. Isaacs. 2014b. Relative toxicity and residual activity of insecticides used in blueberry pest management: mortality of natural enemies. Journal of Economic Entomology 107: 277-285. Roush, R. T. 1998. Two-toxin strategies for management of insecticidal transgenic crops: can pyramiding succeed where pesticide mixtures have not? Philosophical Transactions of the Royal Society B 353: 1777-1786. Ruberson, J. R., Y. J. Shen, and T. J. Kring. 2000. Photoperiodic sensitivity and diapause in the predator Orius insidiosus (Heteroptera: Anthocoridae). Annals of the Entomological Society of America 93: 1123-1130.

173 Rutledge, C. E., and R. J. O'Neil. 2005. Orius insidiosus (Say) as a predator of the soybean aphid, Aphis glycines Matsumura. Biological Control 33: 56-64. Rutledge, C. E., and R. J. O’Neil. 2006. Soybean plant stage and population growth of soybean aphid. Journal of Economic Entomology 99: 60-66. Rutledge, C. E., rsquo, R. J. Neil, T. B. Fox, and D. A. Landis. 2004. Soybean aphid predators and their use in integrated pest management. Annals of the Entomological Society of America 97: 240-248. Sanchez-Arroyo, H., P. G. Koehler, and S. M. Valles. 2001. Effects of the synergists piperonyl butoxide and S,S,S-tributyl phosphorotrithioate on propoxur pharmacokinetics in Blattella germanica (Blattodea: Blattellidae). Journal of Economic Entomology 94: 1209- 1216. Santos, K. F. A., O. Z. Zanardi, M. R. de Morais, C. R. O. Jacob, M. B. de Oliveira, and P. T. Yamamoto. 2017. The impact of six insecticides commonly used in control of agricultural pests on the generalist predator Hippodamia convergens (Coleoptera: Coccinellidae). Chemosphere 186: 218-226. Savin, N. E., J. L. Robertson, and R. M. Russell. 1977. A critical evaluation of bioassay in insecticide research: Likelihood ratio tests of dose-mortality regression. Bulletin of the Entomological Society of America 23: 257-266. Schellhorn, N. A., J. Bellati, C. A. Paull, and L. Maratos. 2008. Parasitoid and moth movement from refuge to crop. Basic and Applied Ecology 9: 691-700. Schlapfer, F., B. Schmid, and I. Seidl. 1999. Expert estimates about effects of biodiversity on ecosystem processes and services. Oikos 84: 346-352. Schmidt, N. P., M. E. O'Neal, P. F. Anderson, D. Lagos, D. Voegtlin, W. Bailey, P. Caragea, E. Cullen, C. DiFonzo, K. Elliott, C. Gratton, D. Johnson, C. H. Krupke, B. McCornack, R. O'Neil, D. W. Ragsdale, K. J. Tilmon, and J. Whitworth. 2012. Spatial distribution of Aphis glycines (Hemiptera: Aphididae): A summary of the suction trap network. Journal of Economic Entomology 105: 259-271. Schmidt-Jeffris, R. A., and B. A. Nault. 2016. Anthranilic diamide insecticides delivered via multiple approaches to control vegetable pests: A case study in snap bean. Journal of Economic Entomology 109: 2479-2488. Scott, J. G. 1999. Cytochromes P450 and insecticide resistance. Insect Biochemistry and Molecular Biology 29: 757-777. Seagraves, M. P., and J. G. Lundgren. 2012. Effects of neonicitinoid seed treatments on soybean aphid and its natural enemies. Journal of Pest Science 85: 125-132. Sengonca, C., K. Ahmadi, and P. Blaeser. 2008. Biological characteristics of Orius similis Zheng (Heteroptera, Anthocoridae) by feeding on different aphid species as prey. Journal of Plant Diseases and Protection 115: 32-38. Sethuraman, A., F. J. Janzen, and J. Obrycki. 2015. Population genetics of the predatory lady beetle Hippodamia convergens. Biological Control 84: 1-10.

174 Shafer, T. J., D. A. Meyer, and K. M. Crofton. 2005. Developmental neurotoxicity of pyrethroid insecticides: Critical review and future research needs. Environmental Health Perspectives 113: 123-136. Shepard, M., G. R. Carner, and S. G. Turnipseed. 1977. Colonization and resurgence of insect pests of soybean in response to insecticides and field isolation. Environmental Entomology 6: 501-506. Simon-Delso, N., V. Amaral-Rogers, L. P. Belzunces, J. M. Bonmatin, M. Chagnon, C. Downs, L. Furlan, D. W. Gibbons, C. Giorio, V. Girolami, D. Goulson, D. P. Kreutzweiser, C. H. Krupke, M. Liess, E. Long, M. McField, P. Mineau, E. A. Mitchell, C. A. Morrissey, D. A. Noome, L. Pisa, J. Settele, J. D. Stark, A. Tapparo, H. Van Dyck, J. Van Praagh, J. P. Van der Sluijs, P. R. Whitehorn, and M. Wiemers. 2015. Systemic insecticides (neonicotinoids and fipronil): trends, uses, mode of action and metabolites. Environmental Science Pollution Research International 22: 5- 34. Smart, L. E., and J. H. Stevenson. 1982. Laboratory estimation of toxicity of pyrethroid insecticides to honeybees: Relevance to hazard in the field. Bee World 63: 150-152. Song, F., S. M. Swinton, C. DiFonzo, M. E. O'Neal, and D. Ragsdale. 2006. Profitability analysis of soybean aphid control treatments in three north-central States. Michigan State University, Department of Agricultural, Food, and Resource Economics Staff Paper Series 11489. Sparks, T. C. 2013. Insecticide discovery: an evaluation and analysis. Pesticide Biochemistry and Physiology 107: 8-17. Sparks, T. C., and R. Nauen. 2015. IRAC: Mode of action classification and insecticide resistance management. Pesticide Biochemistry and Physiology 121: 122-128. Spencer, E. Y., and R. D. Obrien. 1957. Chemistry and mode of action of organophosphorus insecticides. Annual Review of Entomology 2: 261-278. Stamm, M. D., L. S. Enders, T. J. Donze-Reiner, F. P. Baxendale, B. D. Siegfried, and T. M. Heng-Moss. 2014. Transcriptional response of soybean to thiamethoxam seed treatment in the presence and absence of drought stress. BMC Genomics 15. Stapel, J. O., A. M. Cortesero, and W. J. Lewis. 2000. Disruptive sublethal effects of insecticides on biological control: Altered foraging ability and life span of a parasitoid after feeding on extrafloral nectar of cotton treated with systemic insecticides. Biological Control 17: 243-249. Stern, V. M., R. F. Smith, R. van den Bosch, and K. S. Hagen. 1959. The integration of chemical and biological control of the spotted alfalfa aphid: The integrated control concept. Hilgardia 29: 81-101. Stoner, K. A., and B. D. Eitzer. 2012. Movement of soil-applied imidacloprid and thiamethoxam into nectar and pollen of squash (Cucurbita pepo). PloS One 7.

175 Studebaker, G. E., and T. J. Kring. 2000. Lethal and sublethal effects of early-season insecticides on insidious flower bug (Orius insidiosus): An important predator in cotton, pp. 221-225. In D. M. Oosterhuis (ed.), Proceedings of the 2000 Cotton Research Meeting and Summaries of Cotton Research in Progress. Arkansas Agricultural Experiment Station, Fayetteville. Studebaker, G. E., and T. J. Kring. 2003. Effects of insecticides on Orius insidiosus (Hemiptera: Anthocoridae), measured by field, greenhouse and petri dish bioassays. The Florida Entomologist 86: 178-185. Sweeden, M. B., and P. J. McLeod. 1997. Systemic toxicity and field efficacy of imidacloprid, pymetrozine, and triazamate against Myzus persicae (Homoptera: Aphididae) on spinach. Journal of Agricultural Entomology 14: 421-433. Szczepaniec, A., S. F. Creary, K. L. Laskowski, J. P. Nyrop, and M. J. Raupp. 2011. Neonicotinoid insecticide imidacloprid causes outbreaks of spider mites on elm trees in urban landscapes. PloS One 6. Szczepaniec, A., M. J. Raupp, R. D. Parker, D. Kerns, and M. D. Eubanks. 2013. Neonicotinoid insecticides alter induced defenses and increase susceptibility to spider mites in distantly related crop plants. PloS One 8. Tabashnik, B. E., T. Brevault, and Y. Carriere. 2013. Insect resistance to Bt crops: lessons from the first billion acres. Nature Biotechnology 31: 510-521. Tamaki, G. 1975. Weeds in orchards as important alternate sources of green peach aphids in late spring. Environmental Entomology 4: 958-960. Tamaki, G., B. Annis, and M. Weiss. 1981. Response of natural enemies to the green peach aphid in different plant cultures (Homoptera: Aphididae). Environmental Entomology 10: 375-378. Tillman, P. G., and J. E. Mulrooney. 2000. Effect of selected insecticides on the natural enemies Coleomegilla maculata and Hippodamia convergens (Coleoptera: Coccinellidae), Geocoris punctipes (Hemiptera: Lygaeidae), and Bracon mellitor, Cardiochiles nigriceps, and Cotesia marginiventris (Hymenoptera: Braconidae) in cotton. Journal of Economic Entomology 93: 1638-1643. Tilmon, K. J., E. W. Hodgson, M. E. O'Neal, and D. W. Ragsdale. 2011. Biology of the soybean aphid, Aphis glycines (Hemiptera: Aphididae) in the United States. Journal of Integrated Pest Management 2: 1-7. Torres, J. B., and A. d. F. Bueno. 2018. Conservation biological control using selective insecticides - A valuable tool for IPM. Biological Control 126: 53-64. Ujváry, I. n. 2003. Propesticides. In J. R. Plimmer, D. W. Gammin and D. W. Ragsdale (eds.), Encyclopedia of Agrochemicals. Unruh, T., A. Knight, and M. R. Bush. 1996. Green peach aphid (Homoptera: Aphididae) resistance to endosulfan in peach and nectarine orchards in Washington State. Journal of Economic Entomology 89: 1067-1073.

176 USGS, U. S. G. S. 2014. Project: estimated annual agricultural pesticide use maps— thiamethoxam, pesticide national synthesis project. Valles, S. M., P. G. Koehler, and R. J. Brenner. 1997. Antagonism of fipronil toxicity by piperonyl butoxide and S,S,S-tributyl phosphorotrithioate in the German cockroach (Dictyoptera: Blattellidae). Journal of Economic Entomology 90: 1254-1258. van den Berg, H., D. Ankasah, A. Muhammad, R. Rusli, H. A. Widayanto, H. B. Wirasto, and I. Yully. 1997. Evaluating the role of predation in population fluctuations of the soybean aphid Aphis glycines in farmers' fields in Indonesia. Journal of Applied Ecology 34: 971-984. van den Bosch, R., and V. M. Stern. 1962. The Integration of Chemical and Biological Control of Arthropod Pests. Annual Review of Entomology 7: 367-386. van den Bosch, R., P. S. Messenger, and A. P. Gutierrez. 1982. An introduction to biological control, Springer, Boston, MA, Division of Biological Control, University of California, Berkeley, Albany, USA. van den Meiracker, R. A. F. 1994. Induction and termination of diapause in orius predatory bugs. Entomologia Experimentalis Et Applicata 73: 127-137. van Emden, H. F., and R. Harrington. 2007. Aphids as crop pests, CABI, Wallingford, UK; Cambridge, MA. van Lenteren, J. C. 1992. Biological control in protected crops: Where do we go? Pesticide Science 36: 321-327. van Lenteren, J. C., and J. Woets. 1988. Biological and integrated pest-control in greenhouses. Annual Review of Entomology 33: 239-269. van Steenis, M. J. 1992. Biological control of the cotton aphid, Aphis gossypii Glover (Hom, Aphididae): preintroduction evaluation of natural enemies. Journal of Applied Entomology 114: 362-380. Varenhorst, A. J., and M. E. O'Neal. 2012. The response of natural enemies to selective insecticides applied to soybean. Environmental Entomology 41: 1565-1574. Varenhorst, A. J., and M. E. O'Neal. 2016. The effect of an interspersed refuge on Aphis glycines (Hemiptera: Aphididae), their natural enemies, and biological control. Journal of Economic Entomology 109: 406-415. Varenhorst, A. J., M. T. McCarville, and M. E. O'Neal. 2015. Reduced fitness of virulent Aphis glycines (Hemiptera: Aphididae) biotypes may influence the longevity of resistance genes in soybean. PLoS One 10: e0138252. Venette, R. C., and D. W. Ragsdale. 2004. Assessing the invasion by soybean aphid (Homoptera: Aphididae): Where will it end? Annals of the Entomological Society of America 97: 219-226. Voegtlin, D. J., R. J. O'Neil, and W. R. Graves. 2004. Tests of suitability of overwintering hosts of Aphis glycines: Identification of a new host association with Rhamnus alnifolia L'Heritier. Annals of the Entomological Society of America 97: 233-234.

177 Vos, J. G., E. Dybing, H. A. Greim, O. Ladefoged, C. Lambre, J. V. Tarazona, I. Brandt, and A. D. Vethaak. 2000. Health effects of endocrine-disrupting chemicals on wildlife, with special reference to the European situation. Critcal Reviews in Toxicology 30: 71- 133. Wang, P., L. L. Zhou, F. Yang, X. M. Liu, Y. Wang, C. L. Lei, and S. Y. Si. 2018. Lethal and behavioral sublethal side effects of thiamethoxam on the predator Harmonia axyridis. Entomologia Experimentalis Et Applicata 166: 703-712. Wang, Q., X. Weijun, Y. Shanchun, and C. Wang. 2011. Research on resistance of Aphis glycines in Hei longjiang province. Advanced Materials Research 393-395: 926-929. Wang, S., J. P. Michaud, X. L. Tan, and F. Zhang. 2014. Comparative suitability of aphids, thrips and mites as prey for the flower bug Orius sauteri (Hemiptera: Anthocoridae). European Journal of Entomology 111: 221-226. Weathersbee, A. A., and D. D. Hardee. 1994. Abundance of cotton aphids (Homoptera: Aphididae) and associated biological-control agents on 6 cotton cultivars. Journal of Economic Entomology 87: 258-265. Weber, D. C., and J. G. Lundgren. 2009. Assessing the trophic ecology of the Coccinellidae: Their roles as predators and as prey. Biological Control 51: 199-214. Weintraub, P. G., and A. R. Horowitz. 1998. Effects of translaminar versus conventional insecticides on Liriomyza huidobrensis (Diptera: Agromyzidae) and Diglyphus isaea (Hymenoptera: Eulophidae) populations in celery. Journal of Economic Entomology 91: 1180-1185. Wells, M. L., and R. M. McPherson. 1999. Population dynamics of three coccinellids in flue- cured tobacco and functional response of Hippodamia convergens (Coleoptera: Coccinellidae) feeding on tobacco aphids (Homoptera: Aphididae). Environmental Entomology 28: 768-773. Welsman, J. A., C. A. Bahlai, M. K. Sears, and A. W. Schaafsma. 2007. Decline of soybean aphid (Homoptera: Aphididae) egg populations from autumn to spring on the primary host, Rhamnus cathartica. Environmental Entomology 36: 541-548. Wenger, J., M. Ramstad, M. A. R. Mian, and A. Michel. 2014. The use of refuge in host plant resistance systems for the control of virulent biotype adaptation in the soybean aphid (Hemiptera: Aphididae). Journal of Economic Entomology 107: 1599-1609. Wenger, J. A., and A. P. Michel. 2013. Implementing an evolutionary framework for understanding genetic relationships of phenotypically defined insect biotypes in the invasive soybean aphid (Aphis glycines). Evolutionary Applications 6: 1041-1053. Wenger, J. A., B. J. Cassone, F. Legeai, J. S. Johnston, R. Bansal, A. D. Yates, B. S. Coates, V. A. C. Pavinato, and A. Michel. 2017. Whole genome sequence of the soybean aphid, Aphis glycines. Insect Biochemistry and Molecular Biology. White, J., and D. Johnson. 2010. ENTFACT-125: Vendors of beneficial organisms in North America. University of Kentucky College of Agriculture.

178 Wilde, G., K. Roozeboom, M. Claassen, K. Janssen, and M. Witt. 2004. Seed treatment for control of early-season pests of corn and its effect on yield. Journal of Agricultural and Urban Entomology 21: 75-85. Wilde, G., K. Roozeboom, A. Ahmad, M. Claassen, B. Gordon, W. Heer, L. Maddux, V. Martin, P. Evans, K. Kofoid, J. Long, A. Schlegel, and M. Witt. 2007. Seed treatment effects on early-season pests of corn and on corn growth and yield in the absence of insect pests. Journal of Agricultural and Urban Entomology 24: 177-193. Wilde, G. E., R. J. Whitworth, M. Claassen, and R. A. Shufran. 2001. Seed treatment for control of wheat insects and its effect on yield. Journal of Agricultural and Urban Entomology 18: 1-11. Wilhoit, L. R. 1991. Modeling the population-dynamics of different aphid genotypes in plant variety mixtures. Ecological Modelling 55: 257-283. Wilkinson, C. F. 1976. Insecticide biochemistry and physiology, Plenum Press, New York. Willoughby, L., P. Batterham, and P. J. Daborn. 2007. Piperonyl butoxide induces the expression of cytochrome P450 and glutathione S-transferase genes in Drosophila melanogaster. Pest Management Science 63: 803-808. Wright, D. J., and R. H. J. Verkerk. 1995. Integration of chemical and biological-control systems for arthropods: Evaluation in a multitrophic context. Pesticide Science 44: 207- 218. Wu, G., Y. Wang, J. N. Wang, X. Z. Chen, Q. X. Hu, Y. F. Yang, and Q. Q. Liu. 2018. Vitality and stability of insecticide resistance in adult Propylaea japonica (Coleoptera: Coccinellidae). Journal of Insect Science 18. Xiao, D., J. Zhao, X. Guo, H. Chen, M. Qu, W. Zhai, N. Desneux, A. Biondi, F. Zhang, and S. Wang. 2016. Sublethal effects of imidacloprid on the predatory seven-spot ladybird beetle Coccinella septempunctata. Ecotoxicology 25: 1782-1793. Yano, K., T. Miyake, and V. F. Eastop. 1983. The biology and economic importance of rice aphids (Hemiptera: Aphididae): A review. Bulleting of Entomological Resesearch 73: 539-566. Youn, Y. N., M. J. Seo, J. G. Shin, C. Jang, and Y. M. Yu. 2003. Toxicity of greenhouse pesticides to multicolored Asian lady beetles, Harmonia axyridis (Coleoptera: Coccinellidae). Biological Control 28: 164-170. Young, S. J., R. V. Gunning, and G. D. Moores. 2005. The effect of piperonyl butoxide on pyrethroid-resistance-associated esterases in Helicoverpa armigera (Hubner) (Lepidoptera: Noctuidae). Pest Management Science 61: 397-401. Young, S. J., R. V. Gunning, and G. D. Moores. 2006. Effect of pretreatment with piperonyl butoxide on pyrethroid efficacy against insecticide-resistant Helicoverpa armigera (Lepidoptera: Noctuidae) and Bemisia tabaci (Sternorrhyncha: Aleyrodidae). Pest Management Science 62: 114-119.

179 Zhao, J. Z., B. A. Bishop, and E. J. Grafius. 2000. Inheritance and synergism of resistance to imidacloprid in the Colorado potato beetle (Coleoptera: Chrysomelidae). Journal of Economic Entomology 93: 1508-1514.

180