(12) INTERNATIONAL APPLICATION PUBLISHED UNDER THE PATENT COOPERATION TREATY (PCT) (19) World Intellectual Property Organization International Bureau (10) International Publication Number (43) International Publication Date WO 2016/149821 Al 29 September 2016 (29.09.2016) P O P C T
(51) International Patent Classification: AO, AT, AU, AZ, BA, BB, BG, BH, BN, BR, BW, BY, C12N 9/02 (2006.01) C12N 15/81 (2006.01) BZ, CA, CH, CL, CN, CO, CR, CU, CZ, DE, DK, DM, C12N 1/19 (2006.01) C12N 9/04 (2006.01) DO, DZ, EC, EE, EG, ES, FI, GB, GD, GE, GH, GM, GT, C12N 15/53 (2006.01) CI2P 17/10 (2006.01) HN, HR, HU, ID, IL, IN, IR, IS, JP, KE, KG, KN, KP, KR, C12N 15/54 (2006.01) C12P 17/12 (2006.01) KZ, LA, LC, LK, LR, LS, LU, LY, MA, MD, ME, MG, MK, MN, MW, MX, MY, MZ, NA, NG, NI, NO, NZ, OM, (21) International Application Number: PA, PE, PG, PH, PL, PT, QA, RO, RS, RU, RW, SA, SC, PCT/CA2016/050334 SD, SE, SG, SK, SL, SM, ST, SV, SY, TH, TJ, TM, TN, (22) International Filing Date: TR, TT, TZ, UA, UG, US, UZ, VC, VN, ZA, ZM, ZW. 23 March 2016 (23.03.2016) (84) Designated States (unless otherwise indicated, for every (25) Filing Language: English kind of regional protection available): ARIPO (BW, GH, GM, KE, LR, LS, MW, MZ, NA, RW, SD, SL, ST, SZ, (26) Publication Language: English TZ, UG, ZM, ZW), Eurasian (AM, AZ, BY, KG, KZ, RU, (30) Priority Data: TJ, TM), European (AL, AT, BE, BG, CH, CY, CZ, DE, 62/136,912 23 March 2015 (23.03.2015) US DK, EE, ES, FI, FR, GB, GR, HR, HU, IE, IS, IT, LT, LU, LV, MC, MK, MT, NL, NO, PL, PT, RO, RS, SE, SI, SK, (71) Applicant: VALORBEC SOCIETE EN COMMAN¬ SM, TR), OAPI (BF, BJ, CF, CG, CI, CM, GA, GN, GQ, DITE [CA/CA]; 355 Peel, Carrefour INGO, Suite 503, GW, KM, ML, MR, NE, SN, TD, TG). Montreal, Quebec H3C 2G9 (CA). Declarations under Rule 4.17 : (72) Inventors: FOSSATI, Elena; 35 rue Marie Chapleau, — as to applicant's entitlement to apply for and be granted a Blainville, Quebec J7C 5Z9 (CA). NARCROSS, Lauren; patent (Rule 4.1 7(H)) 5090 Circle Road, Apt. 308, Montreal, Quebec H3W 2A1 (CA). MARTIN, Vincent; 5205 Beaconsfield, Montreal, Published: Quebec H3X 3R9 (CA). — with international search report (Art. 21(3)) (74) Agent: GOUDREAU GAGE DUBUC; 2000 McGill Col — with sequence listing part of description (Rule 5.2(a)) lege, Suite 2200, Montreal, Quebec H3A 3H3 (CA). (81) Designated States (unless otherwise indicated, for every kind of national protection available): AE, AG, AL, AM,
(54) Title: METHODS OF MAKING MORPHINAN ALKALOIDS AND ENZYMES THEREFORE (57) Abstract: A method of preparing a morphinan alkaloid (MA) metabolite comprising: (a) culturing a host cell under conditions suitable for MA production including a first fermentation at a pH of between about 7.5 and about 10, said host cell comprising: (i) a o first heterologous coding sequence encoding a first enzyme involved in a metabolite pathway that converts (R)-reticuline into the metabolite; (ii) a second heterologous coding sequence encoding a second enzyme involved in a metabolite pathway that converts (R)-reticuline into the metabolite; and/or (iii) a third heterologous coding sequence encoding a second enzyme involved in a meta bolite pathway that converts (R)-reticuline into the metabolite; (b) adding (R)-reticuline to the cell culture; and (c) recovering the metabolite from the cell culture. Plasmids and host cells encoding the enzymes are also provided. METHODS OF MAKING MORPHINAN ALKALOIDS AND ENZYMES THEREFORE
CROSS REFERENCE TO RELATED APPLICATIONS
[0001] This application is PCT application Serial No PCT/CA2016/* filed on March 23, 2016 and published in English under PCT Article 2 1(2), which itself claims benefit of U.S. provisional application Serial
No. 62/136,912, filed on March 23, 2015. All documents above are incorporated herein in their entirety by reference.
STATEMENT REGARDING FEDERALLY SPONSORED RESEARCH OR DEVELOPMENT
[0002] N.A.
FIELD OF THE INVENTION
[0003] The present invention relates to methods of making morphinan alkaloids and enzymes therefore. More specifically, the present invention is concerned with a recombinant method of making morphinan alkaloids in microbial cells.
REFERENCE TO SEQUENCE LISTING
[0004] Pursuant to 37 C.F.R. 1.821 (c), a sequence listing is submitted herewith as an ASCII compliant text file named, that was created on March 22, 2016 and having a size of 1080 kilobytes. The content of the aforementioned file named 13234-1 86_ST25 is hereby incorporated by reference in its entirety.
BACKGROUND OF THE INVENTION
[0005] Morphinan alkaloids are the most powerful narcotic analgesics currently used to treat moderate to severe and chronic pain. They include the opiates codeine and morphine and their semi¬ synthetic derivatives, such as dihydromorphine and hydromorphone as well as thebaine. Thebaine and morphine are the two main opiates extracted from opium poppy latex, meaning that they are the starting precursors for the synthesis of other opioids [3]. The opioids antagonist naloxone and naltrexone, used to treat opiate addiction and overdose, are derived from thebaine. Thebaine is a precursor to codeine and morphine biosynthesis in planta (FIG. 1) and is also the starting precursor for semi-synthetic opioids. For instance, it can be used for the chemical synthesis of the analgesics oxycodone and buprenorphine, which have more favourable side-effect profiles than morphine [1 ,2].
[0006] Morphinan alkaloids belong to a broader class of plant secondary metabolites known as benzylisoquinoline alkaloids (BIAs), with diverse pharmaceutical properties including the muscle relaxant papaverine, the antimicrobials berberine and sanguinarine and the antitussive and potential anticancer drug noscapine [8,9]. Thousands of distinct BIAs have been identified in plants, all derived from a single precursor: (S)-norcoclaurine. BIA synthesis in plants proceeds through the enantioselective Pictet-Spengler condensation of the L-tyrosine derivatives L-dopamine and 4-hydroxyphenylacetaldehyde to produce (S)-
norcoclaurine, catalyzed by the enzyme norcoclaurine synthase (NCS; FIG. 2a) [ 10]. (S)-Norcoclaurine can
be converted to the branch point intermediate (S)-reticuline via three methylation events (FIG. 2a). In P.
somniferum the morphine pathway diverges from other BIA pathways in that it proceeds through (R)-
reticuline instead of (S)-reticuline (FIG. 2a). The epimerization of (S)-reticuline to (R)-reticuline has been
proposed to proceed via dehydrogenation of (S)-reticuline to 1,2-dehydroreticuline and subsequent
enantioselective reduction to (R)-reticuline but the enzyme(s) responsible for this reaction have long
remained elusive [ 1 1,12].
[0007] Cultivars of opium poppy improved for optimal opiate production by extensive breeding
cycles and mutagenesis are the only commercial source of thebaine and morphine [2,3]. While the supply of
morphinan alkaloids from plant extraction currently meets demand [3], efficient production of opiates using
microbial platforms could not only contribute to reduce the cost of opiate production, but also offer a versatile
platform for the creation of new scaffolds for drug discovery [7]. This refers to both alkaloids that do not
accumulate in sufficient quantity and new molecules not yet isolated nor produced from plants.
[0008] There remains a need for efficient production of opiates using microbial platforms.
[0009] The present description refers to a number of documents, the content of which is herein
incorporated by reference in their entirety.
SUMMARY OF THE INVENTION
[0010] Morphinan alkaloids are the most powerful narcotic analgesics currently used to treat
moderate to severe and chronic pain. The feasibility of morphinan synthesis in recombinant Saccharomyces
cerevisiae starting from the precursor (R,S)-norlaudanosoline and (R)-reticuline was investigated. Chiral
analysis of the reticuline produced by the expression of opium poppy methyltransferases showed strict
enantioselectivity for (S)-reticuline starting from (R,S)-norlaudanosoline and demonstrated that (R)-reticuline
cannot be generated from (R)-norlaudanosoline. In addition, the P. somniferum enzymes salutaridine
synthase (PsSAS), salutaridine reductase (PsSAR) and salutaridinol acetyltransferase (PsSAT) (FIG. 1) were functionally co-expressed in S. cerevisiae and optimization of the pH conditions allowed for productive
spontaneous rearrangement of salutaridinol-7-O-acetate and synthesis of thebaine from (R)-reticuline.
Finally, a 7-gene pathway was reconstituted for the production of codeine and morphine from supplemented
precursors in S. cerevisiae.
[001 1] Yeast cell feeding assays using (R)-reticuline, salutaridine or codeine as substrates showed
that all enzymes were functionally co-expressed in yeast and that activity of salutaridine reductase (SAR)
and codeine-O-demethylase (CODM) likely limit flux to morphine synthesis. Poor PsSAR and CODM
expression or catalytic properties could all contribute to the low efficiency of this conversion and should be investigated for pathway optimization. Variation of gene expression (through copy number variation for example) [4] and use of orthologues and/or paralogs with better expression and/or catalytic properties are possible approaches to overcome this problem [36]. Also, solutions could be to generate synthetic microbial compartments [34], multi-enzyme scaffolds to channel intermediates to the pathway of interest [35], or alteration of an enzyme's specificity by protein engineering. Salutaridine reductase from Papaver bracteatum
(PbSAR), which differs only in 13 amino acids from PsSAR, is known to be substrate inhibited at low
concentration of salutaridine ( ,· = 150 µΜ) [29]. A previous mutagenesis study of PbSAR, based on homology modeling, resulted in identification of 2 mutants, F 104A and I275A, with reduced substrate inhibition and increased K , but slightly higher t. The double mutant F104A/I275A showed no substrate inhibition, with a higher K and cat. Therefore, an increased flux in the (R )-reticuline to the thebaine pathway could ostensibly be achieved by incorporating these mutations in PsSAR sequences.
[0012] The ( )-reticuline used in the present invention can be obtained by the epimerization of (S)- reticuline to (R )-reticuline e.g., with the use of a fusion protein composed of a cytochrome P450 domain and an oxidoreductase domain (STORR) [41]; via dehydrogenation of (S)-reticuline to 1,2-dehydroreticuline by dehydroreticuline synthase (DRS) and subsequent enantioselective reduction to (R )-reticuline by dehydroreticuline reductase (DRR). The methods of the present invention may encompass such step prior to the step performed by SAS and CPR.
Methods
[0013] More specifically, in accordance with an aspect of the present invention, there is provided a method of preparing a morphinan alkaloid (MA) metabolite comprising: (a) culturing a host cell under conditions suitable for MA production including a first fermentation at a pH of between about 7.5 and about
10, said host cell comprising: (i) a first heterologous coding sequence encoding a first enzyme involved in a metabolite pathway that converts ( )-reticuline into the metabolite; (ii) a second heterologous coding sequence encoding a second enzyme involved in a metabolite pathway that converts (R )-reticuline into the metabolite; (iii) a third heterologous coding sequence encoding a third enzyme involved in a metabolite pathway that converts (R )-reticuline into the metabolite; (iv) a fourth heterologous coding sequence encoding a fourth enzyme involved in a metabolite pathway that converts (R )-reticuline into the metabolite; (v) a fifth heterologous coding sequence encoding a fifth enzyme involved in a metabolite pathway that converts (R)- reticuline into the metabolite; (vi) a sixth heterologous coding sequence encoding a sixth enzyme involved in a metabolite pathway that converts (R )-reticuline into the metabolite; and/or (vii) a seventh heterologous coding sequence encoding a seventh enzyme involved in a metabolite pathway that converts (R )-reticuline into the metabolite; (b) adding (R )-reticuline, salutaridine, salutaridinol, thebaine, oripavine, morphinone, neopinone, codeinone, and/or codeine to the cell culture; and (c) recovering the metabolite from the cell culture. Method comprising one enzyme
[0014] In a more specific embodiment, the method comprises a first heterologous coding sequence
encoding a first enzyme involved in a metabolite pathway that converts (R)-reticuline into the metabolite.
[0015] In a more specific embodiment, step (b) comprises adding salutaridine to the cell culture. In a
more specific embodiment, the metabolite is salutaridinol. In a more specific embodiment, the first enzyme is
salutaridine reductase (SAR). In a more specific embodiment, the SAR is as set forth in any one of the
sequences as depicted in FIGs. 9E or 10C (e.g., SEQ ID NOs: 50 and 119-135). In a more specific
embodiment, the SAR is from Papaver somniferum. In a more specific embodiment, PsSAR is as set forth in
in any one of SEQ ID NOs: 50, 119-121 , 126-127, 130 and 133 (FIG. 10C), preferably SEQ ID NO: 50. In
another more specific embodiment, step (b) comprises adding salutaridinol to the cell culture. In a more
specific embodiment, the metabolite is salutaridinol-7-O-acetate or thebaine. In a more specific embodiment,
the first enzyme is salutaridinol acetyltransferase (SAT). In a more specific embodiment, the SAT is as set forth in any one of the sequences as depicted in FIGs. 9E or 10D (e.g., SEQ ID NOs: 52 and 136-166). In a
more specific embodiment, SAT is from Papaver somniferum. In a more specific embodiment, PsSAT is as
set forth in in any one of SEQ ID NOs: 52 and 136-165 (FIG. 10D), preferably SEQ ID NO: 52. In another
more specific embodiment, step (b) comprises adding salutaridinol-7-O-acetate or thebaine to the cell
culture. In a more specific embodiment, the metabolite is oripavine and the first enzyme is CODM. In a more
specific embodiment, the CODM is as set forth in any one of the sequences as depicted in FIGs. 9E or 10E
(e.g., SEQ ID NOs: 55, 58 and 167-1 78), preferably Pso9 (FIG. 10E (SEQ ID NO: 175)). In accordance with
another more specific embodiment CODM is from Papaver somniferum. In accordance with a further more
specific embodiment, PsCODM is as set forth in FIG. 9 or 10E (e.g., SEQ ID NOs: 55, 58 and 167-1 77),
preferably SEQ ID NO: 55. In another more specific embodiment, the metabolite is neopinone and the first
enzyme is thebaine-6-O-demethylase (T60DM). In another more specific embodiment, step (b) comprises
adding oripavine to the cell culture. In a more specific embodiment, the metabolite is morphinone and the first enzyme is T60DM. In a more specific embodiment, the T60DM is as set forth in any one of the
sequences as depicted in FIGs. 9E or 10E (e.g., SEQ ID NOs: 55, 58 and 167-178). In accordance with
another more specific embodiment T60DM is from Papaver somniferum. In accordance with a further more
specific embodiment, PsT60DM is as set forth in FIG. 9E or 10E (e.g., SEQ ID NOs: 55, 58 and 167-1 77),
preferably SEQ ID NO: 58. In another more specific embodiment, step (b) comprises adding morphinone to
the cell culture. In a more specific embodiment, the metabolite is morphine and the first enzyme is codeinone
reductase (COR). In another more specific embodiment, step (b) comprises adding neopinone or codeinone
to the cell culture. In a more specific embodiment, the metabolite is codeine and the first enzyme is
codeinone reductase (COR). In a more specific embodiment, the COR is as set forth in any one of the
sequences depicted in FIG. 10F (e.g., SEQ ID NOs: 6 1 and 179-1 93). In accordance with another more
specific embodiment, COR is from Papaver somniferum. In accordance with a further more specific embodiment, PsCOR is as set forth in FIG. 9 or 10F (e.g., SEQ ID NOs: 6 1 and 179-1 89) , preferably SEQ
ID NO: 6 1. In another more specific embodiment, step (b) comprises adding codeine to the cell culture. In a more specific embodiment, the metabolite is morphine and the first enzyme is CODM. In a specific embodiment, these enzymes are as set forth in any one of the sequences depicted in FIGs. 9E or 10 or nucleotide molecules encoding same.
[0016] In another specific embodiment, the cell further comprises a second heterologous coding sequence encoding a second enzyme involved in a metabolite pathway that converts (R)-reticuline into the metabolite.
Method comprising two enzymes
[0017] In another specific embodiment, the method comprises (i) a first heterologous coding sequence encoding a first enzyme involved in a metabolite pathway that converts (R)-reticuline into the metabolite; and (ii) a second heterologous coding sequence encoding a second enzyme involved in a metabolite pathway that converts (R)-reticuline into the metabolite.
[0018] In a specific embodiment, step (b) comprises adding (R)-reticuline to the cell culture. In a more specific embodiment, the metabolite is salutaridine. In a more specific embodiment, the first and second enzymes are salutaridine synthase (SAS), and cytochrome P450 reductase (CPR), respectively. In a more specific embodiment, the (i) SAS is as set forth in any one of the sequences as depicted in FIGs. 9E or
10A (e.g., SEQ ID NOs: 4 1, 4446, 68-80 and 277-288), e.g., NT CAS-SAS as depicted in FIG. 9A (SEQ ID
NO: 45) or NTCFS-SAS as depicted in FIG. 9 (SEQ ID NO: 46); and/or (ii) CPR is as set forth in any one of the sequences as depicted in FIGs. 9E or 10B (e.g., SEQ ID NOs: 47, 81-1 18 and 289-322). In a more specific embodiment, SAS and/or CPR is from Papaver somniferum. In a more specific embodiment, (i)
PsSAS is as set forth in in any one of SEQ ID NOs: 4 1, 4446, 70-78 and 279-288 (FIGs. 9E or 10A), preferably SEQ ID NO: 4 1 or 288; and/or CPR is as set forth in SEQ ID NO: 47 or 296. In another specific embodiment, step (b) comprises adding salutaridine to the cell culture. In a more specific embodiment, the metabolite is salutaridinol-7-O-acetate or thebaine. In a more specific embodiment, the first and second enzymes are salutaridine reductase (SAR), and salutaridinol acetyltransferase (SAT), respectively. In another specific embodiment, step (b) comprises adding salutaridinol to the cell culture. In a more specific embodiment, the metabolite is oripavine. In a more specific embodiment, the first and second enzymes are salutaridinol acetyltransferase (SAT) and CODM, respectively. In another more specific embodiment, the metabolite is neopinone. In a more specific embodiment, the first and second enzymes are salutaridinol acetyltransferase (SAT) and T60DM, respectively. In another specific embodiment, step (b) comprises adding salutaridinol-7-O-acetate or thebaine to the cell culture. In another specific embodiment, the metabolite is morphinone. In a more specific embodiment, the first and second enzymes are CODM and
T60DM, respectively. In another specific embodiment, the metabolite is codeine. In a more specific embodiment, the first and second enzymes are T60DM and COR respectively. In another specific
embodiment, step (b) comprises adding oripavine to the cell culture. In another specific embodiment, the
metabolite is morphine. In a more specific embodiment, the first and second enzymes are T60DM and COR,
respectively. In another specific embodiment, step (b) comprises adding codeinone to the cell culture. In
another specific embodiment, the metabolite is morphine. In a more specific embodiment, the first and
second enzymes are COR and CODM, respectively. In a specific embodiment, these enzymes are as set forth in any one of the sequences depicted in FIGs. 9E or 10 or as defined above e.g., in the method
comprising one enzyme.
[0019] In another specific embodiment, the cell further comprises a third heterologous coding
sequence encoding a third enzyme involved in a metabolite pathway that converts (R)-reticuline into the
metabolite.
Method comprising three enzymes
[0020] In another specific embodiment, the method comprises (i) a first heterologous coding
sequence encoding a first enzyme involved in a metabolite pathway that converts (R)-reticuline into the
metabolite; (ii) a second heterologous coding sequence encoding a second enzyme involved in a metabolite
pathway that converts (R)-reticuline into the metabolite; and (iii) a third heterologous coding sequence
encoding a second enzyme involved in a metabolite pathway that converts (R)-reticuline into the metabolite.
[0021] In a specific embodiment, step (b) comprises adding (R)-reticuline to the cell culture. In a
more specific embodiment, the metabolite is salutaridinol. In a more specific embodiment, the first, second
and third enzymes are SAS, CPR and SAR. In a specific embodiment, these enzymes are as set forth in any
one of the sequences depicted in FIGs. 9E or 10 or as defined above e.g., in the method comprising one
more enzyme(s).
[0022] In another specific embodiment, step (b) comprises adding salutaridine to the cell culture. In
a more specific embodiment, the metabolite is oripavine. In a more specific embodiment, the first, second
and third enzymes are SAR, SAT and CODM. In a more specific embodiment, the metabolite is neopinone.
In a more specific embodiment, the first, second and third enzymes are SAR, SAT and T60DM. In a specific
embodiment, these enzymes are as set forth in any one of the sequences depicted in FIGs. 9E or 10 or as
defined above e.g., in the method comprising one or more enzyme(s).
[0023] In another specific embodiment, step (b) comprises adding salutaridinol to the cell culture. In
a more specific embodiment, the metabolite is morphinone. In a more specific embodiment, the first, second
and third enzymes are SAT, CODM and T60DM. In a more specific embodiment, the metabolite is codeine.
In a more specific embodiment, the first, second and third enzymes are SAT, T60DM and COR. In a specific
embodiment, these enzymes are as set forth in any one of the sequences depicted in FIGs. 9E or 10 or as defined above e.g., in the method comprising one or more enzyme(s).
[0024] In another specific embodiment, step (b) comprises adding salutaridinol-7-O-acetate or
thebaine to the cell culture. In a more specific embodiment, the metabolite is morphine. In a more specific
embodiment, the first, second and third enzymes are CODM, T60DM and COR. In a specific embodiment,
these enzymes are as set forth in any one of the sequences depicted in FIGs. 9E or 10 or as defined above
e.g., in the method comprising one or more enzyme(s).
[0025] In accordance with a more specific embodiment of the present invention, there is provided a
method of preparing a morphinan alkaloid (MA) metabolite comprising: (a) culturing a host cell under
conditions suitable for MA production including a first fermentation at a pH of between about 7.5 and about
10, said host cell comprising: (i) a first heterologous coding sequence encoding a first enzyme involved in a
metabolite pathway that converts (R)-reticuline into the metabolite; (ii) a second heterologous coding
sequence encoding a second enzyme involved in a metabolite pathway that converts (R)-reticuline into the
metabolite; and (iii) a third heterologous coding sequence encoding a third enzyme involved in a metabolite
pathway that converts (R)-reticuline into the metabolite; (b) adding (R)-reticuline to the cell culture; and (c)
recovering the metabolite from the cell culture.
[0026] In accordance with a more specific embodiment, the metabolite is morphine. In accordance with another specific embodiment (i) the first enzyme is codeine-O-demethylase (CODM); (ii) the second
enzyme is thebaine-6-O-demethylase (T60DM); and/or (iii) the third enzyme is codeinone reductase (COR).
In accordance with a more specific embodiment (i) the T60DM is as set forth in any one of the sequences as
depicted in FIGs. 9E and 10E (e.g., SEQ ID NOs: 55, 58 and 167-178); (ii) the CODM is as set forth in any
one of the sequences as depicted in FIGs. 9E and 10E (e.g., SEQ ID NOs: 55, 58 and 167-1 78), preferably
Pso9 (FIG. 10E (SEQ ID NO:1 75)); and/or (iii) the COR is as set forth in any one of the sequences depicted
in FIGs. 9E and 10F (e.g., SEQ ID NOs: 6 1 and 179-1 93). In accordance with another more specific
embodiment (i) T60DM is from Papaver somniferum; (ii) CODM is from Papaver somniferum; and/or (iii)
COR is from Papaver somniferum. In accordance with a further more specific embodiment, (i) PsT60DM is
as set forth in any one of the sequences as depicted in FIGs. 9E and 10E (e.g., SEQ ID NOs: 55, 58 and
167-177), preferably SEQ ID NO: 58; (ii) PsCODM is as set forth in any one of the sequences as depicted in
FIGs. 9E and 10E (e.g., SEQ ID NOs: 55, 58 and 167-177), preferably SEQ ID NO: 55; and/or (iii) PsCOR is
as set forth in any one of the sequences as depicted in FIGs. 9E and 10F (e.g., SEQ ID NOs: 6 1 and 179-
189), preferably SEQ ID NO: 6 1. In a specific embodiment, these enzymes are as set forth in any one of the
sequences depicted in FIGs. 9E or 10 or as defined above e.g., in the method comprising one or more
enzyme(s).
[0027] In a more specific embodiment, the cell further comprises a fourth heterologous coding
sequence encoding a fourth enzyme involved in a metabolite pathway that converts (R)-reticuline into the metabolite.
Method comprising four enzymes
[0028] In another specific embodiment, the method comprises (i) a first heterologous coding
sequence encoding a first enzyme involved in a metabolite pathway that converts ( )-reticuline into the
metabolite; (ii) a second heterologous coding sequence encoding a second enzyme involved in a metabolite
pathway that converts ( )-reticuline into the metabolite; (iii) a third heterologous coding sequence encoding
a second enzyme involved in a metabolite pathway that converts ( )-reticuline into the metabolite; and (iv) a fourth heterologous coding sequence encoding a fourth enzyme involved in a metabolite pathway that
converts (/?)-reticuline into the metabolite.
[0029] In a specific embodiment, step (b) comprises adding ( )-reticuline to the cell culture. In a
more specific embodiment, the metabolite is salutaridinol-7-O-acetate or thebaine. In a more specific
embodiment, the first, second, third and fourth enzymes are SAS, CPR, SAR and SAT. In a specific
embodiment, these enzymes are as set forth in any one of the sequences depicted in FIGs. 9E or 10 or as
defined above e.g., in the method comprising one or more enzyme(s).
[0030] In another specific embodiment, step (b) comprises adding salutaridine to the cell culture. In
a more specific embodiment, the metabolite is morphinone. In a more specific embodiment, the first, second,
third and fourth enzymes are SAR, SAT, CODM and T60DM. In another more specific embodiment, the
metabolite is codeine. In a more specific embodiment, the first, second, third and fourth enzymes are SAR,
SAT, T60DM and COR. In a specific embodiment, these enzymes are as set forth in any one of the
sequences depicted in FIGs. 9E or 10 or as defined above e.g., in the method comprising one or more
enzyme(s).
[0031] In another specific embodiment, step (b) comprises adding salutaridinol to the cell culture. In
a more specific embodiment, the metabolite is morphine. In a more specific embodiment, the first, second,
third and fourth enzymes are SAT, CODM, T60DM and COR. In a specific embodiment, these enzymes are
as set forth in any one of the sequences depicted in FIGs. 9E or 10 or as defined above e.g., in the method
comprising one or more enzyme(s).
[0032] In another specific embodiment, (i) the first enzyme is salutaridine synthase (SAS); the
second enzyme is cytochrome P450 reductase (CPR); the third enzyme is salutaridine reductase (SAR);
and/or the fourth enzyme is salutaridinol acetyltransferase (SAT). In a more specific embodiment, (i) the SAS
is as set forth in any one of the sequences as depicted in FIGs. 9E and 10A (e.g., SEQ ID NOs: 4 1, 44-46,
68-80 and 277-288), e.g., NTCAS-SAS as depicted in FIG. 9A (SEQ ID NO: 45) or NTCFS-SAS as depicted in
FIG. 9 (SEQ ID NO: 46); (ii) the CPR is as set forth in any one of the sequences as depicted in FIGs. 9E and
10B (e.g., SEQ ID NOs: 47, 8 1- 1 18 and 289-322); (iii) the SAR is as set forth in any one of the sequences as depicted in FIGs. 9E and 10C (e.g., SEQ ID NOs: 50 and 119-135); and/or (iv) the SAT is as set forth in any
one of the sequences as depicted in FIGs. 9E and 10D (e.g., SEQ ID NOs: 52 and 136-1 66). In a more
specific embodiment, (i) SAS is from Papaver somniferum; (ii) CPR is from Papaver somniferum; (iii) SAR is from Papaver somniferum; and/or (iv) SAT is from Papaver somniferum. In a more specific embodiment, (i)
PsSAS is as set forth in in any one of SEQ ID NOs: 4 1, 44-46, 70-78 and 279-288 (FIGs. 9E or 10A),
preferably SEQ ID NO: 4 1; PsCPR is as set forth in SEQ ID NO: 47 (FIG. 10B); PsSAR is as set forth in in
any one of SEQ ID NOs: 50, 119-121 , 126-127, 130 and 133 (FIG. 10C), preferably SEQ ID NO: 50; and/or
PsSAT is as set forth in in any one of SEQ ID NOs: 52 and 136-165 (FIG. 10D), preferably SEQ ID NO: 52.
In a specific embodiment, these enzymes are as set forth in any one of the sequences depicted in FIGs. 9E
or 10 or as defined above e.g., in the method comprising one or more enzyme(s).
[0033] In another specific embodiment, the cell further comprises a fifth heterologous coding
sequence encoding a fifth enzyme involved in a metabolite pathway that converts ( )-reticuline into the
metabolite.
Method comprising five enzymes
[0034] In another specific embodiment, the method comprises (i) a first heterologous coding
sequence encoding a first enzyme involved in a metabolite pathway that converts (R)-reticuline into the
metabolite; (ii) a second heterologous coding sequence encoding a second enzyme involved in a metabolite
pathway that converts (R)-reticuline into the metabolite; (iii) a third heterologous coding sequence encoding
a second enzyme involved in a metabolite pathway that converts ( )-reticuline into the metabolite; (iv) a fourth heterologous coding sequence encoding a fourth enzyme involved in a metabolite pathway that
converts (R)-reticuline into the metabolite; and (v) a fifth heterologous coding sequence encoding a fifth
enzyme involved in a metabolite pathway that converts (R)-reticuline into the metabolite.
[0035] In a specific embodiment, step (b) comprises adding (R)-reticuline to the cell culture. In a
more specific embodiment, the metabolite is oripavine. In a more specific embodiment, the first, second,
third, fourth and fifth enzymes are SAS, CPR, SAR, SAT and CODM. In another more specific embodiment,
the metabolite is neopinone. In a more specific embodiment, the first, second, third, fourth and fifth enzymes
are SAS, CPR, SAR, SAT and T60DM. In another specific embodiment, the fifth enzyme is a thebaine-6-O-
demethylase (T60DM) and/or codeine-O-demethylase (CODM). In a specific embodiment, these enzymes
are as set forth in any one of the sequences depicted in FIGs. 9E or 10 or as defined above e.g., in the
method comprising one or more enzyme(s).
[0036] In another specific embodiment, the fifth enzyme is T60DM. In another specific embodiment,
the metabolite is neopinone, which spontaneously rearranges to codeinone. In another specific embodiment,
the T60DM and is as set forth in any one of the sequences as depicted in FIGs. 9E and 10E (e.g., SEQ ID
NOs: 55, 58 and 167-178). In another specific embodiment, the T60DM is from Papaver somniferum (Ps). In another specific embodiment, PsT60DM is as set forth in any one of the sequences as depicted in SEQ ID
NOs: 55, 58 and 167-1 77 (FIG. 10E), preferably SEQ ID NO: 58. In another specific embodiment, PsT60DM
is as set forth in SEQ ID NO: 58.
[0037] In another specific embodiment, the fifth enzyme is CODM. In another specific embodiment,
the metabolite is oripavine. In another specific embodiment, the CODM is as set forth in any one of the
sequences as depicted in FIGs. 9E and 10E (e.g., SEQ ID NOs: 55, 58 and 167-178), preferably Pso9 (FIG.
10E (SEQ ID NO: 175)). In another specific embodiment, the CODM is from Papaver somniferum (Ps). In
another specific embodiment, PsCODM is as set forth in any one of the sequences as depicted in SEQ ID
NO: 55, 58 and 167-1 77 (FIG. 10E). In another specific embodiment, PsT60DM is as set forth in SEQ ID
NO: 55.
[0038] In another specific embodiment, step (b) comprises adding salutaridine to the cell culture. In
a more specific embodiment, the metabolite is morphine. In a more specific embodiment, the first, second,
third, fourth and fifth enzymes are SAR, SAT, CODM, T60DM and COR. In a specific embodiment, these
enzymes are as set forth in any one of the sequences depicted in FIGs. 9E or 10 or as defined above e.g.,
in the method comprising one or more enzyme(s).
[0039] In another specific embodiment, the cell further comprises a sixth heterologous coding
sequence encoding a sixth enzyme involved in a metabolite pathway that converts (R)-reticuline into the
metabolite.
Method comprising six enzymes
[0040] In another specific embodiment, the method comprises (i) a first heterologous coding
sequence encoding a first enzyme involved in a metabolite pathway that converts (R)-reticuline into the
metabolite; (ii) a second heterologous coding sequence encoding a second enzyme involved in a metabolite
pathway that converts (R)-reticuline into the metabolite; (iii) a third heterologous coding sequence encoding
a second enzyme involved in a metabolite pathway that converts (R)-reticuline into the metabolite; (iv) a fourth heterologous coding sequence encoding a fourth enzyme involved in a metabolite pathway that
converts (R)-reticuline into the metabolite; (v) a fifth heterologous coding sequence encoding a fifth enzyme
involved in a metabolite pathway that converts (R)-reticuline into the metabolite; and (vi) a sixth heterologous
coding sequence encoding a sixth enzyme involved in a metabolite pathway that converts (R)-reticuline into
the metabolite.
[0041] In a specific embodiment, step (b) comprises adding (R)-reticuline to the cell culture. In a
more specific embodiment, the metabolite is morphinone. In a more specific embodiment, the first, second,
third, fourth, fifth and sixth enzymes are SAS, CPR, SAR, SAT, CODM and T60DM. In another more
specific embodiment, the metabolite is codeine. In a more specific embodiment, the first, second, third, fourth, fifth and sixth enzymes are SAS, CPR, SAR, SAT, T60DM and COR. In a specific embodiment,
these enzymes are as set forth in any one of the sequences depicted in FIGs. 9E or 10 or as defined above
e.g., in the method comprising one or more enzyme(s).
[0042] In a specific embodiment, the sixth enzyme is codeinone reductase (COR) or thebaine-6-O-
demethylase (T60DM). In a specific embodiment, the sixth enzyme is COR. In a more specific embodiment,
the metabolite is codeine. In a specific embodiment, the COR is as set forth in any one of the sequences
depicted in FIGs. 9E and 10F (e.g., SEQ ID NOs: 6 1 and 179-193). In a specific embodiment, the COR is from Papaver somniferum (Ps). In a specific embodiment, PsCOR is as set forth in in any one of the
sequences depicted in SEQ ID NOs: 6 1 and 179-189 (FIG. 10F), preferably SEQ ID NO: 6 1. In another
specific embodiment, the sixth enzyme T60DM. In a specific embodiment, the metabolite is morphinone. In
a specific embodiment, the T60DM and is as set forth in any one of the sequences as depicted in FIGs. 9E
and 10E (e.g., SEQ ID NOs: 55, 58 and 167-1 78), preferably SEQ ID NO: 58. In a specific embodiment, the
T60DM is from Papaver somniferum (Ps). In a specific embodiment, the PsT60DM is as set forth in SEQ ID
NO: 58 (FIG. 10E).
[0043] In another specific embodiment, the cell further comprises a seventh heterologous coding
sequence encoding a seventh enzyme involved in a metabolite pathway that converts (R)-reticuline into the
metabolite.
Method comprising seven enzymes
[0044] In another specific embodiment, the method comprises (i) a first heterologous coding
sequence encoding a first enzyme involved in a metabolite pathway that converts (R)-reticuline into the
metabolite; (ii) a second heterologous coding sequence encoding a second enzyme involved in a metabolite
pathway that converts ( )-reticuline into the metabolite; (iii) a third heterologous coding sequence encoding
a second enzyme involved in a metabolite pathway that converts ( )-reticuline into the metabolite; (iv) a fourth heterologous coding sequence encoding a fourth enzyme involved in a metabolite pathway that
converts ( )-reticuline into the metabolite; (v) a fifth heterologous coding sequence encoding a fifth enzyme
involved in a metabolite pathway that converts ( )-reticuline into the metabolite; (vi) a sixth heterologous
coding sequence encoding a sixth enzyme involved in a metabolite pathway that converts ( )-reticuline into
the metabolite; and (vii) a seventh heterologous coding sequence encoding a seventh enzyme involved in a
metabolite pathway that converts ( )-reticuline into the metabolite.
[0045] In a specific embodiment, step (b) comprises adding ( )-reticuline to the cell culture. In a
more specific embodiment, the metabolite is morphine. In a more specific embodiment, the first, second,
third, fourth, fifth, sixth and seventh enzymes are SAS, CPR, SAR, SAT, CODM, T60DM and COR. In a
specific embodiment, these enzymes are as set forth in any one of the sequences depicted in FIGs. 9E or 10
or as defined above e.g., in the method comprising one or more enzyme(s). [0046] In another specific embodiment, the seventh enzyme is codeine-O-demethylase (CODM) or codeinone reductase (COR). In another specific embodiment, the metabolite is morphine. In another specific embodiment, the seventh enzyme is CODM. In a more specific embodiment, the CODM is as set forth in any one of the sequences as depicted in FIGs. 9E and 10E (e.g., SEQ ID NOs: 55, 58 and 167-178). In another specific embodiment, the CODM is from Papaver somniferum (Ps). In another specific embodiment,
PsCODM is as set forth in in any one of the sequences as depicted in SEQ ID NO: 55, 58 and 167-177 (FIG.
10E). In another specific embodiment, the seventh enzyme is COR. In another specific embodiment, the
COR is as set forth in any one of the sequences depicted in FIGs. 9E and 10F (e.g., SEQ ID NOs: 6 1 and
179-193). In another specific embodiment, the COR is from Papaver somniferum (Ps). In another specific embodiment, PsCOR is as set forth in any one of the sequences as depicted in SEQ ID NOs: 6 1 and 179-
189 (FIG. 10F).
[0047] Any of the methods described above may further comprise a cytochrome b5 (Cyti>5). In a specific embodiment, Cy 5 is as set forth in any one of the sequences as depicted in FIGs. 9E or 10G (e.g.,
SEQ ID NOs: 64, 66 and 194)
[0048] As used herein, the terms "first enzymes", "second enzymes", etc. and "first heterologous coding sequence", "second heterologous coding sequence", etc. do not denote the sequence/order in which the enzymes are acting on substrates. These terms are merely used for convenient claiming. Hence for instance, in an embodiment where the first, second, third, fourth, fifth, sixth and seventh enzymes are SAS,
CPR, SAR, SAT, CODM, T60DM and COR, CODM and T60DM may both act on thebaine (see e.g., FIG.
1), so that depending on various factors including their relative specificity of each of these enzymes towards this substrate, T60DM and/or CODM will act first. If T60DM has more specificity towards thebaine than
CODM, it will favor the pathway towards neopinone and codeinone which will then be transformed into codeine by COR, and codeine will then be transformed into morphine by CODM. Similarly, if CODM has more specificity towards thebaine than T60DM, it will favor the pathway towards oripavine which will then be transformed into morphinone by T60DM, and morphinone will then be transformed into morphine by COR.
Both pathways can co-exist in the methods.
Plasmids
[0049] In accordance with another aspect of the invention, there is provided a plasmid comprising a nucleic acid encoding at least one of the SAS, CPR, SAR, SAT, CODM, T60DM and COR enzymes as defined herein. . In a specific embodiment, these enzymes are as set forth in any one of the sequences depicted in FIGs. 9E or 10 or as defined above e.g., in the method comprising one or more enzyme(s).
[0050] In another specific embodiment, the plasmid comprises comprising a nucleic acid encoding at least two of the SAS, CPR, SAR, SAT, CODM, T60DM and COR enzymes as defined herein. In a more specific embodiment, the plasmid comprises a nucleic acid encoding the SAS and CPR as defined herein; SAR and SAT as defined herein, SAT and CODM as defined herein; SAT and T60DM as defined herein;
CODM and T60DM as defined herein; T60DM and COR as defined herein; T60DM and COR as defined
herein; or COR and CODM as defined herein. . In a specific embodiment, these enzymes are as set forth in
any one of the sequences depicted in FIGs. 9E or 10 or as defined above e.g., in the method comprising
one or more enzyme(s).
[0051] In another specific embodiment, the plasmid comprises comprising a nucleic acid encoding
at least three of the SAS, CPR, SAR, SAT, CODM, T60DM and COR enzymes as defined herein. In a more
specific embodiment, the plasmid comprises a nucleic acid encoding SAS, CPR and SAR as defined herein;
SAR, SAT and CODM as defined herein; SAR, SAT and T60DM as defined herein; SAT, CODM and
T60DM as defined herein; SAT, T60DM and COR as defined herein; or CODM, T60DM and COR as
defined herein. In a specific embodiment, these enzymes are as set forth in any one of the sequences
depicted in FIGs. 9E or 10 or as defined above e.g., in the method comprising one or more enzyme(s).
[0052] In another specific embodiment, the plasmid comprises comprising a nucleic acid encoding
at least four of the SAS, CPR, SAR, SAT, CODM, T60DM and COR enzymes as defined herein. In a more
specific embodiment, the plasmid comprises a nucleic acid encoding SAS, CPR, SAR and SAT as defined
herein; SAR, SAT, CODM and T60DM as defined herein; or SAR, SAT, T60DM and COR as defined
herein. In a specific embodiment, these enzymes are as set forth in any one of the sequences depicted in
FIGs. 9E or 10 or as defined above e.g., in the method comprising one or more enzyme(s).
[0053] In another specific embodiment, the plasmid comprises comprising a nucleic acid encoding
at least five of the SAS, CPR, SAR, SAT, CODM, T60DM and COR enzymes as defined herein. In a more
specific embodiment, the plasmid comprises a nucleic acid encoding SAS, CPR, SAR, SAT and CODM as
defined herein; SAS, CPR, SAR, SAT and T60DM as defined herein; or SAR, SAT, CODM, T60DM and
COR as defined herein. In a specific embodiment, these enzymes are as set forth in any one of the
sequences depicted in FIGs. 9E or 10 or as defined above e.g., in the method comprising one or more
enzyme(s).
[0054] In another specific embodiment, the plasmid comprises comprising a nucleic acid encoding
at least six of the SAS, CPR, SAR, SAT, CODM, T60DM and COR enzymes as defined herein. In a more
specific embodiment, the plasmid comprises a nucleic acid encoding SAS, CPR, SAR, SAT, CODM and
T60DM; or SAS, CPR, SAR, SAT, T60DM and COR. In a specific embodiment, these enzymes are as set forth in any one of the sequences depicted in FIGs. 9E or 10 or as defined above e.g., in the method
comprising one or more enzyme(s).
[0055] In another specific embodiment, the plasmid comprises comprising a nucleic acid encoding
the SAS, CPR, SAR, SAT, CODM, T60DM and COR enzymes as defined herein. [0056] In another specific embodiment, the plasmid comprises a nucleic acid encoding a cytochrome b5 (Cy 5). In a specific embodiment, these enzymes are as set forth in any one of the sequences depicted in FIGs. 9E or 10 or as defined above e.g., in the method comprising one or more enzyme(s).
[0057] In another specific embodiment, the plasmid is as set forth in any one of the plasmids pGC263 (SAS-HA tag) (SEQ ID NO: 6); pGC264 (CPR-HA tag) (SEQ ID NO: 7); pGC265 (SAR -HA tag)
(SEQ ID NO: 8); pGC359 (SAS, CPR, SAR, SAT) (SEQ ID NO: 9); pGC719 (SAS, CPR) (SEQ ID NO: 10); pGC720 (truncated SAS, CPR) (SEQ ID NO: 11); pGC721 (NTCAS-SAS , CPR) (SEQ ID NO: 12); pGC722
(NTCFS-SAS , CPR) (SEQ ID NO: 13); or pGC1 1 (T60DM, CODM, COR) (SEQ ID NO: 14).
[0058] In accordance with another specific embodiment of the present invention, there is provided a plasmid comprising nucleic acid encoding: (a) the SAS, CPR, SAR and/or SAT enzymes as defined herein; or (b) the CODM, T60DM and/or COR enzymes as defined herein. In another specific embodiment, the plasmid is (i) pGC359 as depicted in FIG. 9 (SEQ ID NO: 9); or (ii) pGC1 1 as depicted in FIG. 9 (SEQ ID
NO: 14).
[0059] In another specific embodiment, the plasmid further comprises a terminator and/or a promoter.
Cells
[0060] In accordance with another aspect of the invention, there is provided a host cell comprising any one of the plasmid described above or any one of the enzymes or combinations of enzymes encoded in any one of the plasmides described above.
[0061] In accordance with another specific embodiment of the present invention, there is provided a recombinant host cell expressing (a) the SAS, CPR, SAR and/or SAT enzymes as defined herein; (b) the
CODM, T60DM and/or COR enzymes as defined herein; or (c) one or more of the plasmids as defined herein. In a specific embodiment, the cell further expresses cytochrome b5 (Cyto5). In another specific embodiment, the Cy 5 is as set forth in any one of the sequences as depicted in FIG. 10G {e.g., SEQ ID
NOs: 64, 66 and 194).
[0062] In a specific embodiment of the any of the above methods, the host cell is a yeast cell. In another specific embodiment, the yeast is Saccharomyces. In another specific embodiment, the
Sacharomyces is Sacharomyces cerevisiae.
Enzymes
[0063] In a specific embodiment of any one of the methods, plasmids, or cells described above, (i) the SAS is as set forth in any one of the sequences as depicted in FIGs. 9E and 10A (e.g., SEQ ID NOs :41 , 44-46, 68-80 and 277-288); (ii) the CPR is as set forth in any one of the sequences as depicted in FIGs. 9E
and 10B (e.g., SEQ ID NOs: 47, 81-1 18 and 289-322); (iii) the SAR is as set forth in any one of the
sequences as depicted in FIGs. 9E and 10C (e.g., SEQ ID NOs: 50 and 119-135); (iv) the SAT is as set forth
in any one of the sequences as depicted in FIGs. 9E or 10D (e.g., SEQ ID NOs: 52 and 136-166); (v) the
CODM is as set forth in any one of the sequences as depicted in FIGs. 9E or 10E (e.g., SEQ ID NOs: 55, 58
and 167-1 78); (vi) the T60DM is as set forth in any one of the sequences as depicted in FIGs. 9E or 10E
(e.g., SEQ ID NOs: 55, 58 and 167-178); (vii) the COR is as set forth in any one of the sequences as
depicted in FIGs. 9E or 10F (e.g., SEQ ID NOs: 6 1 and 179-193); and/or (viii) the Cyt 5 is as set forth in any
one of the sequences as depicted in FIGs. 9E or 10G (e.g., SEQ ID NOs: 64, 66 and 194).
[0064] The SAS sequences "as depicted in FIG. 10A" or "as set forth in any one of the sequences
as depicted in FIGs. 9E or 10A" or the like include the sequences without transmembrane domain (e.g., not
shaded) of each of the species and consensus sequences shown in FIG. 10A or FIGs. 9E and 10A.
Similarly, CPR sequences "as depicted in FIG. 10B" or "as set forth in any one of the sequences as depicted
in FIGs. 9E or 10B" or the like includes the sequences without transmembrane domain (e.g., not shaded) of
each of the species and consensus sequences shown in FIG. 10B or 9E and 10B.
[0065] In another specific embodiment of any one of the methods, plasmids, or cells described
above, (i) the SAS is from Papaver somniferum; (ii) the CPR is from Papaver somniferum; (iii) the SAR is from Papaver somniferum; (iv) the SAT is from Papaver somniferum; (v) the CODM is from Papaver
somniferum; (vi) the T60DM is from Papaver somniferum; (vii) the COR is from Papaver somniferum; and/or
(viii) the Cytb5 is from Papaver somniferum.
[0066] In a more specific embodiment of any one of the methods, plasmids, or cells described
above, (i) the PsSAS is as set forth in any one of SEQ ID NOs: 4 1, 44-46, 70-78 and 279-288 (FIGs. 9E and
10A); (ii) PsCPR is as set forth in SEQ ID NO: 47 or 296 (FIGs. 9E and 10B); (iii) the PsSAR is as set forth in
any one of SEQ ID NOs: 50, 119-121 , 126-127, 130 and 133 (FIGs. 9E and 10C); (iv) the PsSAT is as set forth in any one of SEQ ID NOs:52 and 136-165 (FIGs. 9E and 10D); (v) the PsCODM is is as set forth in
any one of SEQ ID NOs: 55, 58 and 167-1 77 (FIGs. 9E and 10E), preferably Pso9 (FIG. 10E (SEQ ID
NO:175)); (vi) the PsT60DM is as set forth in any one of SEQ ID NOs: 55, 58 and 167-177 (FIGs. 9E and
10E); and/or (vii) the PsCOR is as set forth in any one of SEQ ID NOs: 6 1 and 179-189 (FIGs. 9E and 10F);
and/or (viii) the PsCytf)5 is as set forth in SEQ ID NO: 64 (FIGs. 9E and 10G).
[0067] The PsSAS sequences "as set forth in any one of SEQ ID NOs: 4 1, 44-46, 70-78 and 279-
288 (FIGs. 9E and1 0A)" or the like includes the sequences without transmembrane domain (e.g., not
shaded) of any of the Papaver somniferum sequences shown in FIGs. 9E or 10A. Similarly, the PsCPR
sequences "as set forth in SEQ ID NO: 47 (FIGs. 9E and 10B)" or the like includes the sequences without
transmembrane domain (e.g., not shaded) of any of Papaver somniferum sequences shown in FIGs. 9E or 10B.
[0068] In accordance with another aspect of the invention, there is provided a polypeptide (i) as depicted in SEQ ID NO: 175 (FIG. 10E); or (ii) comprising an amino acid at least 60% identical to the polypeptide of (i) and having the ability to demethylate a morphinan at position 3. In accordance with another aspect of the invention, there is provided a polypeptide NTCAS-SAS (i) as depicted in SEQ ID NO: 45 (FIG.
9); or (ii) comprising an amino acid at least 60% identical (or 65%, 70%, 75%, 80%, 85%, 90%, 95%, 96%,
97%, 97%, 98% or 99% identical) to the polypeptide of (i) and having the ability to convert (R)-reticuline into salutaridine. In accordance with another aspect of the invention, there is provided a polypeptide NTCFS-SAS
(i) as depicted in SEQ ID NO: 46 (FIG. 9); or (ii) comprising an amino acid at least 60% identical (or 65%,
70%, 75%, 80%, 85%, 90%, 95%, 96%, 97%, 97%, 98% or 99 %)to the polypeptide of (i) and having the ability to convert (R)-reticuline into salutaridine.
[0069] In s more specific embodiment, there is provided a polypeptide Pso9 as set forth in SEQ ID
NO: 175 (FIG. 10E). In accordance with another embodiment, there is provided a polypeptide NTCAS-SAS as depicted in SEQ ID NO: 45 (FIG. 9E). In accordance with another embodiment, there is provided a polypeptide NTCFS-SAS as depicted in SEQ ID NO: 46 (FIG. 9E).
[0070] Other objects, advantages and features of the present invention will become more apparent upon reading of the following non-restrictive description of specific embodiments thereof, given by way of example only with reference to the accompanying drawings.
BRIEF DESCRIPTION OF THE DRAWINGS
[0071] In the appended drawings:
[0072] FIG. 1. Description of the (R)-reticuline to morphine biosynthetic pathway reconstituted in S. cerevisiae. The pathway is divided in two blocks of sequential enzymes all from P. somniferum. The thebaine block includes the enzymes involved in the synthesis of thebaine from (R)- reticuline: PsSAS, salutaridine synthase; PsCPR, cytochrome P450 reductase; PsSAR, salutaridinol reductase; PsSAT, salutaridinol acetyltransferase. The morphine block is composed of enzymes involved in the synthesis of morphine from thebaine: PsT60DM, thebaine-6-O-demethylase; PsCOR, codeinone reductase; PsCODM, codeine-O-demethylase. Boxed text identifies intermediates used as feeding substrates to test for functional expression of the assembled pathways in yeast.
[0073] FIGs. 2A to D: Reticuline production and utilization in engineered S. cerevisiae.
Biochemical pathway depicting reticuline production and utilization in opium poppy (FIG. 2A) and in engineered S. cerevisiae (FIG. 2B). FIG. 2C Immunoblot analysis of recombinant PsSAS and PsCPR expression in S. cerevisiae. FIG. 2D Reticuline production and utilization by strains expressing a recombinant reticuline-producing pathway (strain GCY1086 (60MT, CNMT and 4Ό ΜΤ2) as well as PsSAS and CPR (strain GCY1357), ΡεΒΒΕ∆Ν-2µ (strain GCY1359) or a complete dihydrosanguinarine pathway
(strain GCY1 125; [4]).
[0074] FIGs. 3A-E. Chiral analysis of reticuline produced from (R,S)-norlaudanosoline by
engineered S. cerevisiae. HPLC-MS chromatographic profile of authentic standards of FIG. 3A: ( ?)-
reticuline, FIG. 3B: (S)-reticuline and FIG. 3C: a mixture of (S)- and (R)-reticuline. FIG. 3D: Chiral analysis of
reticuline produced from (R,S)-norlaudanosoline in cell feeding assays of strain GCY1 125 expressing the
opium poppy Ps60MT, PsCNMT, Ps4'OMT2 ([4]). FIG. 3E: Chiral analysis of reticuline produced from (R,S)-
norlaudanosoline in cell feeding assays of strain GCY1086 expressing the opium poppy Ps60MT, PsCNMT
and Ps4'OMT2. FIG. 3F: Methylation pathway for conversion of (R,S)-norlaudanosoline to (S)-reticuline.
[0075] FIGs. 4A-B. Functional activity of PsSAS, PsCPR and PsSAR in S. cerevisiae. LC-FT-
MS chromatographic profile of culture supernatants from cell feeding assays in FIG. 4A of strain GCY1 356
encoding for PsSAS and PsCPR (pGC71 9) and incubated with 100 µ Μ (R)-reticuline; and in FIG. 4B of
strain GCY258 encoding for PsSAR (pGC265 (SAR-HA tag)) and incubated with 100 µΜ salutaridine.
Extracted ion chromatograms for fz = 328 and m z = 330 confirm the production of salutaridine and
salutaridinol, respectively.
[0076] FIGs. 5A-B. Synthesis of thebaine in engineered S. cerevisiae. Synthesis of thebaine from cell feeding assays at pH 7.5, 8. 8.5 or 9 and supplemented in FIG. 5A with 100 µΜ (R)-reticuline or in
FIG. 5B with 100 µΜ salutaridine. Strain GCY368 (expressing SAS, CPR, SAR, and SAT) was used for all
cell feeding assays. Error bars represent standard deviations of n=3.
[0077] FIGs 6A-B: Activity of N-terminal variants of PsSAS expressed in S. cerevisiae.
Synthesis of salutaridinol from (R)-reticuline FIG. 6A at pH 7.5 and FIG. 6B at pH 9. PsSAS was truncated
between amino acids 30 and 3 1 to generate truncated PsSAS. NTCAS-SAS is a fusion protein of the N-
terminal domain of PsCAS and truncated PsSAS and NTCFS-SAS is a fusion protein of the N-terminal
domain of PsCFS and truncated PsSAS.
[0078] FIGs. 7A-B. Synthesis of codeine and morphine in S. cerevisiae. 7A. Schematic
representation of the production of morphine from thebaine proceeding through the intermediate codeine.
Thebaine is demethylated to neopinone by T60DM. Neopinone spontaneously rearranges to codeinone or is
reduced to the side product neopine by COR. Codeine and neopine are demethylated to morphine and the
undesired side-product neomorphine by CODM; 7B. Synthesis of codeine and morphine from whole cell feeding assays were performed at pH 9 and supplemented with 100 µ Μ (R)-reticuline, 100 µ Μ salutaridine
or 100 µΜ codeine. GCY1358 was used in all cell feeding assays. Error bars represent standard deviations
of n=3. * Indicates the substrate used in the cell feeding assays.
[0079] FIGs. 8A-D: Synthesis of morphinans at pH 7.5 and 9 in cell feeding assays with strain GCY1358. Whole cell feeding assays at pH 7.5 and 9. Strain GCY1358 was supplemented with FIG. 8A 100
µΜ (R)-reticuline, FIG. 8B 100 µΜ salutaridine, FIG. 8C 100 µΜ thebaine, FIG. 8D 100 µΜ codeine. Error
bars represent standard deviations of at least n=2.
[0080] FIGs. 9 A-E. Amino acid and nucleotide sequences. FIG. 9A nucleotide sequences of vectors pGREG503 (SEQ ID NO: 1); pGREG504 (SEQ ID NO: 2); pGREG505 (SEQ ID NO: 3); pGREG506
(SEQ ID NO: 4); 2µ vector pYES2 (SEQ ID NO: 5); FIG. 9B nucleotide sequences of plasmids: pGC263
(SAS-HA tag) (SEQ ID NO: 6); pGC264 (CPR-HA tag) (SEQ ID NO: 7); pGC265 (SAR-HA tag) (SEQ ID NO:
8); pGC359 (SAS, CPR, SAR, SAT) (SEQ ID NO: 9); pGC71 9 (SAS, CPR) (SEQ ID NO: 10); pGC720
(truncated SAS, CPR) (SEQ ID NO: 11); pGC721 (NTCAS-SAS, CPR) (SEQ ID NO: 12); pGC722 (NTCFS-
SAS, CPR) (SEQ ID NO: 13); pGC1 1 (T60DM, CODM, COR) (SEQ ID NO: 14); pGC1062 (block 1 plasmid)
(SEQ ID NO: 15); pGC557 (CPR plasmid) (SEQ ID NO: 16); pGC655 (ΒΒΕ∆Ν plasmid) (SEQ ID NO: 17);
pBOT-LEU (SEQ ID NO: 18); FIG. 9C nucleotide sequences of promoters: TDH3 promoter (SEQ ID NO:
19); FBA1 promoter (SEQ ID NO: 20); PDC1 promoter (SEQ ID NO: 21); PMA1 promoter (SEQ ID NO: 22);
GAL1 promoter (SEQ ID NO: 23); GAL10 promoter (SEQ ID NO: 24); TEF1 promoter (SEQ ID NO: 25);
TEF2 promoter (SEQ ID NO: 26); PGK1 promoter (SEQ ID NO: 27); PYK1 promoter (SEQ ID NO: 28) TPI1
promoter (SEQ ID NO: 29); TDH2 promoter (SEQ ID NO: 30); EN02 promoter (SEQ ID NO: 31); HXT9
promoter (SEQ ID NO: 32); FIG. 9D nucleotide sequences of terminators: CYC1 terminator (SEQ ID NO:
33); ADH1 terminator (SEQ ID NO: 34); PGI1 terminator (SEQ ID NO: 35); ADH2 terminator (SEQ ID NO:
36); EN02 terminator (SEQ ID NO: 37); FBA1 terminator (SEQ ID NO: 38); TDH2 terminator (SEQ ID NO:
39); TPI1 terminator (SEQ ID NO: 40); and FIG. 9E Amino acid and nucleotide sequences of enzymes:
SAS: PsSAS protein sequence_gb ABR14720 (SEQ ID NO: 41); PsSAS_codon optimized nucleotide
sequence_gb KP400664 (N-terminal domain is shaded) (SEQ ID NO: 42); PsSAS_native nucleotide
sequence_gb EF451 150 (SEQ ID NO: 43); Truncated PsSAS protein sequence (SEQ ID NO: 44); NTCAS-
SAS protein sequence (truncated PsSAS with the N-terminal domain of CAS shaded) (SEQ ID NO: 45);
NTCFS-SAS (truncated PsSAS with the N-terminal domain of CFS shaded) (SEQ ID NO: 46); CPR; PsCPR
protein AHF27398 (SEQ ID NO: 47); PsCPR_codon optimized nucleotide sequence_gb KF661328 (SEQ ID
NO: 48); PsCPR native nucleotide sequence_gb U67185 (SEQ ID NO: 49); SAR: PsSAR protein
sequence_GI:3151 13446 (SEQ ID NO: 50); PsSAR codon optimized nucleotide sequence_gb KP400665
(SEQ ID NO: 5 1); SAT: PsSAT protein sequence_gb AAK73661 (SEQ ID NO: 52); PsSAT codon optimized
nucleotide sequence_gb KP400666 (SEQ ID NO: 53); PsSAT native nucleotide sequence_gb AF33991 3
(SEQ ID NO: 54); CODM: PsCODM protein sequence_gb D4N502 (ADD85331 ) (SEQ ID NO: 55); PsCODM
codon optimized nucleotide sequence_gb : KP4006667 (SEQ ID NO: 56); PsCODM native nucleotide
sequence_gb GQ500141 (SEQ ID NO: 57); T60DM: PsT60DM protein sequence_gb D4N500 (ADD85329)
(SEQ ID NO: 58); PsT60DM codon optimized nucleotide sequence_gb : KP4006668 (SEQ ID NO: 59);
PsT60DM native nucleotide sequence_gb GQ500139 (SEQ ID NO: 60); COR: PsCOR1 .3 (PsCOR) protein sequence_gb AAF13738 (SEQ ID NO: 61); PsCOR1 .3 codon optimized nucleotide sequence_gb :
KP4006669 (SEQ ID NO: 62); PsCOR1 .3 native nucleotide sequence_gb AF108434 (SEQ ID NO: 63); and
Cytb5:PsCytb5 protein sequence (SEQ ID NO: 64); PsCytb5 nucleotide sequence (SEQ ID NO: 65);
Synthetic Cytb5 construct, partial cds (derived from Artemisia annua) JQ582841 protein sequence (SEQ ID
NO: 66); and Synthetic Cytb5 construct nucleotide sequence (SEQ ID NO: 67).
[0081] FIGs. 10A-G Clustal™ Omega multiple alignments of homolog orthologues and candidates for each enzyme described in the reticuline to morphine pathway. Protein motives searched were performed using the PhytoMetaSyn (www.phytometasyn.ca) transcriptomics database to identify homologs (orthologues or paralogs) for each of the enzyme described in the reticuline to morphine pathway. Hence, amino acid alignments of orthologues for each of enzymes SAS, CPR, SAR, SAT, CODM and T60DM; and COR; and consensus sequences derived therefrom are presented. In these sequences, "*" denotes that the residues in that column are identical in all sequences of the alignment, ":" denotes that conserved substitutions have been observed, and "." denotes that semi-conserved substitutions have been observed. Consensus sequences derived from these alignments are also presented wherein X is any amino acid. Sequences corresponding to the N-terminal membrane-spanning domains of enzymes are shaded.
[0082] FIG. 10A: SAS: Papaver bracteatum candidate 2 (Pbr-2) (SEQ ID NOs: 69 and 278);
Papaver somniferum SAS PsoSAS-ABR14720: SAS used in the reticuline to morphine pathway; shaded
(SEQ ID NOs: 4 1 and 288); Papaver somniferum candidate 4 (Pso-4) (SEQ ID NOs: 70 and 279); Papaver somniferum candidate 5 (Pso-5) (SEQ ID NOs: 7 1 and 280); Papaver somniferum candidate 6 (Pso-6) (SEQ
ID NOs: 72 and 281); Papaver somniferum candidate 7 (Pso-7) (SEQ ID NOs: 73 and 282); Papaver somniferum candidate 8 (Pso-8) (SEQ ID NOs: 74 and 283); Papaver bracteatum candidate 1 (Pbr-1) (SEQ
ID NOs: 68 and 277); Papaver somniferum candidate 9 (Pso-9) (SEQ ID NOs: 75 and 284); Papaver somniferum candidate 10 (Pso-10) (SEQ ID NOs: 76 and 285); Papaver somniferum candidate 11 (Pso-1 1)
(SEQ ID NOs: 77 and 286); Papaver somniferum candidate 12 (Pso-12) (SEQ ID NOs: 78 and 287), and consensus sequences (e.g., SEQ ID NOs: 79 to 80). Truncated versions are shown (i.e. without shaded domain) for all above sequences (SEQ ID NOs: 277-288).
[0083] FIG. 10B: CPR: Corydalis cheilanthifolia candidate 2 (Cch-2) (SEQ ID NOs: 96 and 304);
Glaucium flavum candidate 2 (Gfl-2) (SEQ ID NOs: 92 and 300); Chelidonium majus candidate 3 (Cma-3)
(SEQ ID NOs: 87 and 295); Stylophorum diphyllum candidate 2 (Sdi-2) (SEQ ID NOs: 89 and 297); Papaver bracteatum candidate 2 (Pbr-2) (SEQ ID NOs: 82 and 290); Argemone Mexicana candidate 2 (Ame-2) (SEQ
ID NOs: 94 and 302); Jeffersonia diphylla candidate 1 (Jdi-1) (SEQ ID NOs: 106 and 312); Nandina domestica candidate 2 (Ndo-2) (SEQ ID NOs: 108 and 314); Mahonia aquifolium candidate 1 (Maq-1) (SEQ
ID NO: 104); Berberis thunbergii candidate 1 (Bth-1 ) (SEQ ID NOs: 103 and 3 10); Mahonia aquifolium candidate 2 (Maq-2) (SEQ ID NOs: 105 and 3 11); Cissampelos mucronata candidate 2 (Cmu-2) (SEQ ID NOs: 112 and 318); Menispermum canadense candidate 2 (Mca-2) (SEQ ID NOs: 110 and 316); Tinospora
cordifolia candidate 3 (Tco-3) (SEQ ID NOs: 116 and 322); Thalictrum flavum candidate 2 (Tfl-2) (SEQ ID
NO: 98); Hydrastis canadensis candidate 1 (Hca-1) (SEQ ID NOs: 99 and 306); Xanthorhiza simplicissima
candidate 2 (Xsi-2) (SEQ ID NOs: 102 and 309); Cissampelos mucronata candidate 3 (Cmu-3) (SEQ ID
NOs: 113 and 319); Papaver somniferum CPR (PsoCPR-AHF27398:CPR used in the reticuline to morphine
pathway; shaded) (SEQ ID NOs: 47 and 296); Papaver bracteatum candidate 1 (Pbr-1) (SEQ ID NOs: 8 1
and 289); Argemone mexicana candidate 1 (Ame-1) (SEQ ID NOs: 93 and 301); Sanguinaria canadensis
candidate 2 (Sca-2) (SEQ ID NOs: 84 and 292); Corydalis cheilanthifolia candidate 1 (Cch-1) (SEQ ID NOs:
95 and 303); Nandina domestica candidate 1 (Ndo-1) (SEQ ID NOs: 107 and 313); Sanguinaria canadensis
candidate 1 (Sca-1) (SEQ ID NOs: 83 and 291 ); Glaucium flavum candidate 1 (Gfl-1) (SEQ ID NOs: 9 1 and
299); Eschscholzia californica candidate 1 (Eca-1) (SEQ ID NOs: 90 and 298); Stylophorum diphyllum
candidate 1 (Sdi-1) (SEQ ID NO: 88); Chelidonium majus candidate 1 (Cma-1) (SEQ ID NOs: 85 and 293);
Chelidonium majus candidate 2 (Cma-2) (SEQ ID NOs: 86 and 294); Cissampelos mucronata candidate 1
(Cmu-1) (SEQ ID NOs: 111 and 3 17); Menispermum canadense candidate 1 (Mca-1) (SEQ ID NOs: 109 and
3 15); Tinospora cordifolia candidate 1 (Tco-1) (SEQ ID NOs: 114 and 320); Tinospora cordifolia candidate 2
(Tco-2) (SEQ ID NOs: 115 and 321); Xanthorhiza simplicissima candidate 1 (Xsi-1) (SEQ ID NOs: 101 and
308); Thalictrum flavum candidate 1 (Tfl-1) (SEQ ID NOs: 97 and 305); Nigella sativa candidate 1 (Nsa-1)
(SEQ ID NOs: 100 and 307), and consensus sequences (e.g., SEQ ID NOs: 117 and 118). Truncated versions are also shown (i.e. without shaded domain) for above sequences (SEQ ID NOs: 289-322).
[0084] FIG. 10C: SAR: Papaver bracteatum candidate 1 (Pbr-1) (SEQ ID NO: 122); Papaver
somniferum candidate 3 (Pso-3) (SEQ ID NO: 130); Papaver somniferum candidate 6 (Pso-6) (SEQ ID NO:
121); Papaver somniferum SAR (PsoSAR-ABR14720: SAR used in the reticuline to morphine pathway;
shaded) (SEQ ID NO: 50); Papaver somniferum candidate 7 (Pso-7) (SEQ ID NO: 120); Papaver
somniferum candidate 4 (Pso-4) (SEQ ID NO: 133); Chelidonium majus candidate 2 (Cma-2) (SEQ ID NO:
134); Papaver somniferum candidate 5 (Pso-5) (SEQ ID NO: 119); Papaver bracteatum candidate 2 (Pbr-2)
(SEQ ID NO: 131); Papaver bracteatum candidate 3 (Pbr-3) (SEQ ID NO: 132); Nandina domestica
candidate 1 (Ndo-1) (SEQ ID NO: 123); Chelidonium majus candidate 1 (Cma-1) (SEQ ID NO: 124);
Argemone Mexicana candidate 1 (Ame-1) (SEQ ID NO: 125); Papaver somniferum candidate 1 (Pso-1)
(SEQ ID NO: 126); Papaver somniferum candidate 2 (Pso-2) (SEQ ID NO: 127); Argemone Mexicana
candidate 2 (Ame-2) (SEQ ID NO: 128); Eschscholzia californica candidate 1 (Eca-1) (SEQ ID NO: 129);
and consensus sequences (e.g., SEQ ID NO: 135).
[0085] FIG. 10D: SAT: Papaver somniferum candidate 13 (Pso-1 3) (SEQ ID NO: 148); Papaver
somniferum candidate 16 (Pso-1 6) (SEQ ID NO: 151 ); Papaver somniferum candidate 12 (Pso-1 2) (SEQ ID
NO: 147); Papaver somniferum candidate 14 (Pso-14) (SEQ ID NO: 149); Papaver somniferum candidate 10
(Pso-10) (SEQ ID NO: 145); Papaver somniferum candidate 11 (Pso-1 1) (SEQ ID NO: 146); Papaver somniferum candidate 2 (Pso-2) (SEQ ID NO: 137); Papaver somniferum candidate 3 (Pso-3) (SEQ ID NO:
138); Papaver somniferum SAT (PsoSAT-AAK73661 : SAT used in the reticuline to morphine pathway;
shaded) (SEQ ID NO: 52) ; Papaver somniferum candidate 17 (Pso-1 7) (SEQ ID NO: 152); Papaver
somniferum candidate 18 (Pso-1 8) (SEQ ID NO: 153); Papaver somniferum candidate 7 (Pso-7) (SEQ ID
NO: 142); Papaver somniferum candidate 8 (Pso-8) (SEQ ID NO: 143); Papaver somniferum candidate 9
(Pso-9) (SEQ ID NO: 144); Papaver somniferum candidate 15 (Pso-1 5) (SEQ ID NO: 15); Papaver
somniferum candidate 5 (Pso-5) (SEQ ID NO: 140); Papaver somniferum candidate 6 (Pso-6) (SEQ ID NO:
141); Papaver somniferum candidate 1 (Pso-1) (SEQ ID NO: 136); Papaver somniferum candidate 4 (Pso-4)
(SEQ ID NO: 139); Papaver somniferum candidate 19 (Pso-1 9) (SEQ ID NO: 154); Papaver somniferum
candidate 20 (Pso-20) (SEQ ID NO: 155); Papaver somniferum candidate 2 1 (Pso-21) (SEQ ID NO: 156);
Papaver somniferum candidate 22 (Pso-22) (SEQ ID NO: 157); Papaver somniferum candidate 25 (Pso-25)
(SEQ ID NO: 160); Papaver somniferum candidate 23 (Pso-23) (SEQ ID NO: 158); Papaver somniferum
candidate 24 (Pso-24) (SEQ ID NO: 159); Papaver somniferum candidate 26 (Pso-26) (SEQ ID NO: 161);
Papaver somniferum candidate 27 (Pso-27) (SEQ ID NO: 162); Papaver somniferum candidate 28 (Pso-28)
(SEQ ID NO: 163); Papaver somniferum candidate 29 (Pso-29) (SEQ ID NO: 164); Papaver somniferum
candidate 30 (Pso-30) (SEQ ID NO: 165); and consensus sequences (e.g., SEQ ID NO: 166).
[0086] FIG. 10E: CODM and T60DM: Papaver somniferum candidate 5 (Pso5) (SEQ ID NO: 171);
Papaver somniferum candidate 6 (Pso6) (SEQ ID NO: 172); Papaver somniferum candidate 4 (Pso4) (SEQ
ID NO: 170); Papaver somniferum candidate 7 (Pso7) (SEQ ID NO: 173); Papaver somniferum candidate 8
(Pso8) (SEQ ID NO: 174); Papaver somniferum candidate 9 (Pso9) (SEQ ID NO: 175); Papaver somniferum
candidate 2 (Pso2) (SEQ ID NO: 168); Papaver somniferum candidate 3 (Pso3; GenBank AGL52587) (SEQ
ID NO: 169); Papaver somniferum T60DM (PsoT60DM-ADD85329: T60DM used in the reticuline to
morphine pathway and as positive controls in ODM screens; shaded) (SEQ ID NO: 58); Papaver somniferum
candidate 12 (Pso12; GenBank ADD85330) (SEQ ID NO: 176); Papaver somniferum candidate 1 (Pso1)
(SEQ ID NO: 167); Papaver somniferum CODM (PsoCODM-ADD85331 : CODM used in the reticuline to
morphine pathway; shaded) (SEQ ID NO: 55); Papaver somniferum candidate 13 (Pso13; GenBank
AGL52588) (SEQ ID NO: 177); and consensus sequences (e.g., SEQ ID NO: 178).
[0087] FIG. 10F: COR from Papaver bracteatum candidate 1 (Pbr-1) (SEQ ID NO: 184); Papaver
bracteatum candidate 3 (Pbr-3) (SEQ ID NO: 186); Argemone Mexicana candidate 1 (Ame-1) (SEQ ID NO:
190); Papaver bracteatum candidate 5 (Pbr-5) (SEQ ID NO: 188); Papaver somniferum candidate 4 (Pso-4)
(SEQ ID NO: 182); Papaver somniferum candidate 5 (Pso-5) (SEQ ID NO: 183); Eschscholzia californica
candidate 1 (Eca-1) (SEQ ID NO: 192); Papaver bracteatum candidate 4 (Pbr-4) (SEQ ID NO: 187); Papaver
bracteatum candidate 2 (Pbr-2) (SEQ ID NO: 185); Papaver somniferum candidate 1 (Pso-1 ; GenBank
B9VRJ2) (SEQ ID NO: 179); Papaver somniferum COR1 .3 (PsoCORI .3-Q9SQ68: COR used in the
reticuline to morphine pathway; shaded) (SEQ ID NO: 61); Papaver somniferum candidate 2 (Pso-2; GenBank Q95Q67) (SEQ ID NO: 180); Papaver somniferum candidate 3 (Pso-3) (SEQ ID NO: 181 );
Papaver bracteatum candidate 6 (Pbr-6) (SEQ ID NO: 189); Chelidonium majus candidate 1 (Cma-1) (SEQ
ID NO: 191); and consensus sequences (e.g., SEQ ID NO: 193).
[0088] FIG. 10G. Cytochrome B5 from Papaver somniferum (SEQ ID NO: 64) and Artemisia annua
(SEQ ID NO: 66), and consensus sequences (e.g., SEQ ID NO: 194).
[0089] FIGs. 11A-C. Extracted ion chromatograms and MS2 spectrum of intermediates
accumulated by S. cerevisiae expressing the reticuline to morphine pathway (GCY1358) used in FIG.
7B. Cell feeding assays using in FIG. 11A a 100 µΜ (R)-reticuline; in FIG. 11B 100 µΜ salutaridine; or in
FIG. 11C 100 µΜ codeine. S corresponds to salutaridine; C corresponds to codeine; N corresponds to
neopine; CC corresponds to codeinone; M corresponds to morphine.
[0090] FIG. 12. Viable plate count for cell feeding assays. S. cerevisiae plate counts assay
showing cell viability before (time 0) and after (time 16 hrs.) incubation in a Tris-HCI buffer at a pH ranging from 7.5 to 9. Bars represent a range of n=2. S. cerevisiae CEN.PK1 13-16B was used to test cell viability
under cell feeding assay conditions. Overnight cultures were diluted to 10% into 1 ml. of fresh SC-GLU in 96
deep-well plates and incubated for an additional 6 hrs. Cells were harvested by centrifugation at 2000 x g for
2 min and suspended in 300 µ Ι of either SC-GLU or Tris-HCI (100mM) at pH 7.5, 8, 8.5 or 9. Serial dilutions
of the cells were made in 96-well plate and 0.1 M sorbitol before and after incubation for 16 hrs. at 30°C and
400 rp . Duplicate samples from 2 independent dilutions were plated on SC-GLC + 2% agar to determine
the number of colony forming units (CFUs).
[0091] FIGs. 13A-D. ODMs homologs from P. somniferum. 13A. Phylogenetic tree of ODMs
candidates from P. somniferum. Full arrows indicate PsoT60DM and PsoCODM, which were used in the
reticuline to morphine pathway and are used as positive controls in screening for expression and screening for activities of the new candidates. 13B Expression in S. cerevisiae of ODMs candidates (Pso1 to Pso9 and
Pso12 shown in FIG. 10E) measured by mean GFP fluorescence. ODMs candidates were tagged with GFP.
13C Activity of ODM candidates from cell feeding assays with 100 µΜ thebaine at pH 8. Thebaine can be
demethylated at position 3' to give oripavine and/or at position 6' to give neopinone, which spontaneously
rearranges to codeinone. PsoCODM and PsoT60DM demethylate position 3' and 6', respectively, and they
are shown as positive controls. 13D Activity of ODM candidates from cell feeding assays with 100 µΜ
codeine at pH 8. Codeine can be demethylated only at 3'. CODM is shown as positive control.
[0092] FIG. 14. Description of the pBOT vector system. The four pBOT versions available
contain a different auxotrophy (LEU, URA, HIS or TRP) and different promoter-terminator pairs associated with each auxotrophy. Any gene of interest can be cloned by Sapl restriction digestion and ligation. Target
genes are PCR amplified using primers that add a Sapl site at the 5' and at the 3' as follows: 5'-
GCTCTTCTACA -GENE-GGCTGAAGAGC-3' (SEQ ID NOs: 195-196). Digestion of vector generates 5' overhangs on vector (TGT and GGC) which complement designed 5' overhangs on digested gene
sequences (ACA and CCG). Ligation of Sapl digested plasmid and target gene will reconstitute a functional
Kozak sequence at the 5' of the gene (AAACA (SEQ ID NO: 197)) followed by the ATG first codon and no
extra UTRs region added. A linker of 36 nucleotides (12 amino acids) is present between the gene and the
GFP (designated UVGFP on FIG. 14).
[0093] FIGs. 15A-F. Clustal Omega™ neighbour-joining trees without distance corrections.
FIG. 15A phylogenetic trees for SAS enzymes of FIG. 10A; FIG. 15B phylogenetic tree for CPR enzymes of
FIG. 10B; FIG. 15C phylogenetic tree for SAR enzymes of FIG. 10C; FIG. 15D phylogenetic tree for SAT
enzymes of FIG. 10D; FIG. 15E phylogenetic tree for CODM and T60DM enzymes of FIG. 10E; and FIG.
15F phylogenetic tree for COR enzymes of FIG. 10E.
DESCRIPTION OF ILLUSTRATIVE EMBODIMENTS
Definitions
General Definitions
[0094] Headings, and other identifiers, e.g., (a), (b), (i), (ii), etc., are presented merely for ease of reading
the specification and claims. The use of headings or other identifiers in the specification or claims does not
necessarily require the steps or elements be performed in alphabetical or numerical order or the order in which they are presented.
[0095] In the present description, a number of terms are extensively utilized. In order to provide a clear and
consistent understanding of the specification and claims, including the scope to be given such terms, the following definitions are provided.
[0096] The use of the word "a" or "an" when used in conjunction with the term "comprising" in the claims
and/or the specification may mean "one" but it is also consistent with the meaning of "one or more", "at least
one", and "one or more than one".
[0097] Throughout this application, the term "about" is used to indicate that a value includes the standard
deviation of error for the device or method being employed to determine the value. In general, the
terminology "about" is meant to designate a possible variation of up to 10%. Therefore, a variation of 1, 2, 3,
4, 5, 6, 7, 8, 9 and 10% of a value is included in the term "about". Unless indicated otherwise, use of the term
"about" before a range applies to both ends of the range.
[0098] As used in this specification and claim(s), the words "comprising" (and any form of comprising,
such as "comprise" and "comprises"), "having" (and any form of having, such as "have" and "has"),
"including" (and any form of including, such as "includes" and "include") or "containing" (and any form of
containing, such as "contains" and "contain") are inclusive or open-ended and do not exclude additional, un- recited elements or method steps.
[0099] As used herein, the term "consists of or "consisting of means including only the elements, steps, or ingredients specifically recited in the particular claimed embodiment or claim.
Enzymes
[00100] The present invention relates to enzymes involved in a BIA synthetic pathway encoded by plasmids or chromosomes in a host cell and improved methods of use thereof to produce various BIA metabolites.
[00101] Without being so limited, enzymes encompassed by the present invention include: native or synthetic enzymes salutaridine synthase (SAS), cytochrome P450 reductase (CPR), salutaridine reductase
(SAR), salutaridinol 7-O-acetyltransferase (SAT), codeine-O-demethylase (CODM), thebaine 6-0- demethylase (T60DM), and codeinone reductase (COR), cytochrome b5.
[00102] As used herein, the term "ODM" refers to demethylases including CODM and T60DM. As used herein, an enzyme able to demethylate a morphinan at position 3 (e.g., demethylate thebaine into oripavine and/or demethylate codeine into morphine) and an enzyme able to demethylate a morphinan at position 6 (e.g., demethylate thebaine into neopinone and/or demethylate oripavine into morphinone) are
CODMs and T60DMs, respectively. CODMs can also possess T60DM activity i.e., qualify as T60DM, and similarly T60DM can also possess CODM activity i.e. qualify as CODM.
[00103] Useful enzymes for the present invention may be isolated from Papaver somniferum,
Eschscholzia califomica, other Papaveraceae (e.g., Papaver bracteatum, Sanguinaria canadensis,
Chelidonium majus, Stylophorum diphyllum, Glaucium flavum, Argemone mexicana and Corydalis cheilanthifolia), Ranunculaceae (e.g., Thalictrum flavum, Hydrastis canadensis, Nigella sativa, Xanthorhiza simplicissima), Berberidaceae (e.g., Berberis thunbergii, Mahonia aquifolium, Jeffersonia diphylla, and
Nandina domestica), or Menispermaceae (e.g., Menispermum canadense, Cissampelos mucronata,
Tinospora cordifolia), etc. The truncated (e.g., devoid of transmembrane domains) and full amino acid sequences of illustrative examples of these enzymes (e.g., SAS) are presented in Figures herein (e.g., FIGs.
9E-1 0).
[00104] Consensuses derived from the alignments of certain of these orthologues are also presented in FIG.
10. In specific embodiment of these consensuses, each X in the consensus sequences (e.g., consensuses in FIG. 10) is defined as being any amino acid, or absent when this position is absent in one or more of the orthologues presented in the alignment (e.g., SEQ ID NOs:79-80, 117-1 18, 135, 166, 178 and 193). In specific embodiment of these consensuses, each X in the consensus sequences is defined as being any amino acid that constitutes a conserved or semi-conserved substitution of any of the amino acid in the corresponding position in the orthologues presented in the alignment, or absent when this position is absent in one or more of the orthologues presented in the alignment. In FIGs. 10A to G , conservative substitutions are denoted by the symbol ":" and semi-conservative substitutions are denoted by the symbol In another
embodiment, each X refers to any amino acid belonging to the same class as any of the amino acid residues
in the corresponding position in the orthologues presented in the alignment, or absent when this position is
absent in one or more of the orthologues presented in the alignment. In another embodiment, each X refers
to any amino acid in the corresponding position of the orthologues presented in the alignment, or absent when this position is absent in one or more of the orthologues presented in the alignment.. The Table below
indicates which amino acid belongs to each amino acid class.
[00105] In other specific embodiments of the enzymes as used in the present invention, the small "o"
denotes alcohol and refers to S or T; small "I" denotes aliphatic and refers to I, L or V; period "." denotes any
amino acid; small "a" denotes aromatic and refers to F, H, W or Y; small "c" denotes charged and refers to D,
E, H, K or ; small "h" denotes hydrophobic and refers to A, C, F, G, H, I, K, L, M, R, T, V, W or Y; minus
sign "-" denotes negative and refers to D or E; small "p" denotes polar and refers to C, D, E, H, K, N, Q, R, S
or T; plus sign "+" denotes positive and refers to H, K or R; small "s" denotes small and refers to A, C, D, G,
N, P, S, T or V; small "u" denotes tiny and refers to A, G or S; small "t" denotes turn like and refers to A, C,
D, E, G, H, K, N, Q, R, S and T.
[00106] Hence enzymes in accordance with the present invention include enzymes having the specific
nucleotide or amino acid sequences described in FIGs. 9-10, or an amino acid sequence that satisfies any of
the consensuses as defined above (e.g., SEQ ID NOs:79-80, 117-1 18, 135, 166, 178 and 193) (e.g., FIG.
10). In particular, it includes enzyme sequences satisfying the consensus sequences described in FIG. 10
(full and truncated (e.g. devoid of shaded domain (e.g., SEQ ID Nos: 80 and 118))) wherein the one or more
Xs are defined as above. It also refers to consensus sequences of catalytic domains of these enzymes.
Enzyme sequences in accordance with the present invention include the specific sequences described in
FIGs. 9-1 0 with up to 10 amino acids (9, 8, 7, 6, 5, 4, 3, 2 or 1) truncated at the N- and/or C-terminal thereof.
[00107] More particularly, SAS as depicted in FIGs. 9E and 10A SEQ ID NOs: 4 1, 4446, 68-80, 277-288;
CPR as depicted in FIGs. 9E and 10B SEQ ID NOs: 47, 81-1 18 and 289-322; SAR as depicted in FIGs. 9E and 10C SEQ ID NOs: 50 and 119-135; SAT as depicted in FIGs. 9E and 10D SEQ ID NOs: 52 and 136-
166; CODM and T60DM as depicted in FIGs. 9E and 10E SEQ ID NOs: 55, 58 and 167-178; COR as
depicted in FIGs. 9E and 10F SEQ ID NOs: 6 1 and 179-1 93; cytochrome W as depicted in in FIGs. 9E and
10G SEQ ID NOs: 64, 66 and 194; and enzymes converting (S)-reticuline into (R)-reticuline such as the fusion protein STORR as described in Winzer et al. [40].
[001 08] In a more specific embodiment, the enzymes are from Papaver somniferum.
[00109] For example, the enzymes may be as described in FIG. 9. Hence SAS as depicted in FIG. 9 SEQ
ID NO: 4 1 {Papaver somniferum - ABR14720) (and its truncated versions SEQ ID NOs: 44 and 288) and
encoded by codon optimized nucleotide sequence_gb KP400664 SEQ ID NO: 42; Papaver somniferum
native (native sequence_gb EF451 150) encoded by SEQ ID NO: 43; truncated PsSAS protein sequence
(SEQ ID NO: 44); NTCAS-SAS protein sequence (truncated PsSAS with the N-terminal domain of CAS
shaded) (SEQ ID NO: 45); or NTCFS-SAS (truncated PsSAS with the N-terminal domain of CFS shaded)
(SEQ ID NO: 46); CPR as depicted in FIG. 9, SEQ ID NO: 47 {Papaver somniferum AHF27398) (and its
truncated version SEQ ID NO: 296) and encoded by codon-optimized by DNA2.0 for optimal expression in
yeast (KF661328) SEQ ID NO: 48; or encoded by Papaver somniferum native (U67185) as depicted in FIG.
9 SEQ ID NO: 49; SAR as depicted in FIG. 9, SEQ ID NO: 50 {Papaver somniferum 3151 13446) and
encoded by codon-optimized by DNA2.0 for optimal expression in yeast (KP400665) SEQ ID NO: 5 1; SAT
as depicted in FIG. 9, SEQ ID NO: 52 {Papaver somniferum AAK73661 ) and encoded by codon optimized
nucleotide sequence KP400666 SEQ ID NO: 53; or encoded by Papaver somniferum native (AF33991 3)
SEQ ID NO: 54; CODM as depicted in FIG. 9, SEQ ID NO: 55 (D4N502 Papaver somniferum) and encoded
by codon optimized nucleotide sequence KP4006667 SEQ ID NO: 56; or Papaver somniferum native
nucleotide sequence (GQ500141) SEQ ID NO: 57; T60DM as depicted in FIG. 9, SEQ ID NO: 58 {Papaver
somniferum D4N500) and encoded by codon optimized nucleotide sequence KP4006668 SEQ ID NO: 59; or
encoded by Papaver somniferum native nucleotide sequence (GQ500139) SEQ ID NO: 60; COR as
depicted in FIG. 9, SEQ ID NO: 6 1 {Papaver somniferum AAF13738) and encoded by codon optimized
nucleotide sequence (KP4006669) SEQ ID NO: 62; or by Papaver somniferum native nucleotide sequence
(AF1 08434) SEQ ID NO: 63; cytochrome 5 as depicted in FIG. 9, SEQ ID NO: 64 {Papaver somniferum
b5) and encoded by SEQ ID NO: 65; or as depicted in FIG. 9, SEQ ID NO: 66 (synthetic Artemisia annua
derived b5) and encoded by SEQ ID NO: 67.
[001 10] Hence enzyme sequences in accordance with the present invention include enzymes with amino
acid sequences having high percent identities (e.g., at least 50%, 55%, 60%, 65%, 70%, 75%, 80%, 85%,
90%, 95%, 96%, 97%, 97%, 98% and 99% identity) with enzymes specifically disclosed in the present
invention and in particular with those shown to display useful activity (see e.g., FIGs. 2 to 14 of the present
invention). [001 11] Relatedness of enzymes of the present invention can also be presented by way of phylogenetic trees (see e.g., FIG. 13A and FIGs. 15A-F for enzymes of the present invention). Hence enzyme sequences in accordance with the present invention include enzymes shown to be related with enzymes specifically disclosed in the present invention and in particular with those shown to display useful activity for a purpose of the present invention through phylogenetic trees. Such phylogenetic trees may be obtained with the internet tool Clustal Omega™ for instance.
[001 12] The enzymes could also be modified for better e.g., expression/stability/yield in the host cell (e.g., replacing the native N-terminal membrane-spanning domain of enzymes of the pathway (e.g., SAS or CPR) by another terminal membrane-spanning domain. The N-terminal membrane spanning domain of cytochromes P450 (e.g., SAS) or cytochrome P450 reductases (CPRs) can be replaced by the N-terminal membrane-spanning domain from another plant's cytochromes P450 or cytochrome P450 reductase (e.g., P. somniferum canadine synthase or P. somniferum cheilanthifoline synthase). For example, the N-terminal membrane spanning domain of SAS was replaced by the N-terminal membrane spanning domain of another plant enzyme (e.g., canadine synthase (CAS) or cheilanthifoline synthase (CFS)) (see e.g., FIGs. 9 and 6A-
B for such SAS constructions and their activities). N-terminal domains from other plants could also be used, e.g., Lactuca sativa (lettuce) germacrene A oxidase) or from a yeast ER bound protein (e.g., ergl 1 or ncpl ).
Codon optimization can be performed for expression in the heterologous host; use of different combinations of promoter/terminators for optimal coexpression of multiple enzymes; spatial colocalization of sequential enzymes using a linker system or organelle-specific membrane domain; introducing mutations to reduce
Km substrate inhibition, increase and/or k at (e.g., replacing the phenylalanine (F) amino acid residue highlighted in FIG. 10C for SAR (at position 119 in consensus for SAR in FIG. 10C) by another amino acid residue e.g., alanine) or replacing the isoleucine (I) amino acid residue highlighted in FIG. 10C for SAR (at position 3 18 in consensus for SAR in FIG. 10C) by another amino acid residue e.g., alanine); tuning gene numbers of enzymes to favor the pathway reducing the risk of production of side products (e.g., increasing gene copy number of CODM), tuning gene expression using inducible promoters (e.g., to reduce COR activity on neopinone). In a more specific embodiment, useful enzymes are as shown in FIGs. 9E and 10 for example. Transmembrane domains can be predicted using, for example, the software TMpred™ (ExPASy) http://www.ch.embnet.org/software/TMPRED_form.html and SignIP 4. 1
(http://www.cbs.dtu.dk/services/SignalP). Tmpred and SignallP 4. 1 predicted alpha-helix transmembrane domains for: PsSAS: AA 3 to 30; P. somniferum canadine synthase (PsCAS): AA 1 to 32; and P. somniferum cheilantifoline synthase (PsCFS): AA 3 to 24. These domains could be replaced by different transmembrane domains and/or simply truncated and lead to proper folded, stable and functional transmembrane proteins (e.g., in SAS and/or CPR).
[001 13] A substantially identical sequence may comprise one or more conservative amino acid mutations. It is known in the art that one or more conservative amino acid mutations to a reference sequence may yield a mutant peptide with no substantial change in physiological, chemical, or functional properties compared to
the reference sequence; in such a case, the reference and mutant sequences would be considered
"substantially identical" polypeptides. Conservative amino acid mutation may include addition, deletion, or
substitution of an amino acid; a conservative amino acid substitution is defined herein as the substitution of
an amino acid residue for another amino acid residue with similar chemical properties {e.g., size, charge, or
polarity).
[001 14] In a non-limiting example, a conservative mutation may be an amino acid substitution. Such a
conservative amino acid substitution may be a basic, neutral, hydrophobic, or acidic amino acid for another
of the same group. By the term "basic amino acid" it is meant hydrophilic amino acids having a side chain pK value of greater than 7, which are typically positively charged at physiological pH. Basic amino acids include
histidine (His or H), arginine (Arg or R), and lysine (Lys or K). By the term "neutral amino acid" (also "polar
amino acid"), it is meant hydrophilic amino acids having a side chain that is uncharged at physiological pH,
but which has at least one bond in which the pair of electrons shared in common by two atoms is held more
closely by one of the atoms. Polar amino acids include serine (Ser or S), threonine (Thr or T), cysteine (Cys
or C), tyrosine (Tyr or Y), asparagine (Asn or N), and glutamine (Gin or Q). The term "hydrophobic amino
acid" (also "non-polar amino acid") is meant to include amino acids exhibiting a hydrophobicity of greater
than zero according to the normalized consensus hydrophobicity scale of Eisenberg ( 1984). Hydrophobic
amino acids include proline (Pro or P), isoleucine (He or I), phenylalanine (Phe or F), valine (Val or V),
leucine (Leu or L), tryptophan (Trp or W), methionine (Met or M), alanine (Ala or A), and glycine (Gly or G).
"Acidic amino acid" refers to hydrophilic amino acids having a side chain pK value of less than 7, which are
typically negatively charged at physiological pH. Acidic amino acids include glutamate (Glu or E), and
aspartate (Asp or D).
[001 15] Sequence identity is used to evaluate the similarity of two sequences; it is determined by calculating
the percent of residues that are the same when the two sequences are aligned for maximum
correspondence between residue positions. Any known method may be used to calculate sequence identity; for example, computer software is available to calculate sequence identity. Without wishing to be limiting,
sequence identity can be calculated by software such as NCBI BLAST2, BLAST-P, BLAST-N, COBALT or
FASTA-N, or any other appropriate software/tool that is known in the art (Johnson M, ef a/. (2008) Nucleic
Acids Res. 36:W5-W9; Papadopoulos JS and Agarwala R (2007) Bioinformatics 23 : 1073-79).
[001 16] The substantially identical sequences of the present invention may be at least 75% identical; in
another example, the substantially identical sequences may be at least 80, 85, 90, 95, 96, 97, 98 or 99%
identical at the amino acid level to sequences described herein. The substantially identical sequences retain
substantially the activity and specificity of the reference sequence.
Nucleic acids, host cells [001 17] The present invention also relates to nucleic acids comprising nucleotide sequences encoding the
above-mentioned enzymes. The nucleic acid may be codon-optimized. The nucleic acid can be an DNA or
an RNA. The nucleic acid sequence can be deduced by the skilled artisan on the basis of the disclosed
amino acid sequences. In a specific embodiment, the nucleic acid encodes one of the amino acid sequences
as presented in any one of FIGs. 9 to 10 (orthologues and/or consensuses). In another specific embodiment,
the nucleic acid for one or more enzymes is as shown in FIG. 9.
[001 18] The present invention also encompasses vectors (plasmids) comprising the above-mentioned
nucleic acids. The vectors can be of any type suitable, e.g., for expression of said polypeptides or
propagation of genes encoding said polypeptides in a particular organism. The organism may be of
eukaryotic or prokaryotic origin (e.g., yeast). The specific choice of vector depends on the host organism and
is known to a person skilled in the art. In an embodiment, the vector comprises transcriptional regulatory
sequences or a promoter operably-linked to a nucleic acid comprising a sequence encoding an enzyme
involved in the BIA pathway of the invention. A first nucleic acid sequence is "operably-linked" with a second
nucleic acid sequence when the first nucleic acid sequence is placed in a functional relationship with the
second nucleic acid sequence. For instance, a promoter is operably-linked to a coding sequence if the
promoter affects the transcription or expression of the coding sequence. Generally, operably-linked DNA
sequences are contiguous and, where necessary to join two protein coding regions, in reading frame.
However, since for example enhancers generally function when separated from the promoters by several
kilobases and intronic sequences may be of variable lengths, some polynucleotide elements may be
operably-linked but not contiguous. "Transcriptional regulatory sequences" or "transcriptional regulatory
elements" are generic terms that refer to DNA sequences, such as initiation and termination signals
(terminators), enhancers, and promoters, splicing signals, polyadenylation signals, etc., which induce or
control transcription of protein coding sequences with which they are operably-linked.
[001 19] Vectors useful to express the enzymes of the present invention include the modified centromeric vectors pGREG503 (FIG. 9, SEQ ID NO: 1), pGREG504 (FIG. 9, SEQ ID NO: 2), pGREG505 (FIG. 9, SEQ
ID NO: 3) and pGREG506 (FIG. 9, SEQ ID NO: 4), from the pGREG series55, the 2µ plasmids pYES2
(Invitrogen) (FIG. 9, SEQ ID NO: 5). Yeast Artificial Chromosome (YACs) able to clone fragments of 100-
1000kpb could also be used to express multiple enzymes (e.g., 10). Many other useful yeast expression vectors, either autonomously replicating low copy-number vectors (YCp or centromeric) or autonomously
replicating high copy-number vectors (YEp or 2µ) are commercially available, e.g., from Invitrogen
(www.lifetechnologies.com), the American Type Culture Collection (ATCC; www.atcc.org) or the Euroscarf
collection (http://web.uni-frankfurt.de/fb1 5/mikro/euroscarf/).
[00120] Plasmids including enzymes in accordance with specific embodiments of the present invention
include pGC263 (PsSAS-HA tag) (FIG. 9, SEQ ID NO: 6), pGC264 (PsCPR-HA tag) (FIG. 9, SEQ ID NO: 7), pGC265 (PsSAR-HA tag) (FIG. 9, SEQ ID NO: 8), pGC359 (SAS, CPR, SAR, SAT) (FIG. 9 , SEQ ID NO: 9), pGC719 (SAS, CPR) (FIG. 9, SEQ ID NO: 10), pGC720 (truncated SAS, CPR) (FIG. 9, SEQ ID NO: 11); pGC721 (NTCAS-SAS, CPR) (FIG. 9, SEQ ID NO: 12); pGC722 (NTCFS-SAS, CPR) (FIG. 9, SEQ ID NO: 13); pGC1 1 (T60DM, CODM, COR) (FIG. 9, SEQ ID NO: 14), pGC1062 (60MT, CNMT, 4Ό ΜΤ2) (FIG. 9, SEQ
ID NO: 15), pGC557 (CPR plasmid) (FIG. 9, SEQ ID NO: 16), pGC655 (ΒΒΕ∆Ν -2 µ ) (FIG. 9, SEQ ID NO:
17), pBOT-LEU (FIG. 9, SEQ ID NO: 18), etc. as shown in Tables l-ll. Plasmids in accordance with the present invention may also include nucleic acid molecule(s) encoding one or more of the polypeptides as shown in FIGs. 9-10 (orthologues or consensuses).
[00121] Promoters useful to express the enzymes of the present invention include the constitutive promoters from the following S. cerevisiae CEN.PK2-1 D genes: glyceraldehyde-3-phosphate dehydrogenase 3 (PTDH3) (FIG. 9, SEQ ID NO: 19), fructose 1,6-bisphosphate aldolase (PFBAI ) (FIG. 9, SEQ
+ ID NO: 20), pyruvate decarboxylase 1 (PPDci) (FIG. 9 , SEQ ID NO: 21), and plasma membrane H -ATPase 1
(PpMAi) (FIG. 9, SEQ ID NO: 22). The inducible promoters from galactokinase (PGALI ) (FIG. 9 , SEQ ID NO:
23), UDP-glucose-4-epimerase (PGALIO) (FIG. 9, SEQ ID NO: 24), from pESC-leu2d are also useful for the present invention. The present invention also encompasses using other available promoters (e.g., yeast promoters), with different strengths and different expression profiles. Examples are the PTEFI (FIG. 9, SEQ
ID NO: 25), and PTEF2 (FIG . 9, SEQ ID NO: 26), promoters from the translational elongation factor EF-1 alpha paralogs TEF1 and TEF2; promoters of gene coding for enzymes involved in glycolysis such as 3- phosphoglycerate kinase (PPGKI ) (FIG. 9, SEQ ID NO: 27), pyruvate kinase (PPYKi) (FIG. 9 , SEQ ID NO: 28), triose-phosphate isomerase (PTPM) (FIG. 9, SEQ ID NO: 29), glyceraldehyde-3-phosphate dehydrogenase
II ΡΗΧΤΘ (PTDH2) (FIG. 9, SEQ ID NO: 30), enolase (PEN02) (FIG. 9, SEQ ID NO: 31), or hexose transporter 9 ( )
(FIG. 9 , SEQ ID NO: 32). Other useful promoters in accordance with the present invention encompass those found through the promoter database of S. cerevisiae (http://rulai.cshl.edu/cgi-bin/SCPD/getgenelist).
[00122] Terminators useful for the present invention include terminators from the following S. cerevisiae
CEN.PK2J D genes: cytochrome C 1 (TCYCI) (FIG. 9, SEQ ID NO: 33), alcohol dehydrogenase 1 (TADHI)
(FIG. 9 , SEQ ID NO: 34), phosphoglucoisomerase 1 glucose-6-phosphate isomerase (TPGH) (FIG. 9, SEQ ID
NO: 35). The present invention also encompasses using other suitable yeast terminators, e.g., terminators from genes encoding for enzymes involved in glycolysis and gluconeogenesis such as alcohol
(TADH II dehydrogenase 1 2) (FIG. 9 , SEQ ID NO: 36), enolase (T ENo2) (FIG. 9, SEQ ID NO: 37), fructose 1,6- bisphosphate aldolase (TFBAI ) (FIG. 9, SEQ ID NO: 38), glyceraldehyde-3-phosphate dehydrogenase (TTDH2)
(FIG. 9 , SEQ ID NO: 39); and triose-phosphate isomerase (TTpn) (SEQ ID NO: 40);. Other useful terminators in accordance with the present invention encompass those found from genes indicated in the promoter database of S. cerevisiae (http://rulai.cshl.edu/cgi-bin/SCPD/getgenelist).
[00123] The term "heterologous coding sequence" refers herein to a nucleic acid molecule that is not normally produced by the host cell in nature.
[00124] The terms "morphinan alkaloid metabolite" as used herein refer to a metabolite of the reticuline-
morphine pathway produced by the host cells of the present invention when fed the relevant substrate. Such
morphinan alkaloid metabolites include plant native [e.g., R-reticuline) and non-native metabolites (e.g.,
neopine, neomorphine (e.g., at pH lower than 9) Without being so limited, it includes (Rj-reticuline
salutaridine, salutaridinol, salutaridinol-7-O-acetate, thebaine, oripavine, morphinone, morphine, codeine,
codeinone, neopinone, neopine, racemic mixtures of any of these compounds and stereoisomers of any of
these compounds.
[00125] A recombinant expression vector (plasmid) comprising a nucleic acid sequence of the present
invention may be introduced into a cell, e.g., a host cell, which may include a living cell capable of
expressing the protein coding region from the defined recombinant expression vector. Accordingly, the
present invention also relates to cells (host cells) comprising the nucleic acid and/or vector as described
above. The suitable host cell may be any cell of eukaryotic (e.g., yeast) or prokaryotic (bacterial) origin that
is suitable, e.g., for expression of the enzymes or propagation of genes/nucleic acids encoding said enzyme.
The eukaryotic cell line may be of mammalian, of yeast, or invertebrate origin. The specific choice of cell line
is known to a person skilled in the art. The terms "host cell" and "recombinant host cell" are used
interchangeably herein. Such terms refer not only to the particular subject cell, but also to the progeny or
potential progeny of such a cell. Because certain modifications may occur in succeeding generations due to
either mutation or environmental influences, such progeny(ies) may not, in fact, be identical to the parent
cell, but are still included within the scope of the term as used herein. Vectors can be introduced into cells via conventional transformation or transfection techniques. The terms "transformation" and "transfection"
refer to techniques for introducing foreign nucleic acid into a host cell, including calcium phosphate or
calcium chloride co-precipitation, DEAE-dextran-mediated transfection, lipofection, electroporation,
microinjection and viral-mediated transfection. Suitable methods for transforming or transfecting host cells
can for example be found in Sambrook ef al. (supra), Sambrook and Russell (supra) and other laboratory
manuals. Methods for introducing nucleic acids into mammalian cells in vivo are also known, and may be
used to deliver the vector DNA of the invention to a subject for gene therapy.
[00126] In a specific embodiment, the host cells can be yeasts or bacteria (£. coli). In a more specific
embodiment, it can be a Sacchammycetaceae such as a Saccharomyces, Pichia or Zygosaccharomyces. In
a more specific embodiment, it can be a Saccharomyces. In a more specific embodiment, it can be a
Saccharomyces cerevisiae (S. cerevisiae). Yeast is advantageous in that cytochrome P450 proteins,
involved in certain steps in the morphinan pathways, are able to fold properly into the endoplasmic reticulum
membrane so that activity is maintained, as opposed to bacterial cells which lack such intracellular
compartments. The present invention encompasses the use of yeast strains that are haploid, and contain auxotropies for selection that facilitate the manipulation with plasmid. Yeast strains that can be used in the
invention include, but are not limited to, CEN.PK, S288C, W303, A363A and YPH499, strains derived from
S288C (FY4, DBY12020, DBY12021 , XJ24-249) and strains isogenic to S288C (FY1679, AB972, DC5). In
specific examples, the yeast strain is any of CEN.PK2-1 D (MATalpha ura3-52; trp1-289; Ieu2-3,1 12; his3A 1;
MAL2-8 C; SUC2) or CEN.PK2-1C (MATa ura3-52; trp1-289; Ieu2-3,1 12; his3A 1; MAL2-8 ; SUC2), or any of
their single, double or triple auxotrophs derivatives. In a more specific embodiment, the yeast strain is any of
the yeast strains listed in Table II {e.g., CEN.PK1 13-13D {MATa um3-52 MAL2-8C SUC2), CEN.PK1 13-14C
{MATa Ieu2-3, 112 his3 MAL2-8C SUC2), CEN.PK-1 13-16B {MATa leu2-3 MAL2-8C SUC2),
CEN.PK1 13-1 7A {MATa ura3-52 Ieu2-3, 112 MAL2-8C SUC2), CEN.PK1 10-7C (MATa ura3-52 ί ί -289
MAL2-8C SUC2) CEN.PK1 10-10C {his3 MAL2-8C SUC2), CEN.PK1 10-16D {MATa trp1-289 MAL2-8C
SUC2). In another specific embodiment, the particular strain of yeast cell is S288C (MATalpha SUC2 mal
mel gal2 CUP1 flo1 flo8-1 hapl ), which is commercially available. In another specific embodiment, the
particular strain of yeast cell is W303.alpha (MAT.alpha.; his3-1 ,15 trp1-1 leu2-3 ura3-1 ade2-1), which is
commercially available. The identity and genotype of additional examples of yeast strains can be found at
EUROSCARF, available through the World Wide Web at web.uni- frankfurt.de/fb15/mikro/euroscarf/col_index.html or through the Saccharomyces Genome Database
(www.yeastgenome.org).
[00127] The above-mentioned nucleic acid or vector may be delivered to cells in vivo (to induce the
expression of the enzymes and generates morphinan metabolites in accordance with the present invention)
using methods well known in the art such as direct injection of DNA, receptor-mediated DNA uptake, viral-
mediated transfection or non-viral transfection and lipid based transfection, all of which may involve the use
of gene therapy vectors. Direct injection has been used to introduce naked DNA into cells in vivo. A delivery
apparatus {e.g., a "gene gun") for injecting DNA into cells in vivo may be used. Such an apparatus may be
commercially available (e.g., from BioRad). Naked DNA may also be introduced into cells by complexing the
DNA to a cation, such as polylysine, which is coupled to a ligand for a cell-surface receptor. Binding of the
DNA-ligand complex to the receptor may facilitate uptake of the DNA by receptor-mediated endocytosis. A
DNA-ligand complex linked to adenovirus capsids which disrupt endosomes, thereby releasing material into
the cytoplasm, may be used to avoid degradation of the complex by intracellular lysosomes.
Methods of preparing a morphinan alkaloid metabolite(s)
[00128] The present invention encompasses a method of using a host cell as described above expressing
enzymes in accordance with the present invention for generating a significant yield of morphinan alkaloid.
[00129] As used herein the terms "conditions suitable for morphinan alkaloid production" include suitable
growing medium {e.g., synthetic complete and 2% glucose), temperature {e.g., about 30°C) and aeration
(e.g., agitation of 200 rpm or higher) for S. cerevisiae growth and expression of heterologous enzymes and suitable buffering conditions for alkaloids synthesis (enzyme activity).
[00130] The applicants have surprisingly discovered that by using first buffering conditions enabling the maintenance of a useful pH of about 7.5 or more, and, optionally, e.g., using a thebaine synthase active at more acidic pH, a second buffering conditions below 7.5, (e.g., 7.4; 7.3; 7.2; 7.1 ; 7; 6.9; 6.8; 6.7; 6.6; 6.5;
6.5; 6.3; 6.2; 6.1 ; 6; 5, 4, 3), the host cells of the present invention produced a significantly improved yield of morphinan alkaloid metabolite.
[00131] The present invention therefore provide a method of using a host cell as described above expressing enzymes in accordance with the present invention for generating a significant yield of benzylisoquinoline alkaloid using a first useful pH. As used herein, the terms "first useful pH" refer to a pH used for a first fermentation and refer to a pH of about 7.5 or more (about 7.5 or over about 7.5, 7.6, 7.7, 7.8,
7.9 or 8, etc.), more preferably between about 7.5 (or about 7.5, 7.6, 7.7, 7.8, 7.9 or 8, etc.) and about 10 (or about 9, 9.1 , 9.2, 9.3, 9.4, 9.5, 9.6, 9.7, 9.8, 9.9 or 10), more preferably, about 8 (or about 8, 8.1 , 8.2, 8.3,
8.4, 8.5, 8.6, 8.7, 8.8 or 8.9, etc.) to about 9.5 (or about 9 9.1 , 9.2, 9.3, 9.4, 9.5, 9.6, 9.7, 9.8 or 9.9); about
7.5 to about 10; about 7.5 to about 9.9; about 7.5 to about 9.8; about 7.5 to about 9.7; about 7.5 to about
9.6; about 7.5 to about 9.5; about 7.5 to about 9.4; about 7.5 to about 9.3; about 7.5 to about 9.2; about 7.5 to about 9.1 ; about 7.5 to about 9; about 7.5 to about 8.9; about 7.5 to about 8.8; about 7.5 to about 8.7; about 7.5 to about 8.6; about 7.5 to about 8.5; about 7.5 to about 8.4; about 7.5 to about 8.3; about 7.5 to about 8.2; about 7.5 to about 8.1 ; about 7.6 to about 10; about 7.6 to about 9.9; about 7.6 to about 9.8; about 7.6 to about 9.7; about 7.6 to about 9.6; about 7.6 to about 9.5; about 7.6 to about 9.4; about 7.6 to about 9.3; about 7.6 to about 9.2; about 7.6 to about 9.1 ; about 7.6 to about 9; about 7.6 to about 8.9; about
7.6 to about 8.8; about 7.6 to about 8.7; about 7.6 to about 8.6; about 7.6 to about 8.5; about 7.6 to about
8.4; about 7.6 to about 8.3; about 7.6 to about 8.2; about 7.6 to about 8.1 ; about 7.7 to about 10; about 7.7 to about 9.9; about 7.7 to about 9.8; about 7.7 to about 9.7; about 7.7 to about 9.6; about 7.7 to about 9.5; about 7.7 to about 9.4; about 7.7 to about 9.3; about 7.7 to about 9.2; about 7.7 to about 9.1 ; about 7.7 to about 9; about 7.7 to about 8.9; about 7.7 to about 8.8; about 7.7 to about 8.7; about 7.7 to about 8.6; about
7.7 to about 8.5; about 7.7 to about 8.4; about 7.7 to about 8.3; about 7.7 to about 8.2; about 7.7 to about
8.1 ; about 7.8 to about 10; about 7.8 to about 9.9; about 7.8 to about 9.8; about 7.8 to about 9.7; about 7.8 to about 9.6; about 7.8 to about 9.5; about 7.8 to about 9.4; about 7.8 to about 9.3; about 7.8 to about 9.2; about 7.8 to about 9.1 ; about 7.8 to about 9.0; about 7.8 to about 8.9; about 7.8 to about 8.8; about 7.8 to about 8.7; about 7.8 to about 8.6; about 7.8 to about 8.5; about 7.8 to about 8.4; about 7.8 to about 8.3; about 7.8 to about 8.2; about 7.8 to about 8.1 ; about 7.9 to about 10; about 7.9 to about 9.9; about 7.9 to about 9.8; about 7.9 to about 9.7; about 7.9 to about 9.6; about 7.9 to about 9.5; about 7.9 to about 9.4; about 7.9 to about 9.3; about 7.9 to about 9.2; about 7.9 to about 9.1 ; about 7.9 to about 9; about 7.9 to about 8.9; about 7.9 to about 8.8; about 7.9 to about 8.7; about 7.9 to about 8.6; about 7.9 to about 8.5; about 7.9 to about 8.4; about 7.9 to about 8.3; about 7.9 to about 8.2; about 7.9 to about 8.1 ; about 8 to about 10; about 8 to about 9.9; about 8 to about 9.8; about 8 to about 9.7; about 8 to about 9.6; about 8 to
about 9.5; about 8 to about 9.4; about 8 to about 9.3; about 8 to about 9.2; about 8 to about 9.1 ; about 8 to
about 9.0; about 8 to about 8.9; about 8 to about 8.8; about 8 to about 8.7; about 8 to about 8.6; about 8 to
about 8.5; about 8 to about 8.4; about 8 to about 8.3; about 8 to about 8.2; about 8 to about 8.1 ; about 8.1 to
about 10; about 8.1 to about 9.9; about 8.1 to about 9.8; about 8.1 to about 9.7; about 8.1 to about 9.6;
about 8.1 to about 9.5; about 8.1 to about 9.4; about 8.1 to about 9.3; about 8.1 to about 9.2; about 8.1 to
about 9.1 ; about 8.1 to about 9.0; about 8.1 to about 8.9; about 8.1 to about 8.8; about 8.1 to about 8.7;
about 8.1 to about 8.6; about 8.1 to about 8.5; about 8.1 to about 8.4; about 8.1 to about 8.3; about 8.1 to
about 8.2; about 8.2 to about 10; about 8.2 to about 9.9; about 8.2 to about 9.8; about 8.2 to about 9.7;
about 8.2 to about 9.6; about 8.2 to about 9.5; about 8.2 to about 9.4; about 8.2 to about 9.3; about 8.2 to
about 9.2; about 8.2 to about 9.1 ; about 8.2 to about 9.0; about 8.2 to about 8.9; about 8.2 to about 8.8;
about 8.2 to about 8.7; about 8.2 to about 8.6; about 8.2 to about 8.5; about 8.2 to about 8.4; about 8.2 to
about 8.3; about 8.3 to about 10; about 8.3 to about 9.9; about 8.3 to about 9.8; about 8.3 to about 9.7;
about 8.3 to about 9.6; about 8.3 to about 9.5; about 8.3 to about 9.4; about 8.3 to about 9.3; about 8.3 to
about 9.2; about 8.3 to about 9.1 ; about 8.3 to about 9.0; about 8.3 to about 8.9; about 8.3 to about 8.8;
about 8.3 to about 8.7; about 8.3 to about 8.6; about 8.3 to about 8.5; about 8.3 to about 8.4; about 8.4 to
about 10; about 8.4 to about 9.9; about 8.4 to about 9.8; about 8.4 to about 9.7; about 8.4 to about 9.6;
about 8.4 to about 9.5; about 8.4 to about 9.4; about 8.4 to about 9.3; about 8.4 to about 9.2; about 8.4 to
about 9.1 ; about 8.4 to about 9.0; about 8.4 to about 8.9; about 8.4 to about 8.8; about 8.4 to about 8.7;
about 8.4 to about 8.6; about 8.4 to about 8.5; about 8.5 to about 10; about 8.5 to about 9.9; about 8.5 to
about 9.8; about 8.5 to about 9.7; about 8.5 to about 9.6; about 8.5 to about 9.5; about 8.5 to about 9.4;
about 8.5 to about 9.3; about 8.5 to about 9.2; about 8.5 to about 9.1 ; about 8.5 to about 9.0; about 8.5 to
about 8.9; about 8.5 to about 8.8; about 8.5 to about 8.7; about 8.5 to about 8.6; about 8.6 to about 10;
about 8.6 to about 9.9; about 8.6 to about 9.8; about 8.6 to about 9.7; about 8.6 to about 9.6; about 8.6 to
about 9.5; about 8.6 to about 9.4; about 8.6 to about 9.3; about 8.6 to about 9.2; about 8.6 to about 9.1 ;
about 8.6 to about 9.0; about 8.6 to about 8.9; about 8.6 to about 8.8; about 8.6 to about 8.7; about 8.8 to
about 10; about 8.8 to about 9.9; about 8.8 to about 9.8; about 8.8 to about 9.7; about 8.8 to about 9.6;
about 8.8 to about 9.5; about 8.8 to about 9.4; about 8.8 to about 9.3; about 8.8 to about 9.2; about 8.8 to
about 9.1 ; about 8.8 to about 9.0; about 8.8 to about 8.9; about 8.9 to about 10; about 8.9 to about 9.9;
about 8.9 to about 9.8; about 8.9 to about 9.7; about 8.9 to about 9.6; about 8.9 to about 9.5; about 8.9 to
about 9.4; about 8.9 to about 9.3; about 8.9 to about 9.2; about 8.9 to about 9.1 ; and about 8.9 to about 9.0.
[00132] As used herein, the terms "second useful pH" refer to the pH used for the optional second fermentation and refer to a pH of between about 2.7 and about 7.4, between about 2.8 and about 7.3,
between about 2.9 and about 7.2, between about 3 and about 7.1 , between about 3 and about 7, between
about 3 and about 6.9, between about 3 and about 6.8, between about 3 and about 6.7, between about 3 and about 6.6.
[00133] Without being so limited, useful buffering conditions capable of maintaining a pH of about 7.5 to about 10 include: a buffer or mixture of buffers such as Tris-HCI; yeast growing medium (e.g., yeast nitrogen broth, synthetic dropout supplement, 2% a-D-glucose and amino acids) (YNB); YNB and a sufficient concentration of Tris-HCI; YNB and HEPES; Tris-HCI; and Tris-HCI and EDTA. Additional examples of such buffers are PBS, PIPES, MOPS, and taurine. A more exhaustive list can be found online at http://www.sigmaaldrich.com/life-science/core-bioreagents/biological-buffers/learning-c^ reference-center.html. In a specific embodiment, such conditions include using about 5mM to about 150mM of Tris-HCI or Tris-HCI and EDTA. In a more specific embodiment, the range is of about 10 to 150mM; 10 to
140mM; 10 to 130mM; 10 to 120mM; 10 to 110mM; 10 to 100mM; 10 to 90mM; 10 to 80mM; 10 to 70mM; 10 to 60mM; 10 to 55mM; 10 to 50mM;20 to 150mM; 20 to 140mM; 20 to 130mM; 20 to 120mM; 20 to 110mM;
20 to 100mM; 20 to 90mM; 20 to 80mM; 20 to 70mM; 20 to 60mM; 20 to 55mM; 20 to 50mM; 30 to 150mM;
30 to 140mM; 30 to 130mM; 30 to 120mM; 30 to 110mM; 30 to 100mM; 30 to 90mM; 30 to 80mM; 30 to
70mM; 30 to 60mM; 30 to 55mM; 30 to 50mM; 40 to 150mM; 40 to 140mM; 40 to 130mM; 40 to 120mM; 40 to 110mM; 40 to 100mM; 40 to 90mM; 40 to 80mM; 40 to 70mM; 40 to 60mM; 40 to 55mM; 40 to 50mM; 45 to 150mM; 45 to 140mM; 45 to 130mM; 45 to 120mM; 45 to 110mM; 45 to 100mM; 45 to 90mM; 45 to
80mM; 45 to 70mM; 45 to 60mM; 45 to 55mM; or 45 to 50mM.
[00134] In one embodiment, the method comprising incubating (R)-reticuline (fed substrate) with a host cell expressing SAS, CPR, SAR and SAT in buffering conditions enabling a useful pH (namely in that case a pH of about 7.5 to 9) yielded about 0.3 µΜ thebaine at pH 7.5, 0.74 µΜ thebaine at pH 8, 0.9 µΜ thebaine at pH
8.5 and 1.1 µΜ thebaine at pH 9. As used herein, the yield may be defined as the ratio of the end product
(metabolite) produced to the fed substrate. Hence 1.1 % of the total fed (R)-reticuline was converted to thebaine in the host cell combined supernatant and cell extract at pH 9, which was the most efficient pH. In another embodiment, the method comprising incubating (S)-salutaridine (fed substrate) with a host cell expressing SAS, CPR, SAR and SAT in buffering conditions enabling a useful pH (namely in that case a pH of about 7.5 to about 9) yielded about 0.3 µΜ thebaine at pH 7.5, 0.75 µΜ thebaine at pH 8, 1.2 µΜ thebaine at pH 8.5 and 1.5 µΜ thebaine at pH. In another embodiment, the method comprising incubating (/?)- reticuline (fed substrate) with a host cell expressing SAS, CPR, SAR, SAT, CODM, T60DM and COR in buffering conditions enabling a useful pH (e.g., a pH of about 9) yielded about 23 nM of codeine and no morphine. In another embodiment, the method comprising incubating salutaridine (fed substrate) with a host cell expressing SAS, CPR, SAR, SAT, CODM, T60DM and COR in buffering conditions enabling a useful pH (e.g., a pH of about 9) yielded about 63 nM of codeine and no morphine. In another embodiment, the method comprising incubating thebaine (fed substrate) with a host cell expressing SAS, CPR, SAR, SAT,
CODM, T60DM and COR in buffering conditions enabling a useful pH (e.g., a pH of about 7.5 or 9) yielded about 4.6 µΜ of codeine and 15 nM of morphine at pH 7.5 and 2 µΜ of codeine and 10 nM of morphine at pH 9. Trace neomorphine was also detected in feeding experiments with thebaine at pH 7.5. In another
embodiment, the method comprising incubating codeine (fed substrate) with a host cell expressing SAS,
CPR, SAR, SAT, CODM, T60DM and COR in buffering conditions enabling a useful pH (namely in that case
a pH of about 7.5 and about 9) yielded about 130 nM of morphine at pH 7.5 and 150 nM of morphine at pH
9.
[00135] The present invention is illustrated in further details by the following non-limiting examples.
EXAMPLE 1: Material and Methods: Chemicals and reagents
[00136] (S)-Reticuline was a gift from Peter Facchini (University of Calgary). (R,S)-Norlaudanosoline was purchased from Enamine Ltd. (Kiev, Ukraine); and (R)-reticuline, salutaridine, thebaine, oripavine,
codeine and morphine were from TRC Inc. (North York, Ontario, Canada). Antibiotics, growth media and a -
D-glucose were purchased from Sigma-Aldrich. Restriction endonuclease enzymes were from New England
Biolabs (NEB). Yeast genomic DNA used as template for PCR was purified using the DNeasy™ Blood and
Tissue Kit (Qiagen). Polymerase chain reactions (PCRs) were performed using Phusion™ High-Fidelity DNA
polymerase (NEB/Thermo Scientific). PCR-amplified products were gel purified using the QIAquick™
Purification Kit (Qiagen). Plasmid extractions were done using the GeneJET™ plasmid mini-prep kit (Thermo
Scientific). HPLC-grade water was purchased from Fluka. HPLC-grade acetonitrile was purchased from
Fischer Scientific.
Plasmids and S. cerevisiae strains construction
[00137] All enzymes used in this work are from P. somniferum. Synthetic sequences of 60MT
(GenBank KF554144), 4Ό ΜΤ (corresponding to 4Ό ΜΤ2, GenBank KF661327), CNMT (GenBank
KF661326), P450R (CPR) (GenBank KF661328), SAS (GenBank KP400664), SAR (GenBank KP400665),
SAT (GenBank KP400666), CODM (GenBank KP400667), T60DM (GenBank KP400668) and COR
(corresponding to COR1 .3, GenBank KP400669) were codon-optimized by DNA2.0 (Menlo Park, CA) for
optimal expression in yeast. The partial Kozak sequence AAAACA (SEQ ID NO: 198) was introduced
upstream of all coding sequences as an integral part of gene synthesis.
[00138] Plasmids sequences were designed to independently express sequential enzymes of the
morphine pathway (Table I).
Table I. List of Saccharomyces cerevisiae strains and plasmids used in the present application. Full
genotypes are available in Supporting Information Table II.
Strain Plasmids ' b Source
GCY256 pGC263 (SAS-HA tag) This Application
GCY257 pGC264 (CPR-HA tag) This Application GCY258 pGC265 (SAR-HA tag) This Application
GCY368 pGC359 (SAS, CPR, SAR, SAT) This Application
ΜΤ GCY1086 pGC1062 (60MT, 4Ό 2, CNMT) [4] pGC1062 (60MT, CNMT, 4Ό ΜΤ2) GCY1 125 (dihydrosanguinarine producing strain) ' [4] pGC655 (ΒΒΕ∆Ν -2µ)
GCY1356 pGC719 (SAS, CPR) This Application
GCY1356b pGC720 (truncated SAS, CPR) This Application
GCY1356C pGC721 (NTCAS-SAS, CPR) This Application
GCY1356d pGC722 (NTCSF-SAS, CPR) This Application
PGC1062 (60MT, CNMT, 4Ό ΜΤ2) GCY1357 This Application pGC719 (SAS, CPR)
pGC359 (SAS, CPR, SAR, SAT) GCY1358 This Application pGC1 1 (CODM, T60DM, COR)
pGC1062 (60MT, CNMT, 4Ό ΜΤ2) GCY1359 This Application pGC655 (ΒΒΕ∆Ν -2µ) a All the genes used in this study are synthetic genes and sequences were codon-optimized for expression in Saccharomyces cerevisiae.
"All protein sequences are from Papaver somniferum.
Table II. List of Saccharomyces cerevisiae strains and plasmids used in this Application.
Strain Genotype Plasmid Source
CEN.PK1 13-13D MATa ura3-52 MAL2-8C SUC2 none [31]
CEN.PK1 10-16D ΜΑΤα ί -289 MAL2-8C SUC2 none [31]
CEN.PK1 13-16B ΜΑΤα leu2-3 MAL2-8C SUC2 none [31]
CEN.PK1 10-10C his3 MAL2-8C SUC2 none [31]
CEN.PK1 13-14C MATa leu2-3, 112 his3 ∆ 1 MAL2-8C SUC2 none [31]
CEN.PK1 10-7C MATa ura3-52 trp1-289 MAL2-8C SUC2 none [31]
CEN.PK1 13-17A MATa ura3-52 leu2-3, 112 MAL2-8C SUC2 none [31]
CEN .PK1 13-13D pGC263 (SAS-HA tag) This GCY256 Application
CEN .PK1 13-13D pGC264 (CPR -HA tag) This GCY257 Application
GCY258 CEN .PK1 13-13D pGC265 (SAR-HA tag) This Application
GCY368 CEN .PK1 13-16D pGC359 This (SAS,CPR,SAR,SAT) Application GCY1082 none [8]
PGC1062 [8] GCY1086 CEN.PK1 13-16B (60MT,4'OMT2,CNMT)
GCY1 125 GCY1082 (dihydrosanguinarine producing pGC1062 [8] strain) (60MT,4'OMT2,CNMT)
pGC557 (CPR)
pGC655 (ΒΒΕ∆Ν-2µ)
pGC719 (SAS, CPR) This GCY1356 CEN.PK1 10-10C Application
pGC720 (truncated This GCY1356b CEN.PK1 10-10C SAS, CPR) Application
pGC721 (NTCAS-SAS, This GCY1356C CEN.PK1 10-10C CPR) Application
pGC722 (NTCFS-SAS, This GCY1356d CEN.PK1 10-10C CPR) Application
pGC1062 (60MT, This ΜΤ GCY1357 CEN.PK1 13-14C CNMT, 4Ό 2) Application pGC719 (SAS, CPR)
pGC359 (SAS, CPR, This SAR, SAT) Application GCY1358 CEN.PK1 10-7C pGC1 1 (CODM, T60MD, COR)
pGC1062 (60MT, This ΜΤ GCY1359 CEN.PK1 13-17A CNMT, 4Ό 2) Application pGC655 (ΒΒΕ∆Ν-2µ)
Plasmid name Genotype Source pYES2 2µ° , pU , URA3, Amp* PGALI-TCYCI Invitrogen pGC263 PYES2::PGALI-PSSAS-HA tag - TCYCI This Application pGC264 PYES2::PGALI-PSCPR-HA tag - TCYCI This Application pGC265 PYES2::PGALI-PSSAR-HA tag - TCYCI This Application
ri pGREG503 CEN6/ARS4° , pMB1 , HIS3, Amp*, loxP-Kan* P GALi-HISstuffer-TC Yci [28]
ri R PGREG504 CEN6/ARS4° , pMB1°», TRP1, Amp* loxP-Kan , P GALi-HISstuffer-TC Yci [28]
ri R PGREG505 CEN6/ARS4° , pMB1™, LEU2, Amp* loxP-Kan , PGALi-HISstuffer-TC Yci ΙοχΡ PGREG506 CEN6/ARS4™, pMB1™, URA3, Amp* -Kan P GALi-HISstuffer-T C Yci [28]
pGC964 pGREG503 pn 3555-25 °)A(3558)G, A Kpn 4509- A (4512)G [8]
pGC965 pGREG504 AKpn }A(3558)G [8] 3 pGC966 pGREG505 A Kpn ^m(3558)G, Κ η 1 ) A (5179)G [8]
pGC967 pGREG506 AKpn 3593-35 )A (3596) G [8]
pGC359 pGC965::C1-PrEF.-PsS S-C4-H15-C5-rcyci-C6-H1-C1-PpDCi-PsCP ?- This C4-H14-C5-7rDH2-C6-H2-C1-PFa,i-PsS/»7-C4-H12-C5-7/,DHrC6-H3-C1- Application PrDHrPsSAR -CA-M 6-C5-7 /i-C6
pGC1062 pGC966:M -P TDHrPs60MT-TcYci4G-M-C^ PFBAi -Ps4OMT2 -TADHi- [8] C6-H2-C1- PpDci-PsCNMT-TpGn-C6
pGC557 PGC 964::C -PTDH3-PSCPR-TCYCI-C% [8]
pGC655 pYES2::P PMAi -PsBBEAN -TpGn [8]
G C 9M:M-PFBAI-PSCPR-TCYCI-C&M-M- PPMM-PSSAS-TADHI-CG This pGC719 Application
pGC964; C 1-P -PsCPR-7 yci-C6-H1 -C1 P Ai -PstruncatedSAS- This pGC720 C P - 6 Application
This Application
pGC964;:C1 -P e4i-PsCPR-7cyc<-C6-H1-C1 - P , i-NT Fs-S S Ps - This pGC722 C TADM-C6 Application
PGC 7::PPGKI-PST 60DM-TCYCI-PTPH-PSCODM-TADHI-PTEFI-PSCOR- This pGC1 1 TpGH Application
All the genes used in this study are synthetic genes and sequences were codon-optimized for expression in Saccharomyces cerevisiae.
Linkers used for cloning purposes are in bold.
[00139] The enzymes were cloned into the pGREG series of £ co//-S. cerevisiae shuttle vectors [1 5].
Modified vectors pGREG503, 504, 505 and 506, harbouring respectively the HIS3, TRP1, LEU2 and URA3
auxotrophic markers and containing a unique Kpn\ site were used [4]. Gene expression cassettes were
inserted by homologous recombination into pGREG vectors previously linearized with Asc\IKpn\. Empty
pGREG control plasmids created by intra-molecular ligation of the linearized pGREG made blunt with T4
DNA polymerase were used as negative controls [4]. In vivo homologous recombination in yeast was used for assembly of the plasmids [16]. Promoters, genes, and terminators were assembled by incorporating a
~50-bp homologous region between the segments. DNA linkers (C6-H(n)-C1) were used to join cassettes to
each other and to the vector backbone as well as to join each gene to its terminator in plasmid pGC359
(Tables II and III).
Table III. Common regions used for cloning purposes.
Primer name Sequence 5'→ 3' C 1 GAGACTGCAGCATTACTTTGAGAAG (SEQ ID NO: 199)
C2 GTCCAGAGTCAGTGTGTATCTACT (SEQ ID NO: 200)
C3 GTTGTCAGCAACGACGATATCTG (SEQ ID NO: 201)
C4 GGCTACTTCGGTGTACCAAACTAA (SEQ ID NO: 202)
C5 TCACTTACACGAGGAGATGCATTG (SEQ ID NO: 203)
C6 GGCAATCACATCACCATGAGTTGT (SEQ ID NO: 204)
CTCATGGCGGGGGTCGGAATGATTAAAGAAAGGGGCTGTGGGCGAGATTG (SEQ ID H 1 NO: 205)
CCAGTTAATAAACCGTGGCAAACATGATGGTGGCCTAATGGAGGTCACCA (SEQ ID H2 NO: 206)
A I l ACAACCAGAACACAAAAGTGCGAAGTTTGAGCAACGGCGACGGAT (SEQ ID H3 NO: 207)
GAGCGTAGGTTCCMGATCCCCAGTTCAAAAGGATCCGTTCTAGTGCCAG (SEQ ID H12 NO: 208)
TTATGAACCGTGTGTGACCCTTTCCGAGCGAGTGTTGGGGTTCCACGCTC (SEQ ID H14 NO: 209)
ACTTCTGCGCTGTACCCGTGGTAATACTTGTCACCTTAGTTTGCGATAAC (SEQ ID NO: H 15 210)
ACCTAATGGTTCTTCGTTGCTATAGCAGGTGGCAGGGACCCAACATCATA (SEQ ID NO: H 16 2 11)
[00140] Promoters and terminators were amplified using CEN.PK genomic DNA as template. Primers used to amplify assembly parts are described in Table IV.
Table IV. Oligonucleotides used for amplification of expression construct parts.
Name Sequence 5'→ 3' pYES2_backbone pYES2 for TACCCATACGATGTTCCAGATTACGCTTAAATCATGTAATTAGTTATGTCACGCTT AC (SEQ ID NO: 212) pYES2 rev CTCCTTGACGTTAAAGTATAGAGG (SEQ ID NO: 213) pGC263 (SAS-HA-tag)
SAS HA tag for ATATACCTCTATACTTTAACGTCAAGGAGAAAACAATGGCACCAATCAACATTGA AG (SEQ ID NO: 214)
SAS HA tag rev TTAAGCGTAATCTGGAACATCGTATGGGTATTGACGAAATGGTTTAGTACGTGGA G (SEQ ID NO: 2 15) pGC264 (CPR-HA tag)
CPR HA Tag F ATATACCTCTATACTTTAACGTCAAGGAGAAAACAATGGGGTCAAACAACCTGG (SEQ ID NO: 216)
CPR HA Tag R TTAAGCGTAATCTGGAACATCGTATGGGTACCATACATCTCTCAAGTATCTCTC (SEQ ID NO: 2 17) PGC265 (CPR-HA tag)
SAR-HA tag for ATATACCTCTATACnTAACGTCAAGGAGAAAACAATGCCAGAAACTTGTC CAAATACGG (SEQ ID NO: 218)
SAR-HA tag rev TTAAGCGTAATCTGGAACATCGTATGGGTAGAAGGCGGACAACTCAGAAC AATC (SEQ ID NO: 219) pGC359 (thebaine block) pG:C1 for TAACCCTCACTAAAGGGAACAAAAGCTGGAGCTCGTTTAAACGGCGCGCC GAGACTGCAGCATTACTTTGAGAAG (SEQ ID NO: 220)
TEF2p rev CnCAATGTTGATTGGTGCCATTGTTTTTTAATTATAGTTCGTTGACCGTAT ATTC (SEQ ID NO: 221 )
SAS for TTAGAATATACGGTCAACGAACTATAATTAAAAAACAATGGCACCAATCAA CATTGAAG (SEQ ID NO: 222)
C4:H15 rev GnATCGCAAACTAAGGTGACAAGTATTACCACGGGTACAGCGCAGAAGT TTAGTTTGGTACACCGAAGTAGCC (SEQ ID NO: 223)
C5:H15for ACTTCTGCGCTGTACCCGTGGTAATACTTGTCACCTTAGTTTGCGATAACT CACTTACACGAGGAGATGCATTG (SEQ ID NO: 224)
C6:H1 rev CAATCTCGCCCACAGCCCCTTTCTTTAATCATTCCGACCCCCGCCATGAGA CAACTCATGGTGATGTGATTGCC (SEQ ID NO: 225)
C 1:H1 frw CTCATGGCGGGGGTCGGAATGATTAAAGAAAGGGGCTGTGGGCGAGATT GGAGACTGCAGCATTACTTTGAGAAG (SEQ ID NO: 226)
PDCIp rev CCA G I IG I I IGACCCCA I IG I 111I A I I IGAC IG I I IA I 11I C IGA (SEQ ID NO: 227)
CPR for CCAGG I IG I I IGACCCCA I IG I 111IGA I I IGAC IG IG I IA I 11I CG IGA (SEQ ID NO: 228)
C4:H14 rev GAGCGTGGAACCCCAACACTCGCTCGGAAAGGGTCACACACGGTTCATA ATTAGTTTGGTACACCGAAGTAGCC (SEQ ID NO: 229)
C5:H14 for TTATGAACCGTGTGTGACCCTTTCCGAGCGAGTGTTGGGGTTCCACGCTC TCACTTACACGAGGAGATGCATTG (SEQ ID NO: 230)
C6:H2 rev TGGTGACCTCCATTAGGCCACCATCATGTTTGCCACGGTnATTAACTGGA CAACTCATGGTGATGTGATTGCC (SEQ ID NO: 231)
C 1:H2 for CCAGTTAATAAACCGTGGCAAACATGATGGTGGCCTAATGGAGGTCACCA GAGACTGCAGCATTACTTTGAGAAG (SEQ ID NO: 232)
FBA1p rev GCAGAATACATTGTGGCCATTGTTTTTATGTATTACTTGGTTATGGTTATAT ATGAC (SEQ ID NO: 233)
SAT for GTCATATATAACCATAACCAAGTAATACATAAAAACAATGGCCACAATGTAT TCTGC (SEQ ID NO: 234)
C4:H12 rev CTGGCACTAGAACGGATCCTTTTGAACTGGGGATCTTGGAACCTACGCTC TTAGTTTGGTACACCGAAGTAGCC (SEQ ID NO: 235)
C5:H12 for GAGCGTAGGTTCCAAGATCCCCAGTTCAAAAGGATCCGTTCTAGTGCCAG TCACTTACACGAGGAGATGCATTG (SEQ ID NO: 236)
C6:H3 rev ATCCGTCGCCGTTGCTCAAACTTCGCACTTTTGTGTTCTGGTTGTAAAATA CAACTCATGGTGATGTGATTGCC (SEQ ID NO: 237) C 1:H3 for ATTTTACAACCAGAACACAAAAGTGCGAAGTTTGAGCAACGGCGACGGAT GAGACTGCAGCATTACTTTGAGAAG (SEQ ID NO: 238)
TDH3p rev GTATTTGGACAAGTTTCTGGCATTGTTTTTCGAAACTAAGTTCTTGGTGTTT TAAAAC (SEQ ID NO: 239)
SARJor GTTTTAAAACACCAAGAACTTAGTTTCGAAAAACAATGCCAGAAACTTGTC CAAATAC (SEQ ID NO: 240)
C4:H16 rev TATGATGTTGGGTCCCTGCCACCTGCTATAGCAACGAAGAACCATTAGGT TTAGTTTGGTACACCGAAGTAGCC (SEQ ID NO: 241)
C5:H16 for ACCTAATGGTTCTTCGTTGCTATAGCAGGTGGCAGGGACCCAACATCATA TCACTTACACGAGGAGATGCATTG (SEQ ID NO: 242)
pG:C6 rev ATAACTTCGTATAATGTATGCTATACGAAGTTATTAGGTACCGCGGCCGCA CAACTCATGGTGATGTGATTGCC (SEQ ID NO: 243)
pGC719 (SAS, CPR)
pG:C1 for TAACCCTCACTAAAGGGAACAAAAGCTGGAGCTCGTTTAAACGGCGCGCCGAGA CTGCAGCATTACTTTGAGAAG (SEQ ID NO: 244)
FBA1p rev GCAGAATACATTGTGGCCATTGTTTTTATGTATTACTTGGTTATGGTTATATATGA C (SEQ ID NO: 245)
FBAIp for GCCAGGTTGTTTGACCCCATTGTTTTTATGTATTACTTGGTTATGGTTATATATGA C (SEQ ID NO: 246)
CPR for GTCATATATAACCATAACCAAGTAATACATAAAAACAATGGGGTCAAACAACCTG GC (SEQ ID NO: 247)
CPR rev GTAAGCGTGACATAACTAATTACATGATTACCATACATCTCTCAAGTATCTCTC (SEQ ID NO: 248)
CYCIt for Α Α ΑΤΑ0 ΤΤ Α ΑβΑΤ ΤΑΤ βΤΑΑΤ0ΑΤ ΤΑΑ Α ΤΤΑΤ Τ Α060 ΤΤΑ0 (SEQ ID NO: 249)
C6:H1 rev CAATCTCGCCCACAGCCCCTTTCTTTAATCAnCCGACCCCCGCCATGAGACAA CTCATGGTGATGTGATTGCC (SEQ ID NO: 250)
C 1:H1 for CTCATGGCGGGGGTCGGAATGATTAAAGAAAGGGGCTGTGGGCGAGATTGGAG ACTGCAGCATTACTTTGAGAAG (SEQ ID NO: 251)
PMA1 p rev GTTGATTGGTGCCATTGTTTTTTTGATAATTAAATCTTTCTTATCTTCTTATTCTTT TC (SEQ ID NO: 252)
SAS for GATAAGAAAGATTTAATTATCAAAAAAACAATGGCACCAATCAACATTGAAGGTA AC (SEQ ID NO: 253)
SAS rev GAGACTTGACCAAACCTCTGGCGAAGAAGTCCACTATTGACGAAATGGTTTAGT ACGTG (SEQ ID NO: 254)
AD t for GATAACTCCACGTACTAAACCATTTCGTCAATAGTGGACTTCTTCGCCAGAGGTT TG (SEQ ID NO: 255)
pYES2:C6 rev CAATACGCAAACCGCCTCTCCCCGCGCGTTGGCCGATTCATTAATGCAGGACAA CTCATGGTGATGTGATTGCC (SEQ ID NO: 256)
pGC1 1 (morphine block)
PG:PGK1 p for TAACCCTCACTAAAGGGAACAAAAGCTGGAGCTCGTTTAAACGGCGCGCCACGC ACAGATATTATAACATCTGCATAATA (SEQ ID NO: 257) PGKIp rev TCATCAGTTTAGCTTTCTCCATTGTTTTATATTTGTTGTAAAAAGTAGATAATTACT TCCTTG (SEQ ID NO: 258)
T60DM for CAAGGAAGTAATTATCTACTTTTTACAACAAATATAAAACAATGGAGAAAGCTAAA CTGATGA (SEQ ID NO: 259)
T60DM rev GAATGTAAGCGTGACATAACTAATTACATGATCAAATACGCATAGAATCTAGAAA TGA I 111C (SEQ ID NO: 260)
CYCIt for GAAAATCATTTCTAGATTCTATGCGTATTTGATCATGTAATTAGTTATGTCACGCT TACATTC (SEQ ID NO: 261 )
CYC1 rev 0ΤΑΑ ΤΑΑ πΑΑΑΤΑΤ 0 ΤΑΑΤ0ΤΓΤΑΑΑ Α ΤΑ Τ 0ΑΑΑπΑΑΑ 600 ΤΤ0 AGCGTC (SEQ ID NO: 262)
TPI1 for GTTTTGGGACGCTCGAAGGCTTTAATTTGCACTAGCTGTTTAAAGATTACGGATA TTTAAC (SEQ ID NO: 263)
TPI1 rev GCnGATTMGATAGGAGTTTCCAnGTTTTTTTTAGTTTATGTATGTGTTTTTTGT AGTTATAG (SEQ ID NO: 264)
CODM for CTATAACTACAAAAAACACATACATAAACTAAAAAAAACAATGGAAACTCCTATCT TAATCAAGC (SEQ ID NO: 265)
CODM rev CnGACCAAACCTCTGGCGAAGMGTCCATTACATTCTCATATAGTCTAGGAAAG ATTTC (SEQ ID NO: 266)
ADHIt for CnGATGGGAAATCTTTCCTAGACTATATGAGAATGTAATGGACTTCTTCGCCAG AGGTTT (SEQ ID NO: 267)
ADH1t rev TCTGGAAGAGTAAAAAAGGAGTAGAAACATTTTGAAGCTATGCATGCCGGTAGA GGTGTG (SEQ ID NO: 268)
TEFIp for CnATTGACCACACCTCTACCGGCATGCATAGCTTCAAAATGTTTCTACTCCTnT TTAC (SEQ ID NO: 269)
TEF1p rev Απ Α0000 ΑΤΤΑ ΑΤΤ00ΑΤΤ ΤπΤΑΤΤΑΑΑΑ 0ΤΤΑ ΑπΑ Α 0ΤΑΤ 0 TTTCT (SEQ ID NO: 270)
COR for GAAAGAAAGCATAGCAATCTAATCTAAGTTTTAATAAAACAATGGAATCTAATGG CGTCCC (SEQ ID NO: 271)
COR rev TGTTCTTTAGGTATATATTTAAGAGCGATTTGTTTTAATCTTTTTCATCCCAGAACT CCTC (SEQ ID NO: 272)
PGMt for GAGGAGTTCTGGGATGAAAAAGATTAAAACAAATCGCTCTTAAATATATACCTAA AGAACA (SEQ ID NO: 273)
pG:PGI1t rev ATAACTTCGTATAATGTATGCTATACGAAGTTATTAGGTACCGCGGCCGCGGTAT ACTGGAGGCTTCATGAG (SEQ ID NO: 274)
[00141] PsSAS, PsCPR and PsSAR were also independently cloned as HA-tagged constructs into
the 2µ vector pYES2 (Table I). For DNA assembly, the pYES2 backbone was amplified by PCR using
primers pYES2 for and pYES2 rev. All primers used to modify pYES2 are described in Table IV.
Transformation of DNA fragments in yeast for homologous recombination was accomplished by
electroporation in the presence of sorbitol [16]. [00142] All plasmids assembled in yeast were transferred to E. coli and sequenced-verified. Yeast
strains for opiate production were obtained by transformations of plasmids using heat shock in the presence
of lithium acetate, carrier DNA and PEG 3350 [ 17]. Yeast nitrogen broth supplemented with synthetic
dropout, 2% a-D-glucose (SC-GLU) and 2% agar was used for selection of plasmid transformation on solid
media. For liquid cultures, S. cerevisiae was grown SC-GLU at 30°C and 200 rpm. All plasmids and yeast
strains used herein are described in Tables I and II.
Immunoblot analysis of PsSAS and PsCPR
[00143] Yeast strains GCY256 and GCY257 (Table I) expressing HA-tagged expressing PsSAS and
PsCPR respectively, were grown overnight in SC medium with 0.2% glucose and 1.8% galactose as carbon
sources. Ten ml of fresh medium containing 2% galactose as a carbon source was inoculated with 5% of the
overnight cultures and incubated at 30°C and 200 rpm. Cells were harvested by centrifugation at ODeoo n of
approximately 0.6 and lysed by bead beating in IP150 buffer (50 mM Tris-HCI (pH 7.4), 150 mM NaCI, 2 mM
MgCI2, 0.1 % Nonidet P-40) supplemented with Complete Mini protease inhibitor mixture tablet (Roche
Applied Science). The lysates were cleared by centrifugation and protein concentration was estimated using
the Coomassie protein assay reagent (Thermo Scientific). Forty g of total protein extract were resolved by
SDS-PAGE and transferred to nitrocellulose for detection of the HA epitope using mouse anti-HA tag
antibody HA-C5 (Abeam). As loading control, glyceraldehyde-3-phosphate dehydrogenase (GAPDH) was
detected using rabbit anti-GAPDH (Rockland immunochemicals). Imaging of the blot was performed using
an Odyssey imager and IRDye™ secondary antibodies (LI-COR Biosciences).
Cell feeding assays
[00144] Whole cell substrate feeding assays were used to test the function of enzymes individually
and in combinations. Assays were performed in 96-well plates. A colony of S. cerevisiae was inoculated in
100 µ Ι of SC-GLU and incubated for 24 hrs on a rotatory shaker at 30°C and 400 rpm. Cultures were diluted
to 10% into 1 ml of fresh SC-GLU and incubated for an additional 6 hrs. Cells were harvested by
centrifugation at 2000 x g for 2 min. Supernatants were decanted and cells were suspended in 300 µ Ι of 100
mM Tris-HCI pH 7.5, 8, 8.5 or 9, containing 100 µΜ of the suitable substrate: (R)-reticuline, salutaridine or
codeine. Cells were incubated for 16 to 20 hrs and then harvested by centrifugation at 15000 x g for 1 min.
For BIA extraction from cells, the cell pellet was suspended in 300 µ Ι methanol and vortexed for 30 min. Cell
extracts were clarified by centrifugation at 15000 x g for 1 min and used directly for LC-MS analysis.
Supernatant fractions were diluted in methanol to keep alkaloid concentrations within the range of standard
curve values and avoid saturating FT signals. As negative controls, yeast strains transformed with the
correspondent empty plasmids were incubated with each of the pathway intermediates.
Chiral analysis of reticuline [00145] Separation of the (R)- and (S)- enantiomers of reticuline was performed using the chiral
column CHIRALCEL™ OD-H (4.6x250mm, Daicel Chemical Industries) and the solvent system hexane:2-
propanohdiethylamine (78:22:0.01) at a flow rate of 0.55 ml min 1 [18]. Following LC separation, metabolites were injected into an LTQ ion trap mass spectrometer (Thermo Electron, San Jose, CA) and detected by
selected reaction monitoring (SRM). SRM transitions of m/z 288 to164.0 (CID@35) and 330 to 192
(CID@30) were used to detect reticuline. Retention times for reticuline obtained in samples matched
retention times observed with authentic standards.
FT-MS analysis of alkaloids
[00146] Detection of opiates in the morphine biosynthetic pathway was performed by FT-MS using a
7T-LTQ FT ICR instrument (Thermo Scientific, Bremen, Germany). Alkaloids were separated by reverse
phase HPLC (Perkin Elmer SERIES 200 Micropump, Norfolk, CT) using an Agilent Zorbax™ Rapid
Resolution HT C18 2.1x30 mm, 1.8 micron column. Solvent A (0.1 % formic acid) and solvent B (100%
acetonitrile, 0.1 % formic acid) were used in a gradient elution to separate the metabolites of interest as follows: 0-1 min at 100% A, 1-6 min 0 to 95% B (linear gradient), 7-8 min 95% B, 8-8.2 min 100% A, followed by a 1 min equilibration at 100% A. Five µΙ of either cell extract or supernatant fraction were loaded
on the HPLC column run at a constant flow rate of 0.25 ml/min. Following LC separation, metabolites were
injected into the LTQ-FT-MS (ESI source in positive ion mode) using the following parameters: resolution,
100000; scanning range, 250 to 450 AMU; capillary voltage, 5 kV; source temperature, 350°C; AGC target
setting for full MS were set at 5 x 105 ions. Identification of alkaloids was done using retention time and exact
mass (<2 ppm) of the monoisotopic mass of the protonated molecular ion [M + H]+. Authentic standards of
(R)-reticuline, (S)-reticuline, salutaridine, thebaine, oripavine, codeine and morphine were used to confirm
the identity of BIA intermediates and to quantify morphine alkaloids. MS2 spectra were also used to further validate compound identity. When unavailable, equal ionization efficiency was assumed between an
intermediate and the closest available quantifiable alkaloid: salutaridinol (m/z=330) as salutaridine,
codeinone {m/z =298) and neopine (m/z=300) as codeine.
EXAMPLE 2: Reticuline production and utilization in engineered S. cerevisiae
[00147] Opium poppy salutaridine synthase (CYP71 9B1 ; PsSAS), the enzyme converting ( )-
reticuline to salutaridine, has been characterized as strictly enantioselective for the (R)-enantiomer of
reticuline [ 19]. However, salutaridine synthesis from (R,S)-norlaudanosoline has been said to be achieved in
yeast using the 3 opium poppy MTs and the human cytochrome P450 enzyme CYP2D6 as a surrogate
source of salutaridine synthase, however it is unclear how for reasons presented above [13]. Unfortunately
the enantioselectivity of the CYP2D6 was not reported.
[00148] Herein, the opium poppy enantioselective PsSAS was used for the reconstitution of the
morphinan pathway in yeast (FIG. 2B). While expression in yeast of the opium poppy salutaridine synthase and its cognate reductase could be confirmed by immunoblotting (FIG. 2C), PsSAS activity as measured by
salutaridine production or reticuline consumption in a reticuline-producing strain supplemented with (R,S)-
norlaudanosoline, was not detected (strains GCY1086 (expressing 60 ΜΤ.4Ό ΜΤ2 and CNMT) and
GCY1357 (expressing 60MT, CNMT, 4Ό ΜΤ2, SAS and CPR); FIG. 2D). In contrast, when co-expressing
the three P. somniferum MTs (Ps60MT, PsCNMT and Ps4'OMT2) with the berberine bridge enzyme
(PsBBEAN-2p), which is enantioselective for the (S)-enantiomer of reticuline [20], greater than 50%
consumption of the reticuline produced by yeast cells was observed (strain GCY1359; FIG. 2D).
Furthermore, near complete consumption of the reticuline intermediate was observed using a
dihydrosanguinarine-producing strain, allegedly due to a pull on reticuline from the downstream pathway
(strain GCY1 125 (expressing the complete sanguinarine pathway); FIG. 2D). Taken together, the lack of
reticuline turnover by the PsSAS expressing strain and the near complete utilisation of reticuline in a
dihydrosanguinarine-producing strain suggested that the reticuline being produced from (R,S)-
norlaudanosoline was not racemic but was in fact only the (S)-enantiomer.
EXAMPLE 3: Chiral analysis of reticuline produced in S. cerevisiae
[00149] To further investigate the possibility that the reticuline produced from (/?,S)-norlaudanosoline
by the three opium poppy MTs was not racemic, chiral analysis by HPLC was used to reveal the presence or
absence of reticuline enantiomers. Chiral analysis of enantio-pure standards of (/?)- and (S)-reticuline and of
racemic (R,S)-reticuline was first performed to confirm the separation of the two enantiomers (FIGs. 3A, 3B
and 3C). Analysis of the reticuline produced by the BBE-expressing strain GCY1359 (60MT, CNMT,
4Ό ΜΤ2, ΒΒΕ∆Ν-2µ), which was assumed to accumulate (R)-reticuline and convert (S)-reticuline into
scoulerine, showed instead that only trace (S)-reticuline remained and no (Rj-reticuline was detected (FIG.
3D). Finally, chiral analysis of the reticuline produced by strain GCY1086 expressing only the three P.
somniferum MTs (60MT, 4Ό ΜΤ2 and CNMT) revealed that only (S)-reticuline was produced (FIG. 3E),
demonstrating the strict enantioselectivity of one or more of the three MTs on racemic norlaudanosoline
(FIG. 3F).
[00150] While the major route for the synthesis of (R)-reticuline in P. somniferum is considered to be
epimerization from (S)-reticuline, the enzymes presumed to be involved in this reaction, DRS and DRR, have
not been cloned [ 1 1,12]. It should however be noted that (R)-reticuline is not the only (R)-BIA intermediate found in Ranunculales [26]. This suggests the possibility of an alternative pathway for the synthesis of (R)-
intermediates, possibly the existence of enzymes selective for the (R)-enantiomers from the very beginning
of the reticuline synthesis pathway. For example, both (S)- and (R)-/V-methylcoclaurine were isolated in
Berberis stolonifera. These two enantiomers of N-methylcoclaurine are required by the cytochrome P450
berbamunine synthase for the synthesis of berbamunine in Berberis stolonifera [26]. While P. somniferum
does not make (R,S)-norlaudanosoline, EXAMPLE 4: Functional expression of PsSAS in S. cerevisiae
[00151] The enzyme salutaridine synthase has been characterized from its heterologous expression
and purification from insect cells [19]. PsSAS can accept both ( )-reticuline and ( )-norreticuline as
substrates, but not their correspondent (S)-enantiomers. The functional expression of PsSAS in S.
cerevisiae was tested using cell feeding assays supplemented with (R)-reticuline. These experiments were
used to demonstrate that the absence of salutaridine synthesis was due to the absence of ( )-reticuline
production as opposed to poor PsSAS expression or activity. Results from the feeding experiments showed
that cells expressing both PsSAS and PsCPR could catalyze the transformation of ( )-reticuline to
salutaridine (FIGs. 4A and 5A). Salutaridine was not detected in the presence of (S)-reticuline or in an (S)-
reticuline-producing strain co-expressing the salutaridine synthase. It was therefore concluded that PsSAS is functional in yeast and that the enzyme is enantioselective for ( )-reticuline, as previously reported [19].
EXAMPLE 5: Thebaine synthesis from salutaridine and (R)-reticuline
[00152] In opium poppy, salutaridine is converted to salutaridinol by the enzyme salutaridine
reductase (PsSAR). PsSAR catalyzes the forward reaction converting salutaridine to salutaridinol at pH 6.0-
6.5 and the reverse reaction at pH 9-9.5 [23].
[00153] When yeast cells expressing PsSAR (GC258) were incubated with salutaridine at pH 8, the
substrate was converted to salutaridinol demonstrating that the PsSAR is functional in yeast (FIG. 4B).
[00154] In vivo, in opium poppy, salutaridinol 7-O-acetyltransferase (PsSAT) acetylates salutaridinol
to salutaridinol-7-O-acetate, which spontaneously rearranges to thebaine at pH 8-9 and to the side product
dibenz[d,f]azonine at pH 6-7 [21 ,22].
[00155] While the existence of a thebaine synthase enzyme involved in the conversion of
salutaridinol-7-O-acetate to thebaine cannot be excluded, an enzyme with this activity has not been isolated
so far [21 ,27].
[00156] Therefore, to determine if the pH of the feeding assay influenced thebaine yields when (/?)-
reticuline or salutaridine was used as substrates, the activity of the engineered thebaine-producing strains was tested at pH 7.5, 8, 8.5 and 9. To test the functional expression in yeast of the ( )-reticuline to thebaine
pathway, cultures of strain GCY368 co-expressing PsSAS, PsCPR, PsSAR and PsSAT (thebaine block) were incubated with ( )-reticuline or salutaridine as substrates.
[00157] Thebaine was detected at all 4 pHs with a 3 and 4 fold higher yield at pH 8.5 and 9 than at
pH 7.5 (FIGs. 5A (wherein ( )-reticuline had been fed to strain GCY368) and 5B (wherein salutaridine had
been fed to strain GCY368). The accumulation of the pathway intermediate salutaridine but not salutaridinol,
salutaridinol-7-O-acetate or dibenz[d,f]azonine was observed. Furthermore, although cellular metabolism is
likely affected at an external pH above 8, enzymes involved in the synthesis of morphinan alkaloids appear to remain active, as demonstrated by thebaine production at pH>8 and viable plate counts showing no
significant cell death after 16 hrs of incubation at pH 7.5, 8, 8.5 or 9 (FIG. 12). A pH of 7.5 to 9 is likely
equivalent to a maximum intracellular pH of -7.5-8 [28].
[00158] These results confirmed functional expression of PsSAT and the spontaneous cyclization of
salutaridino-7-O-acetate to thebaine, with an increasing efficiency using alkaline assay conditions.
Accumulation of salutaridine when strain GCY368 was supplemented with either (R)-reticuline or salutaridine
indicates that PsSAR is likely limiting flux through the recombinant thebaine-producing pathway (FIGs. 5A-
B).
[00159] The functional expression of all known opium poppy genes leading to codeine and morphine
synthesis in yeast and for the first time thebaine was synthesized in S. cerevisiae.
EXAMPLE 6: Functional expression of PsSAS N-terminal variants in S. cerevisiae
[00160] The P. somniferum salutaridine synthase (PsSAS; CYP719B1) is a plant cytochrome P450.
Plant cytochrome P450s are usually membrane-bound enzymes and localize to the microsomes in yeast.
Analysis of the sequence of PsSAS using TMpred (http://www.ch.embnet.oiy/software MPRED_form.html)
and SignIP 4. 1 {http://www.cbs.dtu.dk/services/SignalP) allowed identification of a possible PsSAS N-
terminal a-helix of 30 amino acids (shaded in FIG 9E and 10A) for membrane localization. The terminal
region of an alpha-helix is characterized by a string of charged amino acids which are probably amino acids
26-31 in PsSAS (KFMFSK (SEQ ID NO: 275)). The Applicants truncated PsSAS between amino acids 30
and 3 1 to generate truncated PsSAS, cloned into vector pGC720. The same analysis was then performed on
other 2 available cytochrome P450s from P. somniferum: canadine synthase (PsCAS) and cheilanthifoline
synthase (CFS), and fusion proteins were generated with their N-terminal a-helixes and truncated PsSAS
using standard cloning techniques. NTCAS-SAS cloned into pGC721 contains the N-terminal domain of
PsCAS and NTCFS-SAS cloned into pGC722 contains the N-terminal domain of PsCFS. The SAS variants
differing at the W-terminal anchoring domain were all cloned together with PsCPR into pGC964 and tested in feeding with 100 uM (R)-reticuline at pHs 7.5 and 9 (FIGs. 6A-B). Constructs are described in Tables I and II.
All variants showed activity at both the tested pHs but wild-type PsSAS showed the highest activity.
EXAMPLE 7 : Synthesis of codeine and morphine in S. cerevisiae
[00161] Thebaine is the precursor to codeine and morphine synthesis (FIG. 1) and to semi-synthetic
opioids. Two alternative pathways have been described for the production of morphine from thebaine in P.
somniferum, only one of which proceeds through the intermediate codeine (FIG. 1). Thebaine 6-0-
demethylase (PsT60DM) and codeine-O-demethylase (PsCODM) are the enzymes responsible of the
demethylation steps at position 6 and 3, respectively. PsCODM can accept both thebaine and codeine, while
PsT60DM can demethylate both thebaine and oripavine [24]. The pathway proceeding through codeinone and codeine, which has been shown to be the favorite route in yeast expressing the PsCODM, PsT60DM
and PsCOR, also leads to the side products neopine and neomorphine in S. cerevisiae [5]. In this pathway,
the codeinone reductase (PsCOR) reduces neopinone to neopine prior to the spontaneous rearrangement of
neopinone to codeinone and neopine is demethylated to neomorphine by CODM (FIG. 7A).
[00162] To test for a functional (R)-reticuline to morphine pathway in yeast and to identify potential
bottlenecks, cells of strain GCY1358 co-expressing the 7 enzymes of the pathway (FIG. 1) were
supplemented with either (R)-reticuline, salutaridine, thebaine or codeine, and morphinan products were
measured using a pH of 7.5 and 9 (FIG. 7B and FIGs. 8A-C). Relative proportion of morphinan alkaloids was
estimated by comparing peak areas.
[00163] Percent conversion was calculated as the ratio of total moles of product (from both cell
extract and supernatant) to moles of recovered substrate. When reticuline was supplemented as substrate,
accumulation of 18% salutaridine as only downstream intermediate was detected at pH 7.5 (FIG. 8A) and
the accumulation of 15% salutaridine and 0.04% codeine was detected at pH 9 (FIGs. 7B and 8A). Since
synthesis of thebaine is less efficient at pH 7.5, intermediates flux was likely not sufficient for detectable
synthesis of codeine, which was instead detected at pH 9. When salutaridine was used as substrate in cell feeding assays at pH 9, trace thebaine, 0.1 % codeine and 0.03% neopine were detected (FIGs. 7B and 8B).
When the same experiment was performed at pH 7.5, no alkaloids downstream salutaridine were detected,
likely because not enough thebaine was produced at this pH to guarantee detectable downstream flux of
metabolites. No other opiate intermediates or side products were detected in the experimental condition
tested.
[00164] Since neither oripavine, morphine or neomorphine were detected and they all are products of
the PsCODM, the functional expression of the CODM in strain GCY1358 using thebaine and codeine as
substrate was tested. When thebaine was used as substrate, about 7% codeine and 0.3% morphine were
detected at pH 7.5 and about 4% codeine and 0. 4% morphine were detected at pH 9 (FIG. 8C). Trace
neomorphine were detected at pH 7.5 but not at pH 9, while neopine was detected at both pHs. When
codeine was used as substrate, conversion yields of codeine to morphine of 0.2% and 0.5% were observed
at pH 7.5 (FIG. 8D) and 9, respectively (FIG. 7B and FIG. 8D), indicating that CODM is indeed functional in
the engineered strain but its expression and/or activity are likely limiting flux to morphine synthesis. While
intracellular transport of the supplemented thebaine and codeine may also be a limiting factor, the absence
of morphine synthesis from (R)-reticuline or salutaridine in strain GCY1358 is likely due to low efficiency of
the overall pathway including CODM. When codeine was supplemented to strain GCY1358, accumulation of
0.3% codeinone at pH 7.5 (FIG. 8D) and 7% codeinone at pH 9 (FIGs. 7B and 8D) were also observed,
indicating the non-productive oxidation of codeine by PsCOR. FIGs. 11A-C showing chromatograms and
MS2 spectra of morphinans produced in whole cell feeding assays of strain GCY1358 at pH 9 is added to further prove the identity of the morphinans detected and described in FIG. 7B
EXAMPLE 8 : CODM with increased specificity towards thebaine than codeine
[001 65] Poor CODM expression or catalytic properties could contribute to the low efficiency of CODM
and should be investigated for pathway optimization.
[00166] Possible approaches to overcome this problem are to generate synthetic microbial
compartments (Kim EY et al, 2014, Biotechnol J 9: 348-354), multi-enzyme scaffolds to channel
intermediates to the pathway of interest (Dueber JE et al, 2009, Nat Biotechnol 27: 753-759), alteration of
enzyme specificity by protein engineering, tuning gene copy numbers (Thodey K. at al, 2014, Nat Chem Biol)
or use of orthologues and/or paralogs with better expression and/or catalytic properties (Xiao M et al, 201 3, J
Biotechnol 166: 122-134).
[00167] Promiscuity of both CODM and COR further affects the overall pathway's efficiency by
provoking accumulation of undesirable side-products such as those observed in the thebaine to morphine
pathway [4,5]. When PsCOR reduces neopinone, prior to the spontaneous rearrangement of neopinone to
codeinone, the side product neopine accumulates. Neopine can then be demethylated by CODM to give the
side product neomorphine (FIG. 7A). Also, COR catalyze the reduction of codeinone to codeine and the
inverse non-productive oxidation of codeine to codeinone (FIG. 7A) (Unterlinner B. et al., 1999, Plant J 18:
465-475). A possible way to overcome these complications could be synthesize morphine from the
alternative pathway that has been described in planta and that does not proceed through codeine (FIG. 1). In
this pathway thebaine is demethylated at 3' to give oripavine, which is demethylated at 6' to give
morphinone, and finally morphinone is reduced to morphine by COR. However, PsCODM and PsT60DM are
not optimal for this purpose because they favor the pathway proceeding through codeine when expressed in
yeast.
[00168] Transcriptomics databases were searched for O-demethylases homologs from P.
somniferum. Selected ODM candidates are shown in FIG. 10E, derived consensus (FIG. 10E), and FIG. 13A
(phylogenetic tree). Candidates were codon optimized for optimal expression in yeast and obtained as
synthetic genes from Gen9 (MA, USA). The pBOT-LEU system was used for cloning purposes (FIG. 14).
The pBOT system allows preliminary GFP tagging of target enzymes by cloning in between Sapl sites. The
GFP tag was removed prior to activity test by cell feeding assay. Removal of the GFP tag was obtained by
Kasl digestion and plasmid religation. Protein expression was first confirmed for all candidates using GFP fusion constructs (FIG. 13B). The same candidates, but with no GFP tag, were tested in feeding experiments with thebaine and codeine (FIGs. 13C-D). Candidate ODM-Pso9 demethylates thebaine to oripavine but
does not accept codeine. This enzyme could be used to direct synthesis of morphine through the oripavine
pathway to avoid the formation of the side products neopine and neomorphine (FIG. 1 and FIG. 7A).
However, to do so, ODM-Pso9 should react with thebaine faster than T60DM. This could be obtained by tuning gene copy numbers for example. Screening for ODM candidates that demethylate oripavine but not
thebaine is another possibility. The present invention encompasses increasing gene copy number of CODM
and/or controlling expression of T60DM and COR by using inducible promoters.
[00169] Plants use cellular compartmentalization of competing activities and transport to channel
specific syntheses towards specialized cell types [33] and tissue. Other means of circumventing this
promiscuity could be to therefore to generate synthetic microbial compartments [34], or multi-enzyme
scaffolds to channel intermediates to the pathway of interest [35].
EXAMPLE 9 : COR with decreased specificity towards neopinone
[00170] NADPH dependent alpha-keto reductase homologs of COR, with different catalytic
properties, namely lower efficiency towards neopinone, could improve pathway efficiency. Transcriptomics
databases were searched for orthologues and paralogs of COR and selected candidates are described in
FIG. 10F and derived consensus (FIG. 10F). Tuning expression of COR using an inducible promoter to
reduce its activity towards neopinone could also be performed to further optimize its efficiency towards
codeine and morphine.
[00171] Enzyme mutagenesis is also a possible way to circumvent this problem.
EXAMPLE 10: Salutaridine reductase (SAR): mutants and SDRs orthologues
[00172] Salutaridine reductase belongs to the NADPH-dependent short chain
dehydrogenases/reductase (SDR) family. Other enzymes involved in BIA metabolism that belong to this family are noscapine synthase (NOS), which converts narcotinehemiacetal to noscapine and sanguinarine
reductase (SanR), which reduces sanguinarine to dihydrosanguinarine.
[00173] Applicants' results indicate that inefficient synthesis of salutaridinol from salutaridine is
limiting flux to thebaine. This is illustrated by the fact that no difference in thebaine synthesis was observed
between cell assays that were supplemented with 100 µΜ salutaridine (FIG. 4B) and those that produced 10
µΜ salutaridine by using (/?)-reticuline as a feeding substrate (FIG. 4A). Intracellular transfer of substrate,
poor PsSAR expression or catalytic properties could all contribute to the low efficiency of this conversion are
investigated for pathway optimization.
[00174] Salutaridine reductase from Papaver bracteatum (PbSAR, FIG. 10C: candidate
280|EF|SDR_Pbr_1_ACN87276), which differs only in 13 amino acids from PsSAR (FIG. 10C: sequence
PsoSAR-ABR14720), is known to be substrate inhibited at low concentration of salutaridine ( ; = 150 µΜ)
[29]. A previous mutagenesis study of PbSAR, based on homology modeling, resulted in identification of 2
mutants, F104A and I275A, with reduced substrate inhibition and increased Km, but slightly higher feat- The
double mutant F104A/I275A showed no substrate inhibition, with a higher K and at- Therefore, an
increased flux in the (R)-reticuline to thebaine pathway could ostensibly be achieved by incorporating these mutations in PsSAR.
The core structure of SAR is highly homologous to other members of the SDR, the main difference being
that the substrate-binding pocket and the nicotinamide moiety are covered by a loop (SAR-Pso-ABR14720,
residues 265-279; FIG. 10C, sequence underlined) on top of which lays a 'flap'-like domain (SAR-Pso-
ABR14720, residues 105 to 140; FIG. 10C sequence in bold)[38]. Candidate SAR homologs were identified
by searching transcriptomics databases for the conserved NADPH-binding motif MNYGIGN (SEQ ID NO:
276) and they are indicated in FIG. 10C including derived consensus; mutants F104A/I275A (Pso_6 SAR
candidate, FIG. 10C, positions shown highlighted) and I275A (Pso_7 SAR candidate, FIG. 10C, position
shown highlighted) are also indicated in FIG. 10C. The Nandina domestica variant (281 |EF|SDR_Ndo-1)
presents the same mutation F 104A described in the mutagenesis study cited above (FIG. 10C, position
shown bold and underlined in Pso_7).
[00175] SAR candidates described in FIG. 10C are tested for conversion of salutaridine to
salutaridinol in order to increase flux in the (R)-reticuline to thebaine.
EXAMPLE 11: Increasing the activity of P450s
[00176] Cytochrome bs has been reported to enhance activity of certain cytochrome P450s40. Tuning
expression of the four P450s, CPR and cognate cytochrome bs could increase pathway efficiency. The
impact of cytochrome b5 on yield is tested by expressing b5 in a plasmid or integrated in a chromosome in
host cells expressing thebaine block(s), and eventually the morphine block.
EXAMPLE 12: Increasing the activity of SAR
[00177] The single mutant I275A (Pso_7 SDR candidate in FIG. 10C) and the double mutant I275A/F104A
(Pso_6 SDR candidate in FIG. 10C) were ordered as synthetic genes and differ from PsSAR only for the
point mutations indicated. Their activities are tested for increased flux in the (R)-reticuline to the thebaine
pathway.
[00178] The scope of the claims should not be limited by the preferred embodiments set forth in the
examples, but should be given the broadest interpretation consistent with the description as a whole. REFERENCES
1. Biancofiore G (2006) Oxycodone controlled release in cancer pain management. Ther Clin Risk Manag 2: 229-234.
2. Millgate AG, Pogson BJ, Wilson IW, Kutchan TM, Zenk MH, et al. (2004) Analgesia: morphine-pathway block in topi poppies. Nature 431 : 413-414.
3. INCB (2013) Supply of opiate raw materials and demand for opiates for medical and scientific purposes. Estim Worid Requir 2014 - Stat 2012: Available: http://www.incb.org/documents/Narcotic-Drugs/technical- Publications/2012/NDR_2012_Part3_Supply_E.pdf. Accessed 30 September 2014.
4. Fossati E, Ekins A, Narcross L, Zhu Y, Falgueyret J-P, et al. (2014) Reconstitution of a 10-gene pathway for synthesis of the plant alkaloid dihydrosanguinarine in Saccharomyces cerevisiae. Nat Commun 5: 3283. Available: doi:10.1 038/ncomms4283. Accessed 27 July 2014.
5. Thodey K, Galanie S, Smolke CD (2014) A microbial biomanufacturing platform for natural and semisynthetic opioids. Nat Chem Biol: 1—1 0.
6. Nakagawa A, Minami H, Kim J-S, Koyanagi T, Katayama T, et al. (2012) Bench-top fermentative production of plant benzylisoquinoline alkaloids using a bacterial platform. Bioeng Bugs 3: 49-53.
7. De Luca V, Salim V, Atsumi SM, Yu F (2012) Mining the biodiversity of plants: a revolution in the making. Science 336: 1658-1661 .
8. Hagel JM, Facchini PJ (2013) Benzylisoquinoline alkaloid metabolism: a century of discovery and a brave new world. Plant Cell Physiol 54: 647-672.
9. Beaudoin GAW, Facchini PJ (2014) Benzylisoquinoline alkaloid biosynthesis in opium poppy. Planta 240: 19-32.
10. llari A, Franceschini S, Bonamore A, Arenghi F, Botta B, et al. (2009) Structural basis of enzymatic (S)- norcoclaurine biosynthesis. J Biol Chem 284: 897-904.
H .Hirata K, Poeaknapo C, Schmidt J, Zenk MH (2004) 1,2-Dehydroreticuline synthase, the branch point enzyme opening the morphinan biosynthetic pathway. Phytochemistry 65: 1039-1 046.
12. De-Eknamkul W, Zenk MH (1992) Purification and properties of 1,2-dehydroreticuline reductase from Papaver somniferum seedlings. Phytochemistry 3 1: 813-821 .
13. Hawkins KM, Smolke CD (2008) Production of benzylisoquinoline alkaloids in Saccharomyces cerevisiae. a Chem Biol 4: 564-573.
14. Nakagawa A, Matsuzaki C, Matsumura E, Koyanagi T, Katayama T, et al. (2014) (R,S)- Tetrahydropapaveroline production by stepwise fermentation using engineered Escherichia coli. Sci Rep 4: 6695. Available: doi:10.1038/srep06695. Accessed 12 November 2014.
15. Jansen G, Wu C, Schade B, Thomas DY, Whiteway M (2005) Drag&Drop cloning in yeast. Gene 344: 43-51 .
16.Shao Z, Zhao H, Zhao H (2009) DNA assembler, an in vivo genetic method for rapid construction of biochemical pathways. Nucleic Acids Res 37: e16. Available: doi: 10.1093/nar/gkn991 . Accessed 24 July 2014. 17.Gietz RD, Schiestl RH (2007) Frozen competent yeast cells that can be transformed with high efficiency using the LiAc/SS carrier DNA/PEG method. Nat Protoc 2: 1-4.
18. Nakagawa A, Minami H, Kim J-S, Koyanagi T, Katayama T, et al. (201 1) A bacterial platform for fermentative production of plant alkaloids. Nat Commun 2: 326-328. Available: http://dx.doi.org/10.1038/ncomms1327. Accessed 30 September, 2014.
19. Gesell A, Rolf M, Ziegler J, Diaz Chavez ML, Huang F-C, et al. (2009) CYP719B1 is salutaridine synthase, the C-C phenol-coupling enzyme of morphine biosynthesis in opium poppy. J Biol Chem 284: 24432-24442.
20. Facchini PJ, Penzes C, Johnson AG, Bull D (1996) Molecular characterization of berberine bridge enzyme genes from opium poppy. Plant Physiol 112: 1669-1 677.
2 1.Fisinger U, Grobe N ZM (2007) Thebaine synthase: a new enzyme in the morphine pathway in P. somniferum. Nat Prod Commun 2: 249-253.
22. Theuns HG, Lenting HBM, Salemink CA, Tanaka H, Shibata M, et al. (1984) Neodihydrothebaine and bractazonine, two dibenz[d,f]azonine alkaloids of Papaver bracteatum. Phytochemistry 23: 1157-1 166.
23. Gerardy R, Zenk MH ( 1993) Purification and characterization of salutaridine : NADPH 7- oxidoreductasefrom papaver somniferum. Phytochemistry 34: 125-132.
24. Hagel JM, Facchini PJ (2010) Dioxygenases catalyze the O-demethylation steps of morphine biosynthesis in opium poppy. Nat Chem Biol 6: 273-275.
25. Facchini PJ, Bohlmann J, Covello PS, De Luca V, Mahadevan R, et al. (2012) Synthetic biosystems for the production of high-value plant metabolites. Trends Biotechnol 30: 127-131 .
26. Kraus PF, Kutchan TM (1995) Molecular cloning and heterologous expression of a cDNA encoding berbamunine synthase, a C-0 phenol-coupling cytochrome P450 from the higher plant Berberis stolonifera. Proc Natl Acad Sci U S A 2 2071-2075.
27.Sabarna K (2006) Approaches to isolating a cDNA encoding thebaine synthase of morphine biosynthesis from opium poppy Papaver somniferum. PhD thesis, Martin Luther University Halle-Wittenberg. Available: http://www.dart-europe.eu/full.php?id=441 10. Accessed: 26 August 2014.
28. Aabo T, Gluckstad J, Siegumfeldt H, Arneborg N (201 1) Intracellular pH distribution as a cell health indicator in Saccharomyces cerevisiae. J R Soc Interface 8: 1635-1643. Available: doi: 10.1 098/rsif .201 .01 48. Accessed 8 March 2014.
29. Ziegler J, Brandt W , Geissler R, Facchini PJ (2009) Removal of substrate inhibition and increase in maximal velocity in the short chain dehydrogenase/reductase salutaridine reductase involved in morphine biosynthesis. J Biol Chem 284: 26758-26767.
30. Weng J-K, Philippe RN, Noel JP (2012) The rise of chemodiversity in plants. Science 336: 1667-1670.
3 1.Farrow SC, Facchini PJ (2013) Dioxygenases catalyze O-demethylation and 0,0-demethylenation with widespread roles in benzylisoquinoline alkaloid metabolism in opium poppy. J Biol Chem 288: 28997-29012.
32. Unterlinner B, Lenz R, Kutchan TM (1999) Molecular cloning and functional expression of codeinone reductase: the penultimate enzyme in morphine biosynthesis in the opium poppy Papaver somniferum. Plant J 18: 465-475. 33. Ziegler J, Facchini PJ (2008) Alkaloid biosynthesis: metabolism and trafficking. Annu Rev Plant Biol 59: 735-769.
34. Kim EY, Tullman-Ercek D (2014) A rapid flow cytometry assay for the relative quantification of protein encapsulation into bacterial microcompartments. Biotechnol J 9: 348-354.
35. Dueber JE, Wu GC, Malmirchegini GR, Moon TS, Petzold CJ, et al. (2009) Synthetic protein scaffolds provide modular control over metabolic flux. Nat Biotechnol 27: 753-759.
36. Xiao M, Zhang Y, Chen X, Lee E-J, Barber CJS, et al. (2013) Transcriptome analysis based on next- generation sequencing of non-model plants producing specialized metabolites of biotechnological interest. J Biotechnol 166: 122-134.
37.Siddiqui (2012) Advancing secondary metabolite biosynthesis in yeast with synthetic biology tools FEMS Yeast Res. 12(2): 144-1 70.
38. Higashi Y at al., 201 1, J Biol Chem 286 (8), pp. 6532-6541 .
39. Farrow, S.C., et al., Stereochemical inversion of (S)-reticuline by a cytochrome P450 fusion in opium poppy. Nat Chem Biol, 2015. 11(9): p. 728-32.
40. Winzer, T., et al., Plant science. Morphinan biosynthesis in opium poppy requires a P450-oxidoreductase fusion protein. Science, 2015. 349(6245): p. 309-12.
4 1.Nakagawa, A., et al., Total biosynthesis of opiates by stepwise fermentation using engineered Escherichia coli. Nat Commun, 201 6. 7: p. 10390. CLAIMS:
1. A method of preparing a morphinan alkaloid (MA) metabolite comprising:
(a) culturing a host cell under conditions suitable for MA production including a first
fermentation at a pH of between about 7.5 and about 10, said host cell comprising:
(i) a first heterologous coding sequence encoding a first enzyme involved in a metabolite
pathway that converts (R)-reticuline into the metabolite;
(ii) a second heterologous coding sequence encoding a second enzyme involved in a
metabolite pathway that converts (R)-reticuline into the metabolite; and
(iii) a third heterologous coding sequence encoding a third enzyme involved in a metabolite
pathway that converts (R)-reticuline into the metabolite;
(b) adding (/?)-reticuline to the cell culture; and
(c) recovering the metabolite from the cell culture.
2. The method of claim 1, wherein the host cell is a yeast cell.
3. The method of claim 2, wherein the yeast is Saccharomyces.
4. The method of claim 3, wherein the Sacharomyces is Sacharomyces cerevisiae.
5. The method of any one of claims 1 to 4, wherein the cell further comprises a fourth heterologous
coding sequence encoding a fourth enzyme involved in a metabolite pathway that converts (R)-reticuline into
the metabolite.
6. The method of claim 5, wherein the metabolite is salutaridinol-7-O-acetate or thebaine.
7. The method of claim 6, wherein:
(i) the first enzyme is salutaridine synthase (SAS) ;
(ii) the second enzyme is cytochrome P450 reductase (CPR);
(iii) the third enzyme is salutaridine reductase (SAR); and/or
(iv) the fourth enzyme is salutaridinol acetyltransferase (SAT).
8. The methode of claim 7, wherein
(i) the SAS is as set forth in any one of the sequences as depicted in FIGs. 9E and 10A (SEQ
ID NOs: 4 1, 4446, 68-80 and 277-288);
(ii) the CPR is as set forth in any one of the sequences as depicted in FIGs. 9E and 10B (SEQ
ID NOs: 47, 81-1 18 and 289-322); (iii) the SAR is as set forth in any one of the sequences as depicted in FIGs. 9E and 10C (SEQ
ID NOs: 50 and 119-1 35); and/or
(iv) the SAT is as set forth in any one of the sequences as depicted in FIGs. 9E andlOD (SEQ
ID NOs: 52 and 136-166).
9. The method of claim 8, wherein:
(i) SAS is from Papaver somniferum;
(ii) CPR is from Papaver somniferum;
(iii) SAR is from Papaver somniferum; and/or
(iv) SAT is from Papaver somniferum.
10. The method of claim 9, wherein:
(i) PsSAS is as set forth in any one of SEQ ID NOs: 4 1, 44-46, 70-78 and 277-288 (FIG. 10A);
(ii) PsCPR is as set forth in SEQ ID NOs: 47 or 296 (FIG. 10B);
(iii) PsSAR is as set forth in any one of SEQ ID NOs: 50, 119-121 , 126-127, 130 and 133 (FIG.
10C); and/or
(iv) PsSAT is as set forth in any one of SEQ ID NOs: 52 and 136-165 (FIG. 10D).
11. The method of any one of claims 1 to 10, wherein the cell further comprises a fifth heterologous coding sequence encoding a fifth enzyme involved in a metabolite pathway that converts (R)-reticuline into the metabolite.
12. The method of claim 11, wherein the fifth enzyme is a thebaine-6-O-demethylase (T60DM) and/or codeine-O-demethylase (CODM).
13. The method of claim 12, wherein the fifth enzyme is T60DM.
14. The method of claim 13, wherein the metabolite is neopinone, which spontaneously rearranges to codeinone.
15. The method of claim 13 or 14, wherein the T60 D and is as set forth in any one of the sequences as depicted in FIGs. 9E and 10E (SEQ ID NOs: 55, 58 and 167-1 78).
16. The method of any one of claims 13 to 15, wherein the T60DM is from Papaver somniferum (Ps).
17. The method of claim 16, wherein PsT60DM is as set forth in any one of SEQ ID NOs: 55, 58 and
167-177 (FIG. 10E), preferably SEQ ID NO: 58.
18. The method of claim 12, wherein the fifth enzyme is CODM. 19. The method of claim 18, wherein the metabolite is oripavine.
20. The method of claim 18 or 19, wherein the CODM is as set forth in any one of the sequences as depicted in FIG. 10E (SEQ ID NOs: 55, 58 and 167-1 78), preferably Pso9 (FIG. 10E (SEQ ID NO:175)).
2 1. The method of any one of claims 18 to 20, wherein the CODM is from Papaver somniferum (Ps).
22. The method of claim 2 1, wherein PsCODM is as set forth in any one of SEQ ID NOs: 55, 58 and 167-
177 (FIG. 10E), preferably SEQ ID NO: 55.
23. The method of any one of claims 11 to 22, wherein the cell further comprises a sixth heterologous coding sequence encoding a sixth enzyme involved in a metabolite pathway that converts (R)-reticuline into the metabolite.
24. The method of claim 23, wherein the sixth enzyme is codeinone reductase (COR) or thebaine-6-O- demethylase (T60DM).
25. The method of claim 24, wherein the sixth enzyme is COR.
26. The method of claim 25, wherein the metabolite is codeine.
27. The method of claim 25 or 26, wherein the COR is as set forth in any one of the sequences depicted in FIG. 10F (SEQ ID NOs: 6 1 and 179-193).
28. The method of any one of claims 25 to 27, wherein the COR is from Papaver somniferum (Ps).
29. The method of claim 28, wherein PsCOR is as set forth in any one of SEQ ID NOs: 6 1 and 179-1 89
(FIG. 10F), preferably SEQ ID NO: 6 1.
30. The method of claim 24, wherein the sixth enzyme T60DM.
3 1. The method of claim 30, wherein the metabolite is morphinone.
32. The method of claim 30 or 3 1, wherein the T60DM and is as set forth in any one of the sequences as depicted in FIG. 10E (SEQ ID NOs: 55, 58 and 167-1 78).
33. The method of any one of claims 30 to 32, wherein the T60DM is from Papaver somniferum (Ps).
34. The method of claim 33, wherein the PsT60DM is as set forth in any one of SEQ ID NOs: SEQ ID
NOs:55, 58 and 167-1 77 (FIG. 10E), preferably SEQ ID NO: 58.
35. The method of any one of claims 23 to 34, wherein the cell further comprises a seventh heterologous coding sequence encoding a seventh enzyme involved in a metabolite pathway that converts (/?)-reticuline into the metabolite.
36. The method of claim 35, wherein the seventh enzyme is codeine-O-demethylase (CODM) or codeinone reductase (COR). 37. The method of claim 36, wherein the metabolite is morphine.
38. The method of claim 36 or 37, wherein the seventh enzyme is CODM.
39. The method of claim 38, wherein the CODM is as set forth in any one of the sequences as depicted in
FIG. 10E (SEQ ID NOs: 55, 58 and 167-1 78).
40. The method of claim 38 or 39, wherein the CODM is from Papaver somniferum (Ps).
4 1. The method of claim 40, wherein PsCODM is as set forth in any one of SEQ ID NOs: SEQ ID NOs:
55, 58 and 167-177 (FIG. 10E), preferably SEQ ID NO: 55.
42. The method of claim 36 or 37, wherein the seventh enzyme is COR.
43. The method of claim 42, wherein the COR is as set forth in any one of the sequences depicted in FIG.
10F (SEQ ID NOs: 6 1 and 179-1 93).
44. The method of claim 42 or 43, wherein the COR is from Papaver somniferum (Ps).
45. The method of claim 44, wherein PsCOR is as set forth in any one of SEQ ID NOs: 6 1 and 179-1 89
(FIG. 10F), preferably SEQ ID NO: 6 1.
46. The method of any one of claims 1 to 4, wherein the metabolite is morphine.
47. The method of claim 46, wherein:
(i) the first enzyme is codeine-O-demethylase (CODM);
(ii) the second enzyme is thebaine-6-O-demethylase (T60DM); and/or
(iii) the third enzyme is codeinone reductase (COR).
48. The method of claim 47, wherein:
(i) the T60DM and is as set forth in any one of the sequences as depicted in FIG. 10E (SEQ
ID N0s:55, 58 and 167-1 78);
(ii) the CODM is as set forth in any one of the sequences as depicted in FIG. 10E (SEQ ID
NOs:55, 58 and 167-1 78), preferably Pso9 (FIG. 10E (SEQ ID NO: 175)); and/or
(iii) the COR is as set forth in any one of the sequences depicted in FIG. 10F (SEQ ID NOs: 6 1
and 179-193).
49. The method of claim 48, wherein:
(i) T60DM is from Papaver somniferum;
(ii) CODM is from Papaver somniferum; and/or
(iii) COR is from Papaver somniferum. 50. The method of claim 49, wherein:
(i) PsT60DM is as set forth in any one of SEQ ID NOs: SEQ ID NOs: 55, 58 and 167-1 77
(FIG. 10E), preferably SEQ ID NO: 55;
(ii) PsCODM is as set forth in any one of SEQ ID NOs: SEQ ID NOs: 55, 58 and 167-1 77 (FIG.
10E), preferably SEQ ID NO: 55; and/or
(iii) PsCOR is as set forth in any one of SEQ ID NOs: 6 1 and 179-189 (FIG. 10F), preferably
SEQ ID NO: 6 1 .
5 1. The method of any one of claims 1 to 50, wherein the host cell further expresses a cytochrome b5
(Cy 5).
52. The method of claim 5 1, wherein the Cy >5 is as set forth in any one of the sequences as depicted in
FIG. 10G (SEQ ID NOs: 64, 66 and 194), preferably SEQ ID NO: 64.
53. A plasmid comprising nucleic acid encoding: (a) the SAS, CPR, SAR and/or SAT enzymes as defined
in any one of claims 7 to 10; or (b) the CODM, T60DM and/or COR enzymes as defined in any one of claims
47 to 50.
54. The plasmid of claim 53, further comprising a terminator and/or a promoter.
55. The plasmid of claim 54 as set forth in:
(i) pGC359 as depicted in FIG. 9 (SEQ ID NO: 9); or
(ii) pGC1 1 as depicted in FIG. 9 (SEQ ID NO: 14).
56. A recombinant host cell expressing (a) the SAS, CPR, SAR and/or SAT enzymes as defined in any
one of claims 7 to 10; (b) the CODM, T60DM and/or COR enzymes as defined in any one of claims 47 to
50; or (c) one or more of the plasmids as defined in any one of claims 53 to 55.
57. The host cell of claim 56, further expressing cytochrome b5 (Cytf)5).
58. The host cell of claim 57, wherein the Cyto5 is as set forth in any one of the sequences as depicted in
FIG. 10G (SEQ ID NOs:64, 66 and 194).
59. A polypeptide (i) as depicted in SEQ ID NO: 175 (FIG. 10E); or (ii) comprising an amino acid at least
60% identical to the polypeptide of (i) and having the ability to demethylate a morphinan at position 3.
60. A polypeptide NTCAS-SAS (i) as depicted in SEQ ID NO: 45 (FIG. 9); or (ii) comprising an amino acid
at least 60% identical to the polypeptide of (i) and having the ability to convert (R)-reticuline into salutaridine.
6 1. A polypeptide NTCFS-SAS (i) as depicted in SEQ ID NO: 46 (FIG. 9); or (ii) comprising an amino acid
at least 60% identical to the polypeptide of (i) and having the ability to convert (R)-reticuline into salutaridine.
International application No. INTERNATIONAL SEARCH REPORT PCT/CA2016/050334
A. CLASSIFICATION OF SUBJECT MATTER IPC: C12N 9/02 (2006.01) , CI2N 1/19 (2006.01) , C12N 15/53 (2006.01) , C12N 15/54 (2006.01) , C12N 15/81 (2006.01) , C12N 9/04 (2006.01) , C12N 9/10 (2006.01) , C12P 17/10 (2006.01) , C12P 1 7/12 (2006.01)
According to International Patent Classification (IPC) or to both national classification and IPC
B. FIELDS SEARCHED
Minimum documentation searched (classification system followed by classification symbols) IPC: C12N 9/02 (2006.01) , C12N 1/19 (2006.01) , C12N 15/53 (2006.01) , C12N 15/54 (2006.01) , C12N 15/81 (2006.01) , C12N 9/04 (2006.01) , C12N 9/70 (2006.01) , CI2P 17/10 (2006.01) , C12P 1 7/12 (2006.01)
Documentation searched other than minimum documentation to the extent that such documents are included in the fields searched
Electronic database(s) consulted during the international search (name of database(s) and, where practicable, search terms used) Databases: ORBIT/QUESTEL, USPTO/WEST, ESPACENET, STN/CAPLUS, CANADIAN PATENT DATABASE, CIPO LIBRARY DISCOVERY TOOL, PUBMED, GOOGLE PATENT, NCBI/dbSNP; Keywords: Morphinan alkaloid metabolite, MA metabolite, opioids, R-reticuline, salutaridinol-7-O-acetate, thebaine, oripavine, codeine, morphinone, morphine, salutaridine synthase, SAS, cytochrome P450 reductase, CPR, salutaridine reductase, SAR, salutaridinol acetyltransferase, SAT, Papaver somniferum, psSAS, psCPR, psSAR, psSAT, thebaine-6-O-demethylase, T60DM, codeine-O-demethylase, CODM, psCODM, codeine reductase, COR, psCOR, cytochrome b5, cytb5, PGC359, PGC1 1, production, biosynthesis, and yeast Sequence Database: GENOMEQUEST; Sequences: SEQ ID NOs: 9, 14, and 41-322
C. DOCUMENTS CONSIDERED TO BE RELEVANT Category* Citation of document, with indication, where appropriate, of the relevant passages Relevant to claim No.
X, P FOSSATI, E . et al, "Synthesis of Morphinan Alkaloids in Saccharomyces cerevisiae". 1-61 PLoS One, 23 April 2015 (23-04-2015), Vol. 10 (4), pp. 1-15, ISSN 1432-2048
X, P GALANIE, S. et al., "Complete biosynthesis of opioids in yeast". Science, 4 September 1-61 2015 (04-09-2015), Vol. 349 (6252), pp. 1095-1 100, ISSN 1095-9203
Further documents are listed in the continuation of Box C. See patent family annex.
Special categories of cited documents: later document published after the international filing date or priority 'A' document defining the general state of the art which is not considered date and not in conflict with the application but cited to understand to be of particular relevance the principle or theory underlying the invention ' earlier application or patent but published on or after the international 'X' document of particular relevance; the claimed invention cannot be filing date considered novel or cannot be considered to involve an inventive 'L' document which may throw doubts on priority claim(s) or which is step when the document is taken alone cited to establish the publication date of another citation or other document of particular relevance; the claimed invention cannot be special reason (as specified) considered to involve an inventive step when the document is Ό ' document referring to an oral disclosure, use, exhibition or other means combined with one or more other such documents, such combination being obvious to a person skilled in the art 'F document published prior to the international filing date but later than document member of the same patent family the priority date claimed Date of the actual completion of the international search Date of mailing of the international search report 04 July 2016 (04-07-2016) 04 July 2016 (04-07-2016) Name and mailing address of the ISA/CA Authorized officer Canadian Intellectual Property Office Place du Portage I, CI 14 - 1st Floor, Box PCT Qianfa Chen (819) 639-7783 50 Victoria Street Gatineau, Quebec K1A 0C9 Facsimile No.: 819-953-2476 Form PCT/ISA/210 (second sheet ) (January 2015) Page 4 of 7 International application No. INTERNATIONAL SEARCH REPORT PCT/CA2016/050334
Box No. II Observations where certain claims were found unsearchable (Continuation of item 2 of the first sheet)
This international search report has not been established in respect of certain claims under Article 17(2)(a) for the following reasons:
1. Claim Nos.: because they relate to subject matter not required to be searched by this Authority, namely:
2. Γ Claim Nos.: because they relate to parts of the international application that do not comply with the prescribed requirements to such an extent that no meaningful international search can be carried out, specifically:
3 Claim Nos.: because they are dependent claims and are not drafted in accordance with the second and third sentences of Rule 6.4(a).
Box No. I Observations where unity of invention is lacking (Continuation of item 3 of first sheet)
This International Searching Authority found multiple inventions in this international application, as follows: The claims are directed to a plurality of inventive concepts as follows:
Group A - Claims 1-10, 5 1-58 (partly, P), 60 and 6 1 are directed to a method for preparing salutaridinol-7-O-acetate or thebaine by culturing host cell comprising heterologous sequences encoding SAS, CPR, SAR and SAT; and
Group B - Claims 11-50, 51-58 (P), and 59 are directed to a method for preparing morphine by culturing host cell comprising heterologous sequences encoding T60DM, CODM and COR.
[continuation in extra sheet]
1. Γ As all required additional search fees were timely paid by the applicant, this international search report covers all searchable claims.
2. As all searchable claims could be searched without effort justifying additional fees, this Authority did not invite payment of additional fees.
3. ~ As only some of the required additional search fees were timely paid by the applicant, this international search report covers only those claims for which fees were paid, specifically claim Nos.:
4. No required additional search fees were timely paid by the applicant. Consequently, this international search report is restricted to the invention first mentioned in the claims; it is covered by claim Nos.:
The additional search fees were accompanied by the applicant's protest and, where applicable, the payment of a protest fee. The additional search fees were accompanied by the applicant's protest but the applicable protest fee was not paid within the time limit specified in the invitation.
No protest accompanied the payment of additional search fees.
Form PCT/ISA/210 (continuation of first sheet (2)) (January 2015) Page 3 of 7 International application No. INTERNATIONAL SEARCH REPORT PCT/CA2016/050334 C (Continuation). DOCUMENTS CONSIDERED TO BE RELEVANT
Category* Citation of document, with indication, where appropriate, of the relevant passages Relevant to claim No.
X WO 2014/143744 A2 (SMOLKE, C. et al.) 18 September 2014 ( 18-09-2014) 1-7, 11-14, 18, 19, 21, 23-26, 28, 30, 31, 33, 35-38, 40, 42, 44, 46, 47, 51, 53, 54, 56, and 57
X WO 2008/067070 A2 (SMOLKE, C. and HAWKINS, K) 5 June 2008 1-6 (05-06-2008) Y 7, 11-14, 18, 19, 21, 23-26, 28, 30, 31, 33, 35-38, 40, 42, 44, 46, 47, 51, 53, 54, 56, and 57
Y BEAUDOIN, G.A.W. and FACCHINI, P.J., "Benzylisoquinoline alkaloid 7, 11-14, 18, 19, 21, 23-26, 28, biosynthesis in opium poppy". Planta, July 2014 (07-2014), Vol. 240 (1), pp. 30, 31, 33, 35-38, 40, 42, 44, 19-32, ISSN 1432-2048 46, 47, 51, 53, 54, 56, and 57
Y WIJEKOON, CP. and FACCHINI, P.J., "Systematic knockdown of morphine 7, 11-14, 18, 19, 21, 23-26, 28, pathway enzymes in opium poppy using virus-induced gene silencing". Plant J.. 30, 31, 33, 35-38, 40, 42, 44, March 2012 (03-2012), Vol. 69 (6), pp. 1052-1063, ISSN 1365-3 13X 46, 47, 51, 53, 54, 56, and 57
Y THODEY, K. et al, "A microbial biomanufacturing platform for natural and 11-14, 18, 19, 21, 23-26, 28, semisynthetic opioids". Nat Chem Biol., October 2014 (10-2014), Vol. 10 (10), 30, 31, 33, 35-38, 40, 42, 44, pp. 837-844, ISSN 1552-4469 46, 47, 51, 53, 54, 56, and 57
A WO 201 1/058446 A2 (FACCHINI, P.J. et al.) 19 May 201 1 (19-05-201 1) 1-61
A SIDDIQUI, M.S. et al, "Advancing secondary metabolite biosynthesis in yeast 1-61 with synthetic biology tools". FEMS Yeast Res., March 2012 (03-2012), Vol. 12 (2), pp. 144-170, ISSN 1567-1364
Form PCT/ISA/210 (continuation of second sheet) (January 2015) Page 5 of 7 INTERNATIONAL SEARCH REPORT International application No. Information on patent family members PCT/CA2016/050334
Patent Document Publication Patent Family Publication Cited in Search Report Date Member(s) Date
WO2014143744 A2 18 September 2014 (18-09-2014) WO2014143744A2 18 September 2014 (18-09-2014) WO2014143744A3 05 November 2015 (05-1 1-2015) AU2014228241A1 17 September 2015 (17-09-2015) CA2905 112A1 18 September 2014 (18-09-2014) CN105247038A 13 January 2016 (13-01-2016) EP2970999A2 20 January 2016 (20-01-2016) GB201518138D0 25 November 2015 (25-1 1-2015) GB2527254A 16 December 2015 (16-12-2015) IL240850D0 29 October 2015 (29-10-2015) JP2016512046A 25 April 2016 (25-04-2016) US2014273109A1 18 September 2014 (18-09-2014)
WO2008067070 A2 05 June 2008 (05-06-2008) WO2008067070A2 05 June 2008 (05-06-2008) WO2008067070A3 02 October 2008 (02-10-2008) US2008176754A1 24 July 2008 (24-07-2008) US8975063B2 10 March 2015 (10-03-2015) US2015267233A1 24 September 2015 (24-09-2015) US9322039B2 26 April 2016 (26-04-2016)
WO201 1058446 A2 19 May 201 1 (19-05-201 1) WO201 1058446A2 19 May 201 1 (19-05-201 1) WO201 1058446A3 14 July 201 1 (14-07-201 1)
Form PCT/ISA/210 (patent family annex ) (January 2015) Page 6 of 7 International application No. INTERNATIONAL SEARCH REPORT PCT/CA2016/050334
Continued from Box No. Ill
There are no common inventive "special technical features" linking each group of the claimed invention. The common concept linking together the groups appears to be a host cell that produces a morphinan alkaloid metabolite compound or a precursor thereof, wherein the host cell comprises multiple copies of one or more heterologous coding sequences for one or more enzymes derived from a different source organism as compared to the host cell. However, this concept is not novel in view of D3 and D4. Therefore, the requirements of the unity of invention are not fulfilled. The expression "special technical features" means those features which define a contribution which each of the claimed inventions considered as a whole makes over the prior art.
Form PCT/ISA/210 (extra sheet) (January 2015) Page 7 of 7