LETTERS other federal statutes and regulations relat- Anaplasma were collected from 50 dogs and 20 ing to animals and experiments involving horses that showed tick infestation animals and adheres to principles stated in phagocytophilum, and symptoms consistent with tick- the Guide for the Care and Use of Sardinia, Italy borne disease, such as fever, anorexia, Laboratory Animals, NRC Publication, jaundice (only in horses), anemia, 1996 edition. To the Editor: Anaplasma phago- myalgia, and reluctance to move. cytophilum (formerly Ehrlichia Genomic DNA was extracted from phagocytophila), a tick-transmitted the buffy coat obtained by centrifuga- Alicia D. Anderson,* pathogen that infects several animal Bonnie Smoak,* Eric Shuping,† tion of 2 to 4 mL of blood, as previ- species, including humans (involved ously described (6). Furthermore, Christopher Ockenhouse,* as accidental “dead-end” hosts), is the and Bruno Petruccelli‡ DNA was extracted from 50 causative agent of human granulocyt- Rhipicephalus sanguineus ticks *Walter Reed Army Institute of Research, ic anaplasmosis (HGA). It is a Silver Spring, Maryland, USA; †Ireland removed from 30 dogs. Primers pathogen of veterinary importance Army Community Hospital, Fort Knox, EphplgroEL(569)F (ATGGTATGCA- Kentucky, USA; and ‡US Army Center for responsible for tickborne fever of GTTTGATCGC), EphplgroEL (1193) Health Promotion and Preventive ruminants and for granulocytic R (TCTACTCTGTCTTTGCGTTC), Medicine, Aberdeen Proving Ground, anaplasmosis of horses and dogs Maryland, USA and EphgroEL(1142)R (TTGAGTA- (1,2). HGA was first described in the CAGCAACACCACCGGAA) were References United States in 1994 (2) and is designed and used in combination to emerging in Europe (3). Although 1. McQuiston JH, Childs JE. Q fever in generate a heminested polymerase only 2 human cases have been report- chain reaction (PCR) for the selective humans and animals in the United States. ed in Italy (4), serologic and molecu- Vector Borne Zoonotic Dis. 2002;2: amplification of 573 bp of the groEL 179–91. lar findings have shown A. phagocy- gene of A. phagocytophilum. The final 2. Maurin M, Raoult D. Q fever. Clin tophilum infections in dogs and µ Microbiol Rev. 1999;12:518–53. 50 L PCR volume of the first PCR Ixodes ricinus ticks (5). Incidence, round contained 5 µL of the DNA 3. Stoker MGP, Marmion BP. The spread of Q prevalence, and public impact of fever from animals to man: the natural his- extraction, primers EphplgroEL tory of a rickettsial disease. Bull World HGA and horse granulocytic anaplas- (569)F and EphplgroEL(1193)R, and Health Organ. 1955;13:781–806. mosis are, therefore, unknown for this 4. Spicer AJ. Military significance of Q fever: HotMaster Taq DNA polymerase geographic area. From 1992 to 1996, (5u/µL, Eppendorf) according to the a review. J R Soc Med. 1978;71:762–7. an average rate of 13.4 cases/year/ 5. Severe acute pneumonitis among deployed manufacturer’s basic protocol U.S. military personnel—southwest Asia, 100,000 inhabitants of tick bite–relat- (Eppendorf AG, Hamburg, Germany). March–August, 2003. MMWR Morb ed fever of unknown etiology has Mortal Wkly Rep. 2003;52:857. Heminested PCR was performed by been reported on the island of using 5 µL of each of the first PCR 6. Rubertone MV, Brundage JF. The Defense Sardinia, Italy, which is considerably Medical Surveillance System and the products and primer EphgroEL Department of Defense serum repository: higher than the corresponding nation- (1142)R. To confirm the PCR diagno- glimpses of the future of public health sur- al average value of 2.1 cases/year/ veillance. Am J Public Health. sis, amplicons were digested with the 100,000 inhabitants. Moreover, 117 HindIII restriction endonuclease (pre- 2002;92:1900–4. cases of tick bite–related fever, whose 7. Bishay FK. Towards sustainable agricultur- dicted digestion pattern: 3 fragments al development in Iraq: the transition from etiology remains obscure, have been of 525 bp, 21 bp, and 27 bp). relief, rehabilitation, and reconstruction to reported from 1995 to 2002 in the development [monograph on the Internet]. Anaplasma phagocytophilum DNA central west coast area of the island. was obtained from strain NCH-1 and Rome: Food and Agriculture Organization Local newspapers occasionally report of the United Nations. 2003 [cited 2005 Jun used as positive control in PCR reac- 2]. Available from http://www.fao.org/doc- deaths as a result of tick bites, tions. Sequences were obtained by uments/show_cdr.asp?url_file=/DOCREP/ although no HGA-associated deaths 006/Y9870E/Y9870E00.HTM cloning the PCR products into the have been documented in Europe. pCR2.1-TOPO vector (Invitrogen This study investigated A. phago- S.R.L., Milan, Italy) and using the Address for correspondence: Alicia D. cytophilum in Sardinia. From 2002 to Anderson, Walter Reed Army Institute of ABI PRISM Big Dye Terminator 2004, veterinarians based on the cen- Cycle Sequencing Ready Reaction Research, Preventive Medicine Division, 503 tral west coast of the island were Robert Grant Ave, Silver Spring, MD 20910, Kit (Applied Biosystems, Foster City, instructed to collect EDTA blood sam- CA, USA), according to the protocols USA; fax: 301-319-9104; email: alicia.ander- ples when a suspected case of tick [email protected] supplied by the manufacturers. bite–related fever was found at their Sequences (AY848751, AY848747) clinics. A total of 70 blood samples were aligned to the corresponding
1322 Emerging Infectious Diseases • www.cdc.gov/eid • Vol. 11, No. 8, August 2005 LETTERS region of other species belonging to The molecular approach applied in Acknowledgment Rickettsiales by using ClustalX (7). this study established A. phagocy- We thank Sandra Edwards, Univer- Genetic distances among species were tophilum in an area of Sardinia char- sity of Newcastle, UK, for critical reading computed by the Kimura 2-parame- acterized by a high prevalence of tick and final editing of the manuscript. ters method by using MEGA, and bite–related fever in humans and ani- were used to construct bootstrapped mal species. To our knowledge, this is Alberto Alberti,* neighbor-joining trees (8). the first evidence of A. phagocy- Maria Filippa Addis,* Of 120 DNA samples, 1 tick, 3 tophilum in Sardinian dogs and horses Olivier Sparagano,† dog, and 3 horse samples generated and the first documentation of infec- Rosanna Zobba,* the predicted band of 573 bp represen- tion in Italian horses caused by patho- Bernardo Chessa,* tative of the groEL gene of A. phago- genic strains. Therefore, these find- Tiziana Cubeddu,* cytophilum. HindIII digestions con- ings suggest the emergence of Maria Luisa Pinna Parpaglia,* firmed PCR diagnosis (see Appendix Anaplasma phagocytophilum in Italy. Mauro Ardu,* and Marco Pittau* Figure, available at http://www.cdc. Ixodes ricinus ticks are indicated as *Università degli Studi di Sassari, Sassari, gov/ncidod/eid/vol11no08/05-0085_ vectors transmitting A. phagocy- Italy; †University of Newcastle, Newcastle app.htm). Two different groEL tophilum in Europe. Although only upon Tyne, United Kingdom sequence types were obtained from 1 0.3% of 4,086 ticks collected in 72 dog and 1 horse and confirmed by sites of Sardinia (9) have been identi- References BLAST (http://www. ncbi.nlm.nih. fied as Ixodes, other tick species are 1. Dumler JS, Barbet AF, Bekker CPJ, Dasch gov/Education/BLASTinfo/informa- better represented on the island GA, Palmer GH, Ray SC, et al. tion3.html) queries as A. phagocy- (Rhipicephalus, 67.2%; Haema- Reorganization of genera in the families tophilum groEL sequences (average physalis, 24.1%; Dermacentor, 4.9%). Rickettsiaceae and Anaplasmataceae in the identity 99%; average E value = 0), A. phagocytophilum in 1 Rhipicep- order Rickettsiales: unification of some species of Ehrlichia with Anaplasma, indicating that sequences did not halus sanguineus could indicate a role Cowdria with Ehrlichia, and Ehrlichia with reflect contamination. Bootstrapped of this tick in the epidemiology of Neorickettsia, descriptions of six new neighbor-joining trees confirmed the HGA. Finally, these data indicate the species combinations and designation of identity of the new sequences presence of a potential threat to Ehrlichia equi and ‘HGA agent’ as subjec- tive synonyms of Ehrlichia phagocytophi- obtained, which are closely related to human and animal health and suggest la. Int J Syst Evol Microbiol. 2001;51: HGA strains isolated in Europe and activation of further epidemiologic 2145–65. the United States (Figure). surveillance and controls. 2. Chen SM, Dumler JS, Bakken JS, Walker DH. Identification of a granulocytotropic Ehrlichia species as the etiologic agent of human disease. J Clin Microbiol. 1994;32:589–95. 3. Parola P. Tick-borne rickettsial diseases: emerging risks in Europe. Comp Immunol Microbiol Infect Dis. 2004;27:297–304. 4. Ruscio M, Cinco M. Human granulocytic ehrlichiosis in Italy: first report on two con- firmed cases. Ann NY Acad Sci. 2003;990:350–2. 5. Manna L, Alberti A, Pavone LM, Scibelli A, Staiano N, Gravino AE. First molecular characterisation of a granulocytic Ehrlichia strain isolated from a dog in South Italy. Vet J. 2004;167:224–7. 6. Pusterla N, Huder J, Wolfensberger C, Litschi B, Parvis A, Lutz H. Granulocytic ehrlichiosis in two dogs in Switzerland. J Clin Microbiol. 1997;35:2307–9. 7. Thompson JD, Gibson TJ, Plewniak F, Jeanmougin F, Higgins DG. The ClustalX windows interface: flexible strategies for multiple sequence alignment aided by qual- Figure. Bootstrapped neighbor-joining tree of several species belonging to Rickettsiales ity analysis tools. Nucl Acid Res. 1997;25: and identification of the strains isolated during the study as Anaplasma phagocytophilum. 4876–82. Strains associated to Sardinian groEL variants are closely related to European and American pathogenic human granulocytic anaplasmosis strains. Numbers indicate statis- tically supported bootstrap values.
Emerging Infectious Diseases • www.cdc.gov/eid • Vol. 11, No. 8, August 2005 1323 LETTERS
8. Kumar S, Tamura K, Jakobsen IB, Nei M. replacement. Physical examination One week later, a chest radiograph MEGA2: molecular evolutionary genetics showed a systolic murmur and an showed bilateral alveolar infiltrates analysis software. Bioinformatics. 2001;17: 1244–5. echocardiogram showed aortic steno- suggestive of pulmonary edema 9. Di Todaro N, Piazza C, Otranto D, sis. Transaortic peak pressure was 100 (Figure). To rule out infection, bron- Giangaspero A. Ticks infesting domestic mm Hg, and the aortic valvular area choscopy and protected specimen animals in Italy: current acarological stud- was 0.3 cm2. A biologic valve pros- brush were conducted. An unidentified ies carried out in Sardinia and Basilicata regions. Parassitologia. 1999;41(Suppl 1): thesis (Mitroflow 21, Sorin Group gram-positive bacillus was cultured 39–40. Canada, Ltd., Burnaby, British from the brush sample. Urine cultures Columbia, Canada) was inserted were positive for Candida kefyr, but Address for correspondence: Alberto Alberti, under the cardiopulmonary bypass. the patient showed no evidence of can- Istituto di Patologia Speciale e Clinica Medica Forty-eight hours later, the patient didemia. An echocardiogram showed Veterinaria, Università degli Studi di Sassari, had paroxysmal atrial fibrillation and no evidence of infective endocarditis. Via Vienna 2, 07100 Sassari, Italy; fax: 39-079- a temperature of 39°C, with severe Since the patient’s condition did not 229451; email: [email protected] hemodynamic and respiratory impair- improve, levofloxacin was replaced ment. She was intubated and intra- with imipenem, and treatment with venous drugs were administered. fluconazole was initiated. However, Blood and urine cultures were the patient developed septic shock, requested. Central venous pressure adult respiratory distress syndrome, lines were changed, and cultures were and oliguric acute renal failure, and obtained. Empiric treatment with lev- died of multiple organ failure. ofloxacin, amikacin, and teicoplanin On direct examination, a Gram was started for the patient. One of 2 stain of the protected specimen brush Williamsia muralis blood cultures was positive for sample showed numerous gram-posi- Staphylococcus epidermidis, as were tive bacilli. After incubation for 48 h Pulmonary cultures from femoral and jugular in either an aerobic or capnophilic Infection venous lines. Although considered a atmosphere, >1,000 CFU/mL were contaminant, we observed that S. epi- observed on Columbia agar plates To the Editor: Bacteria of the dermidis was susceptible to empiric containing 5% sheep blood (BD genus Williamsia are mycolic antimicrobial drugs. Stacker Plates, BBL, Franklin Lakes, acid–containing actinomycetes of the suborder Corynebacterineae (1). This suborder also includes the genera Gordonia, Mycobacterium, Nocardia, Corynebacterium, Rhodococcus, Dietzia, Skermania, Tsukamurella, and Turicella (2,3). Within the genus Williamsia, only 2 species have been reported: Williamsia muralis, isolated from a daycare center (4), and W. maris, isolated from the Sea of Japan (5). One important aspect shared by both species is their apparent lack of pathogenicity, since they have been isolated only from environmental samples. An 80-year-old woman, whose medical history included allergy to penicillin and high blood pressure, was admitted to the cardiothoracic intensive care unit at Juan Canalejo Hospital Complex in La Coruña, Spain, because of a loss of conscious- Figure. Chest radiograph of the patient showing bilateral alveolar infiltrates. Although pul- monary edema was the initial diagnosis, an infectious cause should be considered and, ness following an aortic valve on the basis of sepsis, appropriate treatment initiated.
1324 Emerging Infectious Diseases • www.cdc.gov/eid • Vol. 11, No. 8, August 2005