Functional Genomics and Metabolite Profiling As Tools for Alkaloid Biosynthetic Gene Discovery

University of Calgary PRISM: University of Calgary's Digital Repository

Graduate Studies The Vault: Electronic Theses and Dissertations

2015-12-16 Functional Genomics and Metabolite Profiling as Tools for Alkaloid Biosynthetic Gene Discovery

Dinsmore, Donald Reed

Dinsmore, D. R. (2015). Functional Genomics and Metabolite Profiling as Tools for Alkaloid Biosynthetic Gene Discovery (Unpublished master's thesis). University of Calgary, Calgary, AB. doi:10.11575/PRISM/26246 http://hdl.handle.net/11023/2686 master thesis

University of Calgary graduate students retain copyright ownership and moral rights for their thesis. You may use this material in any way that is permitted by the Copyright Act or through licensing that has been assigned to the document. For uses that are not allowable under copyright legislation or licensing, you are required to seek permission. Downloaded from PRISM: https://prism.ucalgary.ca UNIVERSITY OF CALGARY

Functional Genomics and Metabolite Profiling as Tools for Alkaloid Biosynthetic Gene

Discovery

Donald Reed Dinsmore

A THESIS

SUMITTED TO THE FACULTY OF GRADUATE STUDIES

IN PARTIAL FULFILMENT OF THE REQUIREMENTS FOR THE

DEGREE OF MASTER OF SCIENCE

GRADUATE PROGRAM IN BIOLOGICAL SCIENCES

CALGARY, ALBERTA

NOVEMBER, 2015

ABSTRACT

The benzylisoquinoline alkaloids (BIAs) are diverse group of plant specialized metabolites found in the families Papaveracea, Ranunculaceae, Berberidaceae and

Menispermaceae. Plants remain the only commercial source for BIAs and their biosynthesis is poorly understood. O-methyltransferases (OMTs) are wide spread in BIA biosynthesis. Putative

OMTs were found in stem and root Next-Generation Sequencing transcriptomic databases.

Putative OMT cDNAs were isolated from Papaver somniferum and commercially synthesized.

Recombinant protoberberine 2-O-methyltransferase (2OMT) was heterologously expressed in

Escherichia coli and assayed. 2OMT demonstrated the 2-O-methylation of protoberberine alkaloids and the 7-O-methylation of simple BIAs. The substrate range and tissue specific expression of 2OMT suggest its in vivo role is converting (S)-cheilanthifoline to (S)-sinactine. A

LC-MS based targeted alkaloid profiling of twenty BIA producing species from the families

Papaveracea, Ranunculaceae, Berberidaceae and Menispermaceae was conducted.

ACKNOWLEDGEMENTS

The completion of this thesis would not have been possible without the continued support and help from my fiancé, Alexis Greene, my parents Murray and Debra Dinsmore, my co- workers Scott Farrow and Guillaume Beaudoin and finally my supervisor Dr. Peter Facchini. I would also like to thank my committee members, Dr. Greg Moorhead and Dr. David Schriemer for their guidance throughout the duration of my program.

TABLE OF CONTENTS

ABSTRACT...... I

ACKNOWLEDGEMENTS...... II

TABLE OF CONTENTS ...... III

LIST OF TABLES...... VII

LIST OF FIGURES ...... VIII

LIST OF SYMBOLS, ABBREVIATIONS AND NOMENCLATURE...... IX

CHAPTER ONE: INTRODUCTION ...... 1

1.1 SECONDARY OR SPECIALIZED METABOLISM IN PLANTS ...... 1

1.2 ALKALOID BIOSYNTHESIS IN PLANTS...... 4

1.3 BENZYLISOQUINOLINE ALKALOID BIOSYNTHESIS ...... 12

1.3.1 Structural diversity of benzylisoquinoline alkaloids ...... 12

1.3.2 Molecular biology and biochemistry of benzylisoquinoline alkaloids...... 14

1.3.3 The catalytic mechanism of OMTs...... 22

1.4 APPROACHES TO GENE DISCOVERY AND FUNCTIONAL CHARACTERIZATION OF ALKALOID BIOSYNTHETIC

GENES...... 24

1.4.1 Traditional approaches to gene identification ...... 24

1.4.2 Genomics-based gene discovery approaches ...... 24

1.4.3 Integration of targeted metabolomics and transcriptomics for gene discovery ...... 26

1.4 OBJECTIVES ...... 27

CHAPTER TWO: MATERIALS AND METHODS...... 29

2.1 NUCLEIC ACID ISOLATION AND ANALYSIS ...... 29

iii

2.1.1 Isolation of cDNAs encoding putative OMTs from opium poppy stem...... 29

2.1.2 Isolation of cDNAs encoding putative OMTs from opium poppy root...... 29

2.2 PHYLOGENETIC ANALYSIS...... 30

2.3 CONSTRUCTION OF EXPRESSION VECTORS AND HETEROLOGOUS EXPRESSION...... 32

2.3.1 Stem OMT gene candidates IzOMT1 through IzOMT6 ...... 32

2.3.2 Root OMT gene candidates DDOMT1-4...... 34

2.4 PURIFICATION OF RECOMBINANT PROTEINS AND ANALYSIS ...... 35

2.4.1 Purification of recombinant IzOMT 1-6 and DDOMT 1-4 ...... 35

2.4.2 SDS-PAGE...... 36

2.4.3 Western Blot Analysis ...... 36

2.5 RECOMBINANT OMT CANDIDATE ASSAYS ...... 36

2.5.1 Routine Enzyme assays...... 36

2.5.2 DDOMT1 Temperature and pH Optima assay...... 37

2.5.3 DDOMT1 Km Assays ...... 37

2.6 LC-MS CONDITIONS FOR ENZYME ASSAY ANALYSIS...... 38

2.6.1 LC conditions for enzyme assays ...... 38

2.6.2 Mass analyzer conditions ...... 38

2.7 REAL-TIME QUANTITATIVE PCR (QPCR)...... 39

2.8 LC-MS BASED TARGETED ALKALOID PROFILING OF 20 BIA PRODUCING PLANTS SPECIES...... 40

2.8.1 Plants...... 40

2.8.2 Chemical Standards ...... 40

2.8.3 Extraction of alkaloids from BIA producing plant species...... 41

2.8.4 LC conditions for targeted alkaloid profiling ...... 42

2.5.2 Mass analyzer conditions for targeted alkaloids profiling...... 42

CHAPTER THREE: THE ISOLATION AND FUNCTIONAL EXPRESSION OF A MOLECULAR CLONE

ENCODING 2-PROTOBERBERINE O-METHYLTRANSFERASE...... 44

3.1 INTRODUCTION...... 44

3.2 RESULTS...... 47

3.2.1 Identification and phylogenetic analysis of 2OMT cDNA ...... 47

3.2.2 Heterologous expression of 2OMT...... 50

3.2.3 Enzymatic properties of 2OMT ...... 50

3.2.4 Relative transcript abundance of 2OMT in opium poppy tissue ...... 63

3.3 DISCUSSION ...... 66

3.4 CONCLUSIONS ...... 76

CHAPTER FOUR: TARGETTED ALKALOID PROFILING OF TWENTY BENZYLISOQUINOLINE

PRODUCING SPECIES ...... 78

4.1 INTRODUCTION...... 78

4.2 RESULTS...... 80

4.2.1 Targeted alkaloid profiling by LC-MS/MS ...... 80

4.3 DISCUSSION ...... 92

4.3.1 Simple BIAs ...... 92

4.3.2 Protoberberine alkaloids...... 94

4.3.3 Protopine alkaloids ...... 96

4.3.4 Benzo[c]phenanthridine alkaloids...... 98

4.4.5 Aporphine alkaloids...... 99

4.4.6 Morphians ...... 100

4.3.6. Limitations of targetted alkaloid profiling...... 101

4.4 CONCLUSIONS ...... 104

CHAPTER FIVE: DISCUSSION...... 105

5.1 OVERVIEW...... 105

5.2 FUTURE DIRECTIONS ...... 106

5.2.1 Further characterization of 2OMT...... 106

5.2.2 Future targeted metabolite profiling...... 107

5.2.3 Using the targeted alkaloid profiles of twenty BIA producing plants in conjunction with NGS

...... 108

REFERENCES...... 112

LIST OF TABLES

Table 2.1 Protein abbreviations and GenBank accession numbers for sequences used in phylogenetic analysis of SAM-dependent O-methyltransferases from selected plants...... 31

Table 2.2. Primer sequences used to amplify gene candidates from stem and root opium poppy cDNA ...... 33

Table 2.3. Real-Time quantitative PCR Primers used to study the relative gene expression of 2OMT in different tissue types from opium poppy...... 39

Table 3.1. The products formed by assaying different chemicals with 2OMT. m/z ratios were determined by LC-MS and reaction products were determined by CID. The methylation pattern of the substrate is indicated by the positions N, 6, 7, 4’ and 3’. Activities are relative to scoulerine...... 56

Table 3.2. The ESI[+]CID pattern of substrates and the products from the substrate range experiments determined by LC-MS/MS...... 61

Table 4.1 Chemical standards used for the targeted alkaloid profiling of 20 BIA producing species by LC-MS/MS...... 83

vii

LIST OF FIGURES

Figure 1.1. The four general groups of plant specialized metabolites and their origins in primary metabolism...... 3

Figure 1.2. Different classes of plant alkaloids and their biosynthetic origins (Dewick 2009)..... 5

Figure 1.3. Monoterpenoid indole alkaloid (MIA) biosynthesis and diversity...... 7

Figure 1.4. Tropane alkaloid biosynthesis and diversity...... 10

Figure 1.5 Purine alkaloids biosynthesis and diversity...... 11

Figure 1.6. Biosynthetic pathways showing benzylisoquinoline alkaloids accumulating in Papver somniferum and other plant species...... 16

Figure 3.1. Neighbour-joining tree of derived from the amino acid sequences of selected plant SAM-dependant O-methyltransferases...... 49

Figure 3.2. Heterologous expression of 2OMT synthetic gene in E. coli...... 51

Figure 3.3. The effect of pH on Papaver somniferum 2OMT activity with scoulerine...... 52

Figure 3.4. The effect of temperature on Papaver somniferum 2OMT activity with scoulerine . 53

Figure 3.6 Extracted ion chromatograms (EICs) showing the O-methylation activity of 2OMT on (A) cheilanthifoline, (B) Scoulerine, (C) coclaurine, (D) dopamine, (E) Reticuline and (F) 6-O-methylnorlaudanosoline...... 58

Figure 3.7 The O-methylation activity of 2OMT on various BIA substrates (A) cheilanthifoline, (B) scoulerine, (C) coclaurine, (D) dopamine, (E) reticuline and (F) 6- O-methylnorlaudanosoline...... 60

Figure 3.8 Michaelis-Menten plot for Papaver somniferum protoberberine 2OMT with (S)- scoulerine with a constant concentration of SAM...... 64

Figure 3.9 Relative abundance of 2OMT gene transcripts in Bea’s Choice opium poppy tissues...... 65

Figure 3.10 The proposed in vivo role of 2OMT in the biosynthesis of cryptopine and rhoeadine alkaloids...... 77

Figure 4.1 Annotated LC-MS chromatograms from 20 BIA producing species...... 89

viii

LIST OF SYMBOLS, ABBREVIATIONS AND NOMENCLATURE

Acronym Definition

[M]+ Parent Ion [M+H]+ Protonated parent ion 2OMT Protoberberine 2-O-methyltransferase 3’OHase Uncharacterized 3’-hydroxylase 3’OMT Uncharacterized 3’-O-methyltansferase 4’OMT2 3’-Hydroxyl-N-methylcoclaurine 4’-O- methyltransferase 4HPAA 4-Hydroxyphenylacetaldehyde 4HPPDC 4-Hydroxyphenylpyruvate decarboxylase 5’OMT 6-O-methylnorlaudanosoline-5’-O- methyltransferase 6OMT norcoclaurine-6-O-methyltransferase 7OMT Reticuline 7-O-methyltransferase Asp Aspartate BBE Berberine bridging enzyme BIA Benzyl isoquinoline alkaloid BLAST Basic Local Alignment Search Tool CAS Canadine synthase CE Collisional energy CFS Cheilanthifoline synthase CID Collisionally-induced dissociation CNMT Coclaurine N-methyltransferase CODM Codeine O-demethylase CoOMT Columbamine O-methyltransferase COR Codeinone reductase CS Caffeine synthase CTAB Cetyl triethylammonium bromide CYP Cytochrome P450 CYP82Y1 N-Methylcanadine 1-hydroxylase Cys Cysteine DBOX Dihydrobenzophenanthridine oxidase DXMT 3, 7-dimethylxanthosine N-methyltransferase DXP Deoxyxyulose phosphate EIC Extracted ion chromatogram ESI Electrospray ionization EST Expressed sequence tag FAD Flavin adenine dinucleotide FADOX FAD-dependent oxidoreductases

FPKM Fragments per kilobase of exon per million fragments mapped FTICR-MS Fourier transform ion cyclotron resonance mass spectrtometry FTIR Fourier transform infrared spectroscopy Gln Glutamine Gly Glycine His Histidine HPLC High-performance liquid chromatography HPR Horseradish peroxidase IPP Isopentenyl diphosphate IPTG Isopropyl ß-D-1-thiogalactopyranoside LB Lauria-Bertani LC Liquid chromatography Lys Lysine MIA Monoterpenoid indole alkaloid MIAMET Minimum information about a metabolomics experiment MPO Methylputrescine oxidase MS Mass spectrometry MSH N-Methylstylopine14-hydroxylase MSn Tandem mass spectrometry MXMT 7-methylxanthosine N-methyltransferase N7OMT Norreticuline 7-O-methyltransferase NCS Norcoclaurine synthase NGS Next-generation sequencing NMCH N-methylcoclaurine 3’-hydroxylase NMR Nuclear magnetic resonance NMT N-methyltransferase NOS Noscapine synthase ODC Ornithine decarboxylase ODD 2-Oxoglutarate/Fe(II)-dependent dioxygenases OMT O-methyltransferase ORF Open reading frame P6H Protopine 6-hydroxylase PCR Polymerase chain reaction Phe Phenylalanine PMT Putrescine N-methyltransferase qPCR Real-time quantitative polymerase chain reaction QqQ Triple quadrupole RT-PCR Real-time quantitative polymerase chain reaction SalAT Salutaridinol 7-O-acetyltransferase SalSyn Salutaridine synthase SAM S-adenosylmethionince SanR Sanguinarine reductase

SDR Short-chain dehydrogenase/reductase Ser Serine SOMT1 Scoulerine-9-O-methyltransferase SPE Solid-phase extraction SPS Stylopine synthase STOX (S)-Tetrahydroxyprotoberberineoxidase STR Strictosidine synthase T6ODM Thebaine 6-O-demethylase TNMT Tetrahydroprotoberberine N-methytransferase TOF Time-of-flight Trp Tryptophan TS Theobromine synthase TYDC Tyrosine decarboxylase Tyr Tyrosine TyrAT Tyrosine aminotransferase VIGS Virus-induced gene silencing

xii

CHAPTER ONE: INTRODUCTION

1.1 Secondary or specialized metabolism in plants

Plants have the remarkable ability to produce a wide variety of low molecular weight metabolites. Ancient metabolic pathways common to almost all organisms are referred to as

‘primary’ and the rest, by convention, are referred to as ‘secondary’. Although primary metabolites comprise a relatively small subset of plant metabolites they are essential for normal growth, development and reproduction (Pichersky and Gang 2000; Kliebenstein and Osbourn

2012). All other metabolites made by plants are known as secondary metabolites. Over 200,000 defined structures are considered secondary metabolites and are found among most plant groups

(Hartmann 2007; Pichersky and Gang 2000). Since ancient times humans have exploited the properties of plant secondary metabolites for use as dyes, fragrances, poisons and medicines.

Even today plants remain the sole source for several compounds essential for the production of commercial and pharmaceutical products, in addition plants can serve as natural chemical libraries for the development of new products and drugs (Butler 2008). Despite their usefulness to humans, the scientific community viewed secondary metabolites as “flotsam and jetsam on the metabolic beach” (Haslam 1986). As it were, secondary metabolites were thought to be metabolic waste or detoxification products and conferred no advantage to the plant (Hartmann

2007). It wasn’t until the right experiments were performed by plant entomologists studying herbivore-plant relationships that a more meaningful role for plant secondary metabolites was considered (Fraenkel 1959). After decades of experiments, it is now widely accepted that many secondary metabolites represent the chemical adaptations of certain plants to specific ecological conditions and serve functional roles in plants to increase their overall fitness (Hartmann 2007;

Pichersky and Lewinsohn 2011). Secondary metabolites can increase the fitness of plants in

several different ways. For example, secondary metabolites can act as defence compounds against herbivores and pathogens; as attractants for pollinators and seed-dispersing animals; and as growth suppressants for neighbouring plants who compete for resources and sunlight

(Facchini et al. 2007; Liscombe and Facchini 2008; Pichersky and Gershenzon 2002; Theis and

Lerdau 2003; Dixon 2001). The anachronistic term, secondary metabolites, has fallen out of use in recent years in favour of the new term, specialized metabolites, which more accurately reflects the importance of these compounds (Ferrer et al. 2008; Pichersky and Lewinsohn 2011).

Plant specialized metabolites can be arranged in four general groups based on their chemical structures: phenolics, terpenoids, non-aromatic polyketides, cyanogenic and sulfur- containing metabolites and alkaloids (Figure1.1) (Micheal Wink 2010). Phenolics draw their name from the presence of a phenol moiety in their structure. All phenolics originate from the shikimate or malonate/acetate pathways. There are approximately 9000 known phenolics.

Figure 1.1 illustrates some of the different subclasses of phenolics, flavonoids, phenylpropanoids, polyactylenes and polyketides (Micheal Wink 2010).

The largest group of plant specialized metabolites are called terpenoids with approximately 25 000 known compounds. The 5-carbon precursor to all terpernoids, isopentenyl diphosphate (IPP), is generated by the cytosolic mevalonate pathway or the plastidic deoxyxyulose phosphate (DXP) pathway. The diversity of terpenoids results from the polymerization and cyclization of IPP monomers by terpene synthases to generate various terpenoid backbones classified by the number of IPP monomer combined to make them (Micheal

Wink 2010). Examples of each class of terpenoid are shown in Figure 1.1.

Figure 1.1. The four general groups of plant specialized metabolites and their origins in primary metabolism.

The color of each box corresponds to the category of specialized metabolites the illustrated compounds belong to: red, phenolics; green, terpenoids; blue, alkaloids; yellow, cyanogenic and sulfur-containing. Cys, cysteine; DXP, deoxyxyulose phosphate; IPP, isopentyl diphosphate.

Cyanogenic and sulfur-containing specialized metabolites are illustrated in Figure 1.1 and include: cyanogenic glucosides, glucosinolates and cysteine sulfoxides. Of these three groupings only approximately 160 compounds are known (Micheal Wink 2010). Cyanogenic glucosides are hydrolyzed by some plants for defence purposes. The enzymatic hydrolysis of cyanogenic glucosides releases toxic by-products in response to tissue damage or wounding (Fahey,

Zalcmann, and Talalay 2001; Dewick 2009). One such example is the compound amygdalin, found in almonds. When almond tissue containing the amygdalin is crushed a series of enzymatic steps hydrolyze it into benzaldehyde and hydrogen cyanide (Dewick 2009). The primary constituent of garlic flavour is a cysteine sulfoxide known as allicin. Allicin is also a known antimicrobial (Dewick 2009). The final class of plant specialized metabolites, alkaloids

(Figure 1.1), will be discussed at length in the preceeding section.

1.2 Alkaloid biosynthesis in plants

Alkaloids are amino acid derived low molecular weight compounds of 100 to 900 Da, often with at least one nitrogen in a heterocyclic ring. These nitrogen-containing compounds are produced by approximately 20% of plant species (Ziegler and Facchini 2008). Although some animals and microbes produce alkaloids the majority of known alkaloids are made by plants.

Over 12 000 alkaloids have been identified making them the second largest groups of plant specialized metabolites after terpenoids (Ziegler and Facchini 2008). Several alkaloids have potent pharmacological effects, including but not limited to use as stimulants, poisons, narcotics and anti-tumour agents (Ky et al. 2001; Reynolds 2005; Beaudoin and Facchini 2014; Noble

1990). As a result of their pharmacological effects, the properties of alkaloids have been exploited by humans for centuries (Theis and Lerdau 2003). This class of plant specialized metabolites can be divided into subgroups shown in Figure 1.2 that represent the chemical

Figure 1.2. Different classes of plant alkaloids and their biosynthetic origins (Dewick 2009). Abbreviations: Trp, tryptophan; DXP, deoxyxylose phosphate; IPP, isopentenyl disphosphate; Glu, glutamate; Gln, glutamine; His, histidine; Asp, aspartate; Lys, lysine; Ser, serine; Gly, glycine; Tyr, tyrosine; Phe, phenylalanine.

diversity of alkaloids (Dewick 2009). The biosynthesis of different alkaloid subgroups depicted in Figure 1.2 has been proposed based on data from a variety of experiments ranging from alkaloids extractions, biosynthetic feeding studies and biomimetic syntheses. The biosynthesis leading to different alkaloid subgroups have not been thoroughly investigated on a molecular biochemical basis. The best studied biosynthetic routes leading to alkaloids are the terpenoid indole, tropane, purine and benzylisoquinoline alkaloids pathways (Ziegler and Facchini 2008).

Monoterpenoid indole alkaloids (MIAs) (Figure 1.3) are a family of more than 3 000 members found primarily in the plant families, Apocynaceae, Loganiaceae, Nissacecae and

Rubiaceae (Loyola-Vargas, Galaz-Avalos, and Ku-Cauich 2007). The most widely used model species for studying the biochemistry and molecular biology of MIA biosynthesis have been

Catharanthus roseus and Rauvolfia serpentina (Facchini and DeLuca 2008). All MIAs are derived from tryptophan which is decarboxylated to form tryptamine. In the first commited step in MIA metabolism, strictosidine synthase catalyzes the Pictet-Spengler condensation of typtamine with secologanin to form strictosidine, illustrated in Figure 1.3 (O’Connor and Maresh

2006; Facchini and DeLuca 2008; Loyola-Vargas, Galaz-Avalos, and Ku-Cauich 2007; Kutchan et al. 1988). In addition to strictosidine synthase over 12 different cDNAs encoding MIA biosynthetic enzymes have been discovered and functionally characterized (Jörg Ziegler and

Facchini 2008). All the unique structural subclasses of MIAs are illustrated in Figure 1.3. In many cases enzymatic steps have been characterized using traditional biochemical methods but the corresponding cDNA has not been cloned (Ziegler and Facchini 2008; Dethier and De Luca

1993).

Figure 1.3. Monoterpenoid indole alkaloid (MIA) biosynthesis and diversity.

Strictosidine synthase (STR), catalyzes the Pictet-Spengler condensation of tryptamine and secologanin to form strictosidine in the first committed step of MIA biosynthesis. The structural subclasses of MIAs derived from strictosidine are italicized and represented by the different colored boxes while the names of the illustrated compounds are written below. Quinoline, red; Sarpagan, orange; Coryanthe, purple; Aspidosperma, green; Ajmalan, yellow; Iboga, blue. Thin arrows represent a single enzyme catalyzed reaction and thick arrows represent multiple enzymatic and/or spontaneous chemical reactions.

Tropane alkaloids are an important class of anticholinergic and stimulant compounds found primarily in the families Solanaceae, Erythroxylaceae and Convolvulaceae (Figure 1.4)

(Griffin and Lin 2000; Ziegler and Facchini 2008). The importance of some tropane alkaloids such as nicotine, cocaine, scopolamine and hyoscyamine has led to the isolation and characterization of several genes encoding enzymes involved in the biosynthesis of tropane alkaloids (Ziegler and Facchini 2008). Much of the pioneering work on tropane alkaloids has been done with tobacco, Hyoscyamus niger and Attropa belladonna, however, recent studies performed using Eruthroxylum coca have changed paradigms surrounding tropane alkaloid biosynthesis (Ziegler and Facchini 2008; Jirschitzka et al. 2012; Docimo et al. 2012).

Interestingly, some evidence suggests that tropane alkaloid formation in distant angiosperm lineages has evolved independently. For example, a tropinone-reduction step which converts methylecgonone to methylecgonine with the help of a short-chain dehydrogenase/reductase

(SDR) family reductase has been found in Eruthroxylum coca and not in the taxonomically remote Solanaceae family (Jirschitzka et al. 2012).

Purine alkaloids are a small group of plant specialized metabolites that are well known and widely used by human. Purine nucleotides provide the precursors for plants like Coffea

Arabica (coffee), Camellia sinensis (tea) and Theobroma cacao (cacao) to synthesize alkaloids such as, caffeine, theobromine and methyluric acid (Figure 1.5) (Suzuki, Ashihara, and Waller

1992; Ashihara, Sano, and Crozier 2008). The major route to caffeine starts with xanthosine which undergoes three O-methylation steps followed by the hydrolysis of the ribosyl moiety

(Ashihara, Sano, and Crozier 2008). cDNAs encoding for each methyltransferase in the pathway has been functionally characterized. Although the enzyme responsible for the hydrolysis of 7- methylxanthosine has been partially purified from tea leaves, the corresponding cDNA has never

been found despite some evidence to suggesting the preceding O-methylation step and the nucleoside cleavage are catalyzed by the same enzyme (Ashihara, Sano, and Crozier 2008;

Mccarthy and Mccarthy 2014). Caffeine synthase (CS), also referred to as 3,7- dimethyxanthosine N-methyltransferase (DXMT), accepts both theobromine and caffeine as substrates and is capable of completing the last two steps of caffeine biosynthesis, while theobromine synthase (TS) or 7-methylxanthosine N-methyltransferase (MXMT) is specific for the conversion of 7-methylxanthine to theobromine (Figure 1.5) (Ashihara, Sano, and Crozier

2008).

Figure 1.4. Tropane alkaloid biosynthesis and diversity.

The spontaneously derived N-methyl-Δ1- pyrrolium cation is the branch point from which scopolamine (yellow) and cocaine (blue) biosynthesis split. Enzymes for which cognate cDNAs have been isolates are in green. Thin arrows represent a single enzyme catalyzed reaction and thick arrows represent multiple enzymatic and/or spontaneous chemical reactions. ODC, ornithine decarboxylase; PMT, putrescine N-methyltransferase; MPO, methylputrescine oxidase.

Figure 1.5 Purine alkaloids biosynthesis and diversity.

Enzymes for which cognate cDNAs have been isolated are in green. Thin arrows represent a single enzyme catalyzed reaction and thick arrows represent multiple enzymatic and/or spontaneous chemical reactions. XMT, xanthosine N-methyltransferase; MXMT, 7- methylxanthosine N-methyltransferase; CS, caffeine synthase; TS, theobromine synthase; DXMT, 3,7-dimethyxanthosine N-methyltransferase.

1.3 Benzylisoquinoline alkaloid biosynthesis

1.3.1 Structural diversity of benzylisoquinoline alkaloids

Occurring primarily in the orders Papaveracea, Ranunculaceae, Berberidaceae and

Menispermaceae, benzylisoquinoline alkaloids (BIAs) are one of the largest and most diverse alkaloid groups with over 2,500 unique structures identified to date (Ziegler and Facchini 2008).

BIAs have been used by humans for thousands of years. Some examples include the well- known, analgesic morphine and the cough-suppressant codeine (Hagel and Facchini 2013).

Many other BIAs also possess potent pharmacological activities for example, noscapine is thought to interact with microtubules to inhibit the proliferation of cancer cells (Landen, Lang, and McMahon 2002). Papaverine and (+)-tubocurarine act as vasodilators and muscle relaxants, while sanguinarine and berberine are known antimicrobial agent (Ziegler et al. 2009; Hagel and

Facchini 2013). The chemical complexity of BIAs, owing to the presence of at least one chiral center, precludes the industrial synthesis of most BIAs. Therefore, in many cases plants remain the sole source economic source of BIAs indispensible to modern medicine (Xiao, Zhang, Chen,

Lee, Barber, Chakrabarty, Desgagné-Penix, et al. 2013).

Despite the incredible structural diversity of BIAs derived from (S)-norcoclaurine there are relatively few enzyme types associated with BIA metabolism. The only reported enzyme types involved in BIA metabolism are S-adenosylmethionine-dependent N- methyltransferases

(NMTs) and O-methyltransferases (OMTs), cytochrome P450s (CYPs), acetyl-CoA-dependent

O-acetyltransferases, 2-oxoglutarate/Fe(II)-dependent dioxygenases (ODDs), Aldo-keto reductases, short-chain dehydrogenases/reductases (SDRs), carboxylesterases and FAD- dependent oxidoreductases (FADOXs) (Beaudoin and Facchini 2014). Most evidence suggest that the evolution of BIA biosynthesis was monophyletic (Liscombe et al. 2005) and as a result

many BIA biosynthetic enzymes, even between species, share considerable sequence identity.

The enzymes involved in BIA biosynthesis are thought to have arisen through the duplication of genes recruited from primary metabolism. Random mutations in the duplicated gene allowed for the development of novel catalytic functions without losing function of the original gene (Ober and Hartmann 2000). The process of gene duplication and random mutation offers an explanation as to how such a vast array of structurally unique BIAs could originate from only a handful of enzyme types.

All BIAs are comprised of an isoquinoline group linked to a benzyl moiety which provides the 1-benzylisoquinoline backbone. Using a limited catalytic tool kit the 1- benzylisoquinoline backbone can be modified and decorated with functional groups to create over 2,500 different BIAs. Alterations of the 1-benzylisoquinoline backbone by the formation of intramolecular C-C and C-O bonds is catalyzed by oxidative enzymes, CYPs, FADOXs and

ODDs. Different backbone rearrangements are the criteria by which BIAs are classified into subgroups and are known as, simple benzylisoquinolines, protoberberines, protopines, aporphines morphinans, promorphinans, cularines, benzophenantridine and phtalideisoquinolines

(Shulgin and Perry 2002). CYPs are known to catalyze a range of different reactions from hydroxylations and C-C and C-O couplings and are responsible for most rearrangements of the

1-benzylisoquinoline backbone (Beaudoin and Facchini 2014; Jörg Ziegler and Facchini 2008).

FADOXs are able to create C-C and C-N bonds in BIA metabolism one such examples is the berberine bridging enzyme (BBE) which forms (S)-scoulerine from (S)-reticuline creating the protoberberine backbone (Dittrich and Kutchan 1991; Beaudoin and Facchini 2014). Despite the various roles of ODDs in other plant specialized metabolite biosynthetic pathways, to date,

ODDs involved in BIA metabolism have only demonstrated dealkylation activity (Hagel and

Facchini 2010; Farrow and Facchini 2013).

Decorative reactions of different BIA scaffolds can be performed by several enzyme types. S-adenosylmethionine-dependent N-methyltransferases (NMTs) add methyl groups to the nitrogen in the BIA backbone. One such enzyme is coclaurine N-methytransferase (CNMT) that

N-methylates (S)-coclaurine to form (S)-N-methylcoclaurine (Loeffler, Deus-Neumann, and

Zenk 1995). O-methylation is a common event in BIA metabolism and is often regiospecific.

Most OMTs are involved in the O-methylation of the 1-benzylisoquinoline backbone such as norcoclaurine-6-O-methyltransferase (6OMT) which converts (S)-norcoclaurine to (S)-coclaurine

(Inui et al. 2007; Ounaroon et al. 2003) or reticuline 7-O-methyltransferase (7OMT) that methylates (S)-reticuline to yield (S)-laudanine (Ounaroon et al. 2003). Other OMTs involved in

BIA biosynthesis O-methylate the protoberberine backbone such as scoulerine-9-O- methyltransferase (SOMT1) which converts (S)-scoulerine to (S)-tetrahydrocolumbamine (Dang and Facchini 2012; Takeshita et al. 1995). Acetylations by enzymes like salutaridinol 7-O- acetlytranferase (SalAT) (Grothe et al. 2001) and hydroxylations by CYPs such as (S)-N- methylcoclaurine 3’-hydroxylase (NMCH) (Pauli and Kutchan 1998) are other forms of decorative reactions that contribute to the structural diversity of BIAs.

1.3.2 Molecular biology and biochemistry of benzylisoquinoline alkaloids

Biochemical and molecular research on BIA biosynthesis has focused on a limited number of plant species. Most BIA biosynthetic genes that have been isolated and functionally characterized are from only 4 species despite the prevalence of BIAs in the plant kingdom.

Coptis japonica (Japanese goldthread) and Thalictrum flavum (Yellow meadow rue) from the

Ranunculaceae family have been adopted as model organisms, particularly in the study of

berberine biosynthesis. The family Papaveracea has provided two model organisms as well

Eschscholzia californica (California poppy) and Papaver somniferum (Opium poppy). Both have been used to study sanguinarine biosynthesis and morphinan alkaloid production respectively (Ziegler and Facchini 2008).

BIA biosynthesis begins with the stereospecific condensation of two tyrosine derivatives, dopamine and 4-hydroxyphenylacetaldehyde (4HPAA) by norcoclaurine synthase (NCS) to form norcoclaurine (Figure 1.6). NCS is a member of the pathogenesis-related (PR)10/Bet v 1 protein family (Liscombe et al. 2005; Samanani and Facchini 2002; Lee and Facchini 2011). 4HPAA is derived from tyrosine in two steps: (1) the transamination of tyrosine by tyrosine aminotransferase (TyrAT) (Lee and Facchini 2011) and (2) the subsequent decarboxylation of 4- hydroxyphenylpyruvate by 4-hydroxyphenylpyruvate decarboxylase (4HPPDC) to form 4- hydroxyphenylacetaldehyde (Figure 1.6). The gene encoding 4HPPDC has not been isolated but the enzyme has been partially purified from Berberis Canadensis callus cultures (Martina

Rueffer and Zenk 1987). Dopamine is formed from tyrosine in two distinct steps, the first being the decarboxylation of tyrosine by tyrosine decarboxylase (TYDC) to form tyramine (Facchini and De Luca 1994) followed by the 3’-hydroxylation of tyramine to form dopamine by an uncharacterized enzyme referred to in the literature as 3’OHase (Figure 1.6) (Beaudoin and

Facchini 2014).

Figure 1.6. Biosynthetic pathways showing benzylisoquinoline alkaloids accumulating in Papver somniferum and other plant species.

Enzymes for which a corresponding gene has been found in Papaver somniferum are shown in green. If the gene has been isolated from another BIA producing species the enzymes are shown in blue. Enzymes for which the corresponding gene has not been found are in black. TYDC tyrosine/DOPA decarboxylase, 3OHase tyrosine/tyramine 3-hydroxylase, 4HPPDC, 4-hydroxyphenylpyruvate decarboxylase, NCS norcoclaurine synthase, 6OMT norcoclaurine 6-O-methyltransferase, CNMT coclaurine N-methyltransferase, NMCH N- methylcoclaurine 3’-hydroxylase, 4’OMT2 3’-hydroxyl-N-methylcoclaurine 4’-O-methyltransferase, BBE berberine bridge enzyme, SOMT1 scoulerine 9-O-methyltransferase, CAS canadine synthase, TNMT, tetrahydroprotoberberine N-methytransferase, CYP82Y1 N-methylcanadine 1-hydroxylase, NOS noscapine synthase, STOX (S)-tetrahydroxyprotoberberineoxidase, CoOMT columbamine O-methyltransferase, CFS cheilanthifoline synthase, SPS stylopine synthase, MSH N-methylstylopine14-hydroxylase, P6H protopine 6- hydroxylase, DBOX dihydrosanguinarine oxidase, SanR sanguinarine reductase, SalAT salutaridinol 7-O- acetyltransferase, T6ODM thebaine 6-O-demethylase, COR codeinone reductase, CODM codeine O- demethylase, N7OMT norreticuline 7-O-methyltransferase, 3’OHase uncharacterized 3’-hydroxylase, 3’OMT uncharacterized 3’-O-methyltansferase, 2OMT uncharacterized protoberine 2-O-methyltransferase. Adapted from Beaudoin and Facchini, 2014.

Many BIAs are derived from the branch point metabolite (S)-reticuline which is formed from (S)-norcoclaurine. Although the order of reactions leading to (S)-reticuline was inferred by the substrate preference of various enzymes recent evidence suggests that the pathway is not linear and operates as lattice (Desgagné-Penix and Facchini 2012). The first conversion is a 6-O- methylation of (S)-norcoclaurine to form (S)-coclaurine by norcoclaurine-6-O-methyltransferase

(6OMT) (Figure 1.6) (Inui et al. 2007; Ounaroon et al. 2003). (S)-coclaurine is then N- methylated by coclaurine N-methyltransferase (CNMT) to form (S)-N-methylcoclaurine (Choi,

Morishige, and Sato 2001). The hydroxylation of (S)-N-methylcoclaurine by (S)-N- methylcoclaurine 3’-hydroxylase (NMCH) forms (S)-3’hydroxy-N-methylcoclaurine (Pauli and

Kutchan 1998) which is subsequently converted to (S)-reticuline by 3’hydroxy-N- methylcoclaurine 4’-O-methyltransferase (4’OMT) (Morishige et al. 2000). NMCH has very strict stereo- and substrate specificity however, most O-methylation and N-methylation steps exhibit more promiscuity in terms of substrate and regiospecificity which contributes to the pathway’s lattice structure.

Two metabolic routes have been proposed for the biosynthesis of papaverine. The first starting at (S)-reticuline followed by N-demethylation of one intermediate leading to papaverine carried out by a hypothetical enzyme (Han et al. 2010). The second, starting at (S)-norreticuline and travelling to papaverine thus eliminating the requirement for an N-demethylation step

(Desgagné-Penix and Facchini 2012). Biochemical support for the N-desmethyl pathway comes from the efficient incorporation of radiolabelled N-desmethyl compounds into papaverine in tracer studies (Brochmann-Hanssen et al. 1975; Han et al. 2010) and from the isolation and characterization of norreticuline 7-O-methyltransferase (N7OMT) which exhibits strict substrate

acceptance for N-desmethyl compounds converting norrecticuline to norlaudanine which could subsequently be converted to papaverine (Pienkny et al. 2009).

Virus-induced gene silencing (VIGS) experiments knocking down expression of several

BIA biosynthetic enzymes also supported an N-desmethyl route to papaverine (Desgagné-Penix and Facchini 2012). The VIGS mediated reduction of CNMT transcript levels in opium poppy plants increased papaverine levels. In addition, when transcript levels of N7OMT, the N- desmethyl specific enzyme were reduced, they corresponded to a reduction of papaverine levels in planta. As further evidence, when 7OMT transcript levels were knocked down there was no change in papaverine accumulation. Despite the evidence supporting an N-desmethyl route to papaverine a recent study using mass spectrometry and a heavy stable-isotope of (S)-reticuline found that the some of the label was incorporated into papaverine supporting a N-methylated pathway. Most of the label however was incorporated into morphinan alkaloids (Han et al.

2010). Another recent study compared the transcriptomes of high and low papaverine producing varieties of opium poppy. The high papaverine plants up-regulated transcripts associated with the

N-desmethyl pathway, 6OMT, CNMT, 4’OMT and most importantly N7OMT, while 7OMT was down regulated in comparison to low papaverine producing plants (Pathak et al. 2013). Thus it seems the major route to papaverine is via an N-desmethyl pathway and perhaps the N- methylated route contributes in a minor way to papaverine biosynthesis (Figure 1.6).

The final step in papaverine biosynthesis involves the oxidation of the fully O- methylated, N-desmethyl alkaloid, tetrahydropapaverine by dihydrobenzophenanthridine oxidase

(DBOX) (Figure 1.6). DBOX is also responsible for the final step in the biosynthesis of the benzo[c]phenanthridine sanguinarine. DBOX is transcribed exclusively in the roots of opium poppy and suggest there may be transport of papaverine from the roots to the aerial organs and

latex (Hagel et al. 2012). The presence of DBOX in the roots presents the possibility that other steps of papaverine biosynthesis could occur in the roots, namely the uncharacterized 3’-O- methylation step.

Morphine biosynthesis is a rare event in the plant kingdom. Only a few plants species from the family Papaveracea are known to make it. Although other morphinans such as salutaridine are less rare than morphine the only other plant family that makes morphinans is

Euphorbiaceae (Theuns, Theuns, and Lousberg 2014). The biosynthesis of morphine is predicated on the ability of the plant to epimerize (S)-reticuline to (R)-reticuline. The reaction mechanism has been postulated to occur in two distinct steps: (1) the dehydrogenation of (S)- reticuline to a 1,2-dehydroreticulinium ion (Hirata et al. 2004) and (2) the reduction of the 1,2- dehydroreticulinium ion to (R)-reticuline (De-Eknamkul and Zenk 1992). The enzyme responsible for the first step was named 1,2-dehydroreticuline synthase and has been partially purified. The enzyme for the second step, 1,2-dehydroreticuline reductase, has been purified to homogeneity and partial characterized. The genes corresponding to both of the enzymes have not been identified.

The morphinan backbone is generated by the C-C phenol-coupling of (R)-reticuline by salutaridine synthase (SalSyn, CYP719B1) to form salutaridine (Figure 1.6) (Gesell et al. 2009).

Salutaridine is converted to salutaridinol by the short-chain dehydrogenase/reductase, salutaridine reductase (SalR) (Ziegler et al. 2006), next salutaridinol is O-acetylated by salutatidinol 7-O-acetyltansferase (SalAT) (Grothe et al. 2001; Lenz and Zenk 1995). The cyclization of salutaridinol 7-O-acetate to form thebaine is spontaneous under basic conditions, pH8-9. The spontaneous cyclization of salutaridinol 7-O-acetate in basic conditions suggests the

reaction occurs in a basic subcellular compartment or there is an uncharacterized enzyme involved in the cyclization process (Fisinger et al. 2007).

The morphine pathway splits at thebaine (Figure 1.6). In the major route thebaine-6-O- demethylase (T6ODM) converts thebaine to neopinone which spontaneously converts to codeinone (Hagel and Facchini 2010). Codeinone is subsequently reduced by the aldo-keto reductase codeinone reductase (COR) to codeine (Unterlinner, Lenz, and Kutchan 1999). The formation of morphine from codeine is catalyzed by codeine O-demethylase (CODM).

Conversely in the minor route, CODM catalyzes the first step by converting thebaine to oripavine. Next, T6OMD catalyzes the formation of morphinone from oripavine, which is subsequently reduced by COR to morphine.

All protoberberine, protopine, phthalideisoquinoline and benzo[c]phenanthridine alkaloids are ultimately derived from conversion of (S)-reticuline to (S)-scoulerine by the berberine bridge enzyme (BBE) (Figure 1.6) (Dittrich and Kutchan 1991). (S)-Scoulerine can be converted to (S)-tetrahydrocolumbamine by scoulerine 9-O-methyltransferase (SOMT1) (Dang and Facchini 2012; Takeshita et al. 1995). (S)-tetrahydrocolumbamine has two possible fates, it can be converted to (S)-tetrahydropalmatine by columbamine O-methyltransferase (CoOMT)

(Takashi Morishige et al. 2002) or a methylenedioxy bridge can be added to (S)- tetrahydrocolumbamine by the CYP, canadine synthase (CAS) to form (S)-canadine (Figure 1.6)

(Diaz Chavez et al. 2011; Ikezawa et al. 2003; Winzer et al. 2012). (S)-Canadine can either lead to noscapine as described below or (S)-canadine can yield berberine through an oxidation by the

FAD-linked enzyme dihydrobenzophenanthridine oxidase (DBOX) (Hagel et al. 2012).

Recently, a gene cluster from opium poppy was found encoding for 10 different genes purported to be involved in noscapine biosynthesis. The function of some of the genes of the cluster were

investigated using VIGS (Winzer et al. 2012) and some of the cDNAs have since been isolated and functionally characterised as described below. (S)-Canadine is N-methylated by (S)- tetrahydroprotoberberine N-methyltransferase (TNMT) to form (S)-N-methylcanadine. TNMT also accepts several different alkaloids with a protoberberine backbone (Liscombe and Facchini

2007). (S)-N-methylcanadine 1-hydroxylase (CYP82Y1) is responsible for the creation of (S)-1- hydroxy-N-methylcanadine from N-methylcanadine (Dang and Facchini 2014). (S)-1-hydroxy-

N-methylcanadine then undergoes aliphatic and aromatic ring hydroxylations and O- methylations which lead to norotinehemiacetal which is converted to noscapine by the short- chain dehydrogenase/reductase noscapine synthase (NOS) (Figure 1.6) (Chen and Facchini

2014).

Alternatively, (S)-scoulerine can be converted to (S)-cheilanlthifoline by cheilanthifoline synthase (CFS) a CYP (Figure 1.6) (Diaz Chavez et al. 2011). O-methylation at the 2 position of

(S)-cheilanthifoline backbone to form (S)-sinactine is an uncharacterized step in BIA metabolism

(Beaudoin and Facchini 2014). (S)-Stylopine can be derived from (S)-cheilanthifoline by addition of another methylenedioxy bridge, the enzyme responsible for this conversion is the

CYP, stylopine synthase (SPS) (Diaz Chavez et al. 2011; Ikezawa, Iwasa, and Sato 2007). The

N-methylation of (S)-stylopine by TNMT forms (S)-cis-N-methylstylopine (Liscombe and

Facchini 2007). Protopine is formed by the 14-hydroxylation of the quaternary protoberberine alkaloid (S)-cis-N-methylstylopine by the CYP (S)-cis-N-methylstylopine 14-hydroxylase

(MSH) which leads to the subsequent ring tautomerization by breaking the C-N bond and forming a keto moiety at C14 (Figure 1.6) (Beaudoin and Facchini 2013). T6ODM, CODM and other ODDs have been implicated in protopine alkaloid regulation through the oxidative

dealkylation of methylenedioxy bridges or methoxy groups on the protopine backbone (Farrow and Facchini 2013).

All benzo[c]phenanthridine alkaloids are derived from protopine with the exception of chelerythrine which is derived from allocryptopine. The formation of dihydrosanguinarine from protopine is catalyzed by protopine 6-hydroxylase (P6H) another CYP (Figure 1.6) (Takemura et al. 2013). The 6-hydroxylation of protopine results in a spontaneous rearrangement of 6- hydroxyprotopine to dihydrosanguinarine. The oxidation of dihydrosanguinarine to sanguinarine is catalyzed by the FAD-linked enzyme dihydrobenzophenanthridine oxidase (DBOX) (Hagel et al. 2012). The reduction of sanguinarine back to dihydrosanguinarine is catalyzed by sanguinarine reductase (SanR) (Vogel et al. 2010; Weiss et al. 2006). The reductive process is thought to have occurred in order to reduce the cytotoxic effect of sanguinarine for the less toxic dihydrosanguinarine.

Rhoeadine alkaloids are only known to occur in members of Papaveracea (Shulgin and

Perry 2002). The origins of rhoeadine alkloids in planta were discovered by feeding labelled protopine to Papaver bracteatum (Ronsch 1972). The suppression of gene transcripts encoding

CODM, responsible for the O-demethylation and/or the O,O-demethylenation of morphinan and protopine alkaloids, by VIGS resulted in elevated levels of rhoeadine alkaloids (Farrow and

Facchini 2013). The enzymatic steps involved in the conversion of protopines to rhoeadine alkaloids are not known.

1.3.3 The catalytic mechanism of OMTs

The widespread belief is that the ability to produce BIAs in angiosperms arose from a monophyletic origin (Liscombe et al. 2005). One result of the monphyletic evolution of BIA metabolism is the incredible structural diversity of BIAs is the result of remarkably few enzyme

types. BIA metabolism dominated by enzymes of these categories: cytochrome P450s, reductases, oxidases, acetyltransferases, a single Pictet-Spenglerase, N-methyltransferases and,

O-methyltransferases.

SAM-dependant O-methylation which catalyze the regiospecific transfer of a methyl group from SAM to a free hydroxyl moiety on the BIA backbone are widespread in BIA metabolism (Beaudoin and Facchini 2014). Genes encoding O-methyltransferases involved in

BIA biosynthesis have been isolated from several plants that produce BIAs and often share significant sequence similarity (Beaudoin and Facchini 2014). Indeed O-methylation is a common reaction occurring in many distinct biological system (Schubert, Blumenthal, and

Cheng 2003). Yet in most plants, O-methylation is performed by SAM-dependant OMTs. SAM is used a the methyl donor and over the course of the reaction is converted to S-adenosyl-L- homocysteine. These enzyme are very diverse in terms of substrate preference yet all retain the important SAM-binding domain (Zubieta et al. 2001). The mechanism of O-methylation in plants is thought to be conserved. OMTs perform a SN2 reaction with the help of a catalytic triad

(Brandt, Manke, and Vogt 2015). The substrate binding pocket positions the substrates free hydroxyl group near the activated methyl of SAM and the amino group of a near by His. Two

Glu residues bracket the His and ensure the proper orientation of histidine’s imidazole ring towards the substrate through hydrogen bonding. His acts as a catalytic base and deprotonates the hydrogen on the substrates free hydroxyl. The negatively charged oxygen that was deprotonated acts as a nucleophile and attacks the methyl carbon on SAM. This results in the

SN2 transfer of the SAM methyl group to the substrate (Brandt, Manke, and Vogt 2015;

Schubert, Blumenthal, and Cheng 2003; Zubieta et al. 2001).

1.4 Approaches to gene discovery and functional characterization of alkaloid biosynthetic genes

1.4.1 Traditional approaches to gene identification

Several BIA biosynthetic genes have been isolated and characterized using classical biochemistry. Some such examples are the isolation of cDNA encoding for BBE from E. califormica (Dittrich and Kutchan 1991) and SOMT, 6OMT and 4’OMT were isolated from C. japonica (Takeshita et al. 1995; T Morishige et al. 2000). In most cases, a specific biosynthetic enzyme was purified to homogeneity from a cell culture suspension or plant tissue. Next the purified protein would be digested with a protease like trypsin, the amino acid sequences would be sequenced and the sequences of the peptide fragments were used to design degenerate oligonucleotide primers. The fragments of the corresponding gene were amplified by polymerase chain reaction (PCR). Amplified DNA fragments from the corresponding to the enzyme of interest were then used as probes to isolate a full-length molecular clone from a cDNA library.

1.4.2 Genomics-based gene discovery approaches

The advent of genomic technologies has led to several new approaches for the discovery of BIA biosynthetic genes and has aided in the efficient isolation of new genes (Goossens and

Rischer 2007). The use of Sanger sequencing to develop expressed sequence tag (EST) collections streamlined the gene discovery process. ESTs represent the transcribed genes derived from the large-scale random sequencing of a cDNA library from a specific plant species and tissue type. The resulting sequences are organized and managed in a computer database and the library can be mined for gene candidates using sequence similarity to a reference gene of

known function with Basic Local Alignment Search Tool (BLAST) (Altschup et al. 1990).

Candidate genes can be subsequently amplified from appropriate cDNA libraries and expressed in bacteria or yeast.

Sanger-based EST projects have yielded over 25 000 ESTs from various BIA-producing tissues of Papaver somniferum (Facchini et al. 2007). Similar initiatives have led to the isolation of various BIA biosynthetic genes. For example, the isolation and characterization of 7OMT and

6OMT from opium poppy (Ounaroon et al. 2003) as well as 4’OMT from opium poppy (Ziegler et al. 2005).

Recently high-throughput next-generation sequencing (NGS) technologies such as

Roche-454 and Illumina have changed the paradigm of functional genomics and have proven to be fast and cost-effective methods of generating deep transcriptomic datasets (Xiao, Zhang,

Chen, Lee, Barber, Chakrabarty, Desgagné-Penix, et al. 2013). Nonetheless, NGS approaches have the draw backs of shorter reads, higher base-call error rate and non uniform coverage when compared to more traditional sequencing methods (C. Chen et al. 2014). Often genomic datasets generated by NGS are mapped by comparing the dataset to a genomic dataset for a similar species which is called a reference sequence in order to make the computational task of creating a de novo library. In situations where there are no reference sequences available, as is the case with many non-model species like opium poppy, RNA-Seq is used to develop a transcriptomic dataset (Nakamura et al. 2011). NGS technologies have been used to develop RNA-Seq based transcriptomic databases for many different plants producing specialized metabolites. This undertaking has led to the discovery of several novel biosynthetic genes from several plant species involved in specialized metabolism, some examples include the discovery of two unique sesquiterpene synthases from the root of Valeriana officinalis (Pyle et al. 2012), a novel

sesquiterpene synthase involved the biosynthesis of the natural sweetener, hernandulcin from

Lippia dulcis (Attia, Kim, and Ro 2012) and an O-methyltransferase and a short-chain dehydrogenase/reductase involved in noscapine biosynthesis (Dang and Facchini 2012; Chen and

Facchini 2014).

1.4.3 Integration of targeted metabolomics and transcriptomics for gene discovery

Targeted metabolomic strategies have also been used to help identity genes involved in plant specialized metabolism (Desgagné-Penix et al. 2012; Farrow, Hagel, and Facchini 2012;

Le, Mccooeye, and Windust 2012). “Soft” ionization techniques such as electrospray ionization tandem mass spectrometry (ESI-MSn) has been widely employed to characterize plant specialized metabolites owing to its high sensitivity, rapid analysis time, low levels of sample consumption and ability to provide structural information of the analytes investigated

(Desgagné-Penix et al. 2012; Farrow, Hagel, and Facchini 2012; Le, Mccooeye, and Windust

2012; Stevens, Reed, and Morré 2009; W. Wu et al. 2005). When a targeted metabolite profile is integrated with a NGS transcriptomic database a powerful biochemical genomics tool to identify novel genes is created (Desgagné-Penix et al. 2012). When this methodology is extended to different varieties of the same species or of different species producing similar compounds, choosing gene candidates is streamlined. Gene candidates can be ranked in terms of their predicted relative expression using fragments per kilobase of exon per million fragments mapped

(FPKM) as mRNA levels are often correlated with protein abundance (C. Chen et al. 2014). For example consider a comparative analysis of unigenes annotated as O-methyltransferases across 5 different species. Of these 5 species only one produces papaverine. Searching for OMTs based on sequence similarity will yield a two lists of genes annotated as OMTs. One list will be OMTs expressed in all 5 of the species and the other list will be OMTs that are expressed exclusively in

the papaverine producing plant. The second list will constitute strong candidate genes for an

OMT involved in papaverine biosynthesis.

1.4 Objectives

The primary objective of this study was to discover and functionally characterize a novel gene involved in BIA biosynthesis using an integrated transcriptomic and metabolomic approach.

Specific objectives were:

1. To isolate and characterize a molecular clone encoding a 3’-O-

methyltranferase involved in papaverine biosynthesis from opium poppy.

2. To generate targeted alkaloid profiles of 20 different BIA producing

species using a triple quadrupole (QqQ) liquid chromatography-mass

spectrometry (LC-MS).

Chapter Two describes the materials and methods used for the studies described in the subsequent chapters.

Chapter Three reports the isolation and functional expression of a molecular clone encoding 2-protoberberine O-methyltransferase (2OMT). The in vitro characterization and enzyme kinetics of 2OMT. In addition, the relative expression of 2OMT was investigated across different opium poppy tissue type by quantitative PCR (qPCR).

Chapter Four reports the targeted alkaloid profiles of 20 different BIA producing species by QqQ LC-MS. The goal was to aid in the development of an integrated transcriptomic/metabolomic database for 20 different species to aid in the discovery of BIA biosynthetic genes.

Chapter 5 discusses the importance of the finding from the previous chapters and suggest ideas for future research.

CHAPTER TWO: MATERIALS AND METHODS

2.1 Nucleic Acid Isolation and analysis

The isolation or RNA from opium poppy cultivars Roxanne, Veronica and Bea’s Choice root, stem, capsule, leaf and bud was performed using a previously described CTAB (cetyl triethylammonium bromide) extraction method (Cairney, Puryear, and Chang 1993). Opium poppy cDNA libraries were constructed using the isolated RNA in conjunction with the cDNA library construction kit, SuperScript III First-Strand Synthesis System (Invitrogen, Carlsbad,

CA).

2.1.1 Isolation of cDNAs encoding putative OMTs from opium poppy stem

OMT gene candidates were identified using opium poppy stem Illumina Velvet Oases

(San Diego, CA) and Roche 454 MIRA (Branford, CT) Next-Generation sequencing libraries

(Citation). Known SAM-dependent OMT genes involved in BIA metabolism were used as

BLAST queries. Queries were: 6OMT from P. somniferum, C. Japonica and E. californica

(Ounaroon et al. 2003; Inui et al. 2007); 4’OMT1/2 from C. japonica and P. somniferum

(Morishige et al. 2000; Facchini and Park 2003); 7OMT from P. somniferum (Ounaroon et al.

2003); N7OMT from P. somniferum (Pienkny et al. 2009); SOMT1 from P. somniferum (Dang and Facchini 2012). Based on their sequence similarity to known OMTs involved in BIA biosynthesis 6 gene candidates were selected, IzOMT1-6.

2.1.2 Isolation of cDNAs encoding putative OMTs from opium poppy root

OMT gene candidates were identified using opium poppy root Illumina Velvet Oases

(San Diego, CA) and Roche 454 MIRA (Branford, CT) Next-Generation sequencing libraries.

Known SAM-dependent OMT genes involved in BIA metabolism were used as BLAST queries.

Queries were: 6OMT from P. somniferum, C. Japonica and E. californica (Ounaroon et al. 2003;

Inui et al. 2007); 4’OMT1/2 from C. japonica and P. somniferum (T Morishige et al. 2000;

Facchini and Park 2003); 7OMT from P. somniferum (Ounaroon et al. 2003); N7OMT from P. somniferum (Pienkny et al. 2009); SOMT1 from P. somniferum (Dang and Facchini 2012).

Based on their sequence similarity to known OMTs involved in BIA biosynthesis and their absence in stem transcriptomic databases, 4 gene candidates were selected, DDOMT1-4.

2.2 Phylogenetic analysis

Phylogenetic analysis based on putative amino acid sequence was performed with

ClustalW (Chenna et al. 2003) with a BLOSUM cost matrix. The phylogenetic tree was constructed using Geneious Tree Builder (Biomatters; Newark, NJ; http://www.geneious.com), using the Jukes-Cantor model (Jukes and Cantor 1969), neighbour-joining tree build method and bootstrap resampling. Gap open cost: 10 and Gap extend cost: 0.1. Number of random seed was

946 361 and the number of replicates was 1000. Protein abbreviations and GeneBank accession numbers are listed in Table 2.1 below.

Table 2.1 Protein abbreviations and GenBank accession numbers for sequences used in phylogenetic analysis of SAM-dependent O-methyltransferases from selected plants.

Abbreviation Protein name Accession #

Ec7OMT Eschscholzia californica, reticuline 7OMT BAE79723.1 CjCoOMT Coptis japonica, columbamine OMT Q8H9A8.1 TtOMT Thalictrum tuberosum, catechol OMT AF064697.1 PsCaOMT Papver somniferum, catchol OMT AY268895.1 Ps7OMT Papaver somniferum, reticuline 7OMT Q6WUC2.1 PsN7OMT Papaver somniferum, norreticuline 7OMT AC88562.1 Ps6OMT Papaver somniferum, norcoclaurine 6OMT AAP45315.1 Ps4’OMT2 Papaver somniferum, 3’-hydroxy-N-methylcoclaurine 4’OMT2 AAP45314.1 Ps4’OMT1 Papaver somniferum, 3’-hydroxy-N-methylcoclaurine 4’OMT1 AAP45314.2 Cc4’OMT Coptis chinensis, 3’-hydroxy-N-methylcoclaurine 4’OMT ABY75613.1 Cj4’OMT Coptis japonica, 3’-hydroxy-N-methylcoclaurine 4’OMT Q9LEL5.1 Tf4’OMT Thalictrum flavum, 3’-hydroxy-N-methylcoclaurine 4’OMT AAU20768.1 Cj6OMT Coptis japonica, norcoclaurine 6OMT Q9LEL6.1 Tf6OMT Thalictrum flavum, norcoclaurine 6OMT AAU20765.1 VvReOMT Vitis vinifera, resveratrol OMT CAQ76879.1 PtFlOMT Populus trichocarpa, flavonoid OMT predicted protein XP_002312933.1 CjSOMT Coptis japonica, scoulerine 9OMT Q39522.1 PaCafOMT Picea abies, caffeate OMT CAI30878.1 CaCafOMT Capsicum annuum, caffeate OMT AAG43822.1 ObEuOMT Ocimum basilicum, engenol OMT AAL30424.1 MpFlOMT Mentha X piperitta, Flavonoid 8OMT AAR09600.1 ObCafOMT Ocimum basilicum, caffeate OMT AAD38189.1 CbEuOMT Clarkia breweri, (iso)eugenol OMT AAC01533.1 CbCafOMT Clarkia breweri, caffeate OMT O23760.1 AmCafOMT Ammi majus caffeate OMT AAR24095.1 PsSOMT1 Papaver somniferum, scoulerine 9OMT1 JN185323.1 PsSOMT2 Papaver somniferum, narcotoline OMT2 JN185324.1 PsSOMT3 Papaver somniferum, scoulerine OMT3 JN185325.1

2.3 Construction of expression vectors and heterologous expression

2.3.1 Stem OMT gene candidates IzOMT1 through IzOMT6

PCR was used to amplify open reading frames (ORFs) encoding selected proteins from P. somniferum Bea’s choice cultivar stem cDNA using Green Taq DNA Polymerase (Genescript,

Piscataway, NJ), forward primers contained a BamHI restriction site and the reverse primers contained a Xho1 restriction site. Primer sequences are listed in Table 2.2. PCR products were ligated into pGEM-T Easy vectors (Promega, Madison, WI). Constructs were subsequently transformed into XL1-Blue competent E. coli cells by heat shocking according to the manufacturer’s protocol (New England Biolabs, Ipswich, MA). After an overnight incubation at

37 ºC on Lauria-Bertani (LB) agar plates supplemented with 100 µg/mL ampicillin, 30 µg/mL

X-gal and 0.1 mM isopropyl ß-D-1-thiogalactopyranoside (ITPG) transformed colonies were selected by blue/white colony screening. White colonies were used to inoculate 2 mL of LB with 100 µg/mL ampicillin and grown overnight at 37 ºC. Plasmids were purified using the

High-Speed Plasmid Mini Kit (Geneaid, New Taipei City, TW) and sent for sequencing to confirm the insert. Upon confirmation of the gene sequence the inserts were excised using

BamHI and Xho1 (New England Biolabs, Ipswich, MA) and ligated into pET29b (Novagen,

Madison, WI) using the engineered restriction sites.

E. coli Arctic Express RP (DE3) competent cells (Agilent, Santa Clara, CA) were transformed with expression vectors, grown at 37 ºC in LB medium supplemented with 50

µg/mL kanamycin and 34 µg/mL chloramphenicol to A600 0.8. Cultures were induced with

0.1mM IPTG for 4 h at 37 ºC and at 25 ºC as well as 24 h and 48 h at 4 ºC and harvested by

centrifugation at 12000 RPM for 5 min. Recombinant proteins were detected in bacterial extracts with Coomassie brilliant blue following separation by SDS-PAGE.

Table 2.2. Primer sequences used to amplify gene candidates from stem and root opium poppy cDNA

ORF Forward Primer Reverse Primer

2OMT GGATCCAATGGATATTGCAGAAGAAAGGTTGA CTCGAGTTCTGGAAAAGCCTCGAT DDOMT2 GGATCCGATGACTATGAATGGGAAT CTCGAGTTTATGAAACTCAATGAGATGAAGTC DDOMT3 GGATCCTATGCTTGACCGTATGTTG CTCGAGATTCTTGTGGCACTCCATAAT DDOMT4 GGATCCCATGGATATCAAATTAGAAGATGAAGAA CTCGAGTGGATATGCAACAATAACTGATTGAAT IzOMT1 GATGGATCCAATGGATATCAAATTAGAAGATG CTACTCGAGTGGATGTGCAACAATAACTG IzOMT2 GATGGATCCAATGGAAATCAAACTAGAAGATC CTACTCGAGAGGATATGCGACAATAACC IzOMT3 GATGGATCCAATGATGGCTAATGACTCTCGC GTGCTCGAGAGGATATACCTCAATAAGGGAAACG IzOMT4 GATGGATCCAATGTATTATGAGAGGTCTTCAG CTACTCGAGATCCTTAGATGGTACTGC IzOMT5 GATGGATCCAATGGGTTCAGGCCATCACAGC CTACTCGAGATTCTTGTGGCACTCCCATAATCC IzOMT6 GATGGATCCAATGGGTTCGATCCAGAACGTAG CTACTCGAGGTTTTTGTAGAATTCCATAACG

Primers used to amplify ORFs from cDNA for ligation to pRSETA

2.3.2 Root OMT gene candidates DDOMT1-4

PCR was used to amplify open reading frames (ORFs) encoding DDOMT3 and

DDOMT4 from P. somniferum Bea’s choice cultivar root cDNA using Green Taq DNA

Polymerase (Genescript, Piscataway, NJ), forward primers contained a BamHI restriction site and the reverse primers contained a Xho1 restriction site. Primer sequences are listed in Table X.

DDOMT1 and DDOMT 2 ORFs were commercially synthesized with a BamH1 restriction site at the 5’ end of the gene and a Xho1 restiction site at the 3’ end of the gene in the pUC57a vector

(Genscript, Piscataway, NJ). PCR products were ligated into pGEM-T Easy vectors (Promega,

Madison, WI). Constructs for the amplified gene candidates and the synthesized gene candidates were subsequently transformed into XL1-Blue competent E. coli cells by heat shocking according to the manufacturer’s protocol (New England Biolabs, Ipswich, MA). After an overnight incubation at 37 ºC on Lauria-Bertani (LB) agar plates supplemented with 100 µg/mL ampicillin, 30 µg/mL X-gal and 0.1 mM isopropyl ß-D-1-thiogalactopyranoside (ITPG) transformed colonies were selected by blue/white colony screening. White colonies were used to inoculate 2 mL of LB with 100 µg/mL ampicillin and grown overnight at 37 ºC. Plasmids were purified using the High-Speed Plasmid Mini Kit (Geneaid, New Taipei City, TW) and sent for sequencing to confirm the insert. Upon confirmation of the gene sequence the inserts were excised using BamHI and Xho1 (New England Biolabs, Ipswich, MA) and ligated into pET29b

(Novagen, Madison, WI) using the engineered restriction sites.

E. coli Arctic Express RP (DE3) competent cells (Agilent, Santa Clara, CA) were transformed with expression vectors, grown at 37 ºC in LB medium supplemented with 50

µg/mL kanamycin and 34 µg/mL chloramphenicol to A600 0.8. Cultures were induced with 0.1 mM IPTG for 4 h at 37 ºC and at 25 ºC as well as 24 h and 48 h at 4 ºC and harvested by

centrifugation at 12 000 RPM for 5 min at 4 ºC. Recombinant proteins were detected in bacterial extracts with Coomassie brilliant blue following separation by SDS-PAGE.

2.4 Purification of recombinant proteins and analysis

2.4.1 Purification of recombinant IzOMT 1-6 and DDOMT 1-4

1 L LB cultures with 50 µg/mL kanamycin and 34 µg/mL chloramphenicol were inoculated with E. coli Arctic Express RP cells containing pET29b constructs containing ORFs for IzOMT 1-6 and DDOMT 1-4 and grown to A600 0.8 at 37 ºC 200 RPM. LB cultures were induced with 0.1 mM IPTG and transferred to 4 ºC 180 RPM for 48 hours. Cultures were centrifuged at 12 000 RPM for 5 min at 4 ºC to pellet the cells. Cells were resuspended in 10 mL of protein extraction buffer, 50 mM NaH2PO4, pH 7.5, 10% glycerol, 750 µg/mL lysozyme from chicken egg white (Sigma-Aldrich, St. Louis, MO), 1 mM ß-mercaptoethanol (Sigma-Aldrich,

St. Louis, MO) and 1% (v/v) Tween 20 (Sigma-Aldrich, St. Louis, MO). Cells were lysed by sonication. Cell debris was removed by centrifugation and the supernatant was bound to Talon cobalt affinity resin (Clonetech, Mountain View CA) by shaking on ice for 60 min, washed three times with protein purification buffer, 50 mM NaH2PO4, pH 7.5, 10% glycerol, 750 µg/mL lysozyme from chicken egg white (Sigma-Aldrich, St. Louis, MO), 1 mM ß-mercaptoethanol

(Sigma-Aldrich, St. Louis, MO) and 1% (v/v) Tween 20 (Sigma-Aldrich, St. Louis, MO).

Proteins were eluted with 1 mL aliquots of protein purification buffer containing increasing concentration of imidazole (5, 50, 100 and 200 mM). Protein elutions were desalted on PD-10 columns (Amersham Biosciences, Piascataway, NJ).

2.4.2 SDS-PAGE

Proteins were fractionated using 12% polyacrylamide SDS-PAGE with the Mini-

PROTEAN Tetra Cell (Bio-Rad Laboratories, Mississauga. ON) following the instructions of the manufacturer.

2.4.3 Western Blot Analysis

Soluble proteins were separated by SDS-PAGE and transferred to BioTrace NT nitrocellulose membranes (Pall Life Sciences, Pensacola, FL). Protein blots were incubated with

1º antibody, anti-His tag mouse (Genscript, Piscataway, NJ) diluted to 1:1000 in blocking buffer

(137 mM NaCl, 10 mM Na2HPO4, 2.7 mM KCl, 1.8 mM KH2PO4, 0.1% (v/v) Tween 20 and 5%

(w/v) skim milk powder) for 12 hours. Following the incubation the membranes were washed in

1x PBS with 0.1% Tween 20 (137 mM NaCl, 10 mM Na2HPO4, 2.7 mM KCl, 1.8 mM KH2PO4,

0.1% (v/v) Tween 20) 4 times for 10 minutes each. Membrane was subsequently incubated with

2º antibody, goat anti-mouse antibody, horseradish peroxidase (HPR) conjugated (Bio-Rad

Laboratories, Mississauga. ON) diluted with 1:10 000 in blocking buffer for 1 hour. Membrane was washed in 1x PBS with 0.1% Tween 20 again the same way as above. Proteins were visualized with SuperSignal West Pico Chemiluminescent Substrate (Thermo Pierce, Rockfort,

IL).

2.5 Recombinant OMT Candidate Assays

2.5.1 Routine Enzyme assays

Standard in vitro enzyme assays were performed using 4 µg of purified recombinant protein in a 50 µL reaction of 50 mM glycine pH 9.0, 500 µM S-adenosyl methionine, 50 µM substrate and 50 mM ß-mercaptoethanol which were incubated for 2 hours at 30 ºC. Assays

were stopped with the addition of 50 µL of methanol. The reactions were then dried down in a

Speed-Vac concentrator (Savant, Ramsey, MN) and resuspended in 50 µL of 1% (v/v) formic acid.

2.5.2 DDOMT1 Temperature and pH Optima assay

Temperature optimum assays were conducted as described in 2.4.1 with a few alterations.

Scoulerine was used as the substrate and assays were incubated at 4, 20, 25, 30, 37, 42 and 55 ºC for 2 hours. All assays were quenched with 50 µL of methanol, dried down in a Speed-Vac concentrator (Savant, Ramsey, MN) and resuspended in 50 µL of 1% (v/v) formic acid.

- - pH optimum assays were performed at pH 5 (citrate), pH 6 (KPO4 ), pH 7 (KPO4 ), pH 8

(Tris-HCl) and pH 9 (glycine). A 50 µM concentration of scoulerine was used in all assays.

Assays were incubated at 30 ºC for 2 hours and quenched with 50 µL of methanol. Assays were dried down in a Speed-Vac concentrator (Savant, Ramsey, MN) and resuspended in 50 µL of 1%

(v/v) formic acid.

2.5.3 DDOMT1 Km Assays

The Michealis constant (Km) was determined by making enzymatic assays with 50 mM glycine pH 9.0, 500 µM S-adenosyl methionine, 50 mM ß-mercaptoethanol and 0.08 µg/µL of purified recombinant protein which were incubated for 2 hours at 30 ºC with varying concentrations of scoulerine from 1 to 500 µM. Enzyme assays were stopped with equal volumes of methanol and dried down in a Speed-Vac concentrator (Savant, Ramsey, MN).

Dried reaction were then resuspended in 1% formic acid to give a final total alkaloid concentration of 1 µM across all samples.

2.6 LC-MS conditions for enzyme assay analysis

2.6.1 LC conditions for enzyme assays

LC analysis was performed with a 1200 liquid chromatograph coupled to a 6410 triple quadrupole mass spectrometer (Agilent, Santa Clara, CA). Solvent A, was 1% aqueous formic acid and solvent B was 100% acetonitrile. The chromatography column used was a Poroshell

120 SB C18 column (2.1 X 50 mm, 2.7 µm particle size; Agilent, Santa Clara, CA) with a flow rate of 0.7 mL/min and a temperature of 55 ºC. The column was equilibrated in solvent A and the elution conditions were as follows: Each extract was injected onto the column with a volume of 10 µL. Compounds were eluted using a flow rate of 0.7 mL/min using a gradient of 1%

HCOOH (solvent A, HCOOH:H2O) and C2H3N (solvent B). Initial HPLC conditions were

100% solvent A changing linearly to 60% (v/v) solvent A over 6 min, and then to 1% (v/v) solvent A by 7 min min. Mobile phase constituents remained constant for 1 min and then returned to starting conditions at 8.1 min for a 4-min re-equilibration period. Total analysis time was 12.1 min per sample.

2.6.2 Mass analyzer conditions

Samples were introduced to the mass analyzer via an electrospray ionization (ESI) probe inlet with a capillary voltage of 4000 kV, a fragmentor voltage of 100V, a gas temperature of

350 ºC, the gas flow was set to 10 L/min and the nebulizer pressure was 50 psi. Mass spectrometry data was acquired in positive ion mode.

Full scan analysis were performed with quadrupole 1 and 2 set to RF only while quadrupole 3 scanned a variable mass range (100 – 400 m/z).

Collisionally-induced dissociation (CID) spectra were recorded using a collision energy of 25 eV applied to quadrupole 2. MS2 fragments were analyzed in quadrupole 3 by

scanning from m/z 40 to m/z 2 greater than the precursor ion. Resulting spectra and retention times were compared to standards when available and previously published spectra for identification purposes.

2.7 Real-time quantitative PCR (qPCR)

Real-time quantitative PCR was performed on cDNA synthesized at 30 ng/µL from Bea’s

Choice variety opium poppy stem, root, capsule, leaf and bud tissues. Each 10 µL reaction contained approximately 1.5 ng/µL of cDNA, 1X KAPA SYBR FAST qPCR kit (Kapa

Biosystems, Boston, MA) and 200 nM of forward and reverse primers specific to 2OMT.

Sequences of the primers for 2OMT and ubiquitin 10 are listed in Table 2.3. Analysis was performed using a 7300 Real-Time PCR System (Applied Biosystems Life Technologies,

Burlington, ON). The AAC method was used to determine the relative gene expression levels with ubiquitin as an endogenous control.

Table 2.3. Real-Time quantitative PCR Primers used to study the relative gene expression of 2OMT in different tissue types from opium poppy. Abbreviations: 2OMT, protoberberine 2-O-methyltranferase; UBQ 10, ubiquitin 10.

Gene Forward Primer Reverse Primer

2OMT AAATGCGCTGTTGAACTTGGT TGTTGATGATCTCCGACATAGTGA UBQ 10 GGGAACACAAACGACACCAAA TCGTCTTCGTGGTGGTAACTAGAG

2.8 LC-MS based targeted alkaloid profiling of 20 BIA producing plants species

2.8.1 Plants

Selected tissues were harvested at the outdoor Jardin Botanique de Montréal (Montréal,

Québec; http://espacepourlavie.ca) from the plants Hydrastis canadensis, Sanguinaria canadensis, Nigella sativa, Mahonia aquifolium, Menispermum canadense, Stylophorum diphyllum, and Xanthoriza simplicissima. Chelidonium majus, Papaver bracteatum, Argemone mexicana, Eschscholtzia californica, Nandina domestica, Glaucium flavum, Thalictrum flavum and Corydalis cheilanthifolia were grown from seed germinated in potted soil under standard open air greenhouse conditions at the University of Calgary (Calgary, Alberta). Jeffersonia diphylla and Berberis thunbergii plants were purchased from Plants Delights Nursary (Raleigh,

North Carolina; www.plantdelights.com) and Sunnyside Greenhouses (Calgary, Alberta; www.sunnysidehomeandgarden.com), respectively. All seeds were purchases from Band T

World Sees (http://b-and-t-world-seeds.com) with the exception of T. flavum and P. bracteatum which were purchased from Jelitto Standensamen (www.jelitto.com) and La Vie in Rose

Gardens (www.lavieenrosegardens.com) respectively. Callus cultures of Cissampelos mucronata, Cocculus trilobus, and Tinospora cordifolia were purchased from Deutsche

Sammlung von Mikroorganismen und Zellkulturen (DSMZ, Braunschweig, Germany; http://www.dsmz.de).

2.8.2 Chemical Standards

(S)-coclaurine was purchased from Toronto Research Chemicals (Toronto, ON; http://www.trc-canada.com). (S)-Reticuline was a gift from Tasmanian Alkaloids (Westbury,

Australia; http://www.tasalk.com.au/). Morphine and codeine were gifts from Sanofi-Aventis

(Paris, France; http://en.sanofi-aventis.com). Allocryptopine, (S)-scoulerine and (S)-canadine

were purchased from Chromadex (Irvine, CA; http://www.chromadex.com). (S)-Isocorydine,

(S)-boldine, (S)-corytuberine, and (S)-glaucine were from Sequoia Research Products (St. James

Close, UK; http:// http://www.seqchem.com/). Cryptopine was purchased from MP Biomedicals

(Santa Ana, CA; http://www.mpbio.com).

Thebaine, oripavine were prepared from P. somniferum latex as described previously

(Hagel and Facchini 2010). Stylopine was produced synthetically from berberine as described previously (Liscombe and Facchini 2007). Cheilanthifoline was produced enzymatically from scoulerine using recombinant cheilanthifoline synthase and purified by TLC as described by

Diaz Chavez et al. 2011.

2.8.3 Extraction of alkaloids from BIA producing plant species

Tissue was harvested from plants and flash frozen in liquid nitrogen. Frozen tissue samples were ground with a TissueLyser II (Qiagen, Venlo, NL) using 30 mL liquid nitrogen cooled stainless steel grinding jars with 20 mm grinding balls (Retsch, Haan, DE). Samples were lyophilized until dry.

Ground, freeze-dried tissue was mixed with Bieleski’s solution (15:1:4) (v/v), methanol, formic acid and water, to a concentration of approximately 30 mL Bieleski’s to each gram of dried plant tissue. Solutions were sonicated at full power for 1 min in an ice water bath. Tubes were shaken at 200 RPM at 4 ºC for 2 hours and then left at -20 ºC for 18 hours to passively diffuse. Debris was removed by centrifugation at 14 000 g for 10 min at 4 ºC. The resulting supernatants were removed from the cell debris and filtered through 22 µm Millex filters (EMD

Millipore, Billerica, MA) into pre-weighed tubes. Samples were dried down in a Speed-Vac concentrator (Savant, Ramsey, MN) and the total mass of alkaloid extract was determined with an analytical balance. Dried total alkaloid extracts were subsequently reconstituted in 10 mM

ammounium acetate, 5% acetonitrile at pH 5.5 to a concentration of 5 mg/mL. The prepare the alkaloids extract for analysis, the reconstituted alkaloid extracts were diluted 1:10 and 1:100 in glass auto-sampler vials in 10 mM ammounium acetate, 5% acetonitrile at pH 5.5.

2.8.4 LC conditions for targeted alkaloid profiling

LC analysis was performed with a 1200 liquid chromatograph coupled to a 6410 triple quadrupole mass spectrometer (Agilent, Santa Clara, CA). Solvent A, was 10 mM ammounium acetate, 5% acetonitrile at pH 5.5 and solvent B was 100% acetonitrile. The chromatography column used was a Zorbax Eclipse Plus C18 column (2.1 X 50 mm, 1.8 µm particle size (Agilent,

Santa Clara, CA) with a flow rate of 0.5 mL/min and a temperature of 45 ºC. The column was equilibrated in solvent A and the elution conditions were as follows: Each extract was injected onto the column with a volume of 10 µL. Compounds were eluted using a flow rate of 0.5 mL/min using a gradient of 10 mM C2H3O2NH4 (solvent A, C2H3O2NH4:C2H3N; pH5.5) and

C2H3N (solvent B). Initial HPLC conditions were 100% solvent A changing linearly to 50%

(v/v) solvent A over 10 min, and then to 1% (v/v) solvent A by 12 min. Mobile phase constituents remained constant for 1 min and then returned to starting conditions at 13.1 min for a 4-min re-equilibration period. Total analysis time was 18.1 min per sample.

2.5.2 Mass analyzer conditions for targeted alkaloids profiling

Samples were introduced to the mass analyzer via an electrospray ionization (ESI) probe inlet with a capillary voltage of 4000 kV, a fragmentor voltage of 100V, a gas temperature of

350 ºC, the gas flow was set to 10 L/min and the nebulizer pressure was 50 psi. Mass spectrometry data was acquired in positive ion mode.

Full scan analysis were performed with quadrupole 1 and 2 set to RF only while quadrupole 3 scanned a variable mass range (200 – 700 m/z). From these experiments a list of m/z found in the alkaloid extracts was compiled and were used to establish subsequent CID experiments.

Collisionally-induced dissociation (CID) spectra were recorded using a collision energy of 25 eV applied to quadrupole 2. MS2 fragments were analyzed in quadrupole 3 by scanning from m/z 40 to m/z 2 greater than the precursor ion m/z. Resulting spectra and retention times for the alkaloid standards were used to identify alkaloids from the 20 BIA producing species.

CHAPTER THREE: THE ISOLATION AND FUNCTIONAL EXPRESSION OF A

MOLECULAR CLONE ENCODING 2-PROTOBERBERINE O-

METHYLTRANSFERASE

3.1 Introduction

Although benzylisoquinoline alkaloids accumulate in diverse taxa of angiosperms they are most common among the orders Papaveracea, Ranunculaceae, Berberidaceae and

Menispermaceae (Ziegler and Facchini 2008). BIAs and other alkaloids are known to contribute to the reproductive fitness of plants due to their roles in plants defence against herbivores and pathogens (Hartmann 2007; Pichersky and Lewinsohn 2011; Wink 2003). The ability to produce

BIAs in angiosperms is thought to have arisen from a monophyletic origin (Liscombe et al.

2005). The incredible structural diversity of BIAs is the result of remarkably few enzyme types.

The structural diversity of BIAs has been explained by the duplication of genes recruited from primary metabolism followed by random mutation of the duplicated genes (Ober and Hartmann

2000). This processes allowed for the generation of novel catalytic functions without loss of the genes’ original functions.

Certain reaction types are widespread in BIA metabolism, one such reaction type is

SAM-dependant O-methylation which catalyze the regiospecific transfer of a methyl group from

SAM to a free hydroxyl moiety on the BIA backbone (Beaudoin and Facchini 2014). Genes encoding O-methyltransferases involved in BIA biosynthesis have been isolated from several plants that produce BIAs and often share significant sequence similarity (Beaudoin and Facchini

2014). 6OMT has been isolated from Coptis japonica (Inui et al. 2007) and P. somniferum

(Ounaroon et al. 2003). A molecular clone for 4’OMT has been isolated from C. japonica

(Morishige et al. 2000) while 4’OMT activity has been found in the cell cultures from several

plants such as, Berberis koetineana, Mahonia nervosa and Eschscholzia californica (Frenzel and

Zenk 1990). SOMT1 has been isolated from both P. somniferum (Dang and Facchini 2012) and

C. japonica (Takeshita et al. 1995). Other known OMTs involved BIA metabolism include

7OMT (Ounaroon et al. 2003) and N7OMT (Pienkny et al. 2009) both were isolated from P. somniferum.

At least two OMTs expected to be involved in BIA metabolism in opium poppy have never been isolated from cDNA or functionally characterized (Beaudoin and Facchini 2014).

The first is a 3’OMT involved in papaverine biosynthesis and the second a 2OMT involved in the formation of 2-O-methylated protoberberines including (S)-tetrahydropalmatine, (S)-sinactine and (S)-tetrahydropalmatrubine. There is a report of a 3’OMT that was partially purified and characterized from Argemone platyceras cell suspension cultures (Rueffer et al. 1983). The 5’ and 3’ positions are equivalent on the simple BIA backbone because both sites are meta to the isoquinoline linking carbon, as such the enzyme was named, 6-O-methylnorlaudanosoline-5’-O- methyltransferase (5’OMT). 5’OMT had a molecular weight of 47 kDa, a pH optimum of 7.5 and a temperature optimum of 35 ºC. 5’OMT was assayed with simple BIAs possessing various

O-methylation and N-methylation patterns, 6-O-methylnorlaudanosoline (6-O-methylated, N- desmethyl), norlaudanosoline (no O-methylation, N-desmethyl) and laudanosoline (no O- methylation, N-methylated). 6-O-methylnorlaudanosoline was the only substrate accepted by

5’OMT (Rueffer et al. 1983). More recently, 3’OMT activity was found in the search for scoulerine 9-O-methyltransferase from P. somniferum (Dang and Facchini 2012). The 9-position of the protoberberine backbone is equivalent to the 3’-position of the simple BIA backbone. An enzyme called SOMT1 was discovered and catalyzed the sequential O-methylation at the 9- position of scoulerine followed the O-methylation of the 2-position of scoulerine which resulted

in the formation of the fully O-methylated protoberberine tetrahydropalmatine. An analogous reaction was catalyzed when the simple BIA reticuline was used as a substrate, reticuline was O- methylated at the 3’-position and subsequently O-methylated at the 7-position to form the fully

O-methylated simple BIA laudanosine. Due to the nearly 300 fold reduction of catalytic efficiency between scoulerine and reticuline, the authors postulated that SOMT1 would be unable, on its own, to account for the high basal levels of papaverine observed in opium poppy and suggested the presence of a more regiospecific and substrate specific 3’OMT in opium poppy. Additional support for the presence of a dedicated 3’OMT came from the systematic silencing of BIA biosynthetic genes from P. somniferum (Desgagné-Penix and Facchini 2012).

The VIGS-mediated knockdown of biosynthetic genes upstream of papaverine suggested that papaverine biosynthesis proceeded via an N-desmethylated pathway which excludes reticuline.

SOMT1 preference for the N-methylated simple BIA reticuline over the N-desmethyled norreticuline suggests that SOMT1 is unlikely to be involved in a major pathway leading to papaverine.

Although an enzyme with protoberberine 2OMT activity has never been reported in opium poppy, O-methylation activity at the 2-position of the protoberberine backbone as been reported in the literature. Columbamine O-methyltransferase was first discovered in suspension cultures of Berberis wilsoniae. CoOMT was partially purified using classical biochemistry approaches and assayed. CoOMT catalyzed the SAM-dependent O-methylation of columbamine at the 2-position to form palmatine and exhibited high substrate specificity (Rueffer, Amann, and

Zenk 1986). A molecular clone of CoOMT was eventually isolated from C. japonica cell cultures and heterologously expressed in E. coli (Morishige et al. 2002). Surprisingly,

CjCoOMT had a higher degree of sequence similarity to C. japonica 6OMT, which accepts

simple BIAs as substrates, than to C. japonica SOMT which accepts protoberberine alkaloids as substrates. CjCoOMT had a molecular weight of 40 kDa, a pH optimum of 8.4 and a temperature optimum of 30 ºC. Among the substrates tested in the study columbamine was the best substrate followed by (S)-scoulerine which indicates that the fully aromatized backbone is preferred. (S)-tetrahydropalmatine was also accepted as a substrate however CoOMT did not accept alkaloids with a 1-benzylisoquinoline backbone indicating a strong preference for the protoberberine backbone.

The following chapter describes the identification and functional characterization of a cDNA encoding protoberberine 2-O-methyltransferase (2OMT) from opium poppy roots.

2OMT is the only OMT reported from opium poppy that catalyzes the transfer of a methyl group from SAM to a free hydroxyl group at the 2 position of protoberberine alkaloids.

3.2 Results

3.2.1 Identification and phylogenetic analysis of 2OMT cDNA

The molecular cloning of several cDNAs encoding OMTs involved in BIA metabolism were used as query sequences to identify full-length candidate cDNAs encoding opium poppy

2OMT. Query sequences were used to mine next-generation sequence databases as described in

Chapter 2.1. Similar approaches have been used previously to identity other BIA biosynthetic genes (Ikezawa, Iwasa, and Sato 2008; Liscombe and Facchini 2007). Six gene candidates were amplified from Bea’s Choice Stem cDNA named, IzOMT1, through IzOMT6, and four gene candidates were amplified from Bea’s Choice Root cDNA named DDOMT 1 through DDOMT4.

All candidates were selected in part based on their high FPKM values which are indicative of transcript abundance. FPKM value for IzOMT1 was 60.1; IzOMT2 was 42.1; IzOMT3 was

1.23; IzOMT4 was 15.58; IzOMT 6 was 119.5; DDOMT1 was 117; DDOMT2 was 68.79;

DDOMT3 was 178.1 and DDOMT4 was 60.1. Of the amplified genes, IzOMT1 contained a stop codon in the middle of the predicted ORF, IzOMT3 was too short to be a SAM-dependent

OMT, IzOMT5 contained a premature stop codon followed by an insertion, DDOMT1 and 2 also contained a premature stop codon followed by an insert. Full length ORFs for DDOMT1 and

DDOMT2 were obtained through gene synthesis. DDOMT1 was renamed protoberberine

2OMT.

Several SAM-dependent O-methyltransferases involved in BIA metabolism were subjected to phylogenetic analysis along with gene candidates to determine the evolutionary relationships between candidate genes and characterized plant OMTs (Figure 3.1). One clade forms around 7OMT and 2OMT. Other BIA biosynthetic enzymes also group together, 6OMT,

N7OMT and 4’OMT for a clade at the top of figure 3.1. SOMT1 and DDOMT2 form a clade near the bottom of the bottom left of figure 3.1.

The amino acid sequence of 2OMT was analyzed using InterPro Protein Sequence analysis and classification tool (Jones et al. 2014). Three domains were located. The first was a winged helix-turn-helix DNA-binding domain with a plant methlytransferase dimerisation domain embedded within the winged helix-turn-helix. The C-terminus of the protein contained a

SAM-dependent methyltransferase domain.

Figure 3.1. Neighbour-joining tree of derived from the amino acid sequences of selected plant SAM-dependant O-methyltransferases.

Amino acid sequences were aligned using Clustal W (Chenna et al. 2003). The tree was constructed and bootstrap analysis was performed using Geneious.

3.2.2 Heterologous expression of 2OMT

The identity of the isolated cDNA as protoberberine 2OMT was established by the production of recombinant polyhistidine-tagged proteins in E. coli Arctic Express (DE3) RP cells containing pET29b::2OMT. The recombinant enzyme had a molecular mass of ~40 kDa which was similar to the expected due to the addition of the C-terminal His-tag (Figure 3.2 A). The recombinant His-tagged 2OMT was only found in total protein extracts and purified protein extracts of E. coli harbouring the pET29b::2OMT (Figure 3.2 B).

His-tagged recombinant 2OMT was purified by cobalt affinity chromatography as shown in Figures 3.2 A and B. The protein was subsequently desalted using PD-10 columns. IzOMT2,

IzOMT3, IzOMT6, DDOMT2, DDOMT3 and DDOMT4 were expressed and purified in the same manner as 2OMT.

3.2.3 Enzymatic properties of 2OMT

The pH optimum for 2OMT was approximately 8 and half-maximum activity occurred at approximately pH 6.3 (Figure 3.3). Recombinant 2OMT showed maximum activity at approximately 37 ˚C and half-maximum activity was predicted to occur at approximately 25 ˚C and 40 ˚C (Figure 3.4).

Figure 3.2. Heterologous expression of 2OMT synthetic gene in E. coli

(A) SDS-PAGE analysis of protein extracts of from non-induced (-IPTG) and induced (+IPTG) E. coli cells harbouring the pET29b 2OMT expression construct. Purified recombinant 2OMT is also shown. (B) Western blot analysis performed on samples from A using a polyhistidine tag monoclonal antibody shows the presence of recombinant proteins. Number of the left of A and B show the protein molecular weight standards.

Figure 3.3. The effect of pH on Papaver somniferum 2OMT activity with scoulerine

Different pH ranges were achieved by using different buffers. pH 5 (citrate), pH 6-7 (potassium phosphate), pH 8(Tris-HCl), and pH 9 (glycine).

Figure 3.4. The effect of temperature on Papaver somniferum 2OMT activity with scoulerine

Substrates from different BIA structural subgroups were used to investigate the substrate specificity of protoberberine 2OMT and the other heterologously expressed recombinant enzymes. Figure 3.5 shows the EICs from each purified recombinant enzyme being assayed with scoulerine as a negative result. Figure 3.6 shows the extracted ion chromatograms for substrates that were accepted by 2OMT. In each frame of figure 3.6 (A-F), the top two chromatogram represent, negative controls with boiled enzyme, the first chromatogram represents the extract ion chromatogram (EIC) corresponding to the m/z of the substrate and the second chromatogram represents the EIC corresponding to the m/z of the product which is equivalent to the m/z of the substrate plus the mass of a single O-methylation event (14 Da). The two lower chromatograms represent the extracted ion chromatograms for the m/z of the substrate and the product with native enzyme. All assays were conducted for 2 hours and incubated at 30 °C. Frame A shows the activity of 2OMT with cheilanthifoline. The controls show that cheilanthifoline (m/z 326) elutes at 3.2 minutes. The product, sinactine (m/z 340), elutes slightly later than cheilanthifoline at 3.7 minutes. Frame B shows the activity of 2OMT with scoulerine. Scoulerine (m/z 328) elutes at 3.2 minutes and the O-methylated product, tetrahydropalatrubine (m/z 342) elutes at 3.5 minutes. Frame C shows the activity of 2OMT with coclaurine. Coclaurine (m/z 286) elutes at

2.8 minutes and the O-methylated product of the reaction, norarmepavine (m/z 300) elutes at 3.2 minutes. Frame D shows the activity of 20MT with dopamine. Dopamine (m/z 154) elutes at 0.4 minutes and the O-methylated product, 4-methoxytyramine (m/z 168) elutes at 0.8 minutes.

Frame E shows the activity of 2OMT with reticuline. Reticuline (m/z 330), retention time, 3.1 minutes, is O-methylated to form laudanidine (m/z 344) with a retention time of 3.2 minutes.

Frame F shows the activity of 6-O-methylnorlaudanosoline with 2OMT. The substrate, 6-O- methylnorlaudanosoline (m/z 302) has a retention time of 2.7 minutes. The product is 6,7-O-

dimethylnorlaudanosoline (m/z 316) elutes at 3.4 minutes. IzOMT2, IzOMT3, IzOMT6,

DDOMT2, DDOMT3 and DDOMT4 were assayed with the same substrates and no activity could be detected.

Table 3.1 lists all the substrates assayed with 2OMT, the methylation pattern of substrate, the relative activity of each substrate relative to scoulerine and the product formed. The relative activities were calculated by comparing the integrations of the EICs and normalizing them to scoulerine. The best substrate for 2OMT under the conditions tested was the protoberberine (S)- cheilanthifoline which was methylated at the 2 position to make (S)-sinactine at % 1010 relative activity followed by (S)-scoulerine which was methylated at the 2 position to form (S)- tetrahydropalmatrubine with a relative of activity % 100. (S)-Coclaurine was converted to (S)- norarmepavine by 2OMT with an O-methylation at the 7 position with a relative activity of %

41.9. The phenylethylamine and precursor to all BIAs, dopamine was also accepted by 2OMT which is thought to form 4-methyoxytryamine with a relative activity of % 21.1. (S)-Reticuline and (S)-6-O-methylnorlaudanosoline were also accepted by 2OMT in trace amounts to form (S)- laudanidine and (S)-6,7-O,O-methylnorlaudanosoline respectively.

Figure 3.7 shows the chemical conversions of the substrates to the reaction products by

2OMT. The products of each reaction were determined by CID at 25 eV. In all cases chemical standards were not available for the products of reaction and the chemical structures were inferred by comparing the fragmentation mass spectra of the substrate and using fragmentation schemes for protoberberine alkaloids and simple BIAs in the literature (Schmidt et al. 2005;

Schmidt et al. 2007). Table 3.2 shows the CID fragmentation patterns of the substrates and the enzymatic products of 2OMT. Across all samples a characteristic gain of 14 Da was observed on the isoquinoline moiety of the product.

Substrate Product Relative Substrate N 6 7 4' 3' Products m/z m/z Activity (%) Dopamine 154.2 168.2 H OH OH - - 21.1 4-Methoxytyramine

(S)-Coclaurine 286.4 300.4 H OMe OH OH - 41.9 (S)-Norarmepavine

(S)-Norlaudanosoline 288.2 302.2 H OH OH OH OH 0 -

(S)-6-O-Methylnorlaudanosoline 302.2 316.2 H OMe OH OH OH 0.2 (S)-6,7-O,O-Dimethylnorlaudanosoline

Norreticuline 316.2 330.2 H OMe OH OMe OH 0 -

(S)-Reticuline 330.4 344.4 Me OMe OH OMe OH 2.61 (S)-Laudanidine

Boldine 328.4 342.4 Me OH OMe OMe OH 0 -

Isocorydine 342.2 356.2 Me OMe OMe OMe OH 0 -

(S)-Scoulerine 328.2 342.2 H OMe OH OMe OH 100 (S)-Tetrahydropalmatrubine

(S)-Cheilanthifoline 326.4 340.4 H OMe OH MDO MDO 1.01E+03 (S)-Sinactine

Oripavine 298.2 312.2 Me OH OMe 0 -

Morphine 286.2 300.2 Me OH OMe 0 -

Figure 3.5 Extracted ion chromatograms (EICs) showing the lack of O-methylation activity observed when scoulerine was assayed with each heterologously expressed enzyme (A) IxOMT2, (B) IzOMT3, (C) IzOMT6, (D) DDOMT2, (E) DDOMT3 and (F) DDOMT4. For each substrate the top two EICs (controls) represent boiled enzyme negative controls and the bottom two lines represent purified native recombinant enzyme.

For each substrate the top two EICs (controls) represent boiled enzyme negative controls and the bottom two lines represent purified native recombinant 2OMT. The incubation of native 2OMT with cheilanthifoline (m/z 326) yielded sinactine (m/z 340) based on its CID spectrum. The incubation of 2OMT with scoulerine (m/z 328) formed tetrahydropalmatrubine (m/z 342) based on its CID spectrum. The incubation of 2OMT with coclaurine (m/z 286) formed norarmepavine (m/z 300) based on its CID spectrum. The incubation of 2OMT with dopamine (m/z 154) formed 4-methyoxytyramine (m/z 168) based on its CID spectrum. The incubation of 2OMT with reticuline (m/z 330) formed laudanidine (m/z 344) based on its CID spectrum. The incubation of 2OMT with 6-O- methylnorlaudanosoline (m/z 302) formed 6,7-O,O-dimethylnorlaudanosoline (m/z 316) based on its CID spectrum.

Figure 3.7 The O-methylation activity of 2OMT on various BIA substrates (A) cheilanthifoline, (B) scoulerine, (C) coclaurine, (D) dopamine, (E) reticuline and (F) 6-O- methylnorlaudanosoline. The incubation of native 2OMT with cheilanthifoline (m/z 326) yielded sinactine (m/z 340) based on its CID spectrum. The incubation of 2OMT with scoulerine (m/z 328) formed tetrahydropalmatrubine (m/z 342) based on its CID spectrum. The incubation of 2OMT with coclaurine (m/z 286) formed norarmepavine (m/z 300) based on its CID spectrum. The incubation of 2OMT with dopamine (m/z 154) formed 4-methyoxytyramine (m/z 168) based on its CID spectrum. The incubation of 2OMT with reticuline (m/z 330) formed laudanidine (m/z 344) based on its CID spectrum. The incubation of 2OMT with 6-O- methylnorlaudanosoline (m/z 302) formed 6,7-O,O-dimethylnorlaudanosoline (m/z 342) based on its CID spectrum.

Table 3.2. The ESI[+]CID pattern of substrates and the products from the substrate range experiments determined by LC-MS/MS

The common name of each alkaloid in indicated as well as the m/z ratio of the molecular ion or the protonated parent ion [M]+ or [M+H]+. The identity of the products was inferred by comparing the CID patterns of the products to those of substrates and by studying the fragmentation patterns for protoberberine alkaloids and simple BIAs in the literature. The retention time is indicated by RT and is expressed in minutes. CE indicates the collision energy in eV used in CID experiments. ESI-CID spectrum m/z indicates the m/z of the fragments resulting from the CID of a given compound and the number in brackets represents the relative intensity of the ion in the spectrum. The structure is also illustrated in the table

ESI-CID Spectrum [M+H]+ RT CE No. Compound m/z (Relative Structure + (min) (eV) or [M] Intensity)

326 (17), 178 (100), 1 (S)-Cheilanthifoline 326 3.2 25 176 (11), 151 (23), 149 (6), 91 (17)

340 (7.2), 192 (100), 2 (S)-Sinactine 340 3.7 25 176 (10), 165 (46)

328 (9.02), 178 (100), 3 (S)-Scoulerine 328 3.2 25 151 (10.77)

342 (14), 192 (100), (S)- 4 342 3.5 25 165 (46), 151 (8), 150 Tetrahydropalmatrubine (7)

286 (18), 269 (65), 5 (S)-Coclaurine 286 2.8 25 178 (5), 175 (3), 143 (12), 107 (100)

300 (14), 283 (92), 6 (S)-Norarmepavine 300 3.2 25 192 (8), 190 (6), 175 (5), 107 (100)

154 (1), 137 (100), 7 Dopamine 154 0.5 25 119 (12), 91 (9)

168 (1), 151 (100), 8 4-Methoxytyramine 168 0.8 25 133 (8)

192 (100), 177 (8.09), 175 (19.32), 151 9 (S)-Reticuline 330 3.1 25 (5.45), 143 (25), 137 (41.49)

344(1), 206 (100), 10 (S)-Laudanidine 344 3.2 25 189 (7), 143 (52), 137 (38)

302 (1), 253 (5), 207 (9), 178 (83), 175 (S)-6-O- 11 302 2.7 25 (27), 163 (12), 143 methylnorlaudanosoline (58), 137 (12), 123 (100), 115 (12)

316 (1), 192 (85), 189 (S)-6,7-O,O- 12 316 3.4 25 (22), 143 (25), 123 dimethylnorlaudanosoline (100)

Varying concentrations of (S)-scoulerine from 5 to 200 µM and a constant concentration of SAM at 500 µM, produced a typical Michaelis-Menten substrate saturation kinetics. The apparent Km value for (S)-scoulerine was 51.8 ± 13.0 µM and the apparent Vmax was calculated as

6 1.51 x 10 Counts/min/µg. Both the apparent Km and apparent Vmax, shown in Figure 3.9, were calculated by regression of the Michaelis-Menten curve using SigmaPlot.

3.2.4 Relative transcript abundance of 2OMT in opium poppy tissue

The relative transcript abundance of 2OMT in different opium poppy tissue types was determined by qPCR. Primers were designed to anneal to a unique region of 2OMT’s 3’UTR.

Of the five tissue types analyzed, root had by far the greatest relative transcript abundance while, stem, capsule, leaf and bud had almost no relative transcript abundance (Figure 3.10).

Figure 3.8 Michaelis-Menten plot for Papaver somniferum protoberberine 2OMT with (S)- scoulerine with a constant concentration of SAM.

The Km and Vmax were calculated by regression using SigmaPlot.

Figure 3.9 Relative abundance of 2OMT gene transcripts in Bea’s Choice opium poppy tissues

RT-PCR was performed with cDNA synthesized using total RNA from each organ. Error bars represent the standard error of the mean for three independent measurements.

3.3 Discussion

Many studies have described the cloning and functional characterization of OMTs involved in BIA biosynthesis (Dang and Facchini 2012; Morishige et al. 2000; Ounaroon et al.

2003; Pienkny et al. 2009). To date, all OMTs involved in BIA biosynthesis utilize SAM as the methyl donor and transfer a methyl group with a certain degree of regiospecificity (Beaudoin and

Facchini 2014). When this study began at least two OMTs involved in BIA biosynthesis remained unknown. The first was a 3’OMT involved in the production of papaverine and the second a protoberberine 2OMT involved in the production of sinactine.

The goal of this study was to isolate the 3’OMT gene and functionally characterize it. To this end, 6 candidates were found in 454 and Illumina NGS stem transcriptomic databases and 4 more gene candidates were selected from 454 and Illumina NGS root transcriptomic databases.

Candidates were selected based on their sequence similarity to characterized OMTs involved in

BIA biosynthesis. Candidate selection was prioritized based on each contig’s FPKM value provided by the Illumina databases. Expression levels of a given gene can be predicted by their

FPKM values in the database because FPKM values are related the number of reads used to assemble any given gene. The assumption was made that mRNA abundance, expressed by the

FPKM value, was correlated to the protein abundance. Due to the high accumulation of papaverine in opium poppy latex, only the most highly expressed putative OMT genes, as indicated by their FPKM values, were selected as gene candidates. A recent study described an enzyme, DBOX, responsible for the conversion of tetrahydropapaverine to papaverine was expressed in root tissue (Hagel et al. 2012). The presence of DBOX in the roots opened the

possibility that other steps of papaverine biosynthesis also occurred in the roots and led to prioritization of gene candidates exclusively from roots over gene candidates found in the stem.

Some gene candidates were dropped due their small size or the presence of introns within the predicted ORF of the gene. Such introns could be the result of a simple assembly error due to certain biases of the Velvet assembly software or by something more systematic like differences in the developmental stage of the plants used for sequencing and for other experiments. Genes for which full length cDNAs were amplified and heterologously expressed in E.coil were

IzOMT2, IzOMT3, IzOMT6, DDOMT3 and DDOMT4.

We report the characterization of a full-length gene encoding protoberberine 2OMT found in opium poppy roots. This novel SAM-dependent OMT was identified by tBLASTn analysis of Illumina HiSeq and Roche-454 pyrosequencing transcriptomic databases of opium poppy root. Amplification of protoberberine 2OMT from P. somniferum variety “Bea’s Choice” roots produced a gene containing an intron in the ORF, as a result, the gene was synthesized.

The intron could the be result of there being several genomic copies of 2OMT or the developmentally dependant splicing of 2OMT. Similarly it is possible that there was an assembly error resulting in a mis-call substitution in the NGS dataset. Unlike, IzOMT1 and

IzOMT5, 2OMT and DDOMT2 were not abandoned, the reasoning was due to their high FPKM values and their presence in roots and absence in stem. Functional expression of the 2OMT synthesized gene produced a polyhistidine-tagged enzyme in E. coli allowed 2OMT to be purified to homogeneity by colbalt-affinity chromatography (Figure 3.2). Purified 2OMT catalyzed the conversion of selected protoberberine alkaloids and simple BIAs to their respective

2-O-methylated and 7-O-methylated derivatives (Figure 3.7). When the protoberberine ring is

formed by BBE, the 7-position of the simple BIA backbone becomes the 2-position of the protoberberine backbone (Dittrich and Kutchan 1991).

The phylogenetics of protoberberine 2OMT were studied by comparing the amino acid sequences of 2OMT to the sequences of characterized plant SAM-dependent OMTs in a neighbour-joining tree (Figure 3.1). 2OMT forms a clade with 7OMTs from Eschscholzia californica and Papaver somniferum which is relatively distant from other characterized OMTs involved in BIA metabolism suggesting they have arisen from a recent common ancestor through a process of gene duplication and subsequent mutation. 7OMT and 2OMT both catalyze a similar reaction: the O-methylation of the isoquinoline moiety at the same position, which corresponds to the 7 position on the simple BIA backbone or the 2 position of the protoberberine backbone. CjCoOMT also methylates at the 2-position of the protoberberine backbone specifically the substrates, columbamine, tetrahydrocolumbamine and scoulerine. CjCoOMT forms a separate and distant clad from 7OMT and 2OMT suggesting it arose independently from

7OMT and 2OMT. Other OMTs involved in BIA metabolism, 6OMT, 4’OMT and N7OMT also formed a distinct clade from 7OMT and 2OMT which is interesting because N7OMT accepts the

N-desmethyled substrate norreticuline and forms norlaudanine by an O-methylation at the 7- position of norreticuline (Pienkny et al. 2009). As a general rule, 6OMT and 4’OMT clustered closest together based on function (O-methylation at the 6- or 4’ positions) and independently of species. PsSOMT1, which catalyzes the O-methylation of scoulerine at the 9-position (3’- position of the simple BIA backbone), is highly similar to DDOMT2. The clade formed with

SOMT and DDOMT2 led us to believe that DDOMT2 may have been the elusive 3’OMT involved in biosynthesis of papaverine however when it was assayed with simple BIAs and protoberberines no activity was detected.

The catalytic properties of recombinant opium poppy protoberberine 2OMT are generally in agreement with those of other purified or partially purified OMTs from opium poppy and other BIA producing plants. The molecular weight of opium poppy 2OMT is approximately

40kDa, determined by SDS-Page (Figure 3.2) which is comparable to the molecular weights of other OMTs purified from opium poppy and related plants. For example, SOMT1 from opium had mass of 43 kDa (Dang and Facchini 2012), 7OMT from opium poppy was 40 kDA

(Ounaroon et al. 2003) and CoOMT from C. japonica had a mass of 40 kDa (Morishige et al.

2002). Gel filtration chromatography of some OMTs has revealed native molecular masses that are approximately double the size (Frick and Kutchan 1999), suggesting the possibility that

2OMT may exist as a dimer in vivo. The possibility of 2OMT existing as a dimer was strengthened by the detection of a plant methyltransferase dimerisation domain by the InterPro sequence analysis tool. The temperature and pH optima for recombinant 2OMT (Figure 3.3 and

3.4) fall in the same range as other characterized OMTs. Opium poppy SOMT1 exhibited a pH optimum of 9.0 and a temperature optimum of 37 °C (Dang and Facchini 2012), opium poppy

7OMT has a pH optimum of 8.0 and a temperature optimum of 37 °C (Ounaroon et al. 2003), and CoOMT from Coptis japonica demonstrated optimal activity at a pH 8.4 and 30 °C

(Morishige et al. 2002). The apparent Km value of 2OMT for (S)-scoulerine of 51.8 ± 13.0 µM falls on the high end of Km values reported for other OMTs and could be lower if the protein had been purified to homogeneity. SOMT1 has an apparent Km of 28.5 ± 6.8 µM for (S)-scoulerine

(Dang and Facchini 2012), while 7OMT from opium poppy is reported as having a Km of 16 µM for (S)-reticuline (Ounaroon et al. 2003). CoOMT and 4’OMT from Coptis japonica have a Km of 66 ± 18 µM for columbamine and 42 µM for 6-O-methylnorlaudanosoline respectively

(Morishige et al. 2002; Morishige et al. 2000). Unfortunately, due to limited availability of the

chemical, a Km for (S)-cheilanthifoline could not be determined for in this study. However, given the apparent substrate preference of 2OMT for (S)-cheilanthifoline suggests that a Km for (S)- cheilanthifoline would be lower than that for (S)-scoulerine. The substrate specificity of opium poppy protoberberine 2OMT is somewhat wide in that it accepts the phenylethylamine dopamine, which serves as a precursor to all BIAs, as well is simple BIAs and protoberberine type alkaloids (Table 3.1). Despite their phylogenetic distance, the reactions catalyzed by protoberberine 2OMT are similar to the reactions catalyzed by C. japonica CoOMT in that they

O-methylate at 2-position of the protoberberine backbone. CoOMT has been reported to O- methylate columbamine, tetrahydrocolumbamine and scoulerine. However, unlike 2OMT,

CoOMT does not accept simple BIAs. Protoberberine 2OMT is unique as it is the only enzyme characterized from opium poppy that catalyzes the 2-O-methylation of the protoberberine backbone.

As discussed above, 2OMT shows homology with other characterized OMTs involved in

BIA metabolism but is most closely related to opium poppy 7OMT (figure 3.1). Like many plant

O-methyltransferases, reticuline 7OMT was reported to have a somewhat broad substrate specificity which often makes assigning an in vivo role difficult. Reticuline 7OMT accepted the phenolics, guaiacol and isovanillic acid in addition to the BIAs, reticuline, orientaline, protosinomenine, isoorientaline (Ounaroon et al. 2003). 7OMT was assayed with scoulerine and showed no catalytic activity. Guaiuacol demonstrated the highest catalytic efficiency (kcat/Km).

However, the authors suggested that because guaiacol does not accumulate in P. somniferum, reticuline, with the second highest catalytic efficiency, was suggested to be the endogenous substrate of 7OMT. Reticuline 7OMT was also quite promiscuous in its ability to methylate positions other than the 7-position. Protosinomenine and isoorientaline each have free hydroxyls

at C-6 and are O-methylated at the C-7, yet both were O-methylated by 7OMT at C-6. In some cases, 7OMT could also methylate at the C-4’, when C-3’ was O-methylated, as a secondary reaction. Despite the interesting methylation products of 7OMT, it showed the highest catalytic efficiency at the 7-position. Unfortunately, we did not have access to many of the substrates that

7OMT accepted as substrates (orientaline, protosinomenine or isoorientaline). Lacking these substrates or their equivalent protoberberine alkaloids, it was impossible to test whether or not

2OMT is capable of methylting at different positions on the BIA backbone. Most of the substrates investigated in this study did not have free hydroxyls at C-6 or C-4’. The notable exceptions to this would be coclaurine which has a free hydroxyl at C-4’ and dopamine with two free hydroxyls. 2OMTs apparent inability to methylate at different positions and its inability to doubly O-methylate substrates could be the result of differences in the binding pocket of 2OMT to accommodate protoberberine alkaloids when compared to 7OMT, however, an investigation with more substrates and using NMR as the method of identifying the products would be needed to determine the real reasons for the differences between 7OMT and 2OMT.

The fragmentation patterns of protoberberine alkaloids and simple BIAs have been studied at length (Schmidt et al. 2005; Schmidt et al. 2007). Published fragmentation schemes, the fragmentation of the chemical standards and the retention times of the standards relative to the enzymatic products, served as the foundation for interpreting the fragmentation mass spectra of the products formed by 2OMT. Simple BIAs fragment in a very distinctive and reproducible fashion, first the bond linking the isoquinoline and the benzyl moieties is broken which forms two charged species, one is derived from the isoquinoline moiety and the other from the benzyl moiety. This information allowed us to determine whether the methylation event occurred on the isoquinoline or benzyl moiety. However, this on its own was not enough information to position

the methylation event on a given hydroxyl and did not preclude the possibility that the methylation event occurred on the amine group. An alternate fragmentation route of simple

BIAs involved the loss of an amine group from the parent ion followed by the recyclization of the isoquinoline moiety without fragmentation of the bond linking the isoquinoline group to the benzyl group. The removal of the nitrogen as a methylation site left only the free hydroxyls on the isoquinoline moiety as possible methylation sites. Further fragmentation of the ion without the amine group resulted in the cleavage of the bond linking the benzyl group and the isoquinoline moiety which leads to the formation of a charges species corresponding to the isoquinoline moiety (Schmidt et al. 2005). Therefore the strategy to identify enzymatic products in this experiment consisted of looking for ions in the fragmentation mass spectra corresponding to the isoquinoline moiety and were 14 Da heavier than the equivalent ions from the fragmentation mass spectra of the substrate. Coclaurine, 6-O-methylnorlaudanosoline and reticuline, which are all 6-O-methylated, only provide a single possible site to for methylation on the isoquinoline ring. The structural limitation of a single methylation site on the isoquinoline moiety provided a strong degree of confidence that 2OMT catalyzed the 7-O-methylation on these substrates. To be certain, NMR should be employed to identify the products.

The fragmentation patterns of protoberberine alkaloids have been studied in considerable depth and share some characteristics with the fragmentation of simple BIAs (Schmidt et al.

2007). As with simple BIAs, protoberberines are broken into two separate ions, one representing the isoquinoline moiety and an other representing the benzyl moiety. The CID of scoulerine results in the formation of two major ions from the parent ion. The scoulerine parent ion is represented by m/z 328, while the singly O-methylated isoquinoline moiety and the singly O- methylated benzylic ion are represented by m/z 178 and 151 respectively. Scoulerine has another

fragmentation route that splits the isoquinoline moiety from the parent ion resulting in an ion without the amine at m/z 151. The fragmentation mass spectrum cheilanthifoline displays equivalent ions. The parent ion of cheilanthifoline is m/z 326. The two distinct ions representing the singly O-methylated isoquinoline moiety of cheilanthifoline are m/z 178 and 151. The ion representing the benzyl moiety with a methylendioxy bridge is m/z 149. The strategy to interpret the fragmentation mass spectra of the enzymatic products was similar to the strategy used for simple BIAs, search for ions that represent the isoquinoline moiety with an additional 14 Da when compared to the substrate and a retention time later than that of the substrate. When assayed with 2OMT, scoulerine was converted to m/z 342. Upon fragmentation of m/z 342 the ions m/z 342, 192, 165, 151 and 150 were observed in the mass spectrum. Ions with m/z 192 and 165 were derived from the isoquinoline moiety and are exactly 14 Da heavier than the equivalent ions in the fragmentation mass spectrum of scoulerine, m/z 178 and 151. This data, when taken together, suggested that a 2-O-methylation occurred on the free hydroxyl group of the isoquinoline moiety of scoulerine. The ion representing the benzylic moiety was detected with m/z 151, indicating no reaction occurred on the benzylic moiety of scoulerine. The product of the enzymatic reaction of 2OMT with scoulerine was identified as (S)-tetrahydropalmatrubine.

Cheilanthifoline (m/z 326) was converted by 2OMT to m/z 340. The fragmentation mass spectrum of m/z 340 displayed the ions m/z 340, 192, 176 and 165. Again ions m/z 192 and 165 represent the isoquinoline moiety with an additional methyl group on the free hydroxyl when compared to the fragmentation mass spectrum of cheilanthifoline. The expected ion at m/z 149 could not be detected. Ion m/z 176 was present in the fragmentation patterns of cheilanthifoline and m/z 340. I believe that m/z 176 is derived from the parent ion moiety and is the benzylic moiety compliment to ion m/z 151 from cheilanthifoline or ion m/z 165 form the enzymatic

product m/z 340. If this is were the case, ion m/z 176 would contain an additional nitrogen and carbon when compared to benzylic ion described above. The presence of m/z 176 in the fragmentation mass spectra of cheilanthifoline and m/z 340 supports the idea that 2OMT did not catalyze any reaction on the benzylic moiety. The O-methylated product of the reaction between

2OMT and cheilanthifoline was putatively identified as (S)-sinactine. These experiments should be repeated using different setting on the MS to increase confidence in the dataset by reducing background noise and to clean up the chromatograms. Selected-reaction monitoring should be used in future experiments to increase the sensitivity and improve the quantitative reliability of the data for both the substrate and the product.

Some OMTs involved in BIA metabolism are know to accept catechols and 2OMT seems no different (Ounaroon et al. 2003). The reaction of 2OMT with dopamine was much more difficult to interpret and the identification of the product is by no means certain. Although it is clear that dopamine (m/z 154) was methylated to form the product m/z 168, dopamine had two sites that can be O-methylated and it was impossible to distinguish where the O-methylation event took place by CID. The loss of 17 Da from the fragmentation mass spectra of both dopamine and the enzymatic product corresponds to the loss of –NH3 and preclude the N- methylation of dopamine. Therefore the most likely site of O-methylation is either the 3-position or the 4-position of dopamine. To draw conclusions regarding the specific site of O-methylation for dopamine without supporting mass fragmentation data of a standard or an NMR study is not possible.

While the study of substrates with differing methylation patterns and CID studies provided support for the identification of the enzymatic products, without chemical standards it is not possible to definitively identify the compounds in accordance with the minimum

information about a metabolomics experiment guidelines (MIAMET) (Katajamaa and Oresic

2007). Ultimately to be certain of the methylation site and the chemical structure of the enzymatic products, NMR would have to be employed for a final identification.

RT-PCR was employed to determine the relative transcript abundance of 2OMT in different tissue types from Bea’s choice variety opium poppy (Figure 3.9). The RT-PCR shows a considerably higher abundance of 2OMT transcripts in root which is, to a certain degree, in agreement with the FPKM values obtained through RNAseq, which showed high levels of

2OMT expression in roots compared to stem. The implication is that 2OMT would be expressed and active in root tissue. RNA gel blot analysis of 7OMT revealed the highest level transcript abundance in bud followed by stem, with almost no expression in capsule, leaf or root

(Ounaroon et al. 2003). The transcript abundance of 2OMT in roots correlates with reports suggesting cryptopine and rhoeadine alkaloids accumulate in the roots of opium poppy (Farrow and Facchini 2013). Figure 3.10 shows the proposed role of 2OMT in vivo from scoulerine.

Cheilanthifoline is made from scoulerine by CFS. Sinactine the product of 2OMTs O- methylation of cheilanthifoline. Cheilanthifoline is subsequently N-methylated by TNMT to form cis-N-methylsinactine. The protopine backbone is formed by the 14-hydroxylation of cis-

N-methylsinactine to form cryptopine. Cryptopine would then be converted to the rhoeadine alkaloids N-methylprophyroxine and glaudine by unknown enzymes. Future studies should investigate the enzymatic steps involved in the conversion of cryptopine to rhoeadine alkaloids.

A good first step would be to do a comparative transcriptomic analysis of plant species that do and do not produce rhoeadine alkaloids but produce cryptopine. The study would look in particular for transcripts that code for oxidative enzymes present in the plants producing rhoeadine alkaloids and are absent in non-rhoeadine producing species. This evidence described

in this chapter reinforces the in vivo role of 2OMT as the missing step in cryptopine metabolism although virus-induced gene silencing of 2OMT would be necessary to establish the true in vivo role of 2OMT.

3.4 Conclusions

Next-generation transcriptomic databases are valuable tools for homology based discovery of novel genes involved in plant specialized metabolism. This platform was used to identify and functionally characterize a novel OMT from opium poppy providing insight into

BIA chemical diversity.

Figure 3.10 The proposed in vivo role of 2OMT in the biosynthesis of cryptopine and rhoeadine alkaloids. Enzymes for which the corresponding genes have been isolated are labelled in green. Enzymes that remain unknown are represented by question marks. Abbreviations used are as follows: CFS, cheilanthifoline synthase; 2OMT, protoberberine 2-O- methyltransferase; TNMT, tetrahydroprotoberberine N-methyltransferase; MSH, N- methylstylopine 14-hydroxylase.

CHAPTER FOUR: TARGETTED ALKALOID PROFILING OF TWENTY

BENZYLISOQUINOLINE PRODUCING SPECIES

4.1 Introduction

Benzylisoquinoline alkaloids are made almost exclusively by the plant families

Papaveracea, Ranunculaceae, Berberidaceae and Menispermaceae. Despite their restriction to only a small number of plant families BIAs are one of the largest and most diverse groups of alkaloids. The knowledge of BIA diversity across different species is the result of limited metabolite profiling of cell culture and plant tissue employing various analytical techniques including UV-Visible spectroscopy, Fourier transform infrared spectroscopy (FTIR), NMR,

HPLC, MS, circular dichroism and various combinations of the aforementioned techniques

(Chintalwar et al. 2003; Farrow, Hagel, and Facchini 2012; Hook, Sheridan, and Wilson 1988;

Ikuta and Itokawa 1988; Iwasa et al. 2008; Liscombe et al. 2009).

Electrospray ionization (ESI) coupled with MS has been adopted as one of the most powerful techniques for the analysis of BIAs due to its high sensitivity and selectivity. Triple quadrupole (QqQ), ion traps and time-of-flight (TOF) mass analyzers have all been used to identify BIAs (Fabre et al. 2000; Le et al. 2014; Li et al. 2010; Ren et al. 2007; Zhang et al.

2006). These studies have provided indispensible data regarding the accurate mass and fragmentation patterns of several different BIAs.

The monophyletic evolution of BIA metabolism (Liscombe et al. 2005) provides strong support for the idea that the routes to different BIAs are achieved through similar pathways across species. This assumption has led to the homology-dependent cloning of biosynthetic gene orthologs from different species (Farrow et al. 2012). Although several BIA biosynthetic genes have been identified, the enzymes responsible for the formation of most BIAs remain largely

uncharacterized. The biochemical snapshots obtained through multi-stage mass spectrometry can offer substantial clues, when integrated with transcriptomic datasets, it can aid in the selection and interpretation of new gene candidates for the discovery of new BIA biosynthetic genes. Similar initiatives have already been undertaken, for example, the transcript and metabolite profiling of cell cultures for 18 BIA producing species (Farrow et al. 2012). In this study cell cultures representing BIA producing plant families Papaveracea, Ranunculaceae,

Berberidaceae and Menispermaceae were used to construct and annotate Sanger-based EST libraries. The cell cultures were also subjected to targeted metabolite profiling by liquid chromatography coupled to an ESI source coupled with a QqQ mass analyzer. The two datasets were integrated by creating BIA metabolic networks based on identified or annotated compounds that fit into previously proposed biosynthetic routes. Next biosynthetic gene candidates from each species were used to fill in known and unknown biosynthetic steps by annotations assigned by tBLASTn analysis. An integrated framework of this nature can provide guidance for the functional characterization of homologous gene candidates and unknown gene candidates.

Additional benefits of an integrated transcriptomic and metabolic approach across species that share some aspects of their metabolism is that it facilitates the isolation of genes that catalyze the same reaction across different plant species. The availability of enzyme variants catalyzing the same reaction is of particular interest to the emerging field of synthetic biology and could aid in the assembly of BIA pathways in microorganism (Hawkins and Smolke 2008; Minami et al.

2008; Nakagawa et al. 2011).

This chapter describes the use of targeted alkaloid profiles for twenty BIA producing species representing four different families of BIA producing plants, Papaveracea,

Ranunculaceae, Berberidaceae and Menispermaceae. Alkaloids were extracted from plant

tissues and analyzed using LC-ESI/MS/MS. The resulting retention times and CID patterns were compared to a series of BIA standards for identification in accordance with guidelines set-out by

MIAMET (Katajamaa and Oresic 2007). The data generated by these experiments represent a piece of a larger initiative which will integrate the aforementioned targeted metabolite profiles with high resolution FTICR-MS data along with Roche 454 and Illumina next-generation transcriptomic database for each species.

4.2 Results

4.2.1 Targeted alkaloid profiling by LC-MS/MS

Initial analysis of alkaloid extracts from the twenty species was performed in Full Scan mode. Alkaloid extracts were made by grinding and subsequently lyophilizing plant tissues snap frozen in liquid nitrogen. Alkaloids were extracted from the freeze-dried ground plant tissue using Bieleski solution. The resulting chromatograms and mass spectra were generated by scanning between m/z 200-700. The chromatogram and mass spectrum for each plant were used to select compounds for further structural study. Compounds were selected for MS/MS by extracting the mass spectrum of major peaks found on the chromatogram. The study focused on fragmenting compounds with m/z that matched the m/z of the standards. In addition, the constituent mass-to-charge ratios of major peaks were also selected for further analysis by CID.

CID was used to generate fragmentation data for compounds found in the full scan of the

20 plant species. The fragmentation pattern and retention times were compared the fragmentation pattern and retention times of chemical standards for identification listed in table

4.1. The annotated chromatograms for each species of BIA producing plant is shown in figure

4.1. Argemone mexicana contains three BIA from the list of standard compounds which include

(10) berberine, (16) protopine and (19) allocryptopine. No compounds were identified in

Chelidonium majus. Papaver bracteatum contains (4) thebaine and (6) boldine. Stylophorum diphyllum contains (5) stylopine and (7) scoulerine. (9) sanguinarine, (15) chelerythrine, (16) protopine, (19) allocryptopine and (21) cryptopine were all found in Sanguinaria canadensis.

Eschscholzia californica produces (8) reticuline, (16) protopine and (19) allocryptopine. A rich array of alkaloids were detected in Glaucium flavum including, (6) boldine, (7) scoulerine, (9) sanguinarine, (13) isocorydine, (15) chelerythrine, (16) protopine, (17) glaucine and (19) allocryptopine. Corydalis cheilanthifolia produces (5) stylopine, (6) boldine and (16) protopine.

No alkaloids could be positively identified in Hydrastis canadensis or Nigella sativa however,

(10) berberine and (16) protopine were identified in Thalictrum flavum samples and (10) berberine was found in Xanthorhiza simplicissima. Mahonia aquifolium produces (9) reticuline,

(10) berberine and (13) isocorydine. Only (10) berberine could be identified from Berberis thunbergii. No alkaloids could be identified in Jeffersonia diphylla. Several alkaloids including

(6) boldine, (8) reticuline, (10) berberine, (13) isocorydine and (16) protopine were positively identified in Nandina domestica. No alkaloids could be identified from any of the species surveyed from the family Menispermaceae.

Alkaloid distribution is to some degree, different across families of plants. For example, the family Papaveracea seems to have the widest distribution of different BIAs of all the families surveyed, however it is worth noting that 8 species from the family Papaveracea were investigated while only 4 were species were investigated from each Ranunculaceae,

Berberidaceae and Menispermaceae. Papaveracea was the only family studied that contained benzo[c]phenanthridine and morphinan alkaloids. The alkaloid subclasses, aporphine, protoberberine and protopine were observed in all of the plant families with the exception of

Menispermaceae. The alkaloids (S)-boldine, berberine and protopine were the most widespread

alkaloids in this study and were found in 4, 6 and 7 plant species respectively and were the only alkaloids to be positively identified across the families Papaveracea, Ranunculaceae and

Berberidaceae. No alkaloids were identified in the family Menispermaceae.

Some trends also develop if the distribution of alkaloids are considered as a function of tissue/organ type. For example, the benzo[c]phenanthridine alkaloids sanguinarine and chelerythrine are only observed in subterranean tissues such as rhizomes and roots. The morphinan thebaine is only found in stem tissue and the 3’-O-methylated aporphine, glaucine was only detected in root tissue. Protoberberine alkaloid types were identified in all of the tissue/organ types except callus. The some alkaloids were observed in multiple tissue types, for example, boldine, protopine and allocryptopine were found in stem, rhizome and root. No alkaloids were identified in callus tissue tested in this study.

Table 4.1 Chemical standards used for the targeted alkaloid profiling of 20 BIA producing species by LC-MS/MS.

The number of the compound is there for illustrative purposes in figure 4.1. The common name of each alkaloid in indicated as well as the m/z ratio of the molecular ion or the protonated parent ion [M]+ or [M+H]+. The retention time is indicated by RT and is expressed in minutes. CE indicates the collision energy in eV used in CID experiments. ESI-CID spectrum m/z indicates the m/z of the fragments resulting from the CID of a given compound and the number in brackets represents the relative intensity of the ion in the spectrum. The structure is also illustrated in the table.

ESI-CID Spectrum [M+H]+ RT CE No. Compound m/z (Relative Structure + (min) (eV) or [M] Intensity)

286 (100), 229 (11.01), 211 (11.97), 209 (8.65), 201 (27.03), 193 (6.91), 185 (13.14), 183 1 Morphine 286.2 1.01 25 (11.34), 180.9 (8.42), 173 (12.69), 165 (12.95), 157 (5.02), 155 (11.35), 147 (6.32), 145 (5.78), 58 (11.42), 44 (6.78) 298 (2), 283 (1), 267 (1), 249 (3), 237 (1), 2 Oripavine 296.2 3.5 25 234 (4), 223 (1), 221 (1), 218 (8), 196 (5), 58 (100) 300 (100), 282 (5.51), 243 (9.69), 241 (5.95), 225 (16.09), 215 (26.76), 209 (5.54), 199 (16.42), 3 Codeine 300.2 3.52 25 193 (7.43), 187 (10.45), 183 (15.64), 181 (7.1), 165 (11.75), 161 (8.53), 155 (7.47), 58 (16.33), 44 (6.68) 312 (2), 281 (2), 266 (4), 255 (1), 251 (11), 249 (2), 237 (1), 234 4 Thebaine 312.2 5.43 25 (2), 223 (2), 221 (7), 218 (4), 195 (2), 177 (1), 58 (100) 324 (20.4), 176 (100), 5 (S)-Stylopine 324 11.25 25 149 (39.94), 119 (6.39) 297 (14.39), 282 (16.54), 267 (6.43), 266 (9.19), 265 6 (R,S)-Boldine 328.2 4.98 25 (90.58), 237 (100), 233 (14.66), 222 (8.36), 205 (32.45), 177 (8.96), 44 (8.79)

328 (9.02), 178 (100), 7 (S)-Scoulerine 328 6.21 25 151 (10.77)

192 (100), 177 (8.09), 175 (19.32), 151 8 (S)-Reticuline 330 4.76 25 (5.45), 143 (25), 137 (41.49) 332 (100), 330 (6.14), 317 (15.91), 304 9 Sanguinarine 332.2 8.26 25 (22.86), 302 (7.52), 274 (14.07) 336 (45.63), 321 (56.34), 320 (100), 10 Berberine 336 8.02 25 306 (22.08), 304 (16.43), 292 (83.38), 278 (5.47), 275 (5.7)

340 (9.82), 176 (100), 11 (R,S)-Canadine 340 10.28 25 149 (9.5)

340 (70.91), 325 (7.91), 324 (74.12), 12 Papaverine 340 8.47 25 296 (11.54), 202 (100), 171 (15.27) 311 (13.26), 296 (36.67), 281 (30.93), 280 (34.69), 279 (100), 267 (5.76), 265 (39.91), 264 (84.05), 13 (S)-Isocorydine 342.2 6.97 25 251 (24.03), 248 (64.06), 247 (18.41), 236 (40.49), 235 (5.61), 219 (9.84), 191 (8.47) 296 (6.8), 192 (100), (R,S)- 189 (33.2), 174 14 344 6.23 25 Tetrahydropapaverine (16.15), 158 (11.77), 151 (51.84) 348 (45.51), 333 (37.27), 332 (100), 15 Chelerythrine 348.2 8.24 25 318 (31.94), 316 (8.2), 315 (8.48), 304 (56), 290 (8.73)

354 (59.25), 336 (9.18), 271 (16.84), 265 (6.09), 247 (9.8), 206 (17.05), 189 16 Protopine 354.2 6.81 25 (79.71), 188 (100), 177 (6.22), 175 (5.93), 165 (14.85), 149 (46.29), 135 (6.12) 325 (8.04), 310 (37.78), 295 (30.25), 17 (S)-Glaucine 356.2 7.64 25 294 (100), 279 (27.57) 356 (10.45), 192 (R,S)- 18 356 9.58 25 (100), 165 (22.38), Tetrahydropalmatine 150 (5.5)

370 (36.41), 352 (18.72), 337 (5.03), 336 (7.29), 321 (5.84), 306 (7.59), 290 (31.63), 206 19 Allocryptopine 370.2 6.99 25 (27.8), 191 (6.21), 190 (8.31), 189 (34.38), 188 (100), 181 (18.47), 166 (6.37), 165 (13.62), 151 (9.34), 149 (9.71)

290 (12.64), 190 20 (S)-Canadaline 370.2 6.85 25 (100)

370 (68.18), 352 (10.46), 339 (5.46), 321 (9.4), 311 (6.87), 291 (15.92), 290 (5.28), 283 (5.57), 263 (10.91), 222 (16.66), 206 (8.09), 21 Cryptopine 370.2 6.65 25 205 (69.54), 204 (100), 194 (8.21), 193 (11.48), 190 (32.49), 175 (10.43), 165 (89.48), 151 (5.35), 150 (12.28), 149 (23.01), 135 (5.56)

369 (7.93), 366 (10.08), 354 (17.54), 22 Hydrastine 384.2 7.68 25 351 (65.15), 336 (100), 333 (5.55), 308 (6) 414 (5), 365 (18.39), 23 Noscapine 414.2 10.67 25 323 (5.23), 220 (100), 206 (5), 179 (6.43)

Figure 4.1 Annotated LC-MS chromatograms from 20 BIA producing species. The numbers on some chromatograms indicate compounds identified by comparing the retention times and CID patterns to the standards in figure 4.1. (A) Argenome mexicana; (B) Chelidonium majus; (C) Papaver bracteatum; (D) Stylophorum diphyllum; (E) Sanguinaria Canadensis; (F) Eschscholzia californica; (G) Glaucium flavum; (H) Corydalis cheilanthifolia; (I) Hydrastis canadensis; (J) Nigella sativa; (K) Thalictrum flavum; (L) Xanthorhiza simplicissima; (M) Mahonia aquifolium; (N) Berberis thunbergii; (O)

Jeffersonia diphylla; (P) Nandina domestica; (Q) Menispermum canadense; (R) Coculus trilobus; (S) Tinospora cordifolia; (T) Cissampelos mucronata.

4.3 Discussion

Metabolomics can be used as a method for the discovery of novel BIA biosynthetic genes particularly when used in conjunction with next-generation transcript profiles. Alkaloid extracts from 20 different BIA producing species from the families Papaveracea, Ranunculaceae,

Berberidaceae and Menispermaceae were analyzed by LC-MS/MS to generate targeted alkaloid profiles. This work helps to reveal the diversity of BIA metabolic networks in these unique plant systems. The positive identification of alkaloids in any given plant implies the existence of upstream enzymes and metabolites from a specific BIA metabolic branch. Such information, used on its own or when integrated with transcriptomic information, can guide the search for novel BIA biosynthetic genes and produce higher quality gene candidates. The QqQ based targeted metabolite profiling discussed in this chapter will ultimately be combined with a metabolite profiling by FTMS and NMR as well as next-generation transcriptomic datasets generated by Roche-454 and Illumina (Xiao et al. 2013). The integration of these complimentary datasets will facilitate the mapping of an extended collection of chemical and genetic components of the combined BIA metabolic network of 20 different plant species. The ultimate goal is to demonstrate how precise metabolic profiles can be used to predict enzyme function, to generate a catalogue of orthologous genes with slightly different catalytic specificities and enzymatic properties to aid in synthetic biology pathway engineering and discover novel genes.

4.3.1 Simple BIAs

The fragmentation patterns of alklaoids with the 1-benzylisoquinoline backbone are relatively well studied and several characteristic fragmentation mechanisms have been proposed

(Schmidt et al. 2005; Schmidt et al. 2007). Typically the fragmentation of simple BIAs occurs at the α-carbon which results in the formation of separate isoquinoline and benzyl ion moieties

(Schmidt et al. 2005; Schmidt et al. 2007). Fragmentation at the α-carbon gives clues to the O- methylation pattern of the alkaloid. Fragmentation of the 1-benzylisoquinoline backbone also generates naphthalene-type ions resulting from loss of an ammonia or methylamine from the isoquinoline nitrogen of the alkaloids (Schmidt et al. 2005; Schmidt et al. 2007). The loss of ammonia or methylamine indicates the N-methylation state of the alkaloid.

The CID spectrum generated for (S)-reticuline follows the fragmentation pattern described in the literature (Schmidt et al. 2005). The reticuline parent ion [M+H]+ has a m/z of

330 and is fragmented at the α-carbon with a collision energy of 25 eV to form an ion with a m/z of 192 and 137. The 192 ion represents the N-methylated and O-methylated isoquinoline moiety of reticuline and the 137 ion represents the O-methylated benzyl ion. The m/z 175 and m/z 143 ions represent the naphthalene-types ions formed upon the loss of a methylamine, subsequent fragmentation at the α-carbon and rearrangement of the isoquinoline moiety.

In this study, reticuline was the only simple BIA surveyed for and was detected in only three species, E. californica, M. aquifolium and Nandina domestica. (S)-Reticuline is considered a branch-point metabolite in BIA metabolism and gives rise to protoberberines, protopines, benzo[c]phenanthridines, phthalideisoquinolines, aporphines, rhoeadines and morphinans

(Beaudoin and Facchini 2014). The limited detection of reticuline in this study and the apparent low basal levels of reticuline among these 20 species could be the result of the considerable metabolic flux of reticuline to other alkaloid types (Beaudoin and Facchini 2014). It is also important to note that the undetectable levels of reticuline in this study do not indicate reticuline is not present, simply that reticuline was not detected. It is possible that reticuline was present below the limit of detection of the QqQ in several species in which it was not detected.

4.3.2 Protoberberine alkaloids

Several protoberberine alkaloids were detected in the families Papaveracea,

Ranunculaceae and Berberidaceae. The fragmentation of protoberberine alkaloids has been investigated in considerable detail (Schmidt et al. 2007). (S)-Scoulerine is the first protoberberine alkaloid made by the FAD-dependent C-C coupling the branch-point intermediate

(S)-reticuline by BBE (Ziegler and Facchini 2008). The CID mass spectrum of scoulerine is characterized by the key ions at m/z 178 representing the singly O-methylated isoquinoline moiety and another ion at m/z 151, represents the complementary singly O-methylated benzylic portion of the molecule (Schmidt et al. 2007). The fragmentation of the protoberberines, tetrahydropalmatine and stylopine are similar to that of scoulerine. The CID mass spectrum for tetrahydropalmatine show a fragment of m/z 192, which represents the dimethylated isoquinoline moiety, and of m/z 165 representing the dimethylated benzylic ion. Stylopine is very similar in structure to tetrahydropalamatine however the double O-methylation of the isoquinoline and benzylic ions are replaced with methylenedioxy bridges. Owing to stylopine’s methylenedioxy bridges the ions observed in the CID mass spectrum derived from the isoquinoline and benzylic moieties are m/z 176 and 149 respectively. The CID mass spectrum of canadine is somewhat different from the CID patterns of other protoberberine alkaloids described above. The expected m/z 176 ion is derived from the isoquinoline moiety containing a methylenedioxy bridge.

However, no ion with m/z 165 is present, which would in most cases indicate the doubly O- methylated benzylic moiety. In its place there is an ion with m/z 149, which implies the loss of

16 mass units. Although the mechanism for canadine’s fragmentation is unknown the loss of 16 could be explained by the loss of –CH2 or of -O.

Berberine is structurally unique from the other protoberberine alkaloids examined in this study in that the ring adjacent to the benzylic moiety is aromatic. This additional aromatic ring results in a unique CID mass spectrum relative to scoulerine, tetrahyrdopalamatine and canadine.

A handful of studies have reported MS/MS information for berberine and other similar alkaloids

(Ren et al. 2007; W. Wu et al. 2005). Although no fragmentation scheme has been proposed for berberine it seems the data collected in this study is in agreement with the literature. Rather than a cleavage separating the isoquinoline and benzyl moieties, as is the case with most protoberberines, there is a loss of functional groups from the backbone of the parent ion. For example, berberine with a m/z of 336 generated fragment ions with m/z 321 and 320 which can be explained by the loss of –CH3 and –CH4 respectively, perhaps through the cleavage of the methylenedioxy bridge. The fragment m/z 306 can be generated from the parent ion by the cleavage of two CH3 groups. While the fragment ion m/z 292 can be generated by the loss –

C2H4O from the parent ion (Wu et al. 2005).

Scoulerine was detected in only two plants from the family Papavercacea, S. diphyllum and G. flavum. Since the presence of many other downstream BIA subclasses such as, protoberberine, protopine, benzo[c]phenanthridine and phthlideisoquinoline, are predicated on the ability of a plants to make scoulerine, it is entirely possible that scoulerine is made by many other plants however the flux through scoulerine metabolism and accumulation of downstream alkaloids made from scoulerine resulted in extremely low basal levels of scoulerine in most plants. Stylopine was detected in the families Papaveracea and Ranunculacea in the species S. diphyllum and H. canadensis. Recent alkaloid characterizations of H. canadensis roots were performed using Orbitrap LS-MSn and ultra performance liquid chromatography quadrupole time-of-flight mass spectrometery (UPLC-QTOF-MSn) (Le, Mccooeye, and Windust 2012; Le,

Mccooeye, and Windust 2014). Both studies reported several BIAs that were not detected using the approach described in this work, conversely we detected some alkaloids that they did not.

For example, in this work stylopine was detected but not in the Orbitrap or QTOF studies. The most obvious reason for this discrepancy would be the analysis of different tissue types. In both the Orbitrap and QTOF studies, alkaloids were extracted from root while in this study alkaloids were extracted from rhizome. Berberine was the most widespread protoberberine alkaloid detected in this study. Berberine was found in the A. mexicana in the family Papaveracea.

Berberine was also found in the species T. flavum and X. simplicissima in the family

Ranunculaceae. Berberine seems to accumulate in the family Berberidaceae. The species M. aquifolium, B. thunbergii and N. domestica all accumulate berberine. There seems to be a certain correlation between tissue type and berberine accumulation. Excluding A. mexicana and

M. aquifolium, berberine seems to be commonly found in roots. This type of information could guide future work on berberine biosynthesis and the search for gene orthologues involved in berberine biosynthesis in other plants species.

4.3.3 Protopine alkaloids

In general, the fragmentation behavior of protopine alkaloids share similarities with the fragmentation behavior of other BIAs. Protopines main fragmentation routes create ions derived from the isoquinoline moiety and the benzyl moiety. Typically protopines will have three isoquinoline derived ions, one of lower mass consisting only the amine, another of higher mass containing the amine and an alcohol group, which is subsequently lost as H2O to make the third isoquinoline derived ion (Schmidt et al. 2007). In addition, there will be at least one ion derived from the benzyl moiety. For example, the alkaloid protopine, m/z 354, will fragment to create an ion at m/z 189 corresponding to the isoquinoline moiety without the alcohol group. Ions at m/z

206 and 188 will also be made corresponding to the isoquinoline ion with the alcohol group and the dehydrated isoquinoline ion. Ion m/z 149 represents the benzylic ion. Protopine and cryptopine are unique in that they make an additional benzylic ion, that is not observed in the mass spectrum of allocryptopine, with an alcohol group at m/z 165 owing perhaps the presence of the benzylic methylenedioxy bridge. The differences between the CID mass spectra of protopine, allocryptopine and cryptopine are the result of differing O-methylation patterns as is the case with protoberberine alkaloids.

Protopine alkaloids were detected in the families Papaveraceae, Ranunculaceae and

Berberidaceae. Protopine alkaloids were found in the stem, root and rhizome of various plants.

The biosynthesis of protopine is catalyzed by the 14-hydroxylation of (S)-cis-N-methylstylopine by MSH, which leads to ring tautomerization by cleavage of the C-N bond and the formation of a

C14 keto moiety (Martina Rueffer and Zenk 1987; Beaudoin and Facchini 2013). This cytochrome P450 catalyzed reaction is prerequisite to the biosynthesis of benzo[c]phenanthridine alkaloids like sanguinarine (Beaudoin and Facchini 2014). Allocryptopine and cryptopine are also enzymatic products of MSH that are made in parallel to protopine by the 14-hydroxylation of (S)-cis-N-methylcanadine and (S)-cis-N-methylsinactine respectively (Beaudoin and Facchini

2013). Protopine was the most widespread of all the targetted protopine alkaloids. In the family

Papaveraceae, protopine was detected in A. mexicana, S. canadensis, E. califorinica and G. flavum. Interestingly, in the family Papaveraceae, the plants which produce protopine also produce allocryptopine. This shared metabolic feature suggests some degree of shared metabolism. Of course the ability of a given plant to produce protopine and allocryptopine is tied to the expression of MSH, but it seems it is also tied to the ability of the plant to express

TNMT which N-methylated the protoberberine backbone (Liscombe and Facchini 2007).

Perhaps genes invovled in protopine alkaloid metabolism are in some way linked. There is new evidence supporting gene clusters involved in BIA metabolism like the 10-gene cluster involved noscapine biosynthesis in P. somniferum (Winzer et al. 2012). It seems however that the link between protopine and allocryptopine metabolism does not extend into the other families observed in this study (allocryptopine was not detected in the families Ranunculaceae,

Berberidaceae and Menisperaceae), which may mean that the possible linking of genes regulating protopine alkaloid metbaolism are only present in the Papaveracea lineage.

Cryptopine was only detected in S. canadensis of the family Papaveracea. Cryptopine is made from scoulerine by the formation of a methylenedioxy bridge by cheilanthifoline synthase to make cheilanthifoline (Figure 3.11). Cheilanthifoline is subsequently 2-O-methylated by protoberberine 2OMT to make sinactine which is then N-methylated by TNMT to make (S)-cis-

N-methylsinactine. (S)-cis-N-methylsinactine is then 14-hydroxylated to make cryptopine by

MSH. Cryptopine is considered to the the source of rhoaedine alkaloids (Farrow and Facchini

2013). The involvement of 2OMT in cryptopine metabolism suggest that S. canadensis may be a good candidate in which to search for opium poppy 2OMT enzyme orthologs due to the presence of cryptopine.

Protopine was also detected in H. canadensis and T. flavum of the family Ranunculaceae.

Protopine was also found in N. domestica of the family Berberidaceae. No protopine alkaloids were detected in the family Menispermaceae.

4.3.4 Benzo[c]phenanthridine alkaloids

Little is known of the fragmentation properties of benzo[c]phenanthridine alkaloids. One characteristic fragment of benzo[c]phenanthridine alkaloids is the loss of m/z 58 from the parent ion. It is thought that the loss of m/z 58 is the result of losing -CH2-CO from the parent ion

(Frick et al. 2005; Schmidt et al. 2007). Both sanguinarine and chelerythrine demonstrate the characteristic loss of m/z 58. The alkaloids sanguinarine and chelerythrine were only detected in the family Papaveracea in the species S. canadensis and G. flavum. In both cases the there is evidence of the upstream metabolism required for the biosynthesis of benzo[c]phenanthridine alkaloids. S. canadensis and G. flavum both produce protopine, which is upstream of sanguinarine, and allocryptopine, which is upstream of chelerythrine (Beaudoin and Facchini

2013; Takao, Kamigauchi, and Okada 1983).

4.4.5 Aporphine alkaloids

The fragmentation of aporphine alkaloids has been well studied and fragmentation schemes for their dissociation have been suggested (Schmidt et al. 2007; Stévigny et al. 2004;

Wu and Huang 2006). The aporphine alkaloids fragmented in this study share certain structural characteristics which lead to similar fragmentation patterns. Boldine, isocorydine and glaucine all contain methylated amino groups, therefore all parent ions loose -CH2NH2 (loss of 31 Da).

+ Subsequent losses from [M+H-RNH2] are dependant on the substitution patterns found on the aromatic rings and are commonly losses of CH3OH (31 Da), CO (28 Da) or radical losses of -

. . CH3 (15 Da) of -OCH3 (31 Da). For example, in the case of isocorydine, m/z 342, the first loss

+ is of the –CH2NH2 creating [M+H-RNH2] at m/z 311. From this point the fragmentation route

. appears to split, one route involves the loss of two -CH3 creating ions at m/z 296 and 281.

Alternatively, m/z 311 can lose –CH3OH to form m/z 279. The m/z 279 ion then looses, -CO, -

. . OCH3 and -CH3 to make ions m/z 251, 248 and 264 respectively. The ion m/z 264 is further fragmented in the same manner as described above to complete the mass spectrum.

Aporphine alkaloids are found in the families Papaveraceae, Ranunculaceae and

Berberidaceae. Among the family Papavercareae, boldine is found in P. bracteatum and G.

flavum. Isocorydine and Glaucine are also found in G. flavum. Only one aporphine, boldine, was found in the family Ranunculaceae in the species H. canadensis. From the family

Berberidaceae, two species contained aporphines. Isocorydine was detected in M. aquifolium, while in N. domestica, boldine and isocorydine were detected. No aporphines were detected in the family Menispermaceae.

Aporphine metabolism is poorly understood and much of what is known comes from tracer studies and suggests glaucine is ultimately derived from reticuline in three steps.

Although the order is unknown, an oxidation forming the aporphine bridge between carbon 8 of the isoquinoloine moiety and the 5’ carbon of the benzyl moiety is required, in addition to two

O-methylation steps (Bhakuni and Jain 1988). The fully O-methylated glaucine is of considerable interest because at some point in its biosynthesis it was methylated at what is equivalent to the 3’ position of the simple BIA backbone suggesting the existance of an enzyme with 3’-O-methyltransferase activity.

4.4.6 Morphians

The fragmentation patterns of morphinans have been described in the literature to some extent (Raith et al. 2003; Schmidt et al. 2005). In most cases, the morphinan parent ion loses an

+ ion at m/z 58 corresponding to the CH3 CHNHCH3 which is derived from the N-methyl group of the alkaloid. Through the same process the parent ion can also lose 57 Da which produces an ion, in the case of thebaine, at m/z 255. Further fragmentation of the thebaine derived ion, m/z

255, produces a loss of 32 Da, –CH3OH, which creates and ion with m/z 223. The ion m/z 223 looses 28 Da, -CO, to make an ion at m/z 195 which subsequently looses –H20, 18 Da, to produce an ion with m/z 177. Variations of this fragmentation pattern for different morphinan

100

species like codeine or morphine are largely due to differing oxidation states of the alcohol groups found on the compounds.

Morphinan alkaloids are not widespread in the plant kingdom and are restricted to the family Papavercacea with the exception of some reports in the family Euphorbiaceae (Beaudoin and Facchini 2014; Theuns et al. 1986). In this study, the only morphinan detected was thebaine in P. bracteatum. The identification of thebaine in P. bracteatum coroborates previous reports which have detected thebaine in P. bracteatum (Ziegler et al. 2009). The presence of thebaine in

P. bracteatum suggest the presence of upstream morphinan metabolites and the genes responsible for its biosynthesis. Based on what we know of morphinan biosynthesis it is likely that the morphinans salutaridinol and salutaridine are made in P. brateatum as well as the simple

BIA (R)-reticuline.

4.3.6. Limitations of targetted alkaloid profiling

As with any technique, the LC-MS/MS approach used in this study presents certain limitations. Targeted alkaloid profiling by LC-MS/MS is only capable of identifying alkaloids for which a standard is available (Katajamaa and Oresic 2007). Often in the case of secondary metabolites, chemical standards are difficult to synthesize and/or are incredibly expensive which often becomes a limiting factor in the identification of alkaloids from a given sample. The scarcity of chemcial standards also presents issues with quantification, in that generating standard curves can become prohibitively expensive. Other techniques, such as NMR, are capable of identifying chemicals without the use of a standard. Despite this obvious strength of

NMR as a technique for metabolite identification, it suffers from a lack of sensitivity when compared to mass spectrometry based techniques (Verpoorte et al. 2008). In many cases the

101

concentration of secondary metabolites in planta are below the limit of detection for most NMR instruments.

As with most metabolomic initiatives, other methodological decisions and limitations have no doubt effected the results of this study. One such area of concern in this study revolves around harvesting of the plants or cell cultures. Firstly, most of the plants use in this analysis were grown under a wide variety of conditions. Due to the narrow distribution of some of these plants in nature and in greenhouses across Canada we had very little control to ensure that the plants were grown under uniform conditions. It is entirely possible that variations in growing conditions resulted in changes to the alkaloid profile of the plants analyzed in this study (Kim and Verpoorte 2010). In addition to the growing conditions, many plants exhibit diurnal changes in primary metabolites as well as secondary metabolites levels (Urbanczyk-Wochniak et al.

2005). Due to limited access to the plants studied in this work, diurnal effects could not be controlled for. Plants were snap frozen in liquid nitrogen immediately following their harvesting to limit oxidation of metabolites, enzymatic reactions and plant wounding responses. The possibility also exists that analyzing a single tissue type from each plant resulted in false negatives in the analysis. It is well established that BIAs are biosynthesized in a tissue specific manner (Facchini et al. 2007). The reach of this study could have been extended by analyzing different tissue types for each plant. At least two studies in the literature examine the alkaloids of H. canadensis and support the possibility that there are differences in the alkaloid profiles of tissues from H. canadensis (Le, Mccooeye, and Windust 2012; Le, Mccooeye, and Windust

2014). Both of the aforementioned studies extracted alkaloids from root compared to this study in which we analyzed rhizome. Although many of the same alkaloids were detected in both sets

102

of studies, root tissue appears to contain some additional alkaloids such as, hydrastine and berberine.

Only cell cultures were available for three out of four species in the Menispermaceae family. As a result we were limited to using plant cell culture in some cases. In opium poppy there is a distinction between the alkaloid profiles of tissues harvested from the plant and cell culture and in most studies alkaloid production is induced using a fungal elicitor. Therefore the absence of detectable alkaloids in the family Menisperaceae could be the result of low basal alkaloid levels in callus versus normal plant tissues.

Extraction of alkaloids from the plant matrix can also introduce error into experiments.

Although we chose a solvent system with hydrophillic and hydrophobic properties, it is probable that we introduced extraction bias to our results. Added to the issue of using a single solvent system for extraction is that the extraction of alkaloids from the biological matrix does not adhere to the basic principles of chemical solvation because the mechanisms of metabolite extractions from biological samples can be influenced by interactions with the chemical milieu of the plant (Kim and Verpoorte 2010). In this study a range of different tissues from different plants were analyzed each with its own biological matrix. In an attempt to improve our extraction efficiency from distinct biological matrices all plant tissues were ground with a tissue lyser and sonicated during the extraction process. Due to cost restraints, solid-phase extraction

(SPE) a method often used in MS based metabolomic initiatives, was not used. SPE often works to remove compounds that may interfere with analysis, such as, salts which dampen MS signals

(Kim and Verpoorte 2010). It is possible that in some samples there were compounds present that interfered with the analysis but without specific comparative studies is impossible to be sure to what degree other compounds may have effected the results of this study.

103

Following harvesting other considerations can effect the outcome of targeted alkaloid profiles. The differences in ionization of different chemical species is well established and in my personal experience I have noticed a difference in the ionization of simple BIAs compared to other BIA alkaloid subclasses. In this study we used a mobile phase A comprised of ammonium acetate and acetonitrile and it seems to reduce the signal of simple BIAs relative to the formic acid mobile phase used for the enzyme assay analysis. Perhaps our choice of mobile phase had the effect of reducing the signals of reticuline below the limit of detection in the plants samples.

4.4 Conclusions

Conclusions drawn in the targeted metabolic snapshot discussed in this chapter must be drawn with care and the dynamic nature of the biological systems studied must be considered.

The targeted alkaloids profiling of 20 plants species that produce BIAs was able to identify several alkaloids in all the families studied except Menispermaceae. The absence of detected alkaloids by no means implies that it is impossible for a given plant to produce a given alkaloid, this is due to the limitations in the collection of standards used, that only a single tissue type was collected from each plant at a single time point in addition to other methodological decisions.

104

CHAPTER FIVE: DISCUSSION

5.1 Overview

A biochemical transcriptomics approach has been employed to isolate and functionally characterize a novel gene involved in BIA biosynthesis. The isolation and functionally characterization of protoberberine 2OMT to provides insight into the chemical diversity of BIAs and into the evolution of BIA biosynthesis. Gene candidate mining in Roche 454 and Illumina

NGS transcriptomic libraries of opium poppy stem and root tissue using sequence similarity and high levels of expression, inferred by the FPKM value of each gene, yielded 10 unique OMT gene candidates. Genes were synthesized or amplified from cDNA, heterologously expressed in

E. coli and purified by cobalt-affinity chromatography. The biochemical characterization of one synthesized gene candidate, sharing considerable sequence similarity with opium poppy reticuline 7OMT, demonstrated O-methylation activity and was named protoberberine 2OMT.

2OMT catalyzed the SAM-dependant 2-O-methylation of protoberberine alkaloids and the 7-O- methylation of simple BIAs. The accumulation of 2OMT transcripts in root agreed with the

FPKM values obtained from the Illumina NGS stem and root databases. The ability of 2OMT to catalyze the 2-O-methylation of cheilanthifoline and it’s presence in roots suggest that 2OMT may be involved with cryptopine and rhoeadine alkaloids metabolism.

Alkaloids were extracted from plant tissues and analyzed using LC-MS/MS to generate targeted alkaloid profiles for 20 different BIA producing species. The plants used in this study were selected from four different families, Papaveracea, Ranunculaceae, Berberidaceae and

Menispermaceae. A specific tissue type was selected from each plant species and at a single time point. Alkaloids in the plant extracts were identified by matching their retention times and

CID patterns to the retention times and CID patterns of 23 BIA authentic standards. Ultimately

105

the targeted alkaloid profiling described in this study will be combined with high resolution

FTICR-MS data and with NGS data for each plant as part of the Genome Canada PhytoMetaSyn

Project (Facchini et al. 2012; Xiao et al. 2013).

In this chapter, the significance and implications of the result of this study will be discussed and directions for future research are suggest.

5.2 Future directions

5.2.1 Further characterization of 2OMT

There are several additional experiments that may help to establish the in vivo role of

2OMT. To begin, the amplification of 2OMT by PCR from root tissue would add support to

2OMT being an enzyme relevant to BIA metabolism. Perhaps the reason we could not isolate the gene from root tissue was due to the developmental stage of the plant. Future attempts to isolate 2OMT could be carried out at distinct developmental points to increase the chance of isolating a full length gene.

To increase our understanding of the substrate specificity and methylation sites of 2OMT, it should be tested with a broader suite of substrates. Assaying 2OMT with the simple BIAs orientaline, protosinomenine and isoorientalinen would help determine if 2OMT shares the ability of 7OMT to methylate at different sites on the BIA backbone. Assaying 2OMT with tetrahydrocolumbamine and other protoberberine could also help determine the regiospecificity of 2OMT. NMR should be employed to definitively identify the enzymatic products in the absence of chemical standards.

Due to the limited availability of cheilanthifoline, the kinetic properties of 2OMT for cheilanthifoline could not be determined experimentally. To add support to the idea that 2OMT

106

is involved in the biosynthesis of cryptopine and ultimately rhoeadine alkaloids it will be crucial to determine the catalytic parameters of 2OMT for cheilanthifoline.

To determine the role of 2OMT in vivo, VIGS should be conducted. Changes in 2OMT transcript abundance can be monitored by qPCR and changes in the alkaloid profile can be determined by LC-MS/MS. If indeed 2OMT is involved in the biosynthesis of cryptopine, the reduction of 2OMT transcript abundance should lead to increased levels of upstream alkaloids such as scoulerine and cheilanthifoline along with a reduction of downstream alkaloids such as sinactine, cryptopine and rhoeadine alkaloids, like N-methylporphyroxine and glaudine, which have been suggested to the downstream products of sinactine (Farrow and Facchini 2013). It would also be interesting to see if the silencing of 2OMT results in a significant increase in the abundance of simple BIAs.

5.2.2 Future targeted metabolite profiling

Future targeted metabolite profiling could add value and information to the metabolic picture described in this study. Expanding the catalogue of BIA standards would allow us to increase the number of alkaloids annotated in any given LC-MS based study. Additionally, it would be valuable to develop an understanding the effect of developmental stage on alkaloid production. Time course experiments that would allow us to extract alkaloids from distinct developmental stages would increase our understanding of what each plant makes, when it makes it and allow us to optimize the isolation specific biosynthetic genes based on the abundance of related alkaloids in a given developmental stage. For example, if a certain developmental stages shows high abundance of a certain alkaloid , it is plausible there would higher transcript abundance of genes involved in the production of that alkaloid.

107

Additional characterization of the existing samples by an alternate analytical method could provide an interesting comparative analysis of the benefits of using one analytical method over another. For example, analysis of the same samples using an LTQ Orbitrap could provide a large increase in resolution, increased mass accuracy and increased dynamic range and could thus provide a deeper metabolite analysis when compared to the QqQ approach used in this study

(Hu et al. 2005).

5.2.3 Using the targeted alkaloid profiles of twenty BIA producing plants in conjunction with

NGS

Care must be taken when drawing conclusions from any metabolomic initiative. In essence, the targeted alkaloid profiling of twenty BIA producing plants represents a metabolic snap shot of a single plant tissue at a single developmental time point. The presence of a given alkaloid only indicates that a given alkaloid was presence at that time in the plant, while the absence only means that the alkaloid could not be detected at that time in the plant. Absence does not mean that the plant cannot make an alkaloid that was not detected. However, with that being said, the presence of a certain alkaloid in a given plant implies the existence of the metabolic machinery required to form that alkaloid.

For example, the presence of the alkaloid sanguinarine in S. canadensis implies the existence of the enzymes responsible for sanguinarine biosynthesis. One would expect to find in the NGS transcriptomic databases for S. canadensis (Xiao et al. 2013), contigs orthologous to the opium poppy enzymes, TNMT, MSH, P6H, and DBOX.

Provided the similar orientation of the benzyl moeity in both glaucine and boldine it is possible the same oxidative enzyme is responsible for the formation of the aporphine bridge in the biosynthesis of both compounds. The combination of the targeted alkaloid profile described

108

in this study could be used in conjunction with NGS transcriptomic data to find the unknown oxidative enzyme involved in forming the aporphine bridge in glaucin and boldine. Recently, a

P450 was isolated from C. japonica cell culture that catalyzes the formation of corytuberine, an aporphine, from reticuline (Ikezawa, Iwasa, and Sato 2008). CYP80G2, as it is known, introduces a C-C bond between carbon 8 of the isoquinoline moiety and the 2’ carbon of the benzyl moeity of reticuline. The result is a distinct orientation of the benzyl moeity in corytuberine compared to to glaucine and isocorydine which have the aporphine bridge between

C8 and C5’. CYP80G2 was not reported to form the aporphine bridge between C8 and C5’ suggesting the possibility that the oxidative enzyme involved in the formation of glaucine and isocorydine is different. Of course it is also a possible that the substrate specificity and binding pocket of CYP80G2 is different in other species allowing it to catalyze the different aporphine isoforms. This question could be answered by comparing the alkaloid profiles and transcriptomic databases of plants that make aporphines. For example, boldine could be detected in many plants examined in this study, P. bracteatum, G. flavum, H. canadensis, and N. domestica. Boldine shares the same C8 C2’ aporphine bridge as corytuberine. Aporphines containing the C8 and C5’ aporphine bridge (isocorydine and glaucine) were only detected in P. bracteatum, M. aquifolium, and N. domestica. If one is looking for the oxidative enzyme responsible for the formation of the aporphine bridge between C8 and C5’, CYP80G2 could be used as a BLAST query sequence to search for similar P450s. All the P450 with a certain degree of sequence similarity from each aporphine producing species could be compiled in a list and analyzed in a phylogenetic tree. Amino acid sequences that share a high degree of similarity with CYP80G2 would cluster close together and would likely not be responsible for the formation of the aporphine bridge between C8 and C5’. Putative P450 amino acid sequences on

109

the tree that cluster away from CYP80G2 and are not found in the species that produce boldine exclusively but are present in species that produce isocorydine or glaucine would consititute high quality gene candidates. The genes could then be isolated from the plant, heterologously expressed and enzymatically characterized to confirm their function.

Future work could use G. flavum as a model species to isolate a molecular clone encoding for a 3’-O-methyltranferase. A similar methodology as described above could be employed to find a 3’OMT. G. flavum contains the aporphine alkaloid glaucine, which is O-methylated at

C3’-position of the simple BIA backbone. In the NGS transcriptomic database of G. flavum, one would expect to find a gene with 3’-O-methylation activity. By comparing the lists of candidate

OMTs from G. flavum and a plant that does not appear to produce 3’-O-methylated compounds like E. californica, it would be possible to reduce the number of possible 3’OMT candidates by eliminating genes annotated as OMTs present in both G. flavum and E. californica.

As described in Chapter Four, the presence of thebaine in P. bracteatum suggest the presence of upstream morphinan metabolites and the genes responsible for its biosynthesis.

Based on what we know of morphinan biosynthesis it is likely that the downstream morphinans salutaridinol and salutaridine are made in P. brateatum. Similarily, (R)-reticuline would also be expected and the enzyme(s) responsible for the epimerization of (S)-reticuline to (R)-reticuline should be present. At this times, the genes involved in the epimerization of reticuline are unknown, however an enzyme thought to be involved in the epimerization of reticuline, 1,2- dehydroreticuline reductase (DRR) has been purified and partially characterized from opium poppy (Beaudoin and Facchini 2014; De-Eknamkul and Zenk 1992). The search for candidate genes encoding enzymes involved in the epimerization of reticuline could be narrowed by a comparative transcriptomic analysis grouping opium poppy plants with P. bracteatum and

110

comparing them to the transcriptoms of another species from the family Papveracea that does not produce morphinan alkaloids such as S. diphyllum or S. canadensis. Uncharacterized genes annotated as reductive enzymes and oxidative enzymes found in opium poppy and P. bracteatum but not in S. diphyllum or S. canadensis would be strong gene candidates for genes.

Certainly these targeted alkaloid profiles could also be used to find 2OMT orthologs in other BIA producing species. Assuming, 2OMT is involved in cryptopine metabolism one could find plants which produce cryptopine, like S. canadensis and expect to find 2OMT homologs.

This could be achieved by searching for a 2OMT in the S. canadensis NGS trancriptomic database using the opium poppy 2OMT sequence as a query. The list of candidate genes generated would be a targeted list and likely to contain a 2OMT ortholog.

111

REFERENCES

Altschup, Stephen F, Warren Gish, The Pennsylvania, and Universily Park. 1990. “Basic Local Alignment Search Tool 2Department of Computer Science.” Journal of molecular biology 215 (3): 403-410. doi:10.1016/S0022-2836(05)80360-2.

Ashihara, Hiroshi, Hiroshi Sano, and Alan Crozier. 2008. “Caffeine and related purine alkaloids : Biosynthesis , catabolism , function and genetic engineering.” Phytochemistry 69 (4): 841- 856. doi:10.1016/j.phytochem.2007.10.029.

Attia, Mohamed, Soo-un Kim, and Dae-kyun Ro. 2012. “Molecular cloning and characterization of (+)-epi-[alpha]-bisabolol synthase, catalyzing the first step in the biosynthesis of the natural sweetener, hernandulcin, in Lippia dulcis.” Archives of Biochemistry and Biophysics 527 (1): 37-44. doi:10.1016/j.abb.2012.07.010. http://dx.doi.org/10.1016/j.abb.2012.07.010.

Beaudoin, Guillaume A W, and Peter J Facchini. 2013. “Biochemical and Biophysical Research Communications Isolation and characterization of a cDNA encoding (S) -cis-N- methylstylopine 14-hydroxylase from opium poppy , a key enzyme in sanguinarine biosynthesis.” Biochemical and Biophysical Research Communications 431 (3): 597-603. doi:10.1016/j.bbrc.2012.12.129. http://dx.doi.org/10.1016/j.bbrc.2012.12.129.

———. 2014. “Benzylisoquinoline alkaloid biosynthesis in opium poppy.” Planta (240): 19-32. doi:10.1007/s00425-014-2056-8.

Bhakuni, Dewan, and Sudha Jain. 1988. “The Biosynthesis of Glaucine in Litsea glutinosa.” Journal of the Chemical Society 1 (8): 1447-1449. doi:10.1039/P19880001447.

Brochmann-Hanssen, Einar, Chung-Hsiung Chen, Rolland C. Chen, Hsuch-Ching Chiang, Albert Y. Leung, and Kenneth McMurtrey. 1975. “The Biosynthesis of 1 - Benzylisoquinolines in Papaver somniferum. Preferred and Secondary Pathways; Stereo- chemical Aspects.” The Journal of the Chemical Society, Perkin Transactions 1 (16The Biosynthesis of 1 -Benzylisoquinolines in Papaver somniferum. Preferred and Secondary Pathways ; Stereo- chemical Aspects): 1531-1537. doi:10.1039/P19750001531.

Butler, Mark S. 2008. “Natural products to drugs : natural product-derived compounds in clinical trials.” Natural Product Reports 25 (3): 475-516. doi:10.1039/b514294f.

Cairney, John, Jeff Puryear, and Shujun Chang. 1993. “A Simple and Efficient Method for Isolating RNA from Pine Trees.” Plant Molecular Biology Reporter 11 (2): 113-116.

Chen, Xue, and Peter J Facchini. 2014. “Short-chain dehydrogenase / reductase catalyzing the final step of noscapine biosynthesis is localized to laticifers in opium poppy.” The Plant Journal 450 (2): 173-184. doi:10.1111/tpj.12379.

112

Chenna, Ramu, Hideaki Sugawara, Tadashi Koike, Rodrigo Lopez, Toby J Gibson, Desmond G Higgins, and Julie D Thompson. 2003. “Multiple sequence alignment with the Clustal series of programs.” Nucleic Acids Research 31 (13): 3497-3500. doi:10.1093/nar/gkg500.

Chintalwar, G J, S Gupta, G Roja, and V A Bapat. 2003. “Protoberberine Alkaloids From Callus and Cell Suspension Cultures of Tinospora cordifolia.” Pharmaceutical biology 41 (2): 81- 86. doi:1388-0209/03/4102-08.

Choi, KB, Takashi Morishige, and Fumihiko Sato. 2001. “Purification and characterization of coclaurine N-methyltransferase from cultured Coptis japonica cells.” Phytochemistry 56: 649-655. http://www.sciencedirect.com/science/article/pii/S0031942200004817.

Dang, Thu-Thuy T, and Peter J Facchini. 2012. “Characterization of three O-methyltransferases involved in noscapine biosynthesis in opium poppy.” Plant physiology 159 (2) (June): 618- 31. doi:10.1104/pp.112.194886. http://www.ncbi.nlm.nih.gov/pubmed/22535422.

Dang, Thuy, and Peter J. Facchini. 2014. “CYP82Y1 Is N-Methylcanadine 1-Hydroxylase, a Key Noscapine Biosynthetic Enzyme in Opium Poppy.” The Journal of biological chemistry 289 (4): 2013-2026. doi:10.1074/jbc.M113.505099.

De-Eknamkul, Wanchai, and Meinhart H. Zenk. 1992. “PURIFICATION AND PROPERTIES OF 1,2-DEHYDRORETICULINE REDUCTASE FROM PAPAVER SOMNIFERUM SEEDLINGS.” Phytochemistry 31 (3): 813-821. doi:10.1016/0031-9422(92)80020-F.

Desgagné-Penix, Isabel, and Peter J Facchini. 2012. “Systematic silencing of benzylisoquinoline alkaloid biosynthetic genes reveals the major route to papaverine in opium poppy.” The Plant Journal 72 (2): 331-344. doi:10.1111/j.1365-313X.2012.05084.x.

Desgagné-Penix, Isabel, Scott C Farrow, Dustin Cram, Jacek Nowak, and Peter J Facchini. 2012. “Integration of deep transcript and targeted metabolite profiles for eight cultivars of opium poppy.” Plant molecular biology 79 (3) (June): 295-313. doi:10.1007/s11103-012-9913-2. http://www.ncbi.nlm.nih.gov/pubmed/22527754.

Dethier, Monique, and Vincenzo De Luca. 1993. “PARTIAL PURIFICATION OF AN N- METHYLTRANSFERASE INVOLVED IN VINDOLINE BIOSYNTHESIS IN CATHARANTHUS.” Phytochemistry 32 (3): 673-678.

Dewick, P.M. 2009. Medicinal natural products : a biosynthetic approach. 3rd ed. Chichester, U.K.: Wiley.

Diaz Chavez, Maria Luisa, Megan Rolf, Andreas Gesell, and Toni M Kutchan. 2011. “Characterization of two methylenedioxy bridge-forming cytochrome P450-dependent enzymes of alkaloid formation in the Mexican prickly poppy Argemone mexicana q.” Archives of Biochemistry and Biophysics 507 (1): 186-193. doi:10.1016/j.abb.2010.11.016.

113

Dittrich, Heinz, and Toni M Kutchan. 1991. “Molecular cloning , expression , and induction of berberine bridge enzyme , an enzyme essential to the formation of benzophenanthridine alkaloids in the response of plants to pathogenic attack.” Proceedings of the National Academy of Sciences of the United States of America 88 (22): 9969-9973.

Dixon, Richard A. 2001. “Natural products and plant disease resistance.” Nature 411 (June): 843-847.

Docimo, Teresa, Michael Reichelt, Bernd Schneider, and John C D Auria. 2012. “The first step in the biosynthesis of cocaine in Erythroxylum coca : the characterization of arginine and ornithine decarboxylases.” Plant molecular biology 78 (6): 599-615. doi:10.1007/s11103- 012-9886-1.

Fabre, N, C Claparols, S Richelme, M L Angelin, I Fourasté, and C Moulis. 2000. “Direct characterization of isoquinoline alkaloids in a crude plant extract by ion-pair liquid chromatography-electrospray ionization tandem mass spectrometry: example of Eschscholtzia californica.” Journal of chromatography. A 904 (1) (December 22): 35-46. http://www.ncbi.nlm.nih.gov/pubmed/11209899.

Facchini, Peter J, Joerg Bohlmann, Patrick S Covello, Vincenzo De Luca, Radhakrishnan Mahadevan, Jonathan E Page, Dae-Kyun Ro, Christoph W Sensen, Reginald Storms, and Vincent J J Martin. 2012. “Synthetic biosystems for the production of high-value plant metabolites.” Trends in biotechnology 30 (3) (March): 127-31. doi:10.1016/j.tibtech.2011.10.001. http://www.ncbi.nlm.nih.gov/pubmed/22209518.

Facchini, Peter J., Jillian M. Hagel, David K. Liscombe, Natalia Loukanina, Benjamin P. MacLeod, Nailish Samanani, and Katherine G. Zulak. 2007. “Opium poppy: blueprint for an alkaloid factory.” Phytochemistry Reviews 6 (1) (March 1): 97-124. doi:10.1007/s11101- 006-9042-0. http://www.springerlink.com/index/10.1007/s11101-006-9042-0.

Facchini, Peter J., and Vincenzo De Luca. 1994. “Differential and Tissue-specific Expression of a Gene Family for Tyrosine/Dopa Decarboxylase in Opium Poppy.” The Journal of biological chemistry 269 (43): 26684-26690.

Facchini, Peter J., and Sang-Un Park. 2003. “Developmental and inducible accumulation of gene transcripts involved in alkaloid biosynthesis in opium poppy.” Phytochemistry 64 (1) (September): 177-186. doi:10.1016/S0031-9422(03)00292-9. http://linkinghub.elsevier.com/retrieve/pii/S0031942203002929.

Facchini, Peter J. and DeLuca, Vincenzo. 2008. “Opium poppy and Madagascar periwinkle : model non-model systems to investigate alkaloid biosynthesis in plants.” The Plant Journal 54 (4): 763-784. doi:10.1111/j.1365-313X.2008.03438.x.

114

Fahey, Jed W, Amy T Zalcmann, and Paul Talalay. 2001. “The chemical diversity and distribution of glucosinolates and isothiocyanates among plants.” Phytochemistry 56 (1): 5- 51. doi:10.1016/S0031-9422(00)00316-2.

Farrow, Scott C, and Peter J Facchini. 2013. “O , O-Demethylenation with Widespread Roles in Benzylisoquinoline Alkaloid Metabolism in Opium Poppy * □.” The Journal of biological chemistry 288 (40): 28997-29012. doi:10.1074/jbc.M113.488585.

Farrow, Scott C, Jillian M Hagel, and Peter J Facchini. 2012. “Transcript and metabolite profiling in cell cultures of 18 plant species that produce benzylisoquinoline alkaloids.” Phytochemistry 77 (March 14): 79-88. doi:10.1016/j.phytochem.2012.02.014. http://www.ncbi.nlm.nih.gov/pubmed/22424601.

Ferrer, J, M B Austin, C Stewart Jr, and J P Noel. 2008. “Structure and function of enzymes involved in the biosynthesis of phenylpropanoids.” Plant Physiol Biochem. 46 (3): 356-370.

Fisinger U, Grobe N, Zenk MH (2007). 2007. “Thebaine synthase: a new enzyme in the morphine pathway in P. somniferum.” Natural Product Communications 2: 249–253.

Fraenkel, Gottfried S. 1959. “The Raison d ’Etre of Secondary Plant Substances.” Science 129 (3361): 1466-1470.

Frenzel, Thomas, and Meinhart H. Zenk. 1990. “S-ADENOSYL-L-METHIONINE : 3’-hydroxy- N-methyl-(S)-coclaurine-4'-O-methyl TRANSFERASE , A REGIO- AND STEREOSELECTIVE ENZYME OF THE ( S ) -RETICULINE PATHWAY.” Phytochemistry 29 (11): 3505-3511.

Frick, S, and T M Kutchan. 1999. “Molecular cloning and functional expression of O- methyltransferases common to isoquinoline alkaloid and phenylpropanoid biosynthesis.” The Plant journal : for cell and molecular biology 17 (4) (March): 329-39. http://www.ncbi.nlm.nih.gov/pubmed/10205892.

Frick, Susanne, Robert Kramell, Anthony J Fist, and Toni M Kutchan. 2005. “Comparative Qualitative and Quantitative Determination of Alkaloids in Narcotic and Condiment Papaver somniferum Cultivars.” Journal of natural products 63 (2): 666-673. doi:10.1021/np0496643.

Gesell, Andreas, Megan Rolf, Jörg Ziegler, María Luisa, Díaz Chávez, Fong-chin Huang, Toni M Kutchan, Andreas Gesell, Megan Rolf, and Toni M Kutchan. 2009. “CYP719B1 Is Salutaridine Synthase , the C-C Phenol-coupling Enzyme of Morphine Biosynthesis in Opium Poppy * □.” The Journal of biological chemistry 284 (36): 24432-24442. doi:10.1074/jbc.M109.033373.

Goossens, Alain, and Heiko Rischer. 2007. “Implementation of functional genomics for gene discovery in alkaloid producing plants.” Phytochemistry Reviews 6 (1) (February 27): 35-

115

49. doi:10.1007/s11101-006-9018-0. http://www.springerlink.com/index/10.1007/s11101- 006-9018-0.

Griffin, William J, and G David Lin. 2000. “Chemotaxonomy and geographical distribution of tropane alkaloids.” Phytochemistry 53 (6): 623-637.

Grothe, Torsten, Rainer Lenz, M Toni, J Biol Chem, Torsten Grothe, Rainer Lenz, and Toni M Kutchan. 2001. “Molecular Characterization of the Salutaridinol 7- O -Acetyltransferase Involved in Morphine Biosynthesis in Opium Poppy Papaver somniferum.” The Journal of biological chemistry 276 (33): 30717-300723. doi:10.1074/jbc.M102688200.

Hagel, Jillian M, Guillaume A W Beaudoin, Elena Fossati, Andrew Ekins, J J Vincent, Peter J Facchini, Jillian M Hagel, et al. 2012. “Characterization of a Flavoprotein Oxidase from Opium Poppy Catalyzing the Final Steps in Sanguinarine and.” The Journal of biological chemistry 287 (51): 42972-42983. doi:10.1074/jbc.M112.420414.

Hagel, Jillian M, and Peter J Facchini. 2010. “Dioxygenases catalyze the O-demethylation steps of morphine biosynthesis in opium poppy.” Nature chemical biology 6 (4) (April): 273-5. doi:10.1038/nchembio.317. http://www.ncbi.nlm.nih.gov/pubmed/20228795.

———. 2013. “Benzylisoquinoline Alkaloid Metabolism : A Century of Discovery and a Brave New World Special Focus Issue – Review.” Plant & cell physiology 54 (5): 647-672. doi:10.1093/pcp/pct020.

Han, Xu, Marc Lamshöft, Nadja Grobe, Xuan Ren, Anthony J Fist, Toni M Kutchan, Michael Spiteller, and Meinhart H Zenk. 2010. “The biosynthesis of papaverine proceeds via (S)- reticuline.” Phytochemistry 71 (11-12) (August): 1305-12. doi:10.1016/j.phytochem.2010.04.022. http://www.pubmedcentral.nih.gov/articlerender.fcgi?artid=2900451&tool=pmcentrez&ren dertype=abstract.

Hartmann, Thomas. 2007. “From waste products to ecochemicals : Fifty years research of plant secondary metabolism.” Phytochemistry 68 (1): 2831-2846. doi:10.1016/j.phytochem.2007.09.017.

Haslam, E. 1986. “Secondary Metabolism - Fact and Fiction.” Natural Product Reports 3 (1): 217-249. doi:10.1039/NP9860300217.

Hawkins, Kristy M, and Christina D Smolke. 2008. “Production of benzylisoquinoline alkaloids in Saccharomyces cerevisiae.” Nature chemical biology 4 (9) (September): 564-73. doi:10.1038/nchembio.105. http://www.pubmedcentral.nih.gov/articlerender.fcgi?artid=2830865&tool=pmcentrez&ren dertype=abstract.

116

Hirata, Kazumasa, Chotima Poeaknapo, Juergen Schmidt, and Meinhart H Zenk. 2004. “1,2- Dehydroreticuline synthase, the branch point enzyme opening the morphinan biosynthetic pathway.” Phytochemistry 65 (8): 1039-1046. doi:10.1016/j.phytochem.2004.02.015.

Hook, Ingrid, Helen Sheridan, and Graham Wilson. 1988. “ALKALOIDS OF CELL CULTURES DERIVED.” Phytochemistry 27 (7): 2137-2141. doi:0031-9422/88.

Hu, Qizhi, Robert J Noll, Hongyan Li, Alexander Makarov, Mark Hardman, and R Graham Cooks. 2005. “The Orbitrap: a new mass spectrometer.” Journal of mass spectrometry : JMS 40 (4) (April): 430-43. doi:10.1002/jms.856. http://www.ncbi.nlm.nih.gov/pubmed/15838939.

Ikezawa, Nobuhiro, Kinuko Iwasa, and Fumihiko Sato. 2007. “Molecular cloning and characterization of methylenedioxy bridge-forming enzymes involved in stylopine biosynthesis in Eschscholzia californica.” FEBS Journal 274 (4): 1019-1035. doi:10.1111/j.1742-4658.2007.05652.x.

———. 2008. “Molecular Cloning and Characterization of CYP80G2, a Cytochrome P450 That Catalyzes an Intramolecular C – C Phenol Coupling of (S)-Reticuline in Magnoflorine Biosynthesis , from Cultured Coptis japonica Cells.” The Journal of biological chemistry 283 (14): 8810-8821. doi:10.1074/jbc.M705082200.

Ikezawa, Nobuhiro, Masaru Tanaka, Raku Shinkyo, Toshiyuki Sakaki, Kuniyo Inouye, and Fumihiko Sato. 2003. “Metabolism and Bioenergetics : Molecular Cloning and Characterization of Enzyme That Belongs to a Novel P450 Family , from cultured Coptis japonica Cells Molecular Cloning and Characterization of CYP719 , a Methylenedioxy Bridge-forming Enzyme That Belong.” The Journal of biological chemistry 278 (40): 38557-38565. doi:10.1074/jbc.M302470200.

Ikuta, Akira, and Hideji Itokawa. 1988. “ALKALOIDS OF TISSUE CULTURES OF NANDINA DOMESTICA.” Phytochemistry 27 (7): 2143-2145. doi:003l 9422/88.

Inui, Takayuki, Ken-Ichi Tamura, Nanae Fujii, Takashi Morishige, and Fumihiko Sato. 2007. “Overexpression of Coptis japonica norcoclaurine 6-O-methyltransferase overcomes the rate-limiting step in Benzylisoquinoline alkaloid biosynthesis in cultured Eschscholzia californica.” Plant & cell physiology 48 (2) (February): 252-62. doi:10.1093/pcp/pcl062. http://www.ncbi.nlm.nih.gov/pubmed/17189286.

Iwasa, Kinuko, Teturo Takahashi, Yumi Nishiyama, Masataka Moriyasu, Makiko Sugiura, and Atsuko Takeuchi. 2008. “Online Structural Elucidation of Alkaloids and Other Constituents in Crude Extracts and Cultured Cells of Nandina domestica by Combination of LC-MS / MS , LC-NMR , and LC-CD.” Journal of natural products 71 (8): 1376-1385. doi:10.1021/np8001496.

117

Jirschitzka, Jan, Gregor W Schmidt, Michael Reichelt, Bernd Schneider, and Jonathan Gershenzon. 2012. “Plant tropane alkaloid biosynthesis evolved independently in the Solanaceae and Erythroxylaceae.” Proceedings of the National Academy of Sciences of the United States of America 109 (26): 10304–10309. doi:10.1073/pnas.1200473109.

Jones, Philip, David Binns, Hsin-yu Chang, Matthew Fraser, Weizhong Li, Craig Mcanulla, Hamish Mcwilliam, et al. 2014. “Sequence analysis InterProScan 5 : genome-scale protein function classification.” Bioinformatics: 1-5. doi:10.1093/bioinformatics/btu031.

Jukes, TH, and CR Cantor. 1969. Evolution of Protein Molecules. New York: Academic Press.

Katajamaa, Mikko, and Matej Oresic. 2007. “Data processing for mass spectrometry-based metabolomics.” Journal of chromatography. A 1158 (1-2) (July 27): 318-28. doi:10.1016/j.chroma.2007.04.021. http://www.ncbi.nlm.nih.gov/pubmed/17466315.

Kim, Hye Kyong, and Rob Verpoorte. 2010. “Sample preparation for plant metabolomics.” Phytochemical analysis : PCA 21 (1) (January): 4-13. doi:10.1002/pca.1188. http://www.ncbi.nlm.nih.gov/pubmed/19904733.

Kliebenstein, Daniel J, and Anne Osbourn. 2012. “Making new molecules – evolution of pathways for novel metabolites in plants.” Current opinion in plant biology 15 (4): 415-423. doi:10.1016/j.pbi.2012.05.005. http://dx.doi.org/10.1016/j.pbi.2012.05.005.

Kutchan, T M, N Hampp, F Lottspeich, and M H Zenk. 1988. “The cDNA clone for strictosidine synthase from Rauvolfia and expression in Escherichia coli.” FEBS letters 237 (1-2): 40-44. doi:10.1016/0014-5793(88)80167-4.

Ky, C.-L, J Louarn, S Dussert, B Guyot, S Hamon, and M Noirot. 2001. “Caffeine, trigonelline, chlorogenic acids and sucrose diversity in wild Coffea arabica L. and C. canephora P. accessions.” Food Chemistry 75 (2) (November): 223-230. doi:10.1016/S0308- 8146(01)00204-7. http://linkinghub.elsevier.com/retrieve/pii/S0308814601002047.

Landen, JW, Roland Lang, and SJ McMahon. 2002. “Noscapine Alters Microtubule Dynamics in Living Cells and Inhibits the Progression of Melanoma.” Cancer research 62: 4109-4114. http://cancerres.aacrjournals.org/content/62/14/4109.short.

Le, Phuong Mai, Margaret Mccooeye, and Anthony Windust. 2012. “Characterization of the alkaloids in goldenseal ( Hydrastis canadensis ) root by high resolution Orbitrap LC-MS n.” Analytical and bioanalytical chemistry 405 (13): 4487-4498. doi:10.1007/s00216-012- 6539-9.

———. 2014. “Application of UPLC-QTOF-MS in MS E mode for the rapid and precise identification of alkaloids in goldenseal (Hydrastis canadensis).” Analytical and Bioanalytical Chemistry 406 (6): 1739-1749. doi:10.1007/s00216-013-7558-x.

118

Lee, Eun-Jeong, and Peter J Facchini. 2011. “Tyrosine aminotransferase contributes to benzylisoquinoline alkaloid biosynthesis in opium poppy.” Plant physiology 157 (3) (November): 1067-78. doi:10.1104/pp.111.185512. http://www.ncbi.nlm.nih.gov/pubmed/21949209.

Lenz, Rainer, and Meinhart H. Zenk. 1995. “Acetyl Coenzyme A: Salutaridinol-7-O- Acetyltransferase from Papaver somniferum Plant Cell Cultures.” The Journal of biological chemistry 270 (52): 0-6. doi:10.1074/jbc.270.52.31091.

Li, Yubo, Tiejun Zhnag, Haiyu Xu, and Changxiao Lui. 2010. “Chemical fingerprint analysis of Phellodendri Amurensis Cortex by ultra performance LC / Q-TOF-MS methods combined with chemometrics.” Journal of separation science 33 (21): 3347-3353. doi:10.1002/jssc.201000426.

Liscombe, David K, and Peter J Facchini. 2007. “Molecular Cloning and Characterization of Tetrahydroprotoberberine cis-N-Methyltransferase , an Enzyme Involved in Alkaloid Biosynthesis in Opium Poppy * □.” The Journal of biological chemistry 282 (20): 14741- 14751. doi:10.1074/jbc.M611908200.

———. 2008. “Evolutionary and cellular webs in benzylisoquinoline alkaloid biosynthesis.” Current opinion in biotechnology 19 (2) (April): 173-80. doi:10.1016/j.copbio.2008.02.012. http://www.ncbi.nlm.nih.gov/pubmed/18396034.

Liscombe, David K., Benjamin P. MacLeod, Natalia Loukanina, Owi I. Nandi, and Peter J. Facchini. 2005. “Evidence for the monophyletic evolution of benzylisoquinoline alkaloid biosynthesis in angiosperms.” Phytochemistry 66 (20) (October): 2500-2520. doi:10.1016/j.phytochem.2005.04.044. http://linkinghub.elsevier.com/retrieve/pii/S0031942205004255.

Liscombe, David K., Jörg Ziegler, Jürgen Schmidt, Christian Ammer, and Peter J. Facchini. 2009. “Targeted metabolite and transcript profiling for elucidating enzyme function : isolation of novel N-methyltransferases from three benzylisoquinoline alkaloid-producing species.” The Plant Journal 60 (4): 729-743. doi:10.1111/j.1365-313X.2009.03980.x.

Loeffler, Susanne, Brigitte Deus-Neumann, and Meinhart H. Zenk. 1995. “S-ADENOSYL-L- METHIONINE:(S)-COCLAURINE-N-METHYL- TRANSFERASE FROM TINOSPORA CORDIFOLIA.” Phytochemistry 38 (6): 1387-1395.

Loyola-Vargas, Victor Manuel, Rosa M. Galaz-Avalos, and Roberto Ku-Cauich. 2007. “Catharanthus biosynthetic enzymes : the road ahead.” Phytochemistry Reviews 6 (2-3): 307-339. doi:10.1007/s11101-007-9064-2.

Mccarthy, Andrew A, and James G Mccarthy. 2014. “The Structure of Two N- Methyltransferases from the Caffeine Biosynthetic Pathway.” Plant physiology 144 (2): 879-889. doi:10.1104/pp.106.094854.

119

Minami, Hiromichi, Ju-Sung Kim, Nobuhiro Ikezawa, Tomoya Takemura, Takane Katayama, Hidehiko Kumagai, and Fumihiko Sato. 2008. “Microbial production of plant benzylisoquinoline alkaloids.” Proceedings of the National Academy of Sciences of the United States of America 105 (21) (May 27): 7393-8. doi:10.1073/pnas.0802981105. http://www.pubmedcentral.nih.gov/articlerender.fcgi?artid=2396723&tool=pmcentrez&ren dertype=abstract.

Morishige, T, T Tsujita, Y Yamada, and F Sato. 2000. “Molecular characterization of the S- adenosyl-L-methionine:3’-hydroxy-N-methylcoclaurine 4'-O-methyltransferase involved in isoquinoline alkaloid biosynthesis in Coptis japonica.” The Journal of biological chemistry 275 (30) (July 28): 23398-405. doi:10.1074/jbc.M002439200. http://www.ncbi.nlm.nih.gov/pubmed/10811648.

Morishige, Takashi, Emilyn Dubouzet, Kum-Boo Choi, Kazufumi Yazaki, and Fumihiko Sato. 2002. “Molecular cloning of columbamine O-methyltransferase from cultured Coptis japonica cells.” European Journal of Biochemistry 269 (22) (November 28): 5659-5667. doi:10.1046/j.1432-1033.2002.03275.x. http://doi.wiley.com/10.1046/j.1432- 1033.2002.03275.x.

Nakagawa, Akira, Hiromichi Minami, Ju-Sung Kim, Takashi Koyanagi, Takane Katayama, Fumihiko Sato, and Hidehiko Kumagai. 2011. “A bacterial platform for fermentative production of plant alkaloids.” Nature communications 2 (May) (January): 326. doi:10.1038/ncomms1327. http://www.pubmedcentral.nih.gov/articlerender.fcgi?artid=3112539&tool=pmcentrez&ren dertype=abstract.

Noble, R L. 1990. “The discovery of the vinca alkaloids--chemotherapeutic agents against cancer.” Biochemistry and cell biology = Biochimie et biologie cellulaire 68 (12) (December): 1344-51. http://www.ncbi.nlm.nih.gov/pubmed/2085431.

Ober, D, and T Hartmann. 2000. “Phylogenetic origin of a secondary pathway: the case of pyrrolizidine alkaloids.” Plant molecular biology 44 (4) (November): 445-50. http://www.ncbi.nlm.nih.gov/pubmed/11197320.

Ounaroon, Anan, Gabriele Decker, Jürgen Schmidt, Friedrich Lottspeich, and Toni M. Kutchan. 2003. “( R,S )-Reticuline 7- O -methyltransferase and ( R,S )-norcoclaurine 6- O - methyltransferase of Papaver somniferum - cDNA cloning and characterization of methyl transfer enzymes of alkaloid biosynthesis in opium poppy.” The Plant Journal 36 (6) (December): 808-819. doi:10.1046/j.1365-313X.2003.01928.x. http://doi.wiley.com/10.1046/j.1365-313X.2003.01928.x.

O’Connor, Sarah E, and Justin J Maresh. 2006. “Chemistry and biology of monoterpene indole alkaloid biosynthesis.” Natural Product Reports 4 (23): 532-547. doi:10.1039/b512615k.

120

Pathak, Sumya, Deepika Lakhwani, Parul Gupta, Brij Kishore Mishra, Sudhir Shukla, and Mehar Hasan Asif. 2013. “Comparative Transcriptome Analysis Using High Papaverine Mutant of Papaver somniferum Reveals Pathway and Uncharacterized Steps of Papaverine Biosynthesis.” PloS one 8 (5): e65622. doi:10.1371/journal.pone.0065622.

Pauli, H H, and T M Kutchan. 1998. “Molecular cloning and functional heterologous expression of two alleles encoding (S)-N-methylcoclaurine 3’-hydroxylase (CYP80B1), a new methyl jasmonate-inducible cytochrome P-450-dependent mono-oxygenase of benzylisoquinoline alkaloid biosynthesis.” The Plant journal : for cell and molecular biology 13 (6) (March): 793-801. http://www.ncbi.nlm.nih.gov/pubmed/9681018.

Pichersky, Eran, and David R Gang. 2000. “Genetics and biochemistry of secondary metabolites in plants : an evolutionary perspective.” Trends in plant science 5 (10): 439-445.

Pichersky, Eran, and Jonathan Gershenzon. 2002. “The formation and function of plant volatiles: perfumes for pollinator attraction and defense.” Current opinion in plant biology 5 (3) (June): 237-43. http://www.ncbi.nlm.nih.gov/pubmed/11960742.

Pichersky, Eran, and Efraim Lewinsohn. 2011. “Convergent Evolution in Plant Specialized Metabolism.” Annual review of plant biology 62: 549-566. doi:10.1146/annurev-arplant- 042110-103814.

Pienkny, Silke, Wolfgang Brandt, Jürgen Schmidt, Robert Kramell, and Jörg Ziegler. 2009. “Functional characterization of a novel benzylisoquinoline O-methyltransferase suggests its involvement in papaverine biosynthesis in opium poppy (Papaver somniferum L).” The Plant journal : for cell and molecular biology 60 (1) (October): 56-67. doi:10.1111/j.1365- 313X.2009.03937.x. http://www.ncbi.nlm.nih.gov/pubmed/19500305.

Pyle, Bryan W, Hue T Tran, Benjamin Pickel, Tegan M Haslam, Zhizeng Gao, John C Vederas, Soo-un Kim, and Dae-kyun Ro. 2012. “Enzymatic synthesis of valerena-4,7(11)-diene by a unique sesquiterpene synthase from the valerian plant (Valeriana officinalis).” FEBS Journal 279 (11): 3136-3146. doi:10.1111/j.1742-4658.2012.08692.x.

Raith, Klaus, Reinhard Neubert, Chotima Poeaknapo, Christian Boettcher, Meinhart H Zenk, and Jürgen Schmidt. 2003. “Electrospray tandem mass spectrometric investigations of morphinans.” Journal of the American Society for Mass Spectrometry 14 (11) (November): 1262-9. doi:10.1016/S1044-0305(03)00539-7. http://www.ncbi.nlm.nih.gov/pubmed/14597116.

Ren, Lingling, Xingya Xue, Feifang Zhang, Qing Xu, and Xinmiao Liang. 2007. “High performance liquid chromatography-mass spectrometry analysis of protoberberine alkaloids in medicine herbs.” Journal of separation science 30 (6): 833-842. doi:10.1002/jssc.200600246.

121

Reynolds, Tom. 2005. “Hemlock alkaloids from Socrates to poison aloes.” Phytochemistry 66 (12t) (June): 1399-1406. doi:10.1016/j.phytochem.2005.04.039. http://www.ncbi.nlm.nih.gov/pubmed/15955542.

Ronsch, Hasso. 1972. “Zur Biosynthese der Alkaloide vom Rhoeadin-Typ.” European Journal of Biochemistry 28: 123-126.

Rueffer, M, M Amann, and M H Zenk. 1986. “S-Adenosyl-L-methionine: Columbamine-O- methyl transferase, a compartmentalized enzyme in protoberberine biosynthesis.” Plant cell reports 5 (3): 182-185.

Rueffer, Martina, N. Nagakura, and Meinhart H. Zenk. 1983. “A Highly Specific O- methyltransferase for Nororientaline Synthesis from Argemone platyceras Cell Cultures.” Journal of Medicinal Plant Research 49: 196-198.

Rueffer, Martina, and Meinhart H. Zenk. 1987. “Distant Precursors of Benzylisoquinoline Alkaloids and their Enzymatic Formation.” European Journal of Biosciences 42c: 319-332.

Samanani, Nailish, and Peter J Facchini. 2002. “Purification and characterization of norcoclaurine synthase. The first committed enzyme in benzylisoquinoline alkaloid biosynthesis in plants.” The Journal of biological chemistry 277 (37) (September 13): 33878-83. doi:10.1074/jbc.M203051200. http://www.ncbi.nlm.nih.gov/pubmed/12107162.

Schmidt, J, K Raith, C Boettcher, and Meinhart H. Zenk. 2005. “Analysis of benzylisoquinoline- type alkaloids by electrospray tandem mass spectrometry and atmospheric pressure photoionization.” European Journal of Mass Spectrometry 11 (3): 325-333. http://www.impublications.com/content/abstract?code=E11_0325.

Schmidt, Jürgen, Chotima Boettcher, Christine Kuhnt, Toni M Kutchan, and Meinhart H Zenk. 2007. “Poppy alkaloid profiling by electrospray tandem mass spectrometry and electrospray FT-ICR mass spectrometry after [ring-13C6]-tyramine feeding.” Phytochemistry 68 (2) (January): 189-202. doi:10.1016/j.phytochem.2006.10.003. http://www.ncbi.nlm.nih.gov/pubmed/17113612.

Schubert, Heidi L, Robert M Blumenthal, and Xiaodong Cheng. 2003. “Many paths to methyltransfer : a chronicle of convergence.” Trends in Biochem Sci. 28 (6): 329-335. doi:10.1016/S0968-0004(03)00090-2.Many.

Shulgin, Alexander T., and Wendy E. Perry. 2002. The Simple Plant Isoquinolines. First Edit. Berkeley, CA, USA: Transform Press.

Stevens, Jan F, Ralph L Reed, and Jeffrey T Morré. 2009. “Characterization of Phytoecdysteroid Glycosides in Meadowfoam (Limnanthes alba) Seed Meal by Positive and Negative Ion LC-MS/ MS.” Journal of Agricultural and Food Chemistry 56 (11): 3945-3952. doi:10.1021/jf800211k.Characterization.

122

Stévigny, Caroline, Jean-Louis Habib Jiwan, Raoul Rozenberg, Edmond de Hoffmann, and Joëlle Quetin-Leclercq. 2004. “Key fragmentation patterns of aporphine alkaloids by electrospray ionization with multistage mass spectrometry.” Rapid communications in mass spectrometry : RCM 18 (5) (January): 523-8. doi:10.1002/rcm.1343. http://www.ncbi.nlm.nih.gov/pubmed/14978796.

Suzuki, Takeo, Hiroshi Ashihara, and George R. Waller. 1992. “PURINE AND PURINE ALKALOID METABOLISM IN CAMELLIA AND COFFEA PLANTS.” Phytochemistry 31 (8): 2575-2584.

Takao, Narao, Miyoko Kamigauchi, and Momoyo Okada. 1983. “Biosynthesis of Benzo [c]phenanthridine Alkaloids Sanguinarine , Chelirubine and Macarpine.” Helvetica Chimica Acta 66 (40): 473-484.

Takemura, Tomoya, Nobuhiro Ikezawa, Kinuko Iwasa, and Fumihiko Sato. 2013. “Phytochemistry Molecular cloning and characterization of a cytochrome P450 in sanguinarine biosynthesis from Eschscholzia californica cells.” Phytochemistry 91: 100- 108. doi:10.1016/j.phytochem.2012.02.013. http://dx.doi.org/10.1016/j.phytochem.2012.02.013.

Takeshita, N, H Fujiwara, H Mimura, J H Fitchen, Y Yamada, and F Sato. 1995. “Molecular cloning and characterization of S-adenosyl-L-methionine:scoulerine-9-O-methyltransferase from cultured cells of Coptis japonica.” Plant & cell physiology 36 (1) (January): 29-36. http://www.ncbi.nlm.nih.gov/pubmed/7719631.

Theis, N, and M Lerdau. 2003. “The Evolution of Function in Plant Secondary Metabolites.” International Journal of Plant Sciences 164 (May 2003): S93-S102. http://www.jstor.org/stable/10.1086/374190.

Theuns, Hubert G, H Leo Theuns, and Robert J J Ch Lousberg. 2014. “Search for New Natural Sources of Morphinans.” Economic Botany 40 (4): 485-497.

Unterlinner, Bernhard, Rainer Lenz, and Toni M Kutchan. 1999. “Molecular cloning and functional expression of codeinone reductase : the penultimate enzyme in morphine biosynthesis in the opium poppy Papaver somniferum.” The Plant Journal 18 (5): 465-475. doi:10.1046/j.1365-313X.1999.00470.x.

Urbanczyk-Wochniak, Eza, Charles Baxter, Anna Kolbe, Joachim Kopka, Lee J. Sweetlove, and Alisdair R. Fernie. 2005. “Profiling of diurnal patterns of metabolite and transcript abundance in potato ( Solanum tuberosum ) leaves.” Planta 221 (6): 891-903. doi:10.1007/s00425-005-1483-y.

Verpoorte, R., Y. H. Choi, N. R. Mustafa, and H. K. Kim. 2008. “Metabolomics: back to basics.” Phytochemistry Reviews 7 (3) (March 11): 525-537. doi:10.1007/s11101-008-9091-7. http://www.springerlink.com/index/10.1007/s11101-008-9091-7.

123

Vogel, Matthias, Michael Lawson, Udo Conrad, Werner Roos, Matthias Vogel, Michael Lawson, Wolfgang Sippl, Udo Conrad, and Werner Roos. 2010. “Structure and Mechanism of Sanguinarine Reductase, an Enzyme of Alkaloid Detoxification.” The Journal of biological chemistry 285 (24): 18397-18406. doi:10.1074/jbc.M109.088989.

Weiss, Dagmar, Alfred Baumert, Matthias Vogel, and Werner Roos. 2006. “Sanguinarine reductase , a key enzyme of benzophenanthridine detoxification.” Plant, Cell and Environment 29 (2): 291-302. doi:10.1111/j.1365-3040.2005.01421.x.

Wink, Michael. 2003. “Evolution of secondary metabolites from an ecological and molecular phylogenetic perspective.” Phytochemistry 64 (1) (September): 3-19. doi:10.1016/S0031- 9422(03)00300-5. http://linkinghub.elsevier.com/retrieve/pii/S0031942203003005.

Wink, Micheal. 2010. Annual Plant Review, Biochemistry of Plant Secondary Metabolism. Ed. J.K.C Roberts, J.A., Evans, D., Imaseki, H., McManus, M.T., Rose. 2nd ed. Hoboken, NJ, USA: Wiley-Blackwell.

Winzer, Thilo, Thilo Winzer, Valeria Gazda, Zhesi He, Filip Kaminski, Marcelo Kern, Tony R Larson, et al. 2012. “A Papaver somniferum 10-Gene Cluster for Synthesis of the Anticancer Alkaloid Noscapine.” Science 336 (2012): 1704-1708. doi:10.1126/science.1220757.

Wu, Wei, Fengrui Song, Cunyu Yan, Zhiqiang Liu, and Shuying Liu. 2005. “Structural analyses of protoberberine alkaloids in medicine herbs by using ESI – FT-ICR-MS and HPLC – ESI – MS n.” Journal of Pharmaceutical and Biomedical Analysis 37 (3): 437-446. doi:10.1016/j.jpba.2004.11.026.

Wu, Wu-nan, and C Huang. 2006. “Structural elucidation of isoquinoline, isoquinolone, benzylisoquinoline, aporphine, and phenanthrene alkaloids using API-ionspray tandem mass spectrometry.” CHINESE PHARMACEUTICAL JOURNAL- … 58 (1): 41-55. http://web2.tmu.edu.tw/pharmtw/cjp/issue/58-1/J005.pdf.

Xiao, Mei, Ye Zhang, Xue Chen, Eun-Jeong Lee, Carla J S Barber, Romit Chakrabarty, Isabel Desgagné-Penix, et al. 2013. “Transcriptome analysis based on next-generation sequencing of non-model plants producing specialized metabolites of biotechnological interest.” Journal of biotechnology 166 (3) (July 10): 122-34. doi:10.1016/j.jbiotec.2013.04.004. http://www.ncbi.nlm.nih.gov/pubmed/23602801.

Xiao, Mei, Ye Zhang, Xue Chen, Eun-jeong Lee, Carla J S Barber, Romit Chakrabarty, Isabel Desgagné-penix, et al. 2013. “Transcriptome analysis based on next-generation sequencing of non-model plants producing specialized metabolites of biotechnological interest.” Journal of Biotechnology 166 (3): 122-134. doi:10.1016/j.jbiotec.2013.04.004. http://dx.doi.org/10.1016/j.jbiotec.2013.04.004.

124

Zhang, Yufeng, Qirong Shi, Peiying Shi, Weidong Zhang, and Yiyu Cheng. 2006. “Characterization of isoquinoline alkaloids , diterpenoids and steroids in the Chinese herb Jin-Guo-Lan (Tinospora sagittata and Tinospora capillipes) by high-performance liquid chromatography/electrospray ionization with multistage mass spectrometry.” Rapid communications in mass spectrometry 20 (15): 2328-2342. doi:10.1002/rcm.

Ziegler, Jorg, Susan Voigtlander, Jurgen Schmidt, Robert Kramell, Otto Miersch, Christian Ammer, Andreas Gesell, and Toni M Kutchan. 2006. “Comparative transcript and alkaloid profiling in Papaver species identifies a short chain dehydrogenase/reductase involved in morphine biosynthesis.” The Plant Journal 48 (2): 177-192. doi:10.1111/j.1365- 313X.2006.02860.x.

Ziegler, Jörg, María Luisa Diaz-Chávez, Robert Kramell, Christian Ammer, and Toni M Kutchan. 2005. “Comparative macroarray analysis of morphine containing Papaver somniferum and eight morphine free Papaver species identifies an O-methyltransferase involved in benzylisoquinoline biosynthesis.” Planta 222 (3) (October): 458-71. doi:10.1007/s00425-005-1550-4. http://www.ncbi.nlm.nih.gov/pubmed/16034588.

Ziegler, Jörg, and Peter J Facchini. 2008. “Alkaloid biosynthesis: metabolism and trafficking.” Annual review of plant biology 59 (January): 735-69. doi:10.1146/annurev.arplant.59.032607.092730. http://www.ncbi.nlm.nih.gov/pubmed/18251710.

Ziegler, Jörg, Peter J Facchini, René Geissler, Jürgen Schmidt, Christian Ammer, Robert Kramell, Susan Voigtländer, Andreas Gesell, Silke Pienkny, and Wolfgang Brandt. 2009. “Evolution of morphine biosynthesis in opium poppy.” Phytochemistry 70 (15-16): 1696- 707. doi:10.1016/j.phytochem.2009.07.006. http://www.ncbi.nlm.nih.gov/pubmed/19665152.

Zubieta, Chloe, Xian-zhi He, Richard A Dixon, Joseph P Noel, Chalcone O-methyltransferase Chomt, and O-methyltransferase Iomt S-adenosyl- L. 2001. “Structures of two natural product methyltransferases reveal the basis for substrate specificity in plant.” Nature Structural Biology 8 (3): 271-279.

125