Cetrimonium Bromide Promotes Lipid Clearance Via TFEB- Mediated Autophagy-Lysosome Activation in Hepatic Cells

Biochemistry and Cell Biology

Cetrimonium bromide promotes lipid clearance via TFEB- mediated autophagy-lysosome activation in hepatic cells

Journal: Biochemistry and Cell Biology

Manuscript ID bcb-2020-0570.R1

Manuscript Type: Article

Date Submitted by the 18-Jan-2021 Author:

Complete List of Authors: Liu, Zhenxing; State Key Laboratory of Food Nutrition and Safety Wang, Xu; State Key Laboratory of Food Nutrition and Safety Shi, Zhichen; State Key Laboratory of Food Nutrition and Safety Xu, Junting; State Key Laboratory of Food Nutrition and Safety Lin, Jieru; DraftState Key Laboratory of Food Nutrition and Safety Li, Dianlong; State Key Laboratory of Food Nutrition and Safety Zhang, Xinpeng; State Key Laboratory of Food Nutrition and Safety Li, Yuyin; Tianjin University of Science and Technology Zhao, Qing; State Key Laboratory of Food Nutrition and Safety Tao, Li; State Key Laboratory of Food Nutrition and Safety Diao, Aipo; State Key Laboratory of Food Nutrition and Safety

Cetrimonium bromide, TFEB, Autophagy, mTORC1 signaling, Lipid Keyword: metabolism

Is the invited manuscript for consideration in a Special Not applicable (regular submission) Issue? :

1 Cetrimonium bromide promotes lipid clearance via TFEB-mediated autophagy-lysosome

2 activation in hepatic cells

4 Running title: CTAB promotes lipid clearance by autophagy

6 Zhenxing Liu, Xu Wang, Zhichen Shi, Junting Xu, Jieru Lin, Dianlong Li, Xinpeng Zhang, Yuyin

7 Li, Qing Zhao, Li Tao and Aipo Diao*

8 9 School of Biotechnology, Tianjin UniversityDraft of Science and Technology, Key Lab of Industrial 10 Fermentation Microbiology of the Ministry of Education, State Key Laboratory of Food Nutrition

11 and Safety, Tianjin 300457 China

13 *To whom correspondence should be addressed: Aipo Diao: school of Biotechnology, Tianjin

14 University of Science and Technology, Tianjin 300457 China; [email protected]; Zhenxing

15 Liu: school of Biotechnology, Tianjin University of Science and Technology, Tianjin 300457

16 China; [email protected]

17 Tel.86-22-60602948; Fax.86-22-60602298.

22 Abstract

23 Autophagy plays a key role in the metabolism of macromolecules by the lysosomal degradative

24 machinery. The transcription factor EB (TFEB) regulates autophagosome biogenesis and lysosome

25 function, and promoting TFEB activity has emerged as a potential strategy for the treatment of

26 metabolic disorders. Here, we describe that cetrimonium bromide (CTAB), a quaternary

27 ammonium compound, promotes autophagy and lysosomal biogenesis by inducing the nuclear

28 translocation of TFEB in hepatic cells. The short hairpin RNA (shRNA)-mediated TFEB 29 knockdown inhibits CTAB-induced autophagyDraft and lysosomal biogenesis. Mechanistically, CTAB 30 treatment inhibits the Akt-mTORC1 signaling pathway. Moreover, CTAB treatment markedly

31 promotes lipid metabolism in both palmitate and oleate-treated HepG2 cells, and this promotion

32 was attenuated by the depletion of TFEB. Altogether, our results indicate that CTAB activates the

33 autophagy-lysosome pathway by inducing the nuclear translocation of TFEB via the inhibition of

34 mTORC1 signaling. These results deepen our understanding of TFEB function and provide new

35 insights into CTAB-mediated lipid metabolism.

36 Key words: Cetrimonium bromide, TFEB, Autophagy, mTORC1 signaling, Lipid metabolism

43 Introduction

44 Autophagy is a highly conserved degradation process by which components of the cell are

45 degraded in lysosomes (Klionsky and Emr 2000). The autophagy-lysosome pathway has a key role

46 in macromolecule metabolism and cellular homeostasis (Mizushima and Komatsu 2011). Its

47 dysregulation has been associated with diverse diseases such as neurodegeneration, aging and

48 metabolic disorders (Eisenberg et al. 2009; Rubinsztein et al. 2011; Rubinsztein et al. 2012; Singh 49 et al. 2009). In metabolic syndromes, decliningDraft autophagy causes aggregation of macromolecules 50 such as lipids, proteins, and glycogen, leading to metabolism impairment and intracellular stresses

51 (Singh et al. 2009). It has been reported that suppression of autophagy results in aggravated hepatic

52 steatosis and nonalcoholic steatohepatitis, and that increasing autophagy ameliorates liver fibrosis

53 in a mice model (Amir and Czaja 2011; Hidvegi et al. 2010). In this context, lipid droplets have

54 been identified as a substrate of the autophagy-lysosome pathway, whereas cholesteryl esters are

55 hydrolyzed to generate free cholesterol by the lysosomal acid lipase (Dong and Czaja 2011; Ouimet

56 et al. 2011). Moreover, fatty acid-induced impairment of autophagy in β-cells leads to apoptotic

57 cell death (Mir et al. 2015). In contrast, chemical chaperone 4-phenyl butyric acid (4-PBA) reduces

58 lipid accumulation and lipotoxicity in hepatocytes via induction of autophagy (Nissar et al. 2017).

59 Thus, promoting the autophagy-lysosome pathway is emerging as a promising strategy to treat

60 metabolic syndromes.

61 The transcription factor EB (TFEB) is a member of the microphthalmia-associated

62 transcription factor (MITF)/transcriptional factor E family (MiT). TFEB positively modulates

63 autophagy-lysosome pathway by directly activating the coordinated lysosomal expression and

64 regulation (CLEAR) network (Settembre et al. 2011). Under nutrient sufficiency, the mammalian

65 target of rapamycin complex 1 (mTORC1) prevents TFEB activation by phosphorylating TFEB at

66 Ser 211, resulting in the inhibition of autophagy and lysosomal biogenesis (Martina et al. 2012;

67 Roczniak-Ferguson et al. 2012). During conditions of starvation or stress, inhibition of mTORC1

68 promotes TFEB activation to induce autophagy and lysosomal biogenesis, mediating cellular 69 adaptation to stress (Martina and PuertollanoDraft 2013; Settembre et al. 2011). It has been reported that 70 TFEB positively modulates lipid catabolism and so overexpression of TFEB in hepatic cells is an

71 effective strategy to mimic many gene transcription events that occur during starvation (Settembre

72 et al. 2013). Moreover, depletion of TFEB in liver causes the impairment of lipid degradation

73 during starvation, while overexpression of TFEB enhances liver fat catabolism and prevents diet-

74 induced obesity (Settembre et al. 2013). Therefore, discovering TFEB agonists is promising and

75 exciting for potential cures for metabolic disorders.

76 Cetrimonium bromide (CTAB), a quaternary ammonium surfactant, exhibits numerous

77 biological activities including antibacterial and antitumor effects (Ito et al. 2009; Nakata et al. 2011;

78 Wissing et al. 2013). However, the effects of CTAB on TFEB and lipid metabolism are unknown.

79 In this study, TFEB activator screening was performed using HeLa cells stably expressing TFEB-

80 GFP, and CTAB was identified as a potent inducer of nuclear translocation of TFEB. We also

81 explore the effects of CTAB on autophagy-lysosome pathway and lipid clearance using a hepatic

82 cell model. These results provide a molecular mechanism to the autophagy activation by CTAB

83 and implicate a potential application of CTAB in the treatment of metabolic syndrome with lipid

84 overload.

85 Materials and methods

86 Reagents and antibodies

87 CTAB was purchased from Selleckchem (Houston, TX, USA) and dissolved in DMSO to

88 make a stock solution. All chemicals were purchased from Sigma Aldrich (St. Louis, MO, USA) 89 unless otherwise stated. Anti-LC3B (L7543)Draft antibody was purchased from Sigma. LAMP-2 90 (ab25631) were purchased from Abcam (Cambridge, UK). Antibodies against p62 (#5114), TFEB

91 (#4240), mTOR (#2983), p-mTOR (#2971), p70S6K (#9202) and p-p70S6K (#9204) were obtained

92 from Cell Signaling Technology (Danvers, MA, USA). Antibodies against p-Akt (sc-514032), Akt

93 (sc-56878), GAPDH (sc-47724) and β-actin (sc-47778) were obtained from Santa Cruz

94 Biotechnology (Santa Cruz, CA, USA). The anti-Histone H3 (KM9005), horseradish peroxidase

95 (HRP) conjugated goat anti-rabbit (LK2001) and anti-mouse secondary antibodies (LK2003) were

96 obtained from Sungene Biotech (Tianjin, China).

97 Cell lines and cell culture

98 HeLa, HepG2, SMMC-7721, normal liver cell line L02 and human embryonic kidney cell

99 HEK-293 were obtained from the American Type Culture Collection (ATCC). Cells were cultured

100 in DMEM (Gibco, Eggenstein, Germany) supplemented with 10% fetal bovine serum, 100 U/ml

101 penicillin, and 0.1 mg/ml streptomycin with an atmosphere of 5% CO2 at 37 °C.

102 Plasmid construction and stable cell lines

103 The plasmid construction of TFEB-GFP or GFP-LC3 was performed as described previously

104 (Li et al. 2019). Briefly, full length human TFEB and LC3 cDNAs were amplified by PCR and

105 cloned into pLVX-AcGFP-N1 and pLVX-AcGFP-C1 plasmids (Clontech, Palo Alto, CA, USA)

106 for generation of the TFEB-GFP and GFP-LC3 transfection vectors, respectively. Lentiviral

107 transfer plasmids and packaging plasmids were co-transfected into HEK293 cells using

108 Lipofectamine 2000 (Invitrogen, Carlsbad, CA, USA) according to the manufacturer’s instructions. 109 After 48 h transfection, viruses were collectedDraft and stored at -80°C before use. HeLa cells were 110 infected with pLVX-AcGFP-TFEB or pLVX-AcGFP-LC3 lentiviruses and selected in 1 μg/ml

111 puromycin for two weeks.

112 RNA interference

113 Plasmids expressing TFEB short hairpin RNA (shRNA) (5′-

114 CCGGCCCACTTTGGTGCTAATAGCTCTCGAG

115 AGCTATTAGCACCAAAGTGGGTTTTTG-3′) was constructed using pLKO.1-puro lentiviral

116 vectors. Lentiviruses were produced according to the manufacturer’s instructions. Cells were

117 infected with lentiviruses and selected in 1 μg/ml puromycin for two weeks. The levels of TFEB

118 knockdown were detected by Western blot and non-target shRNA vector was used as a negative

119 control.

120 Western blot

121 Cells were lysed using RIPA buffer containing protease inhibitors (Roche, Basel, Switzerland)

122 and the concentration of cell extracts were determined by the Bradford method. Total proteins (10

123 μg) were separated by 12% SDS-PAGE gel and transferred onto PVDF membranes. The

124 membranes were blocked with 5% non-fat milk in Tris-buffered saline containing 0.1% Tween-20

125 (TBST), followed by incubating with primary antibodies at 4°C overnight. Then, membranes were

126 incubated with HRP-conjugated secondary antibodies. The immunoblot bands were visualized

127 using a chemiluminescence detection system (GE Healthcare, Little Chalfont, Buckinghamshire,

128 UK). The density of the bands were analyzed using ImageJ software (Wayne Rasband, NIH, 129 Bethesda, MD, USA). Draft 130 Nuclear and cytoplasmic fractionation

131 Cells were treated with CTAB and lysed with NP-40 lysis buffer (10 mM Tris-HCl, 150 mM

132 NaCl, 0.05% NP-40) containing EDTA-free protease inhibitors. Lysates were centrifuged at 12,000

133 rpm for 5 min to separate the pellets (nuclei) and supernatants (cytosol). Pellets and supernatants

134 were then measured by Western blot.

135 Immunofluorescence

136 Cells were cultured on polylysine-coated glass coverslips. Following CTAB treatment, cells

137 were fixed with 4% paraformaldehyde and permeabilized with 0.1% Triton X-100 in PBS.

138 Coverslips were then blocked with 5% BSA for 30 min at room temperature. The cells were

139 incubated with primary antibodies at 4 °C overnight, followed by incubating with secondary

140 antibodies for an additional 2 h at room temperature. After washing, coverslips were visualized and

141 imaged by fluorescent microscopy (Nikon DEclipse C1, Tokyo, Japan).

142 Cell viability assay

143 Cells were seeded into 96-well plates at a density of 9 × 103 per well. After CTAB exposure

144 for 24 h or 48 h, 3-[4,5-dimethylthiazol-2-yl]-2,5-diphenyltetrazolium bromide (MTT) solution (20

145 μL, 5 mg/mL in PBS) was added and incubated at 37 °C for 4 h. DMSO was then added to dissolve

146 insoluble crystals completely, followed by absorbance measurements at 490 nm using a microplate

147 reader (Bio-Rad, Hercules, CA, USA).

148 Acridine orange (AO) staining 149 Cells cultured on coverslips were treatedDraft with CTAB or DMSO for 24 h, and stained with the 150 pH-sensitive fluorescent dye AO (5 μg/ml) at 37 °C for 15 min. After washing with PBS, coverslips

151 were visualized and imaged on a fluorescent microscope (Nikon).

152 Induction of lipid droplets

153 For lipid formation, HepG2 cells were treated with a combination of sodium palmitate (PA)

154 and sodium oleate (OA) for 24 h after serum-free medium starvation for 12 h. PA and OA were

155 dissolved in 0.1 mM NaOH solution and prepared into 100 mM solutions respectively. PA and OA

156 were prepared into 50 mM free fatty acids inducer in a ratio of 1:2, which was stored at -20 °C and

157 heated at 50 °C before use. Working solution was prepared by diluting PA or OA stocks in 2% fatty

158 acid-free DMEM. After CTAB treatment for 24 h, lipid-loaded cells on dishes were washed twice

159 with PBS. The cells were fixed with 4% paraformaldehyde at room temperature for 30 min, and

160 then stained with Oil red O (ORO) for 1 h at room temperature. Finally, cells were stained with

161 hematoxylin solution and imaged on a microscope. Images from at least three different fields per

162 sample were acquired, and the area of ORO was calculated and analyzed using ImageJ software.

163 In all, 20-30 cells were evaluated from each image for each sample, and three independent

164 experiments were performed to generate the graphed values.

165 Statistical analysis

166 All experiments were repeated at least three times. Data were presented as mean ± standard

167 deviation of three independent experiments. Statistical significance was analyzed by the unpaired

168 Student’s t-test or one-way analysis of variance (ANOVA) using GraphPad Prism version 8.0 169 (GraphPad Software). Differences wereDraft considered statistically significant when P<0.05. 170

171 Results

172 CTAB induces TFEB nuclear translocation

173 HeLa cells stably expressing TFEB-GFP fusion protein were used to detect the effect of CTAB

174 on TFEB nuclear translocation. Nuclear accumulation of TFEB-GFP fluorescence was observed

175 after CTAB treatment (2.5 μM, 12 or 24 h), compared to the control (Fig. 1A). Similar result were

176 also acquired in response to the known mTORC1 inhibitor Torin1 (250 nM, 1 h). Moreover,

177 subcellular fractionation and Western blot analysis were performed in HepG2 and SMMC-7721

178 cells to verify the effect of CTAB on endogenous TFEB levels. The levels of nuclear TFEB were

179 significantly increased in these cells, following CTAB treatment (2.5 μM, 12 or 24 h) (Fig. 1B and

180 C). These results suggest that CTAB induces TFEB nuclear translocation.

181 CTAB induces autophagy

182 HeLa cells stably expressing GFP-LC3 fusion protein were used to further assess the effects

183 of CTAB on autophagy. The results showed that GFP-LC3 fluorescence puncta obviously increased

184 after CTAB treatment (2.5 μM, 6-24 h) (Fig. 2A), suggesting that CTAB increases the number of

185 autophagosome. Western blot analysis further showed that CTAB treatment led to an obvious

186 increase in the levels of LC3-II and a decrease in the abundance of p62 in HepG2 and SMMC-7721

187 cells (Fig. 2B). Moreover, bafilomycin A1 (Baf A1), a known inhibitor of autophagic degradation,

188 was used to evaluate the role of CTAB in the autophagic flux. Dual treatment with Baf A1 and 189 CTAB resulted in a significant accumulationDraft of LC3-II, compared to Baf A1 alone (Fig. 2C). These 190 results suggest that CTAB promotes autophagy.

191 CTAB induces autophagy and lysosomal biogenesis through TFEB activation

192 The shRNA-mediated knockdown of TFEB was used to investigate whether TFEB directly

193 participates in CTAB-induced autophagy. As shown in Fig. 3A, TFEB knockdown clearly impaired

194 the CTAB-induced LC3-II accumulation in HepG2 cells, compared to the control. Moreover,

195 lysosome associated membrane protein 2 (LAMP2) staining showed that CTAB treatment (2.5 μM,

196 24 h) led to a distinct increase in the number and the size of lysosomes. In contrast, depletion of

197 TFEB attenuated CTAB-induced lysosomal biogenesis (Fig. 3B). Acridine orange (AO) staining

198 assay further revealed an increase in the number of acidic organelles in CTAB-treated cells, and

199 TFEB knockdown impaired the accumulation of acidic organelles (Fig. 3C). These results indicate

200 that TFEB contributes to CTAB-induced autophagy and lysosomal biogenesis.

201 CTAB inhibits Akt-mTORC1 signaling

202 Since mTORC1 is the major negative upstream factor for TFEB regulation, we investigated

203 the activity of mTORC1 signaling following CTAB treatment in HepG2 and SMMC-7721 cells.

204 Western blot analyses showed that the phosphorylation of mTOR and p70 S6 kinase (p70S6K)

205 were significantly decreased after CTAB treatment (Fig. 4A and B). As mTORC1 is an effector of

206 PI3K/Akt signaling, we then examined the effect of CTAB on Akt activation. The results showed

207 that CTAB reduced the level of phosphorylated Akt, without affecting its overall protein level (Fig.

208 4A and B). These results indicate that Akt-mTORC1 signaling is inhibited by CTAB treatment. 209 CTAB ameliorates lipid accumulation inDraft hepatocytes by the activation of TFEB 210 To further explore the CTAB-promoted activation of autophagy-lysosome pathway, we

211 investigated the potential role of CTAB in regulating lipid degradation. Firstly, the effect of CTAB

212 on cell viability was evaluated by MTT assays, as shown in Fig. 5A, CTAB treatment (<5 μM, 48

213 h) had low cytotoxicity against HepG2 cells and normal liver cell line L02. Furthermore, to assess

214 the impact of CTAB on lipid clearance, PA and OA-treated HepG2 cells were subjected to ORO

215 staining. The results showed that CTAB resulted in a significant decrease in the PA and OA-

216 induced lipid accumulation, compared to the control (Fig. 5B). However, the degradation of lipid

217 droplets was attenuated by shRNA-mediated knockdown of TFEB (Fig. 5C), which suggests that

218 CTAB-induced TFEB activation is directly involved in lipid clearance.

219

220 Discussion

221 CTAB is a FDA-approved compound of quaternary ammonium widely used as an antiseptic

222 agent against fungi and bacteria (Weiss et al. 1987). Here, we provide evidence that CTAB

223 promotes autophagy-lysosome pathway in a TFEB-dependent mechanism, and CTAB treatment

224 specifically promotes lipid degradation in hepatic cells. Impairment of autophagy-lysosome

225 pathway has been mechanistically associated with age-related diseases and metabolic disorders

226 (Rubinsztein et al. 2011; Singh et al. 2009; Yang et al. 2010). As TFEB acts as a master regulator

227 in autophagy occurring and lysosome biogenesis, identifying TFEB activator offers a novel strategy

228 for therapy of these diseases. Indeed, several small-molecule TFEB agonists have already been 229 shown to ameliorate metabolic syndromeDraft and to extend lifespan in C. elegans (Kim et al. 2017; 230 Wang et al. 2017). Thus, our study demonstrates that CTAB has therapeutic potential in the

231 treatment of lipid metabolism disorders as a TFEB agonist.

232 Although CTAB has been shown to be cytotoxic against some cancer cells, it exhibits low

233 toxicity to normal cells. For instance, CTAB exhibits cytotoxicity against head and neck cancer

234 cells, with minimal effects on normal fibroblasts (Ito et al. 2009). It also inhibits the migration and

235 invasion of hepatic adenocarcinoma SK-HEP-1 cells, but does not affect growth and cell cycle

236 distribution of SK-HEP-1 cells (Wu et al. 2019). Moreover, CTAB can enhance sensitivity of breast

237 cancer to doxorubicin with low systemic toxicity (Pan et al. 2019). Consistent with this concept,

238 our data showed that CTAB treatment (at concentrations of < 5 μM) was not cytotoxic to HepG2

239 and L02 cells. Therefore, CTAB shows high systemic safety and could serve as a potential drug for

240 clinical therapy.

241 It has been known that mTORC1 directly phosphorylates TFEB at residues Ser 142 and Ser

242 211 on lysosomal surfaces, promoting its cytosolic sequestration by interaction with 14-3-3 proteins

243 (Martina et al. 2012; Settembre et al. 2012). In this study, CTAB treatment led to detectable

244 dephosphorylation of p70S6K, a mTORC1 substrate, indicating that mTORC1-dependent

245 mechanism mediates CTAB induction of TFEB. Consistent with our observations, a recent study

246 demonstrated that CTAB attenuates the migratory and invasion capacity of hepatic cancer cells SK-

247 HEP-1 by suppressing the PI3K/Akt/mTOR signaling pathway (Wu et al. 2019). It is well known

248 that nutrient starvation or elevated cytosolic Ca2+ results in AMP-activated protein kinase (AMPK) 249 activation, which in turn inhibits mTORC1Draft to promote TFEB nuclear translocation (Hoyer-Hansen 250 et al. 2007; Wang et al. 2017). Interestingly, another study suggested that CTAB increases the

251 sensitivity of breast cancer to DOX therapy by activating AMPK both in vitro and in vivo (Pan et

252 al. 2019). Thus, more studies are needed to detect whether AMPK also contributes to CTAB-

253 induced TFEB activation. Besides, it has been reported that Ca2+-sensing phosphatase calcineurin

254 contributes to the dephosphorylation and activation of TFEB (Medina et al. 2015). However, Ca2+

255 chelation by BAPTA-AM (1,2-Bis (2-aminophenoxy) ethane-N,N,N′,N′-tetraacetic acid tetrakis

256 (acetoxymethyl ester)) was insufficient to block the nuclear translocation of TFEB in response to

257 CTAB (data not shown), suggesting that CTAB-induced TFEB activation is relatively independent

258 of Ca2+/calcineurin. It is also intriguing to investigate whether or not different phosphatases

259 participate in TFEB activation induced by CTAB.

260 TFEB not only promotes the expression of autophagy-associated genes but also some essential

261 genes for lysosomal function (Sardiello et al. 2009; Settembre et al. 2011). Lysosome plays an

262 essential role in macromolecule metabolism by degrading the contents delivered in the

263 autophagosomes. Recently, dysfunction of lysosomes has been associated with various

264 pathological conditions, such as lysosomal storage and neurodegenerative diseases (Ballabio and

265 Bonifacino 2020). In this study, CTAB treatment enhanced the function of lysosomes, whilst in

266 contrast, TFEB knockdown significantly decreased the CTAB-induced lysosomal biogenesis. Thus,

267 we believe that CTAB is of significant interest for potential therapeutic intervention for lysosome-

268 related diseases. 269 In summary, this study demonstratedDraft that CTAB promotes lipid clearance by inducing TFEB- 270 mediated autophagy-lysosome activation in hepatic cells. These findings suggest that CTAB as a

271 novel TFEB agonist might have a promising application in the treatment of metabolic disorders.

272

273 Acknowledgements

274 We are grateful to Dr. Edward McKenzie (The University of Manchester, UK) for the critical

275 reading of the manuscript. Funding was provided by the National Key R&D Program of China

276 (2017YFD0400300) and the Scientific and Technological Research Program of Tianjin Municipal

277 Education Commission (2017KJ007).

278

279 Conflict of interest

280 The authors declare that they have no conflicts of interest with the contents of this article.

281

282

283

284

285

286

287

288 289 Draft 290

291

292

293

294

295 References:

296 Amir, M., and Czaja, M.J. 2011. Autophagy in nonalcoholic steatohepatitis. Expert

297 RevGastroenterol Hepatol 5(2): 159-166. doi:10.1586/egh.11.4.

298 Ballabio, A., and Bonifacino, J.S. 2020. Lysosomes as dynamic regulators of cell and organismal

299 homeostasis. Nat Rev Mol Cell Biol 21(2): 101-118. doi:10.1038/s41580-019-0185-4.

300 Dong, H., and Czaja, M.J. 2011. Regulation of lipid droplets by autophagy. Trends Endocrinol

301 Metab 22(6): 234-240. doi:10.1016/j.tem.2011.02.003.

302 Eisenberg, T., Knauer, H., Schauer, A., Buttner, S., Ruckenstuhl, C., Carmona-Gutierrez, D., et al.

303 2009. Induction of autophagy by spermidine promotes longevity. Nat Cell Biol 11(11):

304 1305-1314. doi:10.1038/ncb1975.

305 Hidvegi, T., Ewing, M., Hale, P., Dippold, C., Beckett, C., Kemp, C., et al. 2010. An autophagy-

306 enhancing drug promotes degradation of mutant alpha1-antitrypsin Z and reduces hepatic

307 fibrosis. Science 329(5988): 229-232. doi:10.1126/science.1190354.

308 Hoyer-Hansen, M., Bastholm, L., Szyniarowski, P., Campanella, M., Szabadkai, G., Farkas, T., et 309 al. 2007. Control of macroautophagyDraft by calcium, calmodulin-dependent kinase kinase-beta, 310 and Bcl-2. Mol Cell 25(2): 193-205. doi:10.1016/j.molcel.2006.12.009.

311 Ito, E., Yip, K.W., Katz, D., Fonseca, S.B., Hedley, D.W., Chow, S., et al. 2009. Potential use of

312 cetrimonium bromide as an apoptosis-promoting anticancer agent for head and neck cancer.

313 Mol Pharmacol 76(5): 969-983. doi:10.1124/mol.109.055277.

314 Kim, S.H., Kim, G., Han, D.H., Lee, M., Kim, I., Kim, B., et al. 2017. Ezetimibe ameliorates

315 steatohepatitis via AMP activated protein kinase-TFEB-mediated activation of autophagy

316 and NLRP3 inflammasome inhibition. Autophagy 13(10): 1767-1781.

317 doi:10.1080/15548627.2017.1356977.

318 Klionsky, D.J., and Emr, S.D. 2000. Autophagy as a regulated pathway of cellular degradation.

319 Science 290(5497): 1717-1721. doi:10.1126/science.290.5497.1717.

320 Li, W., Lin, J., Shi, Z., Wen, J., Li, Y., Liu, Z., et al. 2019. Clomiphene citrate induces nuclear

321 translocation of the TFEB transcription factor and triggers apoptosis by enhancing

322 lysosomal membrane permeabilization. Biochem Pharmacol 162: 191-201.

323 doi:10.1016/j.bcp.2018.11.016.

324 Martina, J.A., and Puertollano, R. 2013. Rag GTPases mediate amino acid-dependent recruitment

325 of TFEB and MITF to lysosomes. J Cell Biol 200(4): 475-491. doi:10.1083/jcb.201209135.

326 Martina, J.A., Chen, Y., Gucek, M., and Puertollano, R. 2012. MTORC1 functions as a

327 transcriptional regulator of autophagy by preventing nuclear transport of TFEB.

328 Autophagy 8(6): 903-914. doi:10.4161/auto.19653. 329 Medina, D.L., Di Paola, S., Peluso, I.,Draft Armani, A., De Stefani, D., Venditti, R., et al. 2015. 330 Lysosomal calcium signalling regulates autophagy through calcineurin and TFEB. Nat Cell

331 Biol 17(3): 288-299. doi:10.1038/ncb3114.

332 Mir, S.U., George, N.M., Zahoor, L., Harms, R., Guinn, Z., and Sarvetnick, N.E. 2015. Inhibition

333 of autophagic turnover in beta-cells by fatty acids and glucose leads to apoptotic cell death.

334 J Biol Chem 290(10): 6071-6085. doi:10.1074/jbc.M114.605345.

335 Mizushima, N., and Komatsu, M. 2011. Autophagy: renovation of cells and tissues. Cell 147(4):

336 728-741. doi:10.1016/j.cell.2011.10.026.

337 Nakata, K., Tsuchido, T., and Matsumura, Y. 2011. Antimicrobial cationic surfactant,

338 cetyltrimethylammonium bromide, induces superoxide stress in Escherichia coli cells. J

339 Appl Microbiol 110(2): 568-579. doi:10.1111/j.1365-2672.2010.04912.x.

340 Nissar, A.U., Sharma, L., Mudasir, M.A., Nazir, L.A., Umar, S.A., Sharma, P.R., et al. 2017.

341 Chemical chaperone 4-phenyl butyric acid (4-PBA) reduces hepatocellular lipid

342 accumulation and lipotoxicity through induction of autophagy. J Lipid Res 58(9): 1855-

343 1868. doi:10.1194/jlr.M077537.

344 Ouimet, M., Franklin, V., Mak, E., Liao, X., Tabas, I., and Marcel, Y.L. 2011. Autophagy regulates

345 cholesterol efflux from macrophage foam cells via lysosomal acid lipase. Cell Metab 13(6):

346 655-667. doi:10.1016/j.cmet.2011.03.023.

347 Pan, Y., Zhang, Y., Chen, Q., Tao, X., Liu, J., and Xiao, G.G. 2019. CTAB Enhances Chemo-

348 Sensitivity Through Activation of AMPK Signaling Cascades in Breast Cancer. Front 349 Pharmacol 10: 843. doi:10.3389/fphar.2019.00843.Draft 350 Roczniak-Ferguson, A., Petit, C.S., Froehlich, F., Qian, S., Ky, J., Angarola, B., et al. 2012. The

351 transcription factor TFEB links mTORC1 signaling to transcriptional control of lysosome

352 homeostasis. Sci Signal 5(228): ra42. doi:10.1126/scisignal.2002790.

353 Rubinsztein, D.C., Marino, G., and Kroemer, G. 2011. Autophagy and aging. Cell 146(5): 682-695.

354 doi:10.1016/j.cell.2011.07.030.

355 Rubinsztein, D.C., Codogno, P., and Levine, B. 2012. Autophagy modulation as a potential

356 therapeutic target for diverse diseases. Nat Rev Drug Discov 11(9): 709-730.

357 doi:10.1038/nrd3802.

358 Sardiello, M., Palmieri, M., di Ronza, A., Medina, D.L., Valenza, M., Gennarino, V.A., et al. 2009.

359 A gene network regulating lysosomal biogenesis and function. Science 325(5939): 473-

360 477. doi:10.1126/science.1174447.

361 Settembre, C., Di Malta, C., Polito, V.A., Garcia Arencibia, M., Vetrini, F., Erdin, S., et al. 2011.

362 TFEB links autophagy to lysosomal biogenesis. Science 332(6036): 1429-1433.

363 doi:10.1126/science.1204592.

364 Settembre, C., Zoncu, R., Medina, D.L., Vetrini, F., Erdin, S., Erdin, S., et al. 2012. A lysosome-

365 to-nucleus signalling mechanism senses and regulates the lysosome via mTOR and TFEB.

366 EMBO J 31(5): 1095-1108. doi:10.1038/emboj.2012.32.

367 Settembre, C., De Cegli, R., Mansueto, G., Saha, P.K., Vetrini, F., Visvikis, O., et al. 2013. TFEB

368 controls cellular lipid metabolism through a starvation-induced autoregulatory loop. Nat 369 Cell Biol 15(6): 647-658. doi:10.1038/ncb2718.Draft 370 Singh, R., Kaushik, S., Wang, Y., Xiang, Y., Novak, I., Komatsu, M., et al. 2009. Autophagy

371 regulates lipid metabolism. Nature 458(7242): 1131-1135. doi:10.1038/nature07976.

372 Wang, C., Niederstrasser, H., Douglas, P.M., Lin, R., Jaramillo, J., Li, Y., et al. 2017. Small-

373 molecule TFEB pathway agonists that ameliorate metabolic syndrome in mice and extend

374 C. elegans lifespan. Nat Commun 8(1): 2270. doi:10.1038/s41467-017-02332-3.

375 Weiss, M.J., Wong, J.R., Ha, C.S., Bleday, R., Salem, R.R., Steele, G.D., Jr., et al. 1987.

376 Dequalinium, a topical antimicrobial agent, displays anticarcinoma activity based on

377 selective mitochondrial accumulation. Proc Natl Acad Sci U S A 84(15): 5444-5448.

378 doi:10.1073/pnas.84.15.5444.

379 Wissing, M.D., Mendonca, J., Kim, E., Kim, E., Shim, J.S., Kaelber, N.S., et al. 2013. Identification

380 of cetrimonium bromide and irinotecan as compounds with synthetic lethality against

381 NDRG1 deficient prostate cancer cells. Cancer Biol Ther 14(5): 401-410.

382 doi:10.4161/cbt.23759.

383 Wu, T.K., Chen, C.H., Pan, Y.R., Hu, C.W., Huang, F.M., Liu, J.Y., et al. 2019. Cetrimonium

384 Bromide Inhibits Cell Migration and Invasion of Human Hepatic SK-HEP-1 Cells Through

385 Modulating the Canonical and Non-canonical TGF-beta Signaling Pathways. Anticancer

386 Res 39(7): 3621-3631. doi:10.21873/anticanres.13510.

387 Yang, L., Li, P., Fu, S., Calay, E.S., and Hotamisligil, G.S. 2010. Defective hepatic autophagy in

388 obesity promotes ER stress and causes insulin resistance. Cell Metab 11(6): 467-478. 389 doi:10.1016/j.cmet.2010.04.005.Draft 390

391

392

393

394

395

396

397

398

399

400 Figure legends

401 Fig. 1 CTAB induces TFEB nuclear translocation. (A) HeLa cells stably expressing TFEB-GFP

402 were treated with or without 2.5 μM CTAB for indicated time points. The fluorescent signals from

403 TFEB-GFP were observed by fluorescence microscopy. Torin1 (100 nM, 1 h) was used as a

404 positive control. Nuclei was identified by Hoechst staining (blue). Scale bar, 20 μm. (B) HepG2

405 and SMMC-7721 cells were treated with or without 2.5 μM CTAB. The levels of endogenous

406 TFEB in nuclear or cytoplasmic fractions were detected by Western blot. GAPDH and Histone H3

407 were used as a loading control. (C) The levels of nuclear TFEB were quantified by densitometric

408 analysis and normalized to nuclear marker Histone H3. Data are presented as mean ± SD of three 409 independent experiments (* P<0.05, **Draft P<0.01). 410 Fig. 2 CTAB promotes autophagy. (A) HeLa cells stably expressing GFP-LC3 were treated with

411 or without 2.5 μM CTAB for the indicated time points. The fluorescent signals of GFP-LC3 were

412 sequentially observed by fluorescence microscopy. Rapamycin (10 μM, 12 h) was used as a positive

413 control. Scale bar, 20 μm. One hundred cells from each group were randomly selected, and cells

414 with GFP-LC3 puncta (≥5 dots) were calculated by ImageJ. (B) HepG2 and SMMC-7721 cells

415 were treated with 2.5 μM CTAB for the indicated time points. The corresponding changes in LC3

416 and p62 levels were measured by Western blot analyses. (C) Following CTAB treatment for 12 h,

417 cells were cultured in complete medium with or without 200 nM Baf A1 for an additional 2 h. LC3-

418 II protein levels were detected by Western blot analyses. β-actin was used as a loading control. Baf

419 A1, bafilomycin A1. The Western blot intensities were analyzed and data presented as means ± SD

420 of three independent experiments (* P<0.05, ** P<0.01).

421 Fig. 3 CTAB promotes autophagy and lysosomal biogenesis through activation of TFEB. (A)

422 HepG2 cells stably expressing TFEB shRNA (shTFEB) or negative control shRNA (NC) were

423 treated with or without 2.5 μM CTAB. The levels of TFEB and LC3-II were measured by Western

424 blot using antibodies against TFEB and LC3. β-actin was used as a loading control. (B) Lysosomes

425 were recognized by immunofluorescence using an antibody against LAMP2. Scale bar, 20 μm. The

426 density of red fluorescence was analyzed using ImageJ software, and three independent

427 experiments were performed to generate the graphed values. (C) Acidic organelles were

428 investigated by AO staining and visualized by fluorescence microscopy. Data are presented as 429 means ± SD of three biological replicatesDraft (* P<0.05, ** P<0.01). 430 Fig. 4 CTAB inhibits Akt-mTORC1 signaling. (A) After CTAB treatment for the indicated

431 intervals, HepG2 and SMMC-7721 cells were subjected to Western blot analysis using the

432 corresponding antibodies. β-actin was used as loading control. (B) The levels of p-Akt and p-

433 p70S6K were quantified by densitometric analysis and normalized to total Akt and total p70S6K,

434 respectively. Data are presented as mean ± SD of three independent experiments (*P < 0.05, **P <

435 0.01).

436 Fig. 5 CTAB ameliorates fatty acid-induced lipid accumulation by the activation of TFEB. (A)

437 Following treatment with increasing doses of CTAB (1-5 μM) for 24 h and 48 h, the viability of

438 HepG2 and L02 cells were determined by MTT assay. The normalized value of untreated cells was

439 arbitrarily set as 1.0. The results from three independent experiments are presented as means ± SD.

440 (B) and (C) HepG2 cells stably expressing shTFEB or NC were stained with Oil red O (ORO).

441 Bright-field images showing ORO-stained cells treated with 2% palmitate (PA) and oleate (OA) or

442 OA alone in the presence or absence of 2.5 μM CTAB. Scale bar, 20 μm. The lipid accumulation

443 was quantified by densitometric analysis of ORO using ImageJ software. Data are presented as

444 mean ± SD of three independent experiments (*P < 0.05, **P < 0.01).

445

446

447

448 449 Draft 450

451

452

453

454

455

456

457

458

459

460

Draft

283x176mm (150 x 150 DPI)

Draft

312x218mm (150 x 150 DPI)

Draft

265x284mm (150 x 150 DPI)

Draft

167x223mm (150 x 150 DPI)

Draft

279x301mm (150 x 150 DPI)