Ancestral Class-Promiscuity As a Driver of Functional Diversity in the BAHD

Home , Acetyltransferase, Salutaridinol

bioRxiv preprint doi: https://doi.org/10.1101/2020.11.18.385815; this version posted November 20, 2020. The copyright holder for this preprint (which was not certified by peer review) is the author/funder. All rights reserved. No reuse allowed without permission.

1 Ancestral class-promiscuity as a driver of functional diversity in the 2 BAHD acyltransferase family in plants 3 Lars H. Kruse1, Austin T. Weigle3, Jesús Martínez-Gómez1,2, Jason D. Chobirko1,5, Jason 4 E. Schaffer6, Alexandra A. Bennett1,7, Chelsea D. Specht1,2, Joseph M. Jez6, Diwakar 5 Shukla4, Gaurav D. Moghe1* 6 Footnotes: 7 1 Plant Biology Section, School of Integrative Plant Sciences, Cornell University, Ithaca, 8 NY, 14853, USA 9 2 L.H. Bailey Hortorium, Cornell University, Ithaca, NY, 14853, USA 10 3 Department of Chemistry, University of Illinois at Urbana-Champaign, Urbana, IL, 61801, 11 USA 12 4 Department of Chemical and Biomolecular Engineering, University of Illinois at Urbana- 13 Champaign, Urbana, IL, 61801, USA 14 5 Present address: Department of Molecular Biology and Genetics, Cornell University, 15 Ithaca, NY, 14853, USA 16 6 Department of Biology, Washington University in St. Louis, St. Louis, MO, 63130, USA 17 7 Present address: Institute of Analytical Chemistry, Universität für Bodenkultur Wien, 18 Vienna, 1190, Austria 19 20 * Corresponding author: [email protected] 21

1 bioRxiv preprint doi: https://doi.org/10.1101/2020.11.18.385815; this version posted November 20, 2020. The copyright holder for this preprint (which was not certified by peer review) is the author/funder. All rights reserved. No reuse allowed without permission.

22 ABSTRACT

23 Gene duplication-divergence and enzyme promiscuity drive metabolic diversification in 24 plants, but how they contribute to functional innovation in enzyme families is not clearly 25 understood. In this study, we addressed this question using the large BAHD 26 acyltransferase family as a model. This fast-evolving family, which uses diverse 27 substrates, expanded drastically during land plant evolution. In vitro characterization of 28 11 BAHDs against a substrate panel and phylogenetic analyses revealed that the 29 ancestral enzymes prior to origin of land plants were likely capable of promiscuously 30 utilizing most of the substrate classes used by current, largely specialized enzymes. Motif 31 enrichment analysis in anthocyanin/flavonoid-acylating BAHDs helped identify two motifs 32 that potentially contributed to specialization of the ancestral anthocyanin-acylation 33 capability. Molecular dynamic simulations and enzyme kinetics further resolved the 34 potential roles of these motifs in the path towards specialization. Our results illuminate 35 how promiscuity in robust and evolvable enzymes contributes to functional diversity in 36 enzyme families.

37 KEY WORDS

38 Evolutionary biochemistry, enzyme family, comparative genomics, gene duplication, 39 promiscuity, protein structure analysis, BAHD acyltransferase 40

2 bioRxiv preprint doi: https://doi.org/10.1101/2020.11.18.385815; this version posted November 20, 2020. The copyright holder for this preprint (which was not certified by peer review) is the author/funder. All rights reserved. No reuse allowed without permission.

41 INTRODUCTION

42 Enzymes involved in plant specialized metabolism often belong to enzyme 43 families, some of whom (e.g. cytochrome P450s, lipases, acyltransferases, 44 dioxygenases) have several hundred members in angiosperm genomes. Such enzyme 45 families are characterized by frequent gene duplication, functional divergence, and 46 promiscuity, all of which contribute to metabolic diversification. For duplication, various 47 models explaining duplicate gene evolution have been proposed, such as neo- 48 functionalization, sub-functionalization, escape from adaptive conflict, dosage balance, 49 and pseudogenization (reviewed in Panchy et al., 2016). Due to advances in sequencing 50 technologies, much is known today about how duplicates evolve at the genomic, 51 epigenetic and transcriptomic levels (Ganko et al., 2007; Zou et al., 2009; Schnable et 52 al., 2011; Moghe et al., 2014; J. Wang et al., 2014); however, our understanding of how 53 substrate preference evolves in duplicate enzymes, especially in large enzyme families 54 is lacking. Specifically, while it is common knowledge that different members of large 55 enzyme families use substrates containing very different chemical/structural scaffolds, 56 the extent to which this “family multi-functionality” or functional diversity is due to ancestral 57 promiscuity vs. neo-functionalization after duplication is not clear. 58 Promiscuity refers to the ability of an enzyme to catalyze multiple reactions, either 59 by using different substrates (substrate promiscuity), producing multiple products from 60 the same substrate (product promiscuity), or performing secondary reactions that cause 61 different chemical transformations (catalytic promiscuity) (Copley, 2015). Here, we do not 62 consider the physiological relevance of the secondary products but only study an 63 enzyme’s ability to use multiple substrates – a definition of promiscuity typically used by 64 molecular/structural biologists (Copley, 2015; Kreis and Munkert, 2019). We also define 65 a special type of substrate promiscuity called “class-promiscuity”, referring to the ability 66 of an enzyme to use substrates containing very different structural scaffolds e.g. aliphatic 67 alcohol vs. anthocyanin. In contrast, the term “multi-functionality” is used here in the 68 context of the collective enzyme family using multiple substrates e.g. multi-functionality 69 of the BAHD family. Even if the product at first is irrelevant in a physiological context, the 70 promiscuous reaction may still continue to occur and may get selected upon if the product 71 directly or indirectly increases organismal fitness. Existence of such promiscuity-driven

3 bioRxiv preprint doi: https://doi.org/10.1101/2020.11.18.385815; this version posted November 20, 2020. The copyright holder for this preprint (which was not certified by peer review) is the author/funder. All rights reserved. No reuse allowed without permission.

72 “underground metabolism” can occur via drift and contributes to the standing natural 73 variation of metabolites (Notebaart et al., 2014). 74 In this study, we address the question of how gene duplication and promiscuity 75 contribute to plant specialized metabolic diversity using the large BAHD acyltransferase 76 family (referred to as BAHDs hereafter) as a model. The ease of heterologous protein 77 expression in Escherichia coli, intronless nature of many BAHD genes, their ability to use 78 structurally diverse substrates, and availability of functional data from multiple species 79 make this an attractive family to address the above question. Named after the four first 80 discovered enzymes of this family – benzyl alcohol O-acetyltransferase (BEAT) 81 (Dudareva et al., 1998), anthocyanin O-hydroxycinnamoyltransferase (AHCT) (Fujiwara 82 et al., 1997; H. Fujiwara et al., 1998; Hiroyuki Fujiwara et al., 1998), N- 83 hydroxycinnamoyl/benzoyltransferase (HCBT) (Yang et al., 1997), and deacetylvindoline 84 4-O-acetyltransferase (DAT) – members of this large family (referred to as BAHDs 85 hereafter) catalyze the transfer of an acyl group from a coenzyme A (CoA) conjugated

86 donor to a –OH or –NH2 group on an acceptor (D’Auria, 2006). BAHDs play important 87 roles in the biosynthesis of several phenylpropanoids, amides, volatile esters, terpenoids, 88 alkaloids, anthocyanins, flavonoids, and acylsugars (D’Auria, 2006; Tuominen et al., 89 2011). Although >150 members of this family have been experimentally characterized 90 across the plant kingdom, transfer of known functions using sequence similarity to these 91 characterized enzymes is difficult owing to their rapid sequence divergence, substrate 92 promiscuity and functional divergence. For example, the 4-5 acylsugar acyltransferases 93 involved in acylsugar biosynthesis in Solanaceae trichomes are BAHDs (Moghe et al., 94 2017) but are only 40-50% identical, and yet all of them use sucrose/acylated sucrose as 95 substrates. In contrast, a single amino acid change is sufficient to convert a BAHD from 96 preferentially using phenylpropanoid substrates to using phenolic amine substrates 97 (Levsh et al., 2016). Compared to the scale of BAHD acceptor diversity, there is an 98 incomplete understanding of BAHD sequence-function and structure-function 99 relationships, which is representative of a similar lack of knowledge in other large enzyme 100 families generated via gene duplication. 101 Previous studies on BAHDs have revealed existence of substrate promiscuity 102 (Aharoni et al., 2000; Aymerick Eudes et al., 2016; Levsh et al., 2016; Moghe et al., 2017;

4 bioRxiv preprint doi: https://doi.org/10.1101/2020.11.18.385815; this version posted November 20, 2020. The copyright holder for this preprint (which was not certified by peer review) is the author/funder. All rights reserved. No reuse allowed without permission.

103 Chiang et al., 2018a), but compared to the known number of BAHD substrates, the extent 104 of our knowledge about BAHD class-promiscuity is still limited. Furthermore, it is unclear 105 whether BAHD multi-functionality is a result of multiple rounds of neo-functionalization – 106 where new activities emerged completely afresh in the BAHD family (also referred to 107 below as “innovation”) – vs. specialization of activities that were already possible in the 108 common ancestor. 109 The BAHD family is speculated to have arisen from carnitine acyltransferases 110 involved in fatty acid metabolism (St Pierre and De Luca, 2000; D’Auria, 2006), however, 111 their evolution across plants has not been studied. We were interested in characterizing 112 evolution of the capability/potential of BAHDs to use different substrate classes rather 113 than their actual in vivo substrates, since the inherent capability of an enzyme can be a 114 starting point for selection to act and fix diversified enzyme activities in different in vivo 115 contexts. Although it may be argued that BAHDs might use any substrates with hydroxyl 116 or amine groups, previous results provide clear evidence of specialization (D’Auria, 2006), 117 and it is unclear how these specializations emerged. We first characterized the known 118 substrate space of extant characterized BAHDs and used it as a template in the context 119 of BAHD phylogeny to delineate the putative ancestral substrate space. Prediction of the 120 ancestral state helped us differentiate between neo-functionalization vs. ancestral 121 promiscuity, and the sequence and structural features that enabled specialization of 122 ancestrally accessible functions. Overall, this study provides a template to assess 123 functional evolution after duplication in large enzyme families, and generates resources 124 foundational for rational prediction of BAHD function in plant genomes. 125

126 RESULTS

127 The BAHD enzyme family occupies a wide substrate space

128 BAHDs have been experimentally characterized across land plants (Sander and 129 Petersen, 2011; Aymerick Eudes et al., 2016; Levsh et al., 2016; Moghe et al., 2017; 130 Chiang et al., 2018a). To get a complete picture of the range of known BAHD substrates, 131 we first compiled a database of 136 biochemically characterized BAHDs that used a total 132 of 187 acceptor substrates and ~30 acyl donor substrates from 64 species across the

5 bioRxiv preprint doi: https://doi.org/10.1101/2020.11.18.385815; this version posted November 20, 2020. The copyright holder for this preprint (which was not certified by peer review) is the author/funder. All rights reserved. No reuse allowed without permission.

133 green plants (File S2). BAHDs characterized solely using other types of experimental 134 evidence such as gene knock-out and knock-down, or gene expression analysis were 135 excluded from this study, because of the remaining uncertainty about the actual substrate 136 the enzyme is acting on. These substrates were empirically classified into thirteen Figure 1

A O

OH O

OH HO Genistin OH O O OH OH Nudaurine O OH Scopolin O O O H Deacetylvindoline N HO OH Tryptamine OH O Spermine OH O OH HO OH Myricetin-Rhammnose-Glucose Cyanidin 3-O-rutinoside Eriodictyol 7-O-glucoside O Pelargonidin 3-O-glucoside Salutaridinol H NH N Formononetin 7-O-glucosidGenistine Cyanidin 3-O Malvidin 3-O-glucoside H2N Daidzin Horhammericine Shikimate

+ O O OH Quercetin 3-O- sophoroside Cyanidin 3-O-glucoside glucoside Cyanidin 3-O-glucoside Naringin Isochorismoyl-glutamate B 2-Naphtol glucosideGlycitein 7-O-glucoside Spermidine Peonidin 3-O-glucoside Genistein 7-O-glucoside Spermidine OH Agmatine HO 4-Methylumbelliferone Cyanidin-3-(6'-malonylglucoside) glucoside Naringenin 7-O-glucoside Umbelliferone glucosidQuercee tin 7-O-glucoside Glycitin OH Quercetin 3-O-glucoside Cyanidin 3,5-O-diglucoside Isochorismoyl-glutamate A H p-Nitrophenyl-ß-d-glucopyranoside N NH Delphinidin 3-O-glucoside Scopolin 2 Apigenin 7-O-glucoside 2N Anthocyanidin Kaempferol 7-O-glucoside OH Cyanidi3-rhamnosylglucoside-5-glucosidn e OH NH 3-O-acetyl-5-O-glucosidDelphinidin 3,5-O-diglucoside Peelargonidin-3-O-beta-D-glucoside Shisonin Kaempferol 3-O-glucoside 6,4-dihydroxy-7-O-glucosyl-isoflavon7-Hydroxyflavone glucoside e 2-Ethoxyethanol Baccatin III Cyanidin Delfinidin-3-O-glucoside Delphinidin-3-O-rhamnosyl-glucoside-5-O-glucoside Quercetin 3-O-glucoside 3-O-malonyl-5-O-glucoside Luteolin 4'-O-glucoside 1-Naphtol glucoside Benzyl alcohol Agmatine Petunidin-3-O-rhamnosyl-glucoside-5-O-glucosidPelargonidin-3,5-diglycoside e Monodemalonylsalvianin Naringenin

A10, A11 3-Hydroxyflavone glucoside Sinapyl alcohol Bisdemalonylsalvianin 2-Propanol Methanol Gardenal Pelargonidin Salicyl alcohol O 3-O-acetyl-5-O-glucosideMalvidin 3-O-rhamnosyl-glucoside-5-O-glucoside O Gentisate 2-Butanol Putrescine trans-3-Hexen-1-ol A6, A8 Malvin O HO Glycerol Ethanol 5-Hydroxyanthranilate O D-glucaric acid O O Benzyl alcohol Tryptamine OH OH Eugenol HydroquinonFurfurylalcohoe l Dopamine2-Phenylethanol Isobutanol HO Phenethylamine Isochavicol 1-Propanol Class Type Cinnamyl alcohol Isoeugenol 2-methyl-1-butanol OH Maltose 2-Hydroxy-2-phenylpropanoic Protocatechuateacid 3-Hydroxybenzoate Quinate 32-Naphthaleneethano-HydroxybenCinnamylzyl alcohol alcohol l Shikimate Malic acid Trehalose Anthranilate HO Phenyllactate OH Lactose Z-2-hexen-1-ol Quinate O O Coniferyl alcohol p-Coumaryl alcohol (Z)-3-hexenn-1-ol 1-Pentanol OH Aromatic alcohols Sucrose Chavicol 3,4-Dihydroxyphenyllactic5-Hydroxyanthranilat acid e Galactaric acid O S2:12(6,6) 3-hydroxyanthranilate S4:19(2,5,6,6) 2,3-Dihydroxybenzoate A 1-Hexanol 3-hydroxyacetophenone Cellobiose S2:10(5R2,5R4) Dihydrosinapyl alcohol Catechol 1-Butanol Aromatic amines S1:6(6R2) 3-Hydroxyanthranilate Tyramine 3-Methyl-1-butanol HO S1:5(5) OH 3-aminobenzoate trans-2-Hexen-1-ol 1-Heptanol S2:11(5,6) 4-Hydroxyphenyllactic acid Carveol N-debenzoyl-(3'-RS)-2'-deoxytaxol Serotonin Perilla alcohol S1:5(5R2) S2:10(5,5) 1-Heptanol Aliphatic alcohols S3:15(5,5,5) HO Geraniol Piscidic acid B O Nerol S3:16(5R2,5R4,6R3) 1-Octanol 10-Deacetyl-2-debenzoylbaccatin Citronellol 1-Decanol III Linalool Methylecgonine Aliphatic amines OH S3:17(5R2.5R4.7R3) S2:17(5,12) HO 1-Dodecanol 1-Tetradecanol O O 1-Nonanol Baccatin III OH S3:18(5R2,5R4,8R3) S4:20(2,6,6,6) Farnesol S3:22(5,5,12) Monoterpenoids 16-hydroxypalmitic acid 10-Deacetylbaccatin III C HO OH 16-Epivellosimine 15-Hydroxy-pentadecanoic acid OH 13-hydroxylupanine Taxadien-5a-ol Sesquiterpenoids 1-Hexadecanol Sucrose C16:0 16-OH FA O I3:22(2,10,10) Methyl-15-hydroxypentade13canoa-Hydteroxymultiflorine Flavonoids I3:24(2,10,12) - 17-hydroxy-heptadecanoic acid 20-Hydroxy-eicosanoic acid HO Tirucalla-7,24-dien-3beta-ol(Tr1) T3 HO (Pupchem ID 12302184) H2N D Anthocyanins HO O Thalaniol(T1) HO O O O O T5 Thalianol Phenolic glycosides Aminobenzoate A2 O N OH O T6 O OH T4 E Diterpenoids O O O Arabidiol(A1) O Methylecgonine O T2 F Triterpenoids HO T7 Farnesol G Sugar derivatives S4:19(2,5,6,6) Mix Alkaloids

B Phospholipids Purines Alkaloids Glycophospholipids

Acyl-CoAs Amino acids Small non-live compounds Sugars Other acids Phenazines Organophosphates Amino acids (e.g. UDP sugars) Fatty acids Other acids Glucosinolates Steroid glycosides Imidazolidinones Sesquiterpenoids Amino acids Fatty acids Lactones Alkaloids Carotenoids Retinol derivatives Phosphocholines Glycerophospholipids Terpenoids Benzoates Hydroxynaphthalenes Glycosphingolipids Phosphosphingolipids Sesquiterpenoids Alkaloids Sterol lipids Alkaloids Peptides Fatty acids Fatty acids Fatty alcohols Cholesterols

Polyketides Phospholipids Glycosphingolipids Chlorophyll derivatives

Figure 1. BAHD substrate space. (A) Substrate similarity network of BAHD acceptor substrates (File S2B), shown as the “Prefuse Force Directed” layout in Cytoscape. An MCS-Tanimoto similarity cutoff of 0.5 used to draw edges between two substrate nodes. Substrates are colored based on the substrate type they belong to. (B) BAHD substrates in the context of a larger network of plant compounds. Plant compounds with KNApSAcK ID were gathered from the ChEBI database. The network was visualized as in part A and BAHD substrates are highlighted by colors corresponding to their substrate class. For each labeled cluster/region in the network, five compounds were chosen randomly and the compound class for each compound was determined based on the ChEBI Ontology (see File S2). Representative classes are shown for each analyzed region. Names in bold are the classes closest to the known BAHD substrates.

6 bioRxiv preprint doi: https://doi.org/10.1101/2020.11.18.385815; this version posted November 20, 2020. The copyright holder for this preprint (which was not certified by peer review) is the author/funder. All rights reserved. No reuse allowed without permission.

137 different types based on similarity of their chemical scaffolds and functional groups (Table 138 S1; Fig. S1A) (Wang et al., 2013), and organized into a network for visualization of the 139 already characterized BAHD substrate space (Fig. 1A; Fig. S1B). 140 Distinct clusters obtained in this visualization suggested that BAHDs have evolved 141 to accept at least eight different structural scaffolds (classes A-G-Mix; Fig. 1A). A 142 majority (109, 80%) of the characterized enzymes use substrates in four classes – class 143 A comprising of aromatic alcohol and amines (69 enzymes, 51%), class B containing 144 aliphatic alcohols and amines (38 enzymes, 28%), class C that includes monoterpenoids 145 and a sesquiterpenoid (7 enzymes, 5%), and class D comprising flavonoids, 146 anthocyanins, and phenolic glycosides (38 enzymes, 28%) (Fig. 1A; File S2B) – roughly 147 indicative of the degree of research attention on lignins, cuticular lipids, floral volatiles and 148 pigments, respectively. BAHDs can also transform a wider array of terpenoids including 149 monoterpenoid (e.g. geraniol), diterpenoid (e.g. taxol intermediates), and triterpenoid 150 alcohols (e.g. thalianol) in classes E and F. Some polyamines (spermine, spermidine) 151 were more distant from aliphatic alcohols primarily due to different functional groups (-OH

152 vs. -NH2), but still were classified into the same class B due to overall scaffold relatedness 153 (Fig. S1A; Table S1). Other substrates such as alkaloids (class Mix) and sugar 154 derivatives (class G), represented smaller and independent classes in the network. 155 Alkaloids themselves are a loosely defined compound type, and hence class Mix 156 comprises of alkaloids that could actually be assigned to other classes. 157 Although large, the characterized BAHD substrate space still only represents a 158 small proportion of the larger phytochemical space. As described in a later section, only 159 ~50% of all multi-species BAHD orthologous groups (OGs) have characterized activities, 160 which suggests that many substrate classes remain undiscovered. We thus used the 161 substrate network to obtain a bird’s eye view of known BAHD substrates in the context of 162 the wider phytochemical space. Using 7128 additional plant-specific compounds, we 163 mapped a broader phytochemical similarity network (Fig. 1B). Since BAHDs can only use 164 substrates containing amine or hydroxyl groups, only ~70% of the compounds from this 165 pool are actually available to them. 166 Previous studies recognize the role of substrate ambiguity and structural motifs in 167 generating secondary reactions (Bar-Even et al., 2011), which, under appropriate

7 bioRxiv preprint doi: https://doi.org/10.1101/2020.11.18.385815; this version posted November 20, 2020. The copyright holder for this preprint (which was not certified by peer review) is the author/funder. All rights reserved. No reuse allowed without permission.

168 conditions, can be selected upon. An investigation of the global “underground 169 metabolism” found that promiscuously used substrates of E. coli enzymes tend to be 170 structurally similar (Notebaart et al., 2014). Based on these observations, we divided 171 compounds in the above phytochemical network (Fig. 1B) into three groups: (1) known 172 BAHD substrate classes; these classes are spread out over a large region of the 173 phytochemical space (colored nodes, Fig. 1B), which potentially allows for transitions to 174 new substrate classes through mutational changes, (2) compound classes that are 175 theoretically accessible – due to similarity to known substrates – but not yet known as 176 BAHD substrates, such as small organic acids in central metabolism, some amino acids, 177 nitrogen bases/nucleosides, many alkaloids, sesquiterpenoids, peptides, polyphenols, 178 and oligosaccharides (Fig. 1B; File S3), and (3) compound classes whose utilization 179 cannot be inferred due to absence of prior data or are unlikely to be BAHD substrates. As 180 far as we could determine, no biochemical or genetic studies have identified BAHDs using 181 sulfur/phosphorus containing compounds (e.g. glucosinolates, nucleotides) and long- 182 chain lipid types (e.g. sulfolipids, sphingolipids, carotenoids/tetraterpenoids) as acyl 183 acceptor substrates – despite some members having hydroxyl groups – and hence, these 184 substrate classes were categorized into group 3. From groups 2 and 3, some substrate 185 types may be inaccessible to BAHDs due to their lipophilic nature or their absence in 186 cytoplasmic environments where most BAHDs are known to exist. Nonetheless, such 187 visualization of the larger network shows that several metabolite classes are structurally 188 very similar to existing BAHD substrates, and represent the latent catalytic potential of 189 BAHDs that could be selected upon after duplication-divergence or could be used for in 190 vitro enzyme engineering. These activities may still lie undetected in uncharacterized 191 enzymes or as secondary activities of characterized enzymes. 192 To address our questions about class-promiscuity, we further assessed enzymes 193 accepting class A, B and D substrates, which are structurally very distinct (Fig. 1A). Three 194 enzymes utilizing class A substrates (AtHCT, SmHCT, PsHCT2) were previously shown 195 in one study to use naringenin, a flavonoid (Chiang et al., 2018a). No class D substrate 196 utilizing enzyme was shown to use class A/B substrates (File S2A). While this difference 197 could represent true functional differentiation, it may likely be a result of experimenter- 198 bias (i.e. researchers studying pigmentation may not assess lignin or volatile esters (class

8 bioRxiv preprint doi: https://doi.org/10.1101/2020.11.18.385815; this version posted November 20, 2020. The copyright holder for this preprint (which was not certified by peer review) is the author/funder. All rights reserved. No reuse allowed without permission.

199 A/B substrates), and vice versa). To minimize the effect of such a bias on our later 200 evolutionary inferences, we performed extensive characterization of 11 BAHDs that use 201 class A, B and D substrates and obtained better insights into promiscuity of BAHD 202 enzymes. 203 204 Determining the class-promiscuity of characterized BAHDs

205 We tested a total of 11 novel and previously characterized BAHD enzymes against 206 an acceptor substrate array (Fig. S2), using optimal conditions described for those 207 enzymes. For donors, we selected the most preferred donor of each tested enzyme, 208 which, for most enzymes was coumaroyl-CoA or malonyl-CoA. Cocaine synthase from 209 Erythroxylum coca (EcCS) was described to use benzoyl-CoA and cinnamoyl-CoA to 210 produce cocaine from methylecgonine (Schmidt et al., 2015; A. Eudes et al., 2016), but 211 in our enzyme assays, we discovered that it is also able to use coumaroyl-CoA (Fig. S2). 212 For the hydroxyacid/alcohol hydroxycinnamoyl transferase of the liverwort Marchantia 213 emarginata (MeHFT), we used its preferred donor feruloyl-CoA. Based on the substrate 214 networks (Fig. 1A; Fig. S1), we selected 11 substrates from six substrate types in classes 215 A, B and D as acceptors for initial analysis, and based on these results, further assayed 216 some enzymes with additional anthocyanin and terpenoid substrates (Fig. S2B,C) to 217 confirm additional hypotheses. 218 Of the eleven enzymes, two used only one tested substrate, six showed substrate 219 promiscuity within the same class (which we also refer to as “specialized” below), while 220 three showed class-promiscuity (Fig. 2A; Fig. S2) According to our assays and gathered 221 literature information (Fig. 4), 75% (103 enzymes) of BAHDs analyzed in this study can 222 use more than one acceptor substrate, 27% (37 enzymes) use >5 substrates, and 9% 223 (12 enzymes) can use >10 substrates, highlighting the considerable substrate promiscuity 224 in the family. One of the two enzymes using only one substrate was a previously 225 uncharacterized enzyme from the outgroup species selected for this study Chara braunii 226 – representing charophytic algae, the most closely related sister lineage to land plants 227 (Cheng et al., 2019; Donoghue and Paps, 2020; Vries and Rensing, 2020). Under the 228 testing conditions, this enzyme exclusively accepted quinate (an aromatic alcohol) (Fig. 229 2A,C; Fig. S2A), leading us to rename this enzyme as CbHQT-like. This observation,

9 bioRxiv preprint doi: https://doi.org/10.1101/2020.11.18.385815; this version posted November 20, 2020. The copyright holder for this preprint (which was not certified by peer review) is the author/funder. All rights reserved. No reuse allowed without permission.

230 coupled with the evolutionary analysis performed below, suggests that activities essential 231 for monolignol biosynthesis in land plants (Weng and Chapple, 2010; Renault et al., 2019)

Figure 2 A D Type Dm3MAT3 Aromatic Aromatic Aliphatic Aliphatic + Malonyl; m/z: 269.0443 2.5e5 HO Genistin amines amines Monoterpenoids Class alcoholsA B alcohols C FlavonoidsD AnthocyaninsTriterpenoidsF % 2.0e5 100 269.0443 O OH 80 OH 516.1239 134.0477

60 517.1239

O 78.9587 O CbHQT-like HO 40 1.0e5 O O

OH 20 morifolium O MeHFT 0 O OH 50 100 200 300 400 500 0.0e0 m/z Dendranthema × SlACT n.t. n.t. 7.0e5 OH SlHCT + % HO O OH 100 287.0546 Cyanin + Malonyl; m/z: 287.0546

O 80

SlHQT 5.0e5 535.1102 OH

O O 449.1098 697.1559 HO O 60

HO 40 HO OH O EcHQT n.t. n.t. OH OH 20 2.5e5 O 0 O OH 50 200 400 600 730 EcCS n.t. n.t. m/z 0.0e0 At5MAT n.t. n.t. 6.0e6 O OH

n.t. n.t. % GmIF7MAT + HO O Malvidin 3-O glycoside 100 O 331.0835 + Malonyl; m/z: 331.0835 80 Dm3MAT3 4.0e6 O 179.0338 579.1345 OH OH 60 535.1441 O 40 O Pc3MAT3 n.t. n.t. 2.0e6 20 OH OH O 0

relative intensity relative 50 125 250 375 500 610 O OH 0.0e0 m/z 2.5e6 MeHFT 1-Decanol + Feruloyl; m/z: 333.2079

% 318.1824 333.2079 0.00 1.00 2.00 3.00 4.00

B 133.0286 OH 100

177.0194 time (min) 1.8e6 80 O 60 3.0e6 HO Cyanidin 3-O glycoside O OH 287.0544 40 % + Malonyl; m/z: 287.0544 1.0e6 O 100 20 O+ 80 m/z 2.0e6 535.1060 6.0e5 0 50 100 150 200 250 300 360 HO 60 O OH 40 Marchantia emarginata O OH 20 0.0e0 O OH 1.0e6 HO 0 OH O O 50 100 200 300 400 500 Geraniol + Feruloyl; m/z: 329.1754 m/z 133.0300 1.2e6 % 329.1754 120

100 0.0e0 OH

80 177.0191

8.0e5 119.0505 O 60 0.00 2.00 4.00 6.00 8.00 O 40

4.0e5 O 20 time (min)

0 50 100 150 200 250 300 355 m/z 0.0e0 E

relative intensity relative 2.0e7 1.6e5 Cucurbitacin E + Feruloyl; m/z: 175.0393 SlHCT Shikimate + Coumaroyl; m/z: 163.0398 % % 175.0393 119.0505

OH 163.0398 120 100 O HO 137.0240 1.3e5 OH 100 1.5e7 80 O 319.0803

80 60 93.0342 O 173.0447

O 731.3502 121.0660 O 60 193.0510 40 O 1.0e7 O 59.0128 HO 7.5e4 OH O 40 20 O

O OH 0 Solanum 20 5.0e6 OH 50 100 200 300 345 2.5e4 0 m/z lycopersicum O 51 100 200 300 400 500 600 700 765 0.0e0 m/z 0.0e0

1.2e7 % 191.0555 Quinate + Coumaroyl; m/z: 191.0555 0.70 1.00 2.00 3.00 4.00 5.00 6.00 7.00 8.00 100 1.0e7 OH 80 OH 163.0391 93.0343

60 337.0011 time (min) O O 40 Tyramine + Feruloyl; m/z: 177.0544 HO O 20

177.0544 5.0e6 OH % 2.5e6 O 100.0 0 OH

121.0639 50 100 200 300 364

145.0285 m/z 2.0e6 O 75.0 314.1376 0.0e0 50.0

2 NH O 1.0e6 25.0 1.6e6 O 0.0 % Tyramine + Coumaroyl; m/z: 147.0443 50 100 150 200 250 300 340 HO m/z O 100 147.0443

80 284.1294 0.0e0 121.0642 1.0e6 60

2 NH 93.0701 40 Dopamine + Feruloyl; m/z: 177.0544 20

5.0e5 HO 177.0545 0 OH % 1.6e6 50 100 200 310 100.0 m/z

75.0 145.0286 0.0e0 137.0596 1.2e6 O 330.1344 H N O 2 50.0 8.0e5 O + Coumaroyl; m/z: 147.0443 8.0e5 25.0 % Dopamine 100 147.0443 OH OH 0.0 50 100 150 200 250 300 355 80 m/z 300.1168 271.2270 179.6055 4.0e5 5.0e5 60 119.0478

40 O H2N 0.0e0 20 2.5e5 O 0 Genistin + Feruloyl; m/z: 269.0445 OH 50 100 200 300 m/z

% 269.0445 O 1.8e5 OH 100 0.0e0

80 134.0465 175.0405 O 391.9874 O 60 337.0922 4.0e6 Malvidin 3-O glucoside O O OH 40 %

OH OH 331.0835 + Coumaroyl; m/z: 331.0835 1.0e5 100 20 relative intensity relative HO O+ 80 HO OH O O 0 HO 179.0334 60 639.1653 50 150 250 350 450 550 640 2.5e6 147.0443 m/z O 5.0e4 40 O O OH OH OH O 1.3e6 20 O 0.0e0 0 OH OH 50 200 400 600 670 O m/z Malvidin 3-O glucoside 0.0e0

O + Feruloyl; m/z: 331.0829 % 6.0e4 OH 100 OH Cyanidin 3-5-O glucoside 287.0546 HO O+ 80

136.0612 + Coumaroyl; m/z: 287.0546 O OH 177.0553 1.6e4 % 60 O+ 100 O 147.0432 4.0e4 449.1082 HO 80 40 O OH OH OH O OH 60

20 40 HO 1.0e4 O OH O O O 2.0e4 O 20 0 HO OH 50 100 200 300 400 520 0 OH O HO OH 50 100 200 300 400 500 O O m/z m/z 5.0e3 HO relative intensity relative 0.0e0 OH Pelargonidin 3-O rutinoside OH + Feruloyl; m/z: 271.0604 0.0e0

% 271.0604 HO O+ 100 HO 1.4e6 OH Cyanidin 3-O glucoside 80 + Coumaroyl; m/z: 287.0546 O % + 287.0543 1.0e6 OH OH 60 O 100 755.2270 O 177.0533 433.1101 4.0e4 136.0616 HO O 80 147.0449

O O 40 OH 600.7072 OH O OH 60

O OH 20 OH 40 O HO OH 5.0e5 O O HO 20 OH 0 2.0e4 OH O 0 53 200 400 600 790 50 100 200 300 400 500 630 m/z m/z 0.0e0 Cyanidin 3-O glucoside OH HO + Feruloyl; m/z: 287.0541 287.0541 Cyanidin 3-O rutinoside % OH 100 OH 4.5e5 O+ + Coumaroyl; m/z: 287.0546

8.0e4 287.0546 HO % O+ HO 80 O 100 OH 80 60 O OH O 595.1632 136.0614 449.1097 177.0556 OH 60 741.2120

OH 136.0629 5.0e4 OH 117.3674 OH O O 40 O O 40

HO OH 2.0e5 O 20 OH 20 O HO OH 2.5e4 OH 0 O 0 52 100 200 300 400 500 600 700 775 O 50 100 200 300 400 500 655 m/z m/z 0.0e0 0.0e0 Cyanidin 3-O rutinoside 0.00 1.00 2.00 3.00 4.00 OH + Feruloyl; m/z: 287.0545

% 1.2e4 136.0614 time (min) OH 100 O+ 287.0545 HO

80 177.0533 O 378.9872 OH % Geraniol + Coumaroyl; m/z: 163.0393 60 120

OH O 299.1654 40 OH 121.0290 O 100 O O 2.5e4 20 5.0e3 OH 80 O O OH

OH 163.0396 0 50 150 250 350 450 550 625 60 HO 145.0307 m/z OH 1.3e4 O 40 20 0.0e0 O 0 0.00 1.00 2.00 3.00 4.00 50 100 150 200 250 300 325 m/z time (min) 0.0e0

% 3.0e5 175.0393 Cucurbitacin E C CbHQT-like 120 3.5e5 Quinate + Coumaroyl; m/z: 191.0555 + Coumaroyl; m/z: 175.0393 100 191.0556 O OH %

80 701.3380 OH 100 2.0e5

163.0408 337.0046 OH 93.0342 O 80 119.0504 60 121.0657 163.0396

O 59.0132 2.0e5 O 60 HO O 40 40 O HO O O 20 1.0e5 O 20 OH 0 OH

100 200 300 Chara 1.0e5 braunii OH m/z 0 O 50 100 200 300 400 500 600 735 0.0e0 m/z

relative intensity relative 0.0e0 0.00 1.00 2.00 3.00 4.00 0.70 1.00 2.00 3.00 4.00 5.00 6.00 7.00 8.00 time (min) time (min) Figure 2. Enzyme activities of selected enzyme representatives. (A) Matrix of tested enzymes and substrates. Class A/B/C/F substrates are pink, Class D substrates are blue. Larger red circle corresponds to major enzyme activity and smaller orange circles indicate moderate activity. See Fig. S2 for more detailed calculations. n.t. = not tested. (B-E) extracted ion chromatograms of the quantifier ions of different enzymatic products of (B) MeHFT with its preferred donor feruloyl-CoA (C) CbHQT-like using quinate and coumaroyl-CoA (D) Dm3MAT3 using malonyl-CoA, and (E) SlHCT using coumaroyl-CoA. Each product was measured using product-specific PRM methods (see Table S4) and the most abundant fragment ion was used for quantification. This ion is noted in the upper right corner of each chromatogram. Structures represent the best-inference based on previously reported structures and the observed fragmentation patterns. Species photographs are from following sources: Chara braunii (Picture by Rob Palmer released under the CC BY-NC-SA license), Marchantia emarginata (Picture by Boon-Chuan Ho), Dendranthema × morifolium (Wikimedia Commons released into the public domain), and Solanum lycopersicum (no license attached).

10 bioRxiv preprint doi: https://doi.org/10.1101/2020.11.18.385815; this version posted November 20, 2020. The copyright holder for this preprint (which was not certified by peer review) is the author/funder. All rights reserved. No reuse allowed without permission.

232 existed before the last common ancestor (LCA) of land plants. Given the timescale of 233 hundreds of millions of years representing the split between charophytes and land plants, 234 it is possible CbHQT-like specialized for utilizing quinate after the split from land plants. 235 Alternatively, CbHQT-like might natively use substrates not tested in this study. Further 236 in vivo experiments coupled with untargeted metabolomics could provide further insights 237 into the functional capacity of algal BAHDs. 238 Three out of eleven tested BAHDs were class-promiscuous. The previously 239 uncharacterized Solanum lycopersicum hydroxycinnamoyl CoA transferase (SlHCT) was 240 able to acylate shikimate and quinate (aromatic alcohols, class A), dopamine and 241 tyramine (aromatic amines, class A), geraniol (monoterpenoids, class C), curcubitacin E 242 (triterpenoids, class F) as well as malvidin 3-O glucoside, cyanidin-3,5-O diglucoside, 243 cyanidin 3-O glucoside, and cyanidin 3-O rutinoside (anthocyanins, class D) (Fig. 2A,E; 244 Fig. S2). Aromatic alcohol, amine and flavonoid use has been described for HCT-type 245 enzymes before (Sander and Petersen, 2011; Aymerick Eudes et al., 2016; Levsh et al., 246 2016; Peng et al., 2016; Chiang et al., 2018a), but not anthocyanin acylation. No activity 247 was found with free sucrose or glucose for any of the 11 enzymes, despite evidence of 248 acylation on the glycoside of the anthocyanin. The liverwort enzyme MeHFT showed a 249 similarly diverse substrate utilization pattern (Fig. 2A,E; Fig. S2). We note that 250 Cucurbitacin E is not known as a substrate for any known BAHD, but still, both SlHCT 251 and MeHFT showed significant activity with it. Another enzyme, EcCS which has only 252 been tested with its native substrate methylecgonine (alkaloid, mix class) (Schmidt et al., 253 2015; A. Eudes et al., 2016), showed high specific activities with shikimate and quinate 254 (class A) – two substrates that are structurally not very similar to methylecgonine (MCS- 255 Tanimoto = 0.47, File S2C). Methylecgonine is most similar to aliphatic alcohols (class B) 256 – and thus, EcCS can also be considered a class-promiscuous enzyme. These findings 257 show that some BAHDs have specialized in vivo substrate profiles, but have the capability 258 to explore a large region of the phytochemical space through secondary activities. 259 As opposed to the relatively promiscuous HCT/HQT-type enzymes, the AnAT-type 260 enzymes show a more specialized substrate usage. All four AnATs, exclusively used 261 other flavonoid and anthocyanin substrates under the testing conditions (Fig. 2A,D; Fig. 262 S2A,C). A previously characterized BAHD (Dendranthema morifolium 3-O

11 bioRxiv preprint doi: https://doi.org/10.1101/2020.11.18.385815; this version posted November 20, 2020. The copyright holder for this preprint (which was not certified by peer review) is the author/funder. All rights reserved. No reuse allowed without permission.

263 malonyltransferase, Dm3MAT3) known to malonylate cyanidin 3-O glucoside acylated 264 other anthocyanins and a flavonoid containing a 3-O glycosylation, and to a lesser extent, 265 3,5-O glycosylation. At5MAT (5-O malonyltransferase from Arabidopsis thaliana) and 266 Pc3MAT (3-O malonyltransferase from Pericallis cruenta) showed the same specificity 267 with 5-O glycosylated and 3-O glycosylated anthocyanins, respectively. These results 268 suggest that enzymes that have specialized for class D substrate acylation may have 269 undergone adaptations constraining them from using class A/B substrates. Since we 270 tested AnATs using malonyl-CoA donor and class A/B-utilizing enzymes with coumaroyl- 271 and feruloyl-CoA, we also tested whether these enzymes can acylate aromatic alcohols 272 and anthocyanins respectively, using non-native donors. We incubated Dm3MAT3 with 273 coumaroyl-CoA and shikimate or quinate. For comparison, SlHQT and SlACT were 274 incubated with malonyl-CoA using five different anthocyanin substrates. In both cases, 275 no product formation was detected (Fig. S2A,B). These results suggest that enzymes 276 transforming substrates in classes A, B and D form two separate groups. While some 277 class A/B enzymes are able to acylate class D substrates, no evidence was obtained for 278 the reverse being true. This finding was robust to changes in donor CoAs, which may be 279 expected considering AnAT-BAHDs are postulated to carry out an ordered bi-bi type of 280 reaction, with the donor binding first (Shaw and Leslie, 1991; Tanner et al., 1999; Suzuki 281 et al., 2003). 282 These observations of promiscuity raise questions about how substrate specificity 283 – especially of broad substrate range enzymes – is maintained in vivo. One mechanism 284 is restricting gene expression – EcCS is specifically expressed in palisade parenchyma 285 of E. coca, which coincides with the highest concentrations of its product cocaine in the 286 plant (Schmidt et al., 2015). Highly specific expression patterns have been shown before 287 for BAHDs and other enzymes (e.g. St-Pierre et al., 1999; Kruse et al., 2017). Another 288 HCT from Plectranthus scutellarioides (PsHCT2, previously Coleus blumei) maintains 289 sufficient substrate specificity in vivo by using a conserved Arg residue near the active 290 site as a handle that regulates substrates entry into the active site (Levsh et al., 2016) 291 through inducing conformational change (Chiang et al., 2018a). Authors also found 292 evidence for alternative substrate binding sites that increased BAHDs substrate 293 permissiveness through diffusion of the non-native substrate towards the active site, while

12 bioRxiv preprint doi: https://doi.org/10.1101/2020.11.18.385815; this version posted November 20, 2020. The copyright holder for this preprint (which was not certified by peer review) is the author/funder. All rights reserved. No reuse allowed without permission.

294 maintaining its specialized native function (Chiang et al., 2018a). Other BAHDs may show 295 similar mechanistic adaptations to maintain in vivo substrate specificity. 296 Through these enzyme assays, we found existence of alternate, previously 297 undocumented scale of BAHD class-promiscuity, which ranged from strong (EcCS using 298 shikimate) to moderate (SlHCT using malvidin-3-O-glucoside) to weak (MeHFT using 299 cyanidin-3-O-glucoside) (Fig. S2). Such latent capacity of BAHDs, like all enzyme 300 families, is critical for emergence of new reactions and new metabolites in cellular 301 environments. We only assayed BAHD promiscuity among the known substrate classes; 302 however, additional promiscuity existing for structurally related classes (Fig. 1B) or under 303 other conditions may influence BAHD incorporation into new pathways. Enzyme assays 304 of C. braunii HQT-like and MeHFT, coupled with the knowledge of lignin and cutin/suberin 305 as ancestral polymers in land plants (Renault et al., 2019; Philippe et al., 2020), also 306 suggested that enzymes utilizing substrates in class A/B were members of an ancestral 307 clade. To address this hypothesis and determine origins of other activities, we next 308 studied BAHD family evolution. 309 310 Functional innovation and expansion in the BAHD acyltransferase family in plants

311 Through an evolutionary analysis, we asked two questions. First, what was the 312 ancestral state of the BAHD family in plants? Second, how did the BAHD family expand 313 and diversify in the plant kingdom? We first identified BAHDs from 49 sequenced plant 314 genomes using the acyltransferase domain model (PF02458). BAHDs were detected in 315 1-5 copies in multiple green algal genomes, however, angiosperm and gymnosperm 316 genomes contain dozens to hundreds of copies, with non-seed plants showing 317 intermediate BAHD counts (Fig. 3A,C). Ancestral state reconstruction of normalized 318 BAHD counts using a Bounded Brownian Motion model (Boucher and Démery, 2016) 319 revealed that the relative BAHD gene content began to increase upon origin of the land 320 plants (Fig. 3A,B). The modal BAHD count per thousand genes rose from <1 in algae to 321 ~1.3 in the ancestor of land plants, increasing to ~3 in the ancestor of seed plants. While 322 the values for vascular plants and euphyllophytes were intermediate, there was also less 323 confidence in the specific modal value at these internal nodes, shown by the broad spread 324 of their distributions. These patterns suggest a gradual increase of relative BAHD count

13 bioRxiv preprint doi: https://doi.org/10.1101/2020.11.18.385815; this version posted November 20, 2020. The copyright holder for this preprint (which was not certified by peer review) is the author/funder. All rights reserved. No reuse allowed without permission.

325 from the origin of land plants to the origin of seed plants, after which the relative counts 326 generally stabilized in the genome with some lineage-specific exceptions (Fig. 3). We 327 thus sought to determine the ancestral state of BAHD activities in the last common

328 ancestorFigure of 3 land plants, prior to their expansion.

Green Plants Charophytes Land Plants Vascular Plants

elihood Seed Plants k Li Euphyllophytes Angiosperms

Normaliz B C

Prunus persica Malus domestica Medicago truncatula Glycine max Ricinus communis Manihot esculenta Populus trichocarpa Brassica oleracea Arabidopsis thaliana Carica papaya Gossypium raimondii Citrus sinensis Eucalyptus grandis Vitis vinifera Anthocyanins Solanum lycopersicum Petunia axillaris Ipomoea nil Monoterpenoids Erythranthe guttata Daucus carota Aquilegia coerulea Zea mays Sorghum bicolor Setaria italica Brachypodium distachyon Aliphatic alcohols Oryza sativa Musa acuminata 6 Aliphatic amines Amborella trichopoda Pinus taeda Picea abies 4 Aromatic amines Azolla filiculoides Salvinia cucullata Aromatic alcohols Selaginella moellendorffii Anthoceros punctatus 2

ed BAHD gene counts Anthoceros agrestis z Pleurozium schreberi Physcomitrella patens mali

r Sphagnum fallax Marchantia polymorpha No Chara braunii Klebsormidium nitens Chlamydomonas reinhardtii Volvox carteri Dunaliella salina Coccomyxa sp Chlorella sp Ostreococcus tauri Ostreococcus lucimarinus Bathycoccus prasinos Micromonas pusilla Cyanidioschyzon merolae Galdieria sulphuraria Porphyridium purpureum

BAHD Million years ago Gene Counts

Figure 3. Number of BAHD acyltransferases in different across the plant phylogeny. (A) Likelihood of the number of BAHDs nodes are indicated in Fig. 3B(B) Fig. 4 and Fig. 8 (C)

14 bioRxiv preprint doi: https://doi.org/10.1101/2020.11.18.385815; this version posted November 20, 2020. The copyright holder for this preprint (which was not certified by peer review) is the author/funder. All rights reserved. No reuse allowed without permission.

329 Ancestral state is typically obtained in two different ways. Performing activity 330 assays after ancestral sequence resurrection is one approach (Huang et al., 2016). 331 However, BAHDs are fast evolving enzymes that maintain activity and structural folds 332 despite undergoing large-scale sequence evolution. Due to such rapid sequence change, 333 there is very little confidence in amino acid state prediction in deep nodes (example: File 334 S6), and thus, ancestral sequence reconstruction or resurrection for deep nodes is not 335 possible. The second approach – predicting ancestral state based on analyses of 336 activities of extant enzymes – is also restricted due to poor confidence in many internal 337 nodes of the BAHD phylogeny and absence of accurate knowledge about extant 338 character states i.e. absence of knowledge about a substrate’s utilization by an enzyme 339 could be truly an inability to use the substrate or simply an untested interaction. Thus, we 340 used a different approach, where we first constructed 765 BAHD OGs across the 49 341 sequenced plant genomes, of which 132 comprised of >2 members and 89 comprised of 342 members from >2 species (multi-species OGs). We then used sequence similarity to 343 assign biochemically characterized enzymes to OGs, thus roughly predicting the OGs 344 biochemical function at the substrate class utilization level. Depending on the breadth of 345 conservation of a specific OG, we inferred the deepest internal node in the species tree 346 likely housing the OG’s associated function. The 136 BAHDs were mapped to only 47 347 OGs, suggesting that ~50% of the multi-species OGs still have unidentified functions. 348 While this method enables assignment of discrete states to specific ancestral nodes, 349 there are no probability estimates associated with the predictions, which is a caveat of 350 this approach. However, most internal node functional inferences were supported by 351 multiple characterized BAHDs with the same function (File S4), thus providing confidence 352 in assigning the phylogenetic extent of each clade in the BAHD gene tree (Fig. 4). 353 The characterized enzymes can be divided into seven clades with high bootstrap 354 support, of which four (clades 1-4) are the same as defined previously (D’Auria, 2006). 355 Clade V in D’Auria, 2006 was divided into three separate clades 5-7 (Fig. S3). Three 356 clades containing HCT/HQT enzymes (clade 5a), alcohol acyltransferases (clade 7a) and 357 polyamine acyltransferases (clade 4a) were the most widely conserved, with orthologs 358 extending from angiosperms to liverworts (Fig. 4). Clade 5a, most of whose members are 359 involved in phenylpropanoid pathway and lignin biosynthesis, is – based on branch

15 bioRxiv preprint doi: https://doi.org/10.1101/2020.11.18.385815; this version posted November 20, 2020. The copyright holder for this preprint (which was not certified by peer review) is the author/funder. All rights reserved. No reuse allowed without permission.

360 lengths – under the most purifying selection of all BAHDs (Fig. S3), suggesting that 361 sequence similarity-based, substrate class-level functional prediction of unknown BAHDs 362 mapping to this clade will likely be accurate. Accurate class-level predictions may also be 363 possible for clades 1a/b (all but one anthocyanin/flavonoid acylating despite long branch 364 lengths) and 7a/7b (cuticular wax biosynthesis and slow-evolving), however, other clades 365 appear to have diverged rapidly at the sequence level as well as for substrate utilization 366 (Fig. S3). A deeper analysis of the sub-clades will be needed to determine their predictive 367 potential. 368 Combined with substrate preference patterns from our enzyme assays and 369 previous studies (Figs. 2,4), these results suggest that aliphatic and aromatic alcohol and 370 amine acylating activities (clades 4a, 5a, 7a) were already established in the ancestor of 371 land plants (Fig. 3). At ~1.3 BAHDs per 1000 genes in this ancestor, and given the 372 predicted gene content of Chara, mosses and liverworts, it is possible that ~15-30 BAHDs 373 may have existed in this ancestor, housing the three clades described above (with 374 additional uncharacterized/lineage-specific activities). Of these, only the aromatic alcohol 375 acylating activity was detected in the outgroup species C. braunii, providing more support 376 to the inference that at least this activity was present in the ancestor of all land plants and 377 perhaps in the LCA of charophytes-land plants. Given the possibility of specialization of 378 the enzyme in the lineage leading to C. braunii, occurrence of other activities (aromatic 379 amine, aliphatic alcohol and amine acylation) in this ancestor cannot be ruled out. 380 The evolution of the AnAT and terpenoid acylation activities is slightly more 381 complex. First, the AnAT- and terpenoid-specialized clades have OGs only containing 382 angiosperm species, but these activities exist in multiple distantly related BAHD clades 383 (clades 1,3,5,7 and 3,5,6,7, respectively). Second, these activities also exist in MeHFT 384 and SlHCT clades, whose OGs extend up to liverworts (Fig. 2B,E, Fig. S2A,B). Both 385 observations combined together suggest that AnAT and terpenoid acylation activities may 386 have been accessible to BAHDs for a long time before their specialization in angiosperms.

16 bioRxiv preprint doi: https://doi.org/10.1101/2020.11.18.385815; this version posted November 20, 2020. The copyright holder for this preprint (which was not certified by peer review) is the author/funder. All rights reserved. No reuse allowed without permission.

Figure 4

Alkaloids Sugar derivatives Phenolic glycosides Anthocyanins Flavonoids Triterpenoids Diterpenoids Sesquiterpenoids Monoterpenoids Aliphatic amines Aliphatic alcohols Aromatic amines Aromatic alcohols

Lp3M Vh3 3.1.p 2 Ss5 62 gen 10 v1.1

2 .1 1 .1 Pf3 M 1 Dm3M 7 .1 NtM A Gt5 M A 9 .1

Dm3M 3 0 T1 2 0150 v1.1 57s00 0 0280 v1.1 2 A A T1 1 1 0 Y087 7

T1 T Dm3M A A A A

Pc3 A 937 AB029 Dp3M A T1 T Y500 9 3940 8.1 AF405 Y50 996.1 A T1 2 4

AB01 R2 M 37.1 2 Mt T2 AB17 5 E 88261.1 Mt A A A M 0 2 GmIF7MaT NM 0 T3 A T A Y298 3 Mapoly0 Y06 aT1 EU 350 MeHFT Mt M T 3 52 T A A Y298 0 AtC 7 Kni kfl005 GmIMaT1 KY3 Kni kfl003 T Y142 40 Kni kfl000 aT2 EU AB29 AF489Y190 6 708 Mpus 4 M 07 Oluc 28702 A 525 Mpus 1 BT0104 5962.1 aT3 EU Cbra bGBG7190 86.1 8 Cbra aGBG7189 F 1 6 15.2 8 09 Cbra dGBG7627 9 397 2 1 10 Cbra cGBG7190 6 GmMT7 EU1 72030.10 MeHF ACT T NM 001 2 338.11 21 MpolFH GmIMaT3 KY3 72032.1 F H FT HHT1 65 2 08 AtDC S 7 72031.1 At T1 JX5 AF46 At5 0 StF H T BT009 125089 C BT 9789.1 AtA T NMT 127 130 AtACM PtF D AF1930 2804 at NM AtS T 9 A 618 At3 2928.13 AtS AF19 Y08 7 T 9 1.1 cDBN A At3 A NM 12551 9790.1 T T T 761.1 T1 NM 1 13880.2 cDB A P AF29 6 A T T T LanA T2 NM 1 Tc 6762.1 ObCA 2a 7b TcBA AXB2 625.1 AT2 DQ886 00275.30 cDBB 7 9.3 T AT1 AXB2 AtDC A 0 2298.1 T1 QKK36 0232.5 1b 7e Cc AT2 AB21 .1 R T1 14 AtE BT0007 9 Cc A AB24 25506 58 05.1 T2 76 PaxA* PS1 N 0 Ih3 A AX0 15 .1 gen 7 36.1 7f AT 0 0 S M 0.1 gen 0a Ih3 XM SsiAS AT3 KT71 126 7a MsA MT 1 sP 2717.1 AT3 KY9 16.2 O MT HG42145 6 Clade 2 ShA 260.1 7g BdP AT BT04 SlAS SAT2 KT3 78748.1 244.1 gen AT2 NM 0 1a ZmpC T1 gen 59561.1 7d A M 015763 013293 OsS AT2 X 4432.1 9 1c Clade 1 OsS PaxA 2.1 AT1 CAA9 200 S SlAS CmA AF500 AT2 KT71 AT3 BT 53 SlAS 6 CbBE Y8590 AT1 NM 0 259.1 AT3 A 013294 7c CmA 0202 SsiASA 03.1 EBT AF50 T2 KY978747.1 NtB 1496 PaxA Clade 7 PBT AY61 SAT4 KT716261.1 PhB PtBEBT KP228019.1 PaxASAT1 KT716 258.1 PtSABT KP228018.1 SsiASAT1 KY978746.1 AtCHAT AF500201.1 en 3b CaPun1 NM 001324769 g LaHMT HLT AB18 307 1292 CrDAT AF053 VlAMAT A 415 Y705388 AT AF253 Clade 5 MdAAT1 CrM AY707098 0150.1 MdAAT2 HD8 KC14 9.1 Clade 3 AY51 EcBA 4 SlAAT1 KM 7491.1 gen EcCS KC1401 5a SpA 975322.1 78749.1 3a 5c AT1 KM AT5 KY9 789 ArHPT1 QAA975321.1 SsiAS AT AF193 5b PvHH FaA 25504 12830.1 T AX0 287 TfHC HT KX44 VAA Fv AY850 054 AtS T2 EU86 3573.1 AT1 CiSHT1HT RhA AY859 AT2G1901219.1 AT4 g47980en 3c CiSHT2 At5 M CmA A1 OsHCT X G457243.170.1 A Clade 4 47950 Clade 6 PvHC M 193275.1g g G457244.1 AtTH P At5 035.1 MoRA 4 T M 015786 AA2 755.1 LanA Like1 AKP2 1 S AtBIA1 N 3d PsRA FR670 AFY1 AtTH 24.1 6a DcHCB AT1 DQ886 263.1 AMB2825.1 gen 0.1 2 ECHQT JQ41S 5 7066.1 SmSpmHT CcaHQT E AM28 23.1 JN3908 T4 T SrSpmHT6 JN3909 7559.1A 4a NtHQT 2 Z84386 9 8 JA75836 SlHQT 3092.104.1 T 467764 SlAS 2 4 4b SlHQT Solyc NaCV NaDH2 CiHQT1 KT22 T KM2 734 AJ58 F 3 AsFM A 3 80 CcHQT1 15393187.1 7 13 CiHQT3 KT22 AJ58 T MT0AF043 9 Vv3 Y38 CcHQT2 E 2 TA T A CiHQT2 KT22 651 A 37.1 PvHC 2 1 AI 0 652.1 .1 T T2 AJ556 AsaHH 70.1 PvHC AM6 0 A AF339 4 2 SbHC 7g005 Sq 6.1 5 PrHCT E CbBE M T 2 MpolHC 80.1.1 90 PpHC T 2 A 70 SmHCT1 4 2 AtHC 893.1 PtH 1a 9 PtH L CsHCT J 3 TfHC U Ss5 RsACT T T 0438.2

A 1 T 839582 7 T2 QKK36 1g071 . 2a KC691 AB72 895.1 60.2.1 T DQ767969.11 Y2285 765.1 825 XM 002 482.1 9 C A C AB076 A 1g42 7 7 T 54.1 81.1 A 8 PsS 7 T 2 F 1g071 JN3908 1 1g42 T1 EU6 T6 XM 0 T 1 KU513 F 9 6 4 T 894.1 1 1 NM 1242 1 1 12145 olyc 1 Mapoly0 0 22892.1 3 T 22891.1 a .1 A S 17600.2.1 5 2 827.1 ObCA A AJ50 2 XM 002 1 N AK28 1 PaxC olyc EU861 6 9

J 00593 4 T 80 S Na HvACT 01575 573.1

F 52390.2 0

2 M EF137 0 3313.1 9 .1 T 2 FN647 B 63684 65.1

1 7 SlACT1 T lyc03g 0 OsTBT1 Os NtHC 0.4

T 2 2 9 OsTBT2 Os o 03s02 OsTHT1 18.1 .1 gen 79015.2 SlACT2 C

CiHCT2 KT H CiHCT1 KT

f 3 CcaHC PsHC

T 0.2 OsTHT2 X 7 7.1.p

SlHCT S

Ortholog group membership up to LCA of:

Dicot- Dicot- Angiosperm- Angiosperms Liverworts Mosses Gymnosperms only

Taxus Monocots Dicots Solanales only only only only Figure 4. Defining BAHD clades. The tree was rooted using the algal enzyme clade (Clade 0a). Maroon circles on branches refer to clades with bootstrap values > 70. Clades were first defined based on deepest, high-confidence monophyletic clades. Clades 1-4 are same as D’Auria et al, 2006 definitions (Fig. S3), while Clade V from that study is divided into Clades 5-7 here, based on the above criterion. Sub-clades were further defined within each clade based on the extent of conservation of OGs across the plant phylogeny (File S3). These clade/sub-clade definitions can be further expanded as new, uncharacterized BAHDs are characterized in the future. Solid circles in the concentric circles around the tree represent activities characterized in this and previous studies, with “gen” referring to genetically characterized BAHDs whose substrates were not considered. * AtEPS1 showes unusual reaction mechanisms for BAHDs and has an isochorismoyl-glutamate A pyruvoyl-glutamate lyase activity that produces salicylic acid.

387

17 bioRxiv preprint doi: https://doi.org/10.1101/2020.11.18.385815; this version posted November 20, 2020. The copyright holder for this preprint (which was not certified by peer review) is the author/funder. All rights reserved. No reuse allowed without permission.

388 Evolution of specialized BAHD activities

389 Orthology-based ancestral state reconstruction suggested that BAHDs accessed 390 new substrate classes or specialized in ancestrally accessible classes over their 391 expansion through gene duplication. Comparisons of OG sequences could thus help 392 identify specific residues that contributed to functional specialization for a given substrate 393 class. We first compared the HCT/HQT-like enzymes (clade 5a/b) to amine-acylating 394 enzymes (clade 4a), both clades being conserved across land plants. We identified 35 395 residues that were present in >70% of the tested sequences in clade 5a/b but had 396 completely switched to a different residue in >70% of the tested sequences in clade 4a 397 (File S5). Of these, only 2 – AtHCT F303L and R356D (Fig. 5A) – were close to the active 398 site, with R356 present in ~90% of clade 5a/b but 0% of clade 4a, being replaced by Asp 399 or Glu in a majority of clade 4a sequences. The effect of R356D switch was previously 400 described (Levsh et al., 2016; Chiang et al., 2018b) in several HCTs, which use shikimate 401 as its primary substrate but do not show activity with aromatic amine substrates. It was 402 found that this switch was able to convert this enzyme into using amine-containing 403 substrates. While this promiscuous activity exists in at least some O-acylating enzymes 404 (Fig. 2, Fig. S2), the ubiquity of the R356D mutation in N-acylating enzymes suggests 405 that this residue was critical for specialization towards positively charged substrates 406 despite alternative binding sites in the protein contributing to increased promiscuity 407 (Chiang et al., 2018a). For F303L, we found that while 95% of the HCT/HQT-like enzymes 408 have the Phe residue, this is completely reversed, with 95% of the amine-acylating 409 enzymes having a Leu residue. Although this residue was not experimentally tested, we 410 hypothesize that this position also plays an important role in specialization towards the 411 respective substrates.

18 bioRxiv preprint doi: https://doi.org/10.1101/2020.11.18.385815; this version posted November 20, 2020. The copyright holder for this preprint (which was not certified by peer review) is the author/funder. All rights reserved. No reuse allowed without permission.

Figure 5 A Clade 5a Clade 4a

B TFFDxxW region YFGNC region

4 4 3 3 2 2 bits bits H F T VAP VA DA I F R F C E L AH I S 1 VL H V 1 P T A I A V L P N G V T L A V L K G P E T Q W GL AG L S S K I F N M S T L I FSA L F H I S G DD T L M F A R L M D Y L TI S I S K L FF K N S M M I A KA T Y L VS C STYVG I QY H F TA 1 VQVS Y V P YPNRPT P Y 0 F 0 1 2 3 4 5 6 7 8 9 1 2 3 T4 5 6 7 8 9 Y 20 10 11 12 13 14 15 16 17 18 19 10 11 12 L13 14 15 16 17 18 19 20 P Y NC N FD W C N G C weblogo.berkeley.edu weblogo.berkeley.edu

4 4 3 3 2 2 bits bits C T E V 2 1 FQ TF PY A Y N 1 P Y L I A I FT GT 0 I H PW SR R G L E C VS TG I A TV

1 2 3 4 5 6 7 8 9 0 V 1 2 S3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 10 11 14 15 16 17 18 19 20 Q 12 13 N L DL L F Y C N E FGN C weblogo.berkeley.edu weblogo.berkeley.edu

4 4 3 3 2 bits 2 bits LKN G 3 1 1 Q 0 0 1 2 3 4 5 6 7 8 9 M1 2 S3 4 5 6 7 8 9 T 10 11 12 13 14 15 16 17 18 19 20 NLPMSNLDLLL P P L DF C N YFGNVLS10 V11 P12 Y13 14 15 16 17 18 E19 A20 C weblogo.berkeley.edu weblogo.berkeley.edu

4 4 3 3 2 bits 2 bits I L FF I I H L A A P V L A F 4 A N F I V K I E S E P D P D 1 LA K 1 PA D I RL C S G FV Y R D T A F C F K D D L HC L D F L V E F T I L I E N L NS V A G G H C I E V F L K M PAN I H C I H Q K M KY H V N C H H S I KS Q T V S I GS K I NVL Y T T Y V F SP MV V Y QA T LV R LI T Q QSYTV MFFVLTT VS 0 1 2 3 4 5 6 7 8 9 0 1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19 20 N D L C N G 10 11 12 13 14 15 16 17 18 19 20 C weblogo.berkeley.edu N R weblogo.berkeley.edu

4 4 3 3 2 bits 2 5 H F G bits H I V T LL L I P P A T I L S S G I N I F A M G I T 1 M G S 1 D M A N F L K K V A G LPY Y E S Q I S H L D I L F T A L F F A K L I QF T WGAV S I Y H T E CG V AS P L I V T L L I N S Q PSEH Q F L FSL I L E A T S P Y T M F I T FN N P M GP C V F A F W L A A KGS N H F LS Q C H G S K D S T C L E SC Q HQ Y P Y K L F I Q C T N A P V YM F R TV R V Q L S H EY W M M T V V T Y R 0 W V P T VNV V SR R 2 4 6 9 1 3 5 7 8 0 LS P 1 2 3 4 5 6 7 8 9 11 13 10 12 14 15 16 17 18 19 20 21 N D V C N GN 10 11 12 13 14 15 H16 F17 S18 19 20 C weblogo.berkeley.edu weblogo.berkeley.edu C

LPLTFFDLPWL

TYFGNCI Anthocyanin-Flavonoid acyltransferases CKLTTFDLPYL Clade 1a/b

SYFGNAI specialization for AnAT activity

CKLSTSDLPML Aromatic alcohols Aromatic amines SYFGNAI acyltransferases + Others Clade 1c Aromatic alcohols Aromatic amines acyltransferases Clade 5a

Figure 5. Conserved residues in different clades and ancestral state reconstruction. (A) Alignment of clade 5a and clade 4a OG sequences. Highlighted in red is the Arg residue conserved in ~90% of clade 5a BAHDs that predomi- nantly use aromatic alcohols. In green, the corresponding Asp, Glu or Asn residues in amine acylating BAHDs are shown, of which Asp is present in ~90% of clade 4a sequences. (B) Conserved TFFDxxW and YFGNC motif region in different clades of the BAHD phylogeny. Groups 1-5 are defined in Figure S4B. A 20 amino acid broad window is shown. (C) Ancestral sequence reconstruction of the conserved TFFDxxW (purple) and YFGNC (green) region. Large letters are residues with a posterior probability >80%. Smaller letters represent residues with a posterior probability <80%. Additional information can be found in File S6.

412 Using OG comparisons, we also looked at sequence differences between 413 HCT/HQT-like enzymes (clade 5a/b) and AnAT-like enzymes (clades 1a/b) by 414 supplementing the single-residue analysis with enrichment analysis of larger motifs given 415 the larger structural difference between the substrates. We focused on AnAT-like 416 enzymes, since they are the most widespread and well-characterized clades among 417 plants (Fig. 4). The OGs of clades 1a/1b extend farthest back to angiosperms, which 418 suggests that the fixation of this activity occurred only in this lineage. This spread 419 corroborates with previous knowledge about evolution of the core anthocyanidin pathway 420 in seed plants (Davies et al., 2020; Piatkowski et al., 2020), which is further extended via

19 bioRxiv preprint doi: https://doi.org/10.1101/2020.11.18.385815; this version posted November 20, 2020. The copyright holder for this preprint (which was not certified by peer review) is the author/funder. All rights reserved. No reuse allowed without permission.

421 glycosylation, methylation and acylation. Anthocyanin acylation can improve the stability 422 of the molecule to heat, higher pH, UV light, also providing an evolutionary advantage to 423 its fixation in flowering plants. 424 Motif enrichment analysis revealed among others, two large, over-represented 425 motifs in these clades (TFFDxxW: E-value=1.9e-248; YFGNC: E-value=4.5e-221, Fig. 426 5B, Fig. S4A). Single-residue analysis also confirmed that two residues Trp36 and 427 Cys320 contained in the conserved motifs, were highly conserved AnAT enzymes in 428 comparison to other biochemically characterized BAHDs (100% vs 0% and 95% vs 4%, 429 respectively) (Fig. S4; Fig. S5A,B). Both these residues were closer to the catalytic His 430 than other identified residues in the crystallized structure of Dm3MAT3 in complex with 431 malonyl-CoA (PDB: 2E1T) (Unno et al., 2007). Ancestral sequence reconstruction was 432 performed to determine when these residues appeared in the BAHD phylogeny. Over 433 80% of residues in the ancestor of all AnAT-type enzymes could not be predicted 434 confidently (posterior probability<0.8), owing to the rapid sequence evolution of BAHDs 435 (File S6); however, both Trp36 and Cys320 were confidently placed in the ancestral node 436 of clade 1a/b (Fig. 5C; posterior probability>0.95). Emergence of these two residues was 437 most likely preceded by a Tyr (<80% posterior probability) and an Ala, respectively, in the 438 prior ancestral node (Fig. 5C). These results suggest that the acquisition of Trp36 and 439 Cys320 was important for the angiosperm-restricted specialization of the ancestrally 440 accessible AnAT activity. We next performed molecular dynamic (MD) simulations to 441 determine the role of these residues in the AnAT activity. MD simulations were performed 442 using the wild-type Dm3MAT3 enzyme and by replacing the two residues with Ala, a 443 catalytically neutral residue. 444 445 The role of Trp36 and Cys320 in anthocyanin malonyltransferase catalysis

446 The first step of the acyltransferase reaction involves proton abstraction from the 447 cyanidin 3-O-glucoside (C3G) 6”-hydroxyl by the deprotonated, basic nitrogen of the 448 His170 imidazole (Fig. 6B) (Unno et al., 2007). For successful intermolecular proton 449 transfer to occur, the distance between these two atoms should be less than 4 Å to 450 account for the longest possible hydrogen forming (Harris and Mildvan, 1999). 451 Simulations revealed that the distance for C3G 6”-hydroxyl proton abstraction fell within

20 bioRxiv preprint doi: https://doi.org/10.1101/2020.11.18.385815; this version posted November 20, 2020. The copyright holder for this preprint (which was not certified by peer review) is the author/funder. All rights reserved. No reuse allowed without permission.

452 a 4 Å threshold for WT Dm3MaT3 for the entire 1 µs of production runs. After maintaining 453 a catalytically competent distance for the first 100 ns of simulation, the distance for proton 454 abstraction in the C320A mutant exceeded the 4 Å threshold. The W36A mutant never 455 achieved a distance satisfactory for catalysis to proceed (Fig. 6A). This result suggested 456 that the W36A mutant would have a lower catalytic efficiency than wild-type and the 457 C320A mutant for both C3G and malonyl-CoA. 458 Figure 6

A B WT W36A C320A

) 6’’- Å OH ( C3G e c an t s Di

Time (ns)

C D E

C3G

Figure 6. Distance calculations between the cyanidin 3-O glucosides 6”-OH hydrogen and the deprotonated, basic nitrogen of the His170 imidazole. (A) Distance calculation for WT (purple), W36A (red) and C320A (green) over 1000 ns of simulation time. (B) Illustration of the distance measured during the simulation. Active site organization is altered upon replacement of Trp36 and Cys320. Active site organization in the (C) WT protein, (D) the W36A variant, and (E) C320A variant during catalysis. Ala substitutions are colored and labeled as goldenrod in the appropriate systems.

459 We next assessed how C3G is repositioned by each of the Dm3MaT3 variants 460 (Fig. 6C-E). In wild-type Dm3MaT3, the glucose moiety of C3G maintained a tight 461 proximity to His170 within the active site, as it was flanked by bulky residues Trp36 and 462 Trp383 (Fig. 6C). The benzene diol moiety of C3G stacked with Trp383 and the 463 chromenylium moiety stacked with Trp36. Incorporation of these bulky residues in the 464 proximal active site imposed a restriction on the movement of C3G, encouraging catalysis

21 bioRxiv preprint doi: https://doi.org/10.1101/2020.11.18.385815; this version posted November 20, 2020. The copyright holder for this preprint (which was not certified by peer review) is the author/funder. All rights reserved. No reuse allowed without permission.

465 by keeping it close to the reactive His170. Upon W36A substitution, the bulky Trp residue 466 was no longer present, which allowed C3G to sample other conformations within a more 467 open active site, while still remaining bound to the enzyme. Trp383 initially stacked with 468 aromatic portions of C3G in the WT, as seen in the Dm3MaT3 WT simulation. However, 469 in W36A, the glucose moiety of C3G was flipped from its starting pose, where backbone 470 hydrogens on the hexose ring demonstrate C-H···pi interactions with Trp383, positioned 471 the 6”-hydoxyl far from His170 (Fig. 6D). Thus, the W36A mutation directly altered active 472 site organization, providing a straightforward justification for this Dm3MaT3 variant’s

473 reduced kcat/Km. 474 While the C320A mutant initially maintained a native active site organization due 475 to the interactions between C3G and Trp36, C3G completely left and was excluded from 476 the active site by the end of the simulation (Fig. 6A,E). Ala substitution altered the native 477 C-H···pi interactions between the backbone of residue 320 and the aromatic portion of 478 Phe32. In apo simulations, the distance between the backbone hydrogen of Ala320 and 479 the pi system of Phe32 was consistently less than 3 Å, but it experienced fluctuations 480 ranging between 2.5 and 6 Å during holo simulations (Fig. S7A,B). For WT and W36A 481 variants, these distances were constant and unperturbed by the introduction of ligand, 482 suggesting that the basis of reduced activity in the C320A mutant is distinct from that 483 seen in the W36A mutant (Fig. 6D). 484 Snapshots from simulation reveal that upon experiencing fluctuations in the 485 distance between the backbone alpha hydrogen of Ala320 and the aromatic portion of 486 Phe32, a series of stacking rearrangements occurred along the helix containing the 487 TFFDxxW motif (Fig. S6C,G). First, Phe32 became destabilized due to inconsistent 488 backbone C-H···pi interactions with Ala320, resulting in increased edge-to-face stacking 489 between Phe31 and Phe32 (Fig. S6A). Alternation of face-to-face and edge-to-face 490 stacking between Phe31 and Phe32 was seen throughout each of the apo and holo 491 systems simulated (Fig. S7), but the extent of fluctuation between the two modes of 492 stacking, and the sampling of continuous no stacking interactions, was greatest for holo 493 C320A. 494 To recover stability within the C320A variant’s TFFDxxW motif, Phe35 broke its 495 edge-to-face stacking with Trp36 and began to stack with Phe31 and Phe32 (Fig. S6D,

22 bioRxiv preprint doi: https://doi.org/10.1101/2020.11.18.385815; this version posted November 20, 2020. The copyright holder for this preprint (which was not certified by peer review) is the author/funder. All rights reserved. No reuse allowed without permission.

496 Fig. S7). While the W36A substitution prevented Phe35 from edge-to-face stacking with 497 an active site tryptophan, Phe35 never stacked with neither Phe31 nor Phe32 (Fig. S8). 498 WT Dm3MaT3 also demonstrated virtually no Phe31-Phe35 nor Phe32-Phe35 stacking 499 (Fig. S9), suggesting these interactions were developed in response to instabilities 500 caused by C320A substitution. Thus, as Phe35 sampled new stacking interactions with 501 Phe31 and Phe32, Phe35-Trp36 stacking interactions were momentarily lost (Fig. S6D). 502 With the network of stacking interactions between Phe35, Trp36, and His170 disrupted, 503 the active site lost the tight organization which is requisite for maintaining a catalytically- 504 competent distance between His170 and the C3G 6”-hydroxyl (Fig. S6E,F). C3G then left 505 the immediate vicinity of His170 and the TFFDxxW motif to bind elsewhere within the 506 enzyme. 507 In contrast to the Ala substituted variants, wild-type Dm3MaT3 maintained an 508 ordered active site which better maintained proximity to C3G and overall acyltransferase 509 activity (Fig. 6C). The stability and organization of the wild-type enzyme is underscored 510 by consistent Phe31-Phe32 face-to-face stacking and Phe35-Trp36 edge-to-face 511 stacking, neither of which were disrupted by Phe31-Phe35 or Phe32-Phe35 stacking at 512 any point during the holo wild-type simulation (Fig. S9). 513 The MD simulation results thus suggested that that the W36A variant would have 514 inferior reaction kinetics in comparison to the wildtype due to absence of the bulky Trp36 515 that is important for keeping the C3G proximal to His170. Furthermore, we were 516 interested in examining how severely the C320A variant activity would be affected, 517 because the MD simulations demonstrated that C320A may position the acyl acceptor in 518 a catalytically competent position, suggesting the possibility for some functionality despite 519 mutation. In addition, for ~10% of the total simulation time (about 100 ns), the C320A 520 mutant maintained C3G 6”-hydroxyl and the His170 imidazole within a distance of 4 Å 521 (Fig. 6A). Therefore, we tested the effects of Ala replacement of Trp36 and Cys320 using 522 site specific mutagenesis and subsequent in vivo enzyme assays. 523 524 The catalytic importance of the two residues in anthocyanin acyltransferase 525 activity

23 bioRxiv preprint doi: https://doi.org/10.1101/2020.11.18.385815; this version posted November 20, 2020. The copyright holder for this preprint (which was not certified by peer review) is the author/funder. All rights reserved. No reuse allowed without permission.

526 We heterologously expressed and purified mutagenized Dm3MAT3 variants from 527 E. coli. These proteins showed similar folding behavior based on similar gel migration and 528 retention time in size-exclusion chromatography compared to the wild-type protein (Fig. 529 S11A,B), suggesting that the mutation did not affect protein folding; however, both 530 mutants substantially affected enzyme reaction kinetics when comparing specific 531 activities (Fig. 7A,B,C). Comparing the pseudo-first-order reaction kinetics of the wild- 532 type Dm3MAT3 enzyme with the W36A mutant revealed that the mutation did not

533 influence the acceptor Km value (Fig. 7D) but drastically reduced turnover number (kcat)

534 and catalytic rate (kcat/Km) by ~97% and 97.5%, respectively (Fig. 7E,F). All three kinetic 535 estimates were significantly reduced for the acyl donor malonyl-CoA (Fig. 7D-F).

Figure 7

A B WT 1 W36A 1 C320A 1 C WT 1 W36A 1 C320A 1 WT 2 W36A 2 C320A 2 WT 2 W36A 2 C320A 2

100 0.008 0.008

0.006 0.006

50 0.004 0.004 umol/s umol/s

0.002 0.002 specific activity (% of WT) 0 0.000 0.000 0 100 200 300 0 100 200 300 WT Mock Malonyl-CoA [uM] W36AC320A control Cyanidin 3-O glucoside [uM] D E F C3G Malonyl-CoA C3G Malonyl-CoA C3G Malonyl-CoA 30 20 150 150 0.0015 ) ) 1 1 - 0.0010 - 15 ) ) 20 /M /M 1 100 100 0.0010 1 - - -1 -1 M) M) (s (s (s (s 10 (u (u m m m m cat cat 0.0005 K K / / k k 10 K 50 K 50 0.0005 5 cat cat k k

0 0 0.0000 0.0000 0 0

WT WT WT WT WT WT W36A W36A C320A W36A C320A W36A C320A W36A C320A W36A C320A C320A

Figure 7. Enzyme activity and enzyme kinetics of Dm3MAT3 wildtype and mutants. (A) Specific activity of Dm3MAT3 wild-type, W36A and C320A mutant. The activity of the wild-type (WT) is set to 100 %. The error bar represents the standard deviation of three expression replicates which were each assayed in technical triplicates. (B) Michaelis-Menten curve for Dm3MAT3 WT (WT), Dm3MAT3 W36A (W36A), and Dm3MAT3 C320A (C320A) in dependence of cyanidin 3-O glucoside (C3G). (C) Michaelis-Menten curve for the malonyl-CoA donor. (D) Km values of WT, W36A and C320. (E) kcat values. (F) kcat/Km values.

536 These changes in enzyme activity suggest that Trp36 is catalytically important for

537 the AnAT activity in clades 1a/b. The relatively similar acceptor Km between wild-type and 538 W36A mutant suggested that the mutation did not affect acceptor substrate binding. Thus, 539 while the MD simulations suggested a quick C3G departure from the active site, the 540 molecule may still remain in the binding cavity due to interactions with other residues, and

541 exit normally. The kinetic assays – specifically the reduced kcat and kcat/Km values for both

24 bioRxiv preprint doi: https://doi.org/10.1101/2020.11.18.385815; this version posted November 20, 2020. The copyright holder for this preprint (which was not certified by peer review) is the author/funder. All rights reserved. No reuse allowed without permission.

542 acceptor and donor – support MD simulation predictions that catalysis would be 543 drastically affected due to C3G departure from a catalytically competent distance with

544 His170. The Km of the W36A mutant towards malonyl-CoA was also significantly reduced. 545 Considering AnAT-like acyltransferases are postulated to operate through a two- 546 substrate ordered bi-bi reaction mechanism with malonyl-CoA binding first (Suzuki et al., 547 2003; Unno et al., 2007), we hypothesize that the reduced catalysis in W36A results in 548 the malonyl-CoA continually bound to the donor binding site, further resulting in a 549 saturation of the available donor sites at lower substrate concentration. 550 In the case of the C320A mutant, the observed effects were less severe than for

551 the W36A mutant (Fig. 7A), and the C320A still exhibited a kcat ~47-74% of the WT (Fig.

552 7E). Compared to the wild-type, the C320A mutant showed an improved Km towards C3G

553 (Fig. 7D). This lower Km and the only slightly reduced kcat resulted in a 50% improved

554 catalytic rate than WT (Fig. 7F). The C320A mutant showed an unchanged Km and a

555 lower kcat for malonyl-CoA. This resulted in a slightly less efficient enzyme with respect to 556 the donor (Fig. 7F). 557 These results support the simulation prediction that Cys320 plays a role in 558 optimizing the enzyme’s activity rather than catalysis. While MD simulations indicated that

559 stability of the C3G bound form is reduced, this results in only a slightly decreased kcat. 560 However, we postulate that the acceptor substrate remains in the substrate binding site

561 without catalysis, reducing the Km to a greater extent than reduction in kcat, thereby 562 mathematically increasing the catalytic efficiency. Combined together, these results 563 suggested that the presence of both Trp36 and Cys320 is necessary for optimal 564 anthocyanin malonyltransferase activity in clades 1a/b, explaining their conservation in 565 AnATs spread out over 150 million years of angiosperm evolution. 566

567 DISCUSSION

568 Evolution of functional diversity in large enzyme families that contribute to the 569 metabolic diversity in plants is still incompletely understood. In this study, we extensively 570 characterized the BAHD family to determine how gene duplication and promiscuity 571 contributed to the diversity of BAHD functions. Nine out of eleven BAHDs assayed in this

25 bioRxiv preprint doi: https://doi.org/10.1101/2020.11.18.385815; this version posted November 20, 2020. The copyright holder for this preprint (which was not certified by peer review) is the author/funder. All rights reserved. No reuse allowed without permission.

572 study were substrate-promiscuous (Fig. 2; Fig. S2; File S2), and three (MeHFT, SlHCT, 573 EcCS) were class-promiscuous under the testing conditions (Fig. 2A, Fig. 1). We only 574 tested nine substrate types (including glucose/sucrose), and the specialized enzymes 575 may still exhibit class-promiscuity with other, untested classes under different conditions. 576 More enzymes that cross class boundaries are known from previous studies (Fig. 4). 577 Nonetheless, these observations suggest that while most BAHDs are not able to 578 discriminate between structurally related compounds (e.g. shikimate, quinate for SlHQT 579 or putrescine, agmatine for SlACT), they are able to differentiate between very different 580 chemical scaffolds. For individual enzymes, these adaptations for specialization may 581 constrain them and their duplicates from traversing large distances in the phytochemical 582 space. On the other hand, the class-promiscuity of multiple enzymes such as SlHCT, 583 AtHCT, SmHCT1, MeHFT, EcCS, alcohol acyltransferases provides a foundation on 584 which duplicates may traverse larger distances in the phytochemical space and “plug into” 585 emerging metabolic pathways. Since such class-promiscuity is not typically assayed, it 586 may be much more prevalent than currently known and may form an important basis for 587 metabolic diversification. Significant presence of class-promiscuity can also confound 588 evolutionary inferences and thus, functional annotation for enzyme family members. 589 Thus, more studies to determine if there are any rules for class-promiscuity are needed. 590 Such studies may also reveal new insights about the nature of selection on protein 591 structural features that enable promiscuity. 592 The integrative analysis of the AnAT activity can be interpreted following the 593 previously proposed potentiation-actualization-refinement model of emergence of new 594 functions (Blount et al., 2008). Our results suggest that the ability to acylate anthocyanins 595 was already actualized (first appeared/already existed) in ancestral BAHDs prior to land 596 plant evolution, or that the ancestral enzymes were potentiated to evolve the AnAT activity 597 through different routes. The refinement of the AnAT activity in clades 1a/b required 598 fixation of two residues, one of which (Trp36) is critical for positioning anthocyanins in the 599 active site and the second (Cys320) for positioning the first residue. Both these residues 600 together optimize the AnAT activity by affecting acceptor binding, however, they are likely 601 not sufficient to confer the AnAT activity. The median clade 1a/b AnAT identity is itself 602 ~50%, hence identifying all residues necessary to transform a class A/B utilizing enzyme

26 bioRxiv preprint doi: https://doi.org/10.1101/2020.11.18.385815; this version posted November 20, 2020. The copyright holder for this preprint (which was not certified by peer review) is the author/funder. All rights reserved. No reuse allowed without permission.

603 to class D substrate utilizing enzyme is challenging. Comparative sequence and structural 604 analysis can help further identify regions in the protein that could be tested by 605 mutagenesis. 606 An important question we asked was whether the structural diversity of substrates 607 used across BAHDs is related to an ancestral ability to use these substrates or 608 emergence of new activities through multiple rounds of duplication-neo-functionalization. 609 Our results can be discussed in the context of two models of BAHD evolution (Fig. 8). In 610 both models, the most likely ancestral activity in the root node prior to BAHD expansion 611 is aromatic alcohol acylation. Based on the fact that many HCT/HQT enzymes also 612 acylate aromatic amines (Fig. 4), class A substrates as a whole are the likely ancestral 613 BAHD substrate space (Fig. 8A,B). For other activities, strong evidence for their 614 existence exists only in the ancestor of all land plants. For example, in our enzyme assays 615 (Fig. 2A) or the accumulated database (Fig. 4), we do not see any enzyme from any 616 orange/yellow (extending to LCA of dicot-liverwort and dicot-mosses, respectively) clades 617 acylating both aliphatic and aromatic alcohols, but these activities are seen together in 618 seed plant clades 1c, 3a, 6a, 5b, 7c/d. Also, many aliphatic alcohol acyltransferases can 619 also acylate monoterpenoids. Thus, while it is possible that the 1-5 root node BAHDs 620 acylated aliphatic alcohols and thus, monoterpenoids, we cannot be certain about this 621 inference. Finally, the presence of anthocyanin acylation is seen in MeHFT, SlHCT and 622 multiple distantly related clades in the BAHD phylogeny (Fig. 4). While this could 623 represent multiple instances of convergent evolution, a simpler explanation is existence 624 of this activity at least among the dozen-odd BAHDs in the land plant ancestor as a 625 promiscuous activity. No evidence exists for the assignment of this activity to the root 626 node, but given presence of class-promiscuous enzymes, this possibility cannot be 627 completely ruled out (Fig. 8B). These inferences reveal that most of the currently known 628 BAHD acyltransferase substrate space was already accessible by the time BAHDs 629 started drastically expanding, either as fixed or unfixed, promiscuous activities. Compared 630 to simpler prior models of individual enzyme evolution such as the “patchwork model” 631 (Jensen, 1976; Matsumura and Ellington, 2001) and the “specialization-generalization- 632 specialization” model (Aharoni et al., 2005), our study of enzyme family reveals a complex 633 picture where ancestral promiscuity played a central role in incorporation of member

27 bioRxiv preprint doi: https://doi.org/10.1101/2020.11.18.385815; this version posted November 20, 2020. The copyright holder for this preprint (which was not certified by peer review) is the author/funder. All rights reserved. No reuse allowed without permission.

A dozens of BAHDs

>20 BAHDs

>10 BAHDs (land plants ancestor) Monocots

1-5 BAHDs Dicots (root node)

Non-angiosperms

Marchantia (liverworts)

Aromatic alcohol Chara (charophytes)

>10 BAHDs Aromatic amine

1-5 BAHDs Aliphatic alcohol

Aliphatic amine

B Monoterpenoid

Anthocyanin Monocots

Dicots

Non-angiosperms

Marchantia (liverworts)

Chara (charophytes)

Figure 8. Two models of evolution of BAHD multi-functionality. (A) Conservative model: Only aromatic alcohols and amines are acylated in the root node. First steps of expansion in the branch towards the land plants ancestor leads to emergence of new activities that are fixed in the ancestor (big circles) as well as other promiscuous activities that remain unfixed (smaller circles) (B) Relaxed model: The 1-5 BAHDs in the LCA of charophytes and land plants are capable of utilizing most of the substrates in the current known substrate space. Specializations evolve in lineage-specific duplications. The aliphatic alcohol acyltransferase enzyme is likely a different one than the aromatic acyltransferase enzyme in the root node ancestor. The first detected monoterpenoid activities appear in the green angiosperm-gymnosperm ancestral clade (Fig. 4), however, strong secondary activities were also detected in MeHFT and SlHCT.

634 enzymes into new pathways. Both of these models likely apply to evolution of individual 635 BAHD enzymes. 636 Our inferences are based on ~140 BAHDs, and activities of many BAHDs are 637 unknown. For example, to the best of our knowledge in tomato, only 10 out of 100 BAHDs 638 have an experimentally determined function (Table S2) (Niggeweg et al., 2004; Goulet et 639 al., 2015; Fan et al., 2016) (including this study), and >80% of BAHDs have a generic 640 domain annotation. It is possible that uncharacterized BAHDs may reveal new primary 641 activities in vitro and in vivo. However, our meta-analysis suggests that – despite the

28 bioRxiv preprint doi: https://doi.org/10.1101/2020.11.18.385815; this version posted November 20, 2020. The copyright holder for this preprint (which was not certified by peer review) is the author/funder. All rights reserved. No reuse allowed without permission.

642 dangers of class-promiscuity – some clade relationships (Fig. 4) can provide a strong 643 functional signal. Combined with other enzyme attributes, these clade relationships can 644 be useful in predicting putative BAHD substrate class utilizations with greater accuracy 645 than simply a similarity-based approach. e.g. using machine learning (Mahood et al., 646 2020). At the same time, among the 42 multi-species OGs not represented among 647 characterized BAHDs, many show broad conservation across angiosperms and vascular 648 plants. These uncharacterized OGs may indeed reveal novel BAHD activities. As new 649 substrate classes are identified, it would be informative to test – using methods similar to 650 those employed in this study – whether the ability to use those classes also exists across 651 the BAHD family. 652 Findings from this study also provide insights into the role of enzyme families in 653 metabolic diversification in plants. BAHDs are fast-evolving enzymes; even in the well- 654 conserved clade 5a, where all known enzymes are associated with substrates related to 655 lignin biosynthesis (Fig. 4), the median percent identity is only ~60%. The ability to use 656 aromatic alcohols such as shikimate and quinate exists in BAHDs that are only 30-40% 657 identical to the clade 5a BAHDs. In other words, these enzymes are robust in retaining 658 their aromatic alcohol acyltransferase activity despite changes to ~70% of their sequence. 659 Similar behavior is observed for acylsugar acyltransferases (Moghe et al., 2017) and 660 aliphatic alcohol acyltransferases (Fig. 4). While being robust, the class-promiscuity of 661 BAHDs and thus, the ability to specialize in one of the classes via duplication, would also 662 make them evolvable. The paradox of a biological system being both robust and 663 evolvable at the same time has previously been addressed in detail (Wagner, 2005, 2008; 664 Bloom et al., 2006; Pigliucci, 2008; Tokuriki and Tawfik, 2009; Payne and Wagner, 2019); 665 these properties may enable enzyme families to become involved in newly emerging 666 metabolic pathways or detoxify harmful metabolites without compromising their core 667 activities. The examples of aromatic alcohol, anthocyanin and terpenoid acylating 668 enzymes – whose OGs have a much narrower phylogenetic spread than the predicted 669 spread of the biochemical activity – also highlight a common theme in metabolism, where 670 enzyme activities may exist promiscuously for millions of years prior to the actual 671 genome-level signatures of their fixation. While presence of substrate promiscuity is 672 helpful in this regard, having class-promiscuous enzymes may also offer an added

29 bioRxiv preprint doi: https://doi.org/10.1101/2020.11.18.385815; this version posted November 20, 2020. The copyright holder for this preprint (which was not certified by peer review) is the author/funder. All rights reserved. No reuse allowed without permission.

673 benefit. Presence of robust evolvable enzymes is likely an important feature of metabolic 674 networks and needs to be studied in greater detail in the context of biochemical evolution. 675 The present study describes an integrative analysis of enzyme evolution, 676 biochemistry and structure-function relationships that captures potentially emergent 677 behaviors of enzyme families in the form of robustness and evolvability. The described 678 analysis can serve as a template for characterizing class-promiscuity in enzyme families, 679 although more high-throughput means of analysis are needed. Our results also identify 680 patterns in duplication-divergence of BAHDs that can be explored in other large enzyme 681 families to determine their involvement in metabolic diversification in plants. 682

683 MATERIALS AND METHODS

684 Creation of a database of biochemically characterized enzyme activities

685 Biochemically characterized BAHD enzymes were gathered through an extensive 686 literature search. Only sequences belonging to the BAHD acyltransferase protein fold 687 (PFAM domain: PF02458) were considered. To ensure a high level of confidence for in 688 vitro activities and the resulting substrate-enzyme pairs, only enzymes that were subject 689 to in vitro biochemical assays were considered. For each enzyme, all tested acceptor and 690 donor substrates with their associated PubChem CID, the associated chemical structure, 691 cDNA and protein sequence as well as the species name from which the gene was 692 isolated were compiled (File S2). 693 694 Generation of substrate similarity networks

695 Structures of known BAHD substrates were downloaded from the PubChem 696 database using the PubChem ID as structure-data file (sdf) format. Substrates not found 697 in the PubChem database were created using ChemDraw, exported in the MOL data 698 format and manually brought into sdf format. To calculate substrate similarity based on 699 the maximum common substructure, overlap coefficient (MCS-Overlap), the R packages 700 ChemmineR v3.34.1 and fmcsR v1.24.0 were used (Cao et al., 2008; Wang et al., 2013) 701 with default values, except for the time threshold for the comparison of two molecules set

30 bioRxiv preprint doi: https://doi.org/10.1101/2020.11.18.385815; this version posted November 20, 2020. The copyright holder for this preprint (which was not certified by peer review) is the author/funder. All rights reserved. No reuse allowed without permission.

702 to 12s. The similarity network was visualized using Cytoscape v3.8.0 (Shannon et al., 703 2003). Additional plant specific compounds were downloaded from the Chemical Entities 704 of Biological Interest (ChEBI) database (Hastings et al., 2013) and only compounds were 705 chosen that were also represented in the plant-centric KNApSAcK database (Afendi et 706 al., 2012), 707 708 Identification of BAHD acyltransferases and OG assignment

709 For identification of BAHD acyltransferases from the analyzed genomes, we used 710 hmmsearch v3.1b2 (Potter et al., 2018) using the BAHD PFAM domain (PF02458) with 711 all default parameters except cut_ga as the hit significance threshold. OGs were 712 constructed using OrthoFinder v2.3.3 (Emms and Kelly, 2019) with default parameters 713 except an inflation parameter of 1.5 to make larger OGs. After defining OGs between 714 these species, we used blastp (Camacho et al., 2009) to assign biochemically 715 characterized enzymes to OGs. For each enzyme, its individual phylogenetic 716 conservation was determined based on the phylogenetic spread of its assigned OG (File 717 S4). An internal node in the species tree was assigned an activity if multiple characterized 718 enzymes shared their conservation up to that node. 719 720 Creating a time-calibrated species phylogeny for ancestral state reconstruction

721 While recent attempts to infer a well-sampled land plant phylogeny (Gitzendanner 722 et al. 2018) and estimate divergence times (Nie et al. 2019) of green plants exist, a time 723 calibrated phylogeny encompassing the breath of taxa included in our dataset does not. 724 In order to obtain one, we first obtained a time calibrated phylogeny from TimeTree, a 725 database of synthesized time calibrated studies (Kumar et al. 2017). Because not all taxa 726 were present in TimeTree we used ‘proxy taxa’ (closest relative represented in TimeTree) 727 to assign a position within the phylogenetic tree. (File S7A). Using this approach, we 728 accounted for all taxa in our database with the exception of Klebsormidium nitens 729 (charophytic algae), which was manually added to the most likely position according to 730 (Leliaert et al., 2012). To obtain divergence time for this group, we recalibrated the 731 phylogeny using a penalized likelihood under a relaxed clock model (Sanderson, 2002),

31 bioRxiv preprint doi: https://doi.org/10.1101/2020.11.18.385815; this version posted November 20, 2020. The copyright holder for this preprint (which was not certified by peer review) is the author/funder. All rights reserved. No reuse allowed without permission.

732 a lambda=0 and 95% CI intervals for major clades, inferred from previous studies 733 (Magallón et al., 2015; Nie et al., 2020) (File S7B), with the function chronos() in R 734 package ape v.5.4 (Sanderson, 2002; Paradis and Schliep, 2019). 735 736 BAHD family size evolution

737 In order to determine the expansion dynamics of the BAHD gene family, we 738 modeled the evolution of normalized BAHD gene counts. Counts were normalized against 739 predicted total number of coding sequences in each genome with a methionine start 740 residue that were longer than 100bp. If >30% of the gene models did not fit these criteria, 741 these genomes (9 gymnosperm, 2 red algae) were eliminated from further analyses. We 742 fitted normalized counts and our phylogeny using Evolutionary Brownian Motion (BM) and 743 Bounded Brownian Motion (BBM) type models and performed model selection using the 744 R package BBMV v2.1 with default parameters except those specified below (Boucher et 745 al. 2016). BBM is a special case of Brownian motion (BM) where values are constrained 746 between a minimum and a maximum value (Boucher et al. 2016). We used a minimum 747 bound of 0, as negative gene copy is biologically nonsensical, and a maximum bound of 748 0.02914. It was suggested that the maximum bound should be set to the largest value in 749 the dataset (in our data set Petunia axillaris: 0.00679) (Boucher et al. 2016). However, 750 this value is value may not realistically represent the upper bound of the gene count for 751 an existing gene family. Therefore, we used Arabidopsis thaliana, the best annotated 752 plant genome, to identify the largest gene family present, which was the EAR repressome 753 family with 403 members (https://www.arabidopsis.org/browse/genefamily/index.jsp; 754 accessed August 20, 2020). We normalized this value against the total number of gene 755 in the Arabidopsis genome (https://www.arabidopsis.org/browse/genefamily/index.jsp; 756 accessed August 20, 2020) and set the upper bound of the model at 2x the normalized 757 gene number in this family (upper normalized limit = 0.02914). We acknowledge the 758 potential existence of gene families in nature that are larger but assume that this limit 759 should properly account for a majority of potential gene families. 760 761 Plant material, RNA extraction and cDNA synthesis

32 bioRxiv preprint doi: https://doi.org/10.1101/2020.11.18.385815; this version posted November 20, 2020. The copyright holder for this preprint (which was not certified by peer review) is the author/funder. All rights reserved. No reuse allowed without permission.

762 Plant material from the cultivated tomato variety M82 was used for cloning tomato 763 BAHDs. Plants were grown in a growth chamber under constant light/dark (16 h/8 h) 764 regime at 24 ºC for 8 weeks until first flowers appeared. For RNA extraction, young leaves 765 were cut from a single plant using clean tweezers and scalpel, immediately flash frozen 766 using liquid nitrogen (liq. N2) and stored at -80 ºC until further use. Total RNA was 767 extracted using the E.Z.N.A Plant RNA Kit (Omega Bio-tek, Norcross, GA) as per 768 manufacturers protocol with on-column DNAse digestion. cDNA was synthesized using 769 the Protoscript II Reverse Transcriptase (New England Biolabs, Ipswich, MA [NEB]) with

770 Oligo-dT17 primer (Table S3) at 45 ºC for one hour. After heat inactivation for 20 minutes 771 at 80 ºC, the reaction mix was diluted with four volumes of nuclease-free water and stored 772 at -20 ºC until further use. 773

774 Amplification of candidate enzymes, cloning of expression constructs, and site- 775 specific mutagenesis

776 For amplifying cDNA sequences of candidate BAHD enzymes for cloning, the Q5 777 Hot Start High Fidelity DNA Polymerase (NEB) with gene specific primers was used 778 (Table S3). To allow fast and easy cloning using the Gibson assembly, the primers 779 contained matching overlaps to the pET28b vector, with successful insertion resulting in 780 N-terminal fusion of the candidate enzyme with a 6x His tag. After successful 781 amplification, the PCR product was purified using the E.Z.N.A Cycle Pure Kit (Omega 782 Bio-tek, Norcross, GA) and eluted in 30 µl nuclease-free water. First, the pET28b vector 783 was linearized using BamHI and XhoI restriction enzymes (NEB) and purified using the 784 E.Z.N.A Cycle Pure Kit. Second, 50 ng of linearized vector was mixed with 100 ng of 785 purified PCR product and incubated with HiFi DNA Assembly Master Mix (NEB) according 786 the manufacturers protocol. After assembly, 3 µl of the reaction mix were used for 787 transformation of E. coli 10-beta (NEB) cells. The transformation mix was plated on Luria- 788 Bertani (LB) medium containing kanamycin (50 µg/ml) and streptomycin (50 µg/ml). 789 Grown colonies were screened using colony PCR with construct-specific primers. Positive 790 clones were confirmed using Sanger sequencing at the Cornell Institute of Biotechnology. 791 In case of Dm3MAT3, the full-length gene was codon-optimized, synthesized and cloned

33 bioRxiv preprint doi: https://doi.org/10.1101/2020.11.18.385815; this version posted November 20, 2020. The copyright holder for this preprint (which was not certified by peer review) is the author/funder. All rights reserved. No reuse allowed without permission.

792 into pET28b by Gene Universal (Newark, DE). For cloning the C. braunii BAHD, the C. 793 braunii genome sequence (Nishiyama et al., 2018) was used. Previous studies postulated 794 presence of a BAHD orthologous to HCT potentially involved in a progenitor of lignin 795 biosynthesis (de Vries et al., 2017; Renault et al., 2019) however, no experimentally 796 characterized functions are available. We chose two out of four C. braunii BAHD enzymes 797 (PFAM: PF02458) that contained an intact catalytic HxxxD motif. The gene was 798 synthesized in two overlapping (42 bp overlap) parts (gBLOCKS) (Integrated DNA 799 Technologies, Coralville, IA [IDT]) and assembled into the pET28b vector as described 800 above. All constructs were sequenced before transformation into E. coli Rosetta2 cells 801 (EMD-Millipore-Sigma, Burlington, MA) for heterologous expression. Site-specific 802 mutagenesis of Dm3MAT3 was conducted using the Q5 site-directed mutagenesis kit 803 (NEB) (Table S3). 804 805 Heterologous expression and protein purification

806 Protein expression was induced in mid-log phase growing E. coli cells containing 807 the respective expression construct after addition of 0.5 mM isopropyl-β-D- 808 thiogalactopyranoside (IPTG). The cultures (300 ml) were incubated for 16 hours at 25°C 809 in LB medium supplemented with 50 µg/ml kanamycin and 50 µg/ml chloramphenicol 810 while shaking at 250 rpm. For protein extraction, the overnight grown cells were pelleted 811 by centrifugation for 15 minutes at 5000g and re-suspended in lysis buffer (50 mM 812 NaH2PO4, 300 mM NaCl, 10 mM imidazole, pH 8.0), to which lysozyme was added 813 (~1 mg/ml) and incubated for 1 hour at 4°C. Subsequent sonification (intensity 90%, 814 Lawson Scientific, Harrogate, United Kingdom) for 10 minutes was conducted to shear 815 remaining intact cells. After centrifugation for 30 min at 21,000 g to remove cell debris 816 and insoluble proteins the cell-free lysate was incubated with Ni-NTA-Agarose matrix 817 (Qiagen, Germantown, MD [Qiagen]) for 30 min. After removing the lysate, the matrix was 818 washed with 10 column volumes (cv) wash buffer (50 mM NaH2PO4, 300 mM NaCl, 819 20 mM imidazole, pH 8.0) and then added to a 2 ml spin column (BioRad, Hercules, CA) 820 equipped with a frit. The matrix was washed again with 5 cv wash buffer after which 821 proteins were eluted three to four times using one cv elution buffer (50 mM NaH2PO4, 822 50 mM NaCl, 250 mM imidazole, pH 8.0). Fractions with similar protein content were

34 bioRxiv preprint doi: https://doi.org/10.1101/2020.11.18.385815; this version posted November 20, 2020. The copyright holder for this preprint (which was not certified by peer review) is the author/funder. All rights reserved. No reuse allowed without permission.

823 combined and the protein concentration was determined in triplicate using the Bradford 824 method (Bradford, 1976). 825 826 Size exclusion chromatography 827 Protein was expressed from E. coli BL21 grown at 37°C with 50 μg/mL kanamycin

828 to select for desired cells. When A600 values reached approximately 0.4, cells were 829 induced with 0.1 M IPTG, cooled to 15°C, and incubated with shaking for 18 hours. Cells 830 were then pelleted with centrifugation, supernatant discarded, and cell pellets frozen at - 831 80°C until ready for next steps. Cell pellets were thawed on ice, then resuspended in lysis 832 buffer (50 mM tris pH 8, 20 mM imidazole, 500 mM NaCl, 10% glycerol, 1% Tween-20), 833 and lysed by sonication. Lysate was centrifuged to pellet debris, and the supernatant was 834 passed through 2 mL of Ni-NTA resin. Resin was washed with buffer (50 mM Tris pH 8, 835 20 mM imidazole, 500 mM NaCl, 10% glycerol), then protein eluted in a single fraction 836 (50 mM Tris pH 8, 250 mM imidazole, 500 mM NaCl, 10% glycerol). To the fraction 837 containing desired protein, 30 U of thrombin was added, the entire solution was 838 transferred to dialysis tubing, and dialyzed overnight in 1 L of wash buffer. The resulting 839 solution was removed from dialysis tubing and passed through a column containing 300 840 μL Ni-NTA resin and 200 μL Benzamidine-sepharose resin. The flowthrough was 841 collected and further purified by FPLC size-exclusion chromatography (Hi-Load 26/600 842 S-200 column, buffer contained 100 mM NaCl, 25 mM HEPES, pH 7.5). 843 844 Biochemical synthesis of p-coumaroyl-CoA and feruloyl-CoA

845 For enzyme assays using p-coumaroyl-CoA and feruloyl-CoA as acyl donor, the 846 donor was synthesized biochemically using 4-coumaroyl-CoA ligase (4CL) from tomato 847 as described previously (Beuerle and Pichersky, 2002). The cDNA of tomato 4CL was 848 amplified using gene specific primers (Table S3), cloned into pET28b, heterologously 849 expressed, and purified as described above. To generate the CoAs, 5 mM MgCl2, 2 mM 850 ATP, 2 mM p-coumaric acid (TCI America, Portland, OR) or ferulic acid (MP Biomedicals, 851 Solon, OH), and 3 mM coenzyme A (MP Biomedicals) in 50 mM sodium phosphate buffer 852 (pH 8.0) were incubated for 24 hours at room temperature (Beuerle and Pichersky, 2002). 853 The reaction was stopped by heating the reaction mix to 70 ºC for 20 min. After

35 bioRxiv preprint doi: https://doi.org/10.1101/2020.11.18.385815; this version posted November 20, 2020. The copyright holder for this preprint (which was not certified by peer review) is the author/funder. All rights reserved. No reuse allowed without permission.

854 centrifugation at 21,000 g for 30 min to remove precipitated protein the supernatant was 855 transferred into a new reaction tube and stored at -20 ºC until further use. The final 856 concentration of activated donor was estimated to be 1.6 mM based on the initial 857 substrate concentrations and an assumed conversion rate of 80% (Beuerle and 858 Pichersky, 2002). 859 860 Enzyme assays

861 In general, enzyme assays used for screening the substrate promiscuity of 862 selected BAHD enzymes were performed in 50 µl reactions containing 50 mM sodium 863 phosphate buffer (pH 7.2), supplemented with 100 µM acceptor substrate, and 300 µM 864 donor substrate. The assay was started by the addition of 20 µg purified enzyme. 865 Preliminary enzyme assays with lower substrate concentrations did not show any 866 indications for substrate inhibition at such substrate concentrations. For each enzyme, 867 three replicates per substrate were performed and incubated for 1 hour. Reactions were 868 stopped by adding 100 µl of a mixture of isopropanol, acetonitrile, and water (ratio of 2:2:1 869 + 0.1% (v/v) formic acid) containing 15 µM of the internal standard telmisartan. The 870 reaction mix was centrifuged for 10 min at 21,000 g to remove precipitated proteins, 871 transferred into LC vials, and stored at -20 ºC until LC-MS analysis. Mock controls using 872 purified protein extracts from empty vector transformed E. coli were run to exclude E. coli 873 background activity, for each of the used acceptor and donor combinations. 874 To test whether SlACT, CbHCT, and MeHFT can use additional substrates from 875 the aromatic alcohol, aliphatic and aromatic amine class not captured using 100 uM of 876 substrate, a modified version with higher substrate concentrations were used (assay 877 version 2). A 50 µl reaction containing 50 mM sodium phosphate buffer (pH 7.2), 1 mM 878 acceptor substrate, 300 µM coumaroyl-CoA was started using 20 µg of the respective 879 enzyme, incubated for 1 hour, stopped, and subsequently run on LC-MS as described 880 above. 881 Enzyme assay reactions for screening for enzyme activities were measured 882 individually on the LC-MS and each product was detected with specific PRM parameters 883 (see below). In order to determine more detailed enzyme kinetics for anthocyanin 884 acylating enzymes, a modified version of the above described enzyme assays was used

36 bioRxiv preprint doi: https://doi.org/10.1101/2020.11.18.385815; this version posted November 20, 2020. The copyright holder for this preprint (which was not certified by peer review) is the author/funder. All rights reserved. No reuse allowed without permission.

885 (assay version 3). Varied concentrations of cyanidin-3-O-glucoside (25, 50, 100, 200, 886 300 µM) and malonyl-CoA (25, 50, 100, 200, 300 µM) were used to determine enzyme 887 kinetics. The counter substrate was kept at a saturating concentration of 300 µM. Two 888 biological replicates (independent enzyme expression and purification) were used and 889 Km, Kcat and Vmax were determined using non-linear curve fitting in Prism 8 (GraphPad, 890 San Diego, CA). All enzyme reactions were measured under initial rate conditions and 891 stopped as described above. The wildtype enzyme reactions were incubated for 10 892 minutes and mutant reactions for 20 and 30 minutes for C320A and W36A variants, 893 respectively. 894 895 LC-MS measurements

896 LC-MS analysis was performed on a ThermoScientific Dionex Ultimate 3000 HPLC 897 equipped with an autosampler coupled to a ThermoScientific Q-Exactive HF Orbitrap 898 mass spectrometer using solvent A (water + formic acid (0.1% v/v)) and solvent B 899 (acetonitrile + formic acid (0.1%)) at a flow rate of 0.6 ml/min. Products of enzyme 900 reactions were detected with specific PRM methods using their predicted parent ion mass 901 in positive or negative ionization mode with an isolation window of 2 m/z (Table S4). 902 Additional details of chromatographic and mass spectrometric methods are described in 903 Table S4 and S5. LC-MS data was analyzed with the ThermoScientific Dionex 904 Chromeleon 7 Chromatography Data System v7.2 software. Peaks were selected using 905 their specific masses (Table S4) and default peak detection parameters. 906 907 Phylogenetic analysis

908 Protein sequence alignment was generated using MAFFT v.7.453-with-extensions 909 (Katoh et al., 2002) using following parameters: --maxiterate 1000 --genafpair --thread 910 70. The alignment was inspected manually to ensure proper alignment e.g. by inspecting 911 that known motifs like the HxxxD and DFGWG motif are aligned properly. Afterwards, IQ- 912 Tree v.1.6.10 (Nguyen et al., 2015) was used to infer a phylogenetic tree using following 913 parameters: -st AA -nt AUTO -ntmax 70 -b 1000 -m TEST after model selection

37 bioRxiv preprint doi: https://doi.org/10.1101/2020.11.18.385815; this version posted November 20, 2020. The copyright holder for this preprint (which was not certified by peer review) is the author/funder. All rights reserved. No reuse allowed without permission.

914 (LG+F+G4) using ModelFinder (Kalyaanamoorthy et al., 2017). Tree visualization was 915 created using iTol v.5.6.2 (Letunic and Bork, 2019). 916 917 Identification of enriched motifs in anthocyanin acylating enzyme

918 For identifying enriched motifs in a specific clade of anthocyanin acylating 919 enzymes, we used MEME v.5.0.5 (Bailey et al., 2009) in discriminative mode using default 920 parameters but the maximum number of motifs to find set to 5. Positive and negative 921 examples were set as described in Fig. S5. The TFFDxxW and YFGNC sub-motifs were 922 selected for further analysis due to their high degree of conservation and their proximity 923 to the active site within the Dm3MAT3 protein. Clade-wise single residues were identified 924 using custom Python scripts. 925 926 Prediction of ancestral sequence of AnATs

927 Ancestral sequence reconstruction was performed using IQ-TREE v1.6.10 928 (Nguyen et al., 2015). Twenty randomly selected sequences from each of the three 929 orthologous groups representing clades 1a-c and 5a (outgroup) were combined together 930 with previously characterized BAHDs from these clades. All protein sequences were 931 aligned using MAFFT v7.453 and provided as input to IQ-TREE, which was run with 932 model selection and ancestral state reconstruction with 1000 standard bootstraps. The 933 optimal tree was obtained using the JTT+I+G4 model. Per-site posterior probabilities of 934 the ancestral state prediction were filtered using a threshold of 0.95, and the resultant 935 FASTA sequence at each ancestral node was extracted using a custom Python script. 936 937 Preparation of PDB structures for docking and molecular simulations

938 The holo structure of Dm3MaT3 bound to malonyl-CoA (MLC), the acyl-donor, was 939 retrieved from the Protein Data Bank (PDB: 2E1T) (Berman et al., 2000; Unno et al., 940 2007).After treatment with the PROPKA-plugin in VMD to verify residue charge states at 941 pH 7.0, (Humphrey et al., 1996; Rostkowski et al., 2011) holo-Dm3MaT3 was then 942 submitted to the Solution Builder Input Generator in CHARMM-GUI (Jo et al., 2008).

38 bioRxiv preprint doi: https://doi.org/10.1101/2020.11.18.385815; this version posted November 20, 2020. The copyright holder for this preprint (which was not certified by peer review) is the author/funder. All rights reserved. No reuse allowed without permission.

943 Because 2E1T was crystallized as a dimer, only segment “A” of the protein was input to 944 Solution Builder. The N- and C-terminal residues were modeled and patched using the 945 ACE and CT3 terminal groupings, respectively. For the W36A and C320A Dm3MaT3 946 mutants, the respective point mutations were also made during pdb structure 947 manipulation. Resulting Dm3MaT3 models were solvated with 150 mM NaCl, neutralized, 948 and output in Amber format. PyMol 2.3.3 was then used to perform structural alignment 949 between the Dm3MaT3 models and the original 2E1T structure containing MLC so that 950 the donor molecule could be introduced in the bound pose to each Dm3MaT3 model 951 (Schrödinger, LLC, 2015). Apo simulations were prepared in a similar fashion but from 952 the 2E1U PDB file (Unno et al., 2007). 953 The MLC structure file was taken directly from the 2E1T PDB file and edited in the 954 Maestro 2017-3 Release for improved structural resolution by adding hydrogens not seen 955 in the crystal structure and revising charge states at pH 7.0 (Schrödinger, LLC, 2020). 956 Cyanidin 3-O-glucoside (C3G), the acyl-acceptor, was also edited in Maestro to reflect an 957 accurate charge state at pH 7.0 (Schrödinger, LLC, 2020). Both ligands were introduced 958 to antechamber and parameterized with the AM1-BCC charge model (Jakalian et al., 959 2002). At pH 7.0, MLC bears a net charge of -5 while C3G has a net charge of 0, although 960 it is zwitterionic due to its oxonium moiety. 961 962 Docking of acyl acceptor into donor-containing Dm3MaT3 structures

963 Holo-Dm3MaT3 was converted into a receptor pdbqt file for docking via AutoDock4 964 command-line (Morris et al., 1998). The box for docking C3G into each holo Dm3MaT3 965 variant (wild-type, WT; and mutants W36A and C320A) was determined in VMD 966 (Humphrey et al., 1996). Autodock Vina v1.1.2 was then used for docking. A docking 967 procedure was then performed using the previously determined box size and an 968 exhaustiveness score of 8 (Trott and Olson, 2010). A low exhaustiveness score was used 969 to obtain greater diversity of bound poses. This procedure was repeated 30 times in order 970 to generate a greater number of different starting seeds for C3G, where bound poses for 971 each iteration were evaluated based on the proximity of the reactive cyanidin 3-O- 972 glucoside 6”-hydroxyl to be ≤ 4.0 Å from the thioate moiety of MLC (Unno et al., 2007),

39 bioRxiv preprint doi: https://doi.org/10.1101/2020.11.18.385815; this version posted November 20, 2020. The copyright holder for this preprint (which was not certified by peer review) is the author/funder. All rights reserved. No reuse allowed without permission.

973 as proximity between the two ligands would serve as a proxy for an intermediate step 974 occurring within the reaction. 975 From this docking procedure, 268 C3G poses were generated for WT Dm3MaT3, 976 270 poses for W36A Dm3MaT3, and 261 poses for C320A Dm3MaT3. Regardless of the 977 orientation of the docked C3G, the pose selected for MD system assembly was that which 978 had the most favorable energy among those with the shortest distance (less than or equal 979 to 4 Å) from the MLC thioate. The C3G poses selected for simulation had docking scores 980 of -5.8 kcal/mol (WT), -7.6 kcal/mol (W36A), and -6.4 kcal/mol (C320A) (Fig. S10). 981 982 Molecular simulation setup

983 Each Dm3MaT3 system (WT, W36A, C320A) was then reassembled using the 984 holo-aligned protein and MLC structures, the AutoDock Vina output, 150 mM NaCl, and 985 ~18,500 water molecules in Packmol 18.169 (Martínez et al., 2009). Parameterization 986 and periodic box conditions were then applied using tleap in Amber18 (Case et al., 2018). 987 All ligands were parameterized with GAFF2 (Wang et al., 2004), Dm3MaT3 variants with 988 the AMBER-FB15 (Wang et al., 2017), and water with the TIP3PFB forcefields (L.-P. 989 Wang et al., 2014), respectively. Ions were parameterized using the 2008 parameter set 990 developed Joung and Cheatham (Joung and Cheatham, 2008). Hydrogen mass 991 repartitioning (Hopkins et al., 2015) was then applied to the resulting files in ParmEd 3.2.0 992 (Case et al., 2018). Apo systems were prepared in an identical fashion. 993 The following conditions were then applied to all Dm3MaT3 systems during 994 initialization stages. Minimization was performed for 50000 cycles, where steepest 995 descent was used for the first 5000 and then conjugate gradient for the remaining 45000 996 cycles. Each system was heated from 0 to 300 K in the NVT ensemble for 5 ns. The 997 systems were then held at 300 K for 5 ns at NPT. A Berendsen thermostat and barostat 998 were used throughout heating and equilibration stages for efficiency (Braun et al., 2018), 999 where the pressure was maintained at 1 bar using isotropic scaling and temperature at 1000 300 K (Berendsen et al., 1984). Each Dm3MaT3 variant and the bound ligands were 1001 restrained during the heating simulation. Restraints were removed during the 50 ns 1002 equilibration. The SHAKE algorithm was applied to all stages of initialization except for 1003 minimization (Krautler et al., 2001), while the Particle Mesh Ewald method used for

40 bioRxiv preprint doi: https://doi.org/10.1101/2020.11.18.385815; this version posted November 20, 2020. The copyright holder for this preprint (which was not certified by peer review) is the author/funder. All rights reserved. No reuse allowed without permission.

1004 treating long-range electrostatics at a 10 Å cutoff (Darden et al., 1993). A Langevin 1005 thermostat was implemented for temperature maintenance and a Monte Carlo barostat 1006 was implemented for pressure maintenance in the production runs (Loncharich et al., 1007 1992; Åqvist et al., 2004). Simulations were performed for a total of 1 μs for each of the 1008 six systems (holo and apo versions of Dm3MaT3 WT, W36A, and C320A). 1009 1010 Data analysis

1011 Trajectories were visualized using VMD 1.9.3 whereas images were rendered 1012 using Chimera 1.14 (Humphrey et al., 1996; Pettersen et al., 2004). Distance 1013 measurements between atoms were conducted using MDTraj 1.9.3 (McGibbon et al., 1014 2015). Residue-residue face-to-face and edge-to-face stacking interactions were 1015 determined using a script which was adapted from a previously reported analysis 1016 (Ferreira de Freitas and Schapira, 2017). Briefly, the plane of an aromatic residue’s pi 1017 system was determined using the same atoms as in GetContacts (GetContacts, 2020). 1018 The normal vector was then determined for each aromatic plane under inspection, where 1019 the intersection between the two vectors was solved for. Solving for the angle between 1020 the center of mass of one aromatic ring, the center of mass of another aromatic, and the 1021 intersection of the rings’ normal vectors, allowed for the supplementary angle, θ, to be 1022 determined. Angle θ and distance cutoffs were then applied to determine the extent of 1023 aromatic stacking (Ferreira de Freitas and Schapira, 2017; “Schrödinger – Knowledge 1024 Base.,” 2020), where exact stacking classifications are detailed in Supplementary 1025 Information. All graphs were generated using Matplotlib 3.2.0 (Hunter, 2007). 1026

41 bioRxiv preprint doi: https://doi.org/10.1101/2020.11.18.385815; this version posted November 20, 2020. The copyright holder for this preprint (which was not certified by peer review) is the author/funder. All rights reserved. No reuse allowed without permission.

1027 ACKNOWLEDGEMENTS

1028 We thank Dr. John D’Auria, Dr. Toru Nakayama and Dr. Sangeeta Dhaubhadel for 1029 providing BAHD constructs, Dr. Bennett Fox and Dr. Frank Schroeder for use of and 1030 assistance with the LC-MS experiments. We thank Dr. Thomas Stegemann for support in 1031 LC-MS method establishment, Elizabeth Mahood and Dr. Nicholas Santantonio for 1032 support in establishing the substrate similarity pipeline, Dr. Hening Lin for helpful advice 1033 regarding our biochemical experiments, Dr. Elisabeth Kaltenegger for helpful comments 1034 on the manuscript, and Anna-Lena Sprick and Dr. Kai Fan for support in the laboratory. 1035 We thank Dr. Florian Boucher for assistance with interpreting BBMV R package output. 1036 1037 COMPETING INTEREST

1038 The authors declare that the research was conducted in the absence of any commercial 1039 or financial relationship that could be construed as a potential conflict of interest. 1040 1041 FUNDING INFORMATION

1042 This work was supported by the following funding sources: 1043 • LK/GM: Deutsche Forschungsgemeinschaft award #411255989 (LK); Cornell startup 1044 funds (GM) 1045 • JMG/CS: NSF award #DGE-1650441 1046 • JC: NSF REU award #DBI-1850796 to the Boyce Thompson Institute/Georg Jander 1047 • AW/DS: Blue Waters sustained-petascale computing project (NSF awards OCI- 1048 0725070 and ACI-1238993, the State of Illinois, and the National Geospatial- 1049 Intelligence Agency). 1050

42 bioRxiv preprint doi: https://doi.org/10.1101/2020.11.18.385815; this version posted November 20, 2020. The copyright holder for this preprint (which was not certified by peer review) is the author/funder. All rights reserved. No reuse allowed without permission.

1051 REFERENCES

1052 Afendi FM, Okada T, Yamazaki M, Hirai-Morita A, Nakamura Y, Nakamura K, Ikeda S, 1053 Takahashi H, Altaf-Ul-Amin M, Darusman LK, Saito K, Kanaya S. 2012. 1054 KNApSAcK Family Databases: Integrated Metabolite–Plant Species Databases 1055 for Multifaceted Plant Research. Plant Cell Physiol 53:e1–e1. 1056 doi:10.1093/pcp/pcr165 1057 Aharoni A, Gaidukov L, Khersonsky O, Gould SM, Roodveldt C, Tawfik DS. 2005. The 1058 “evolvability” of promiscuous protein functions. Nat Genet 37:73–76. 1059 doi:10.1038/ng1482 1060 Aharoni A, Keizer LC, Bouwmeester HJ, Sun Z, Alvarez-Huerta M, Verhoeven HA, Blaas 1061 J, van Houwelingen AM, De Vos RC, van der Voet H. 2000. Identification of the 1062 SAAT gene involved in strawberry flavor biogenesis by use of DNA microarrays. 1063 Plant Cell 12:647–661. 1064 Åqvist J, Wennerström P, Nervall M, Bjelic S, Brandsdal BO. 2004. Molecular dynamics 1065 simulations of water and biomolecules with a Monte Carlo constant pressure 1066 algorithm. Chem Phys Lett 384:288–294. doi:10.1016/j.cplett.2003.12.039 1067 Bailey TL, Boden M, Buske FA, Frith M, Grant CE, Clementi L, Ren J, Li WW, Noble WS. 1068 2009. MEME Suite: tools for motif discovery and searching. Nucleic Acids Res 1069 37:W202–W208. doi:10.1093/nar/gkp335 1070 Bar-Even A, Noor E, Savir Y, Liebermeister W, Davidi D, Tawfik DS, Milo R. 2011. The 1071 Moderately Efficient Enzyme: Evolutionary and Physicochemical Trends Shaping 1072 Enzyme Parameters. Biochemistry 50:4402–4410. doi:10.1021/bi2002289 1073 Berendsen HJC, Postma JPM, van Gunsteren WF, DiNola A, Haak JR. 1984. Molecular 1074 dynamics with coupling to an external bath. J Chem Phys 81:3684–3690. 1075 doi:10.1063/1.448118 1076 Berman HM, Westbrook J, Feng Z, Gilliland G, Bhat TN, Weissig H, Shindyalov IN, 1077 Bourne PE. 2000. The Protein Data Bank. Nucleic Acids Res 28:235–242. 1078 doi:10.1093/nar/28.1.235 1079 Beuerle T, Pichersky E. 2002. Enzymatic Synthesis and Purification of Aromatic 1080 Coenzyme A Esters. Anal Biochem 302:305–312. doi:10.1006/abio.2001.5574 1081 Bloom JD, Labthavikul ST, Otey CR, Arnold FH. 2006. Protein stability promotes 1082 evolvability. Proc Natl Acad Sci 103:5869–5874. doi:10.1073/pnas.0510098103 1083 Blount ZD, Borland CZ, Lenski RE. 2008. Historical contingency and the evolution of a 1084 key innovation in an experimental population of Escherichia coli. Proc Natl Acad 1085 Sci 105:7899–7906. doi:10.1073/pnas.0803151105 1086 Boucher FC, Démery V. 2016. Inferring Bounded Evolution in Phenotypic Characters from 1087 Phylogenetic Comparative Data. Syst Biol 65:651–661. 1088 doi:10.1093/sysbio/syw015

43 bioRxiv preprint doi: https://doi.org/10.1101/2020.11.18.385815; this version posted November 20, 2020. The copyright holder for this preprint (which was not certified by peer review) is the author/funder. All rights reserved. No reuse allowed without permission.

1089 Bradford MM. 1976. A rapid and sensitive method for the quantitation of microgram 1090 quantities of protein utilizing the principle of protein-dye binding. Anal Biochem 1091 72:248–254. doi:10.1016/0003-2697(76)90527-3 1092 Braun E, Gilmer J, Mayes HB, Mobley DL, Monroe JI, Prasad S, Zuckerman DM. 2018. 1093 Best Practices for Foundations in Molecular Simulations [Article v1.0]. Living J 1094 Comput Mol Sci 1:5957. doi:10.33011/livecoms.1.1.5957 1095 Camacho C, Coulouris G, Avagyan V, Ma N, Papadopoulos J, Bealer K, Madden TL. 1096 2009. BLAST+: architecture and applications. BMC Bioinformatics 10:421. 1097 doi:10.1186/1471-2105-10-421 1098 Cao Y, Charisi A, Cheng L-C, Jiang T, Girke T. 2008. ChemmineR: a compound mining 1099 framework for R. Bioinformatics 24:1733–1734. doi:10.1093/bioinformatics/btn307 1100 Case DA, Ben-Shalom IY, Brozell SR, Cerutti DS, Cheatham TEI, Cruziero VWD, Darden 1101 TA, Duke RE, Ghoreishi D, Gilson MK, Gohlke H, Goetz AW, Greene D, Harris R, 1102 Homeyer N, Izadi S, Kovalenko A, Kurtzman T, Lee T-S, LeGrand S, Li P, Lin C, 1103 Liu J, Luchko T, Luo R, Mermelstein DJ, Merz KM, Miao Y, Monard G, Nguyen C, 1104 Nguyen H, Omelyan I, Onufriev A, Pan F, Qi R, Roe DR, Roitberg A, Sagui C, 1105 Schott-Verdugo S, Shen J, Simmerling CL, Smith J, Salomon-Ferrer R, Swails J, 1106 Walker RC, Wang J, Wei H, Wolf RM, Wu X, Xiao L, York DM, Kollman PA. 2018. 1107 AMBER. San Francisco, CA: University of California, San Francisco. 1108 Cheng S, Xian W, Fu Y, Marin B, Keller J, Wu T, Sun W, Li X, Xu Y, Zhang Y, Wittek S, 1109 Reder T, Günther G, Gontcharov A, Wang S, Li L, Liu X, Wang J, Yang H, Xu X, 1110 Delaux P-M, Melkonian B, Wong GK-S, Melkonian M. 2019. Genomes of Subaerial 1111 Zygnematophyceae Provide Insights into Land Plant Evolution. Cell 179:1057- 1112 1067.e14. doi:10.1016/j.cell.2019.10.019 1113 Chiang Y-C, Levsh O, Kei Lam C, Weng J-K, Wang Y. 2018a. Active Site Dynamics and 1114 Substrate Permissiveness of Hydroxylcinnamoyltransferase (HCT). Biophys J 1115 114:583a–584a. doi:10.1016/j.bpj.2017.11.3193 1116 Chiang Y-C, Levsh O, Lam CK, Weng J-K, Wang Y. 2018b. Structural and dynamic basis 1117 of substrate permissiveness in hydroxycinnamoyltransferase (HCT). PLOS 1118 Comput Biol 14:e1006511. doi:10.1371/journal.pcbi.1006511 1119 Copley SD. 2015. An evolutionary biochemist’s perspective on promiscuity. Trends 1120 Biochem Sci 40:72–78. doi:10.1016/j.tibs.2014.12.004 1121 Darden T, York D, Pedersen L. 1993. Particle mesh Ewald: An N⋅log(N) method for Ewald 1122 sums in large systems. J Chem Phys 98:10089–10092. doi:10.1063/1.464397 1123 D’Auria JC. 2006. Acyltransferases in plants: a good time to be BAHD. Curr Opin Plant 1124 Biol 9:331–340. doi:10.1016/j.pbi.2006.03.016 1125 Davies KM, Jibran R, Zhou Y, Albert NW, Brummell DA, Jordan BR, Bowman JL, Schwinn 1126 KE. 2020. The Evolution of Flavonoid Biosynthesis: A Bryophyte Perspective. 1127 Front Plant Sci 11:7. doi:10.3389/fpls.2020.00007

44 bioRxiv preprint doi: https://doi.org/10.1101/2020.11.18.385815; this version posted November 20, 2020. The copyright holder for this preprint (which was not certified by peer review) is the author/funder. All rights reserved. No reuse allowed without permission.

1128 de Vries J, de Vries S, Slamovits CH, Rose LE, Archibald JM. 2017. How Embryophytic 1129 is the Biosynthesis of Phenylpropanoids and their Derivatives in Streptophyte 1130 Algae? Plant Cell Physiol 58:934–945. doi:10.1093/pcp/pcx037 1131 Donoghue P, Paps J. 2020. Plant Evolution: Assembling Land Plants. Curr Biol 30:R81– 1132 R83. doi:10.1016/j.cub.2019.11.084 1133 Dudareva N, D’Auria JC, Nam KH, Raguso RA, Pichersky E. 1998. Acetyl- 1134 CoA:benzylalcohol acetyltransferase – an enzyme involved in floral scent 1135 production in Clarkia breweri. Plant J 14:297–304. doi:10.1046/j.1365- 1136 313X.1998.00121.x 1137 Emms DM, Kelly S. 2019. OrthoFinder: phylogenetic orthology inference for comparative 1138 genomics. bioRxiv 466201. doi:10.1101/466201 1139 Eudes A., Mouille M, Robinson DS, Benites VT, Wang G, Roux L, Tsai YL, Baidoo EE, 1140 Chiu TY, Heazlewood JL, Scheller HV, Mukhopadhyay A, Keasling JD, Deutsch 1141 S, Loque D. 2016. Exploiting members of the BAHD acyltransferase family to 1142 synthesize multiple hydroxycinnamate and benzoate conjugates in yeast. Microb 1143 Cell Fact 15:198. doi:10.1186/s12934-016-0593-5 1144 Eudes Aymerick, Pereira JH, Yogiswara S, Wang G, Teixeira Benites V, Baidoo EEK, 1145 Lee TS, Adams PD, Keasling JD, Loqué D. 2016. Exploiting the Substrate 1146 Promiscuity of Hydroxycinnamoyl-CoA:Shikimate Hydroxycinnamoyl Transferase 1147 to Reduce Lignin. Plant Cell Physiol 57:568–579. doi:10.1093/pcp/pcw016 1148 Fan P, Miller AM, Schilmiller AL, Liu X, Ofner I, Jones AD, Zamir D, Last RL. 2016. In 1149 vitro reconstruction and analysis of evolutionary variation of the tomato 1150 acylsucrose metabolic network. Proc Natl Acad Sci 113:E239–E248. 1151 doi:10.1073/pnas.1517930113 1152 Ferreira de Freitas R, Schapira M. 2017. A systematic analysis of atomic protein–ligand 1153 interactions in the PDB. MedChemComm 8:1970–1981. 1154 doi:10.1039/C7MD00381A 1155 Fujiwara Hiroyuki, Tanaka Y, Fukui Y, Ashikari T, Yamaguchi M, Kusumi T. 1998. 1156 Purification and characterization of anthocyanin 3-aromatic acyltransferase from 1157 Perilla frutescens. Plant Sci 137:87–94. doi:10.1016/S0168-9452(98)00119-8 1158 Fujiwara H, Tanaka Y, Fukui Y, Nakao M, Ashikari T, Kusumi T. 1997. Anthocyanin 5- 1159 aromatic acyltransferase from Gentiana triflora: purification, characterization and 1160 its role in anthocyanin biosynthesis. Eur J Biochem 249:45–51. 1161 Fujiwara H., Tanaka Y, Yonekura-Sakakibara K, Fukuchi-Mizutani M, Nakao M, Fukui Y, 1162 Yamaguchi M, Ashikari T, Kusumi T. 1998. cDNA cloning, gene expression and 1163 subcellular localization of anthocyanin 5-aromatic acyltransferase from Gentiana 1164 triflora. Plant J 16:421–31. doi:10.1046/j.1365-313x.1998.00312.x 1165 Ganko EW, Meyers BC, Vision TJ. 2007. Divergence in Expression between Duplicated 1166 Genes in Arabidopsis. Mol Biol Evol 24:2298–2309. doi:10.1093/molbev/msm158 1167 GetContacts. 2020.

45 bioRxiv preprint doi: https://doi.org/10.1101/2020.11.18.385815; this version posted November 20, 2020. The copyright holder for this preprint (which was not certified by peer review) is the author/funder. All rights reserved. No reuse allowed without permission.

1168 Goulet C, Kamiyoshihara Y, Lam NB, Richard T, Taylor MG, Tieman DM, Klee HJ. 2015. 1169 Divergence in the Enzymatic Activities of a Tomato and Solanum pennellii Alcohol 1170 Acyltransferase Impacts Fruit Volatile Ester Composition. Mol Plant, Plant 1171 Metabolism and Synthetic Biology 8:153–162. doi:10.1016/j.molp.2014.11.007 1172 Harris TK, Mildvan AS. 1999. High-Precision Measurement of Hydrogen Bond Lengths in 1173 Proteins by Nuclear Magnetic Resonance Methods. Proteins Struct Funct 1174 Bioinforma 35:275–282. doi:https://doi.org/10.1002/(SICI)1097- 1175 0134(19990515)35:3<275::AID-PROT1>3.0.CO;2-V 1176 Hastings J, de Matos P, Dekker A, Ennis M, Harsha B, Kale N, Muthukrishnan V, Owen 1177 G, Turner S, Williams M, Steinbeck C. 2013. The ChEBI reference database and 1178 ontology for biologically relevant chemistry: enhancements for 2013. Nucleic Acids 1179 Res 41:D456–D463. doi:10.1093/nar/gks1146 1180 Hopkins CW, Le Grand S, Walker RC, Roitberg AE. 2015. Long-Time-Step Molecular 1181 Dynamics through Hydrogen Mass Repartitioning. J Chem Theory Comput 1182 11:1864–1874. doi:10.1021/ct5010406 1183 Huang R, O’Donnell AJ, Barboline JJ, Barkman TJ. 2016. Convergent evolution of 1184 caffeine in plants by co-option of exapted ancestral enzymes. Proc Natl Acad Sci 1185 113:10613–10618. doi:10.1073/pnas.1602575113 1186 Humphrey W, Dalke A, Schulten K. 1996. VMD: Visual molecular dynamics. J Mol Graph 1187 14:33–38. doi:10.1016/0263-7855(96)00018-5 1188 Hunter JD. 2007. Matplotlib: A 2D Graphics Environment. Comput Sci Eng 9:90–95. 1189 doi:10.1109/MCSE.2007.55 1190 Jakalian A, Jack DB, Bayly CI. 2002. Fast, efficient generation of high-quality atomic 1191 charges. AM1-BCC model: II. Parameterization and validation. J Comput Chem 1192 23:1623–1641. doi:10.1002/jcc.10128 1193 Jensen RA. 1976. Enzyme recruitment in evolution of new function. Annu Rev Microbiol 1194 30:409–425. doi:10.1146/annurev.mi.30.100176.002205 1195 Jo S, Kim T, Iyer VG, Im W. 2008. CHARMM-GUI: A web-based graphical user interface 1196 for CHARMM. J Comput Chem 29:1859–1865. doi:10.1002/jcc.20945 1197 Joung IS, Cheatham TE. 2008. Determination of Alkali and Halide Monovalent Ion 1198 Parameters for Use in Explicitly Solvated Biomolecular Simulations. J Phys Chem 1199 B 112:9020–9041. doi:10.1021/jp8001614 1200 Kalyaanamoorthy S, Minh BQ, Wong TKF, von Haeseler A, Jermiin LS. 2017. 1201 ModelFinder: fast model selection for accurate phylogenetic estimates. Nat 1202 Methods 14:587–589. doi:10.1038/nmeth.4285 1203 Katoh K, Misawa K, Kuma K, Miyata T. 2002. MAFFT: a novel method for rapid multiple 1204 sequence alignment based on fast Fourier transform. Nucleic Acids Res 30:3059– 1205 3066. 1206 Krautler V, van Gunsteren WF, Hunenberger PH. 2001. A fast SHAKE algorithm to solve 1207 distance constraint equations for small molecules in molecular dynamics 1208 simulations. J Comput Chem 22:501–508.

46 bioRxiv preprint doi: https://doi.org/10.1101/2020.11.18.385815; this version posted November 20, 2020. The copyright holder for this preprint (which was not certified by peer review) is the author/funder. All rights reserved. No reuse allowed without permission.

1209 Kreis W, Munkert J. 2019. Exploiting enzyme promiscuity to shape plant specialized 1210 metabolism. J Exp Bot 70:1435–1445. doi:10.1093/jxb/erz025 1211 Kruse LH, Stegemann T, Sievert C, Ober D. 2017. Identification of a Second Site of 1212 Pyrrolizidine Alkaloid Biosynthesis in Comfrey to Boost Plant Defense in Floral 1213 Stage. Plant Physiol 174:47–55. doi:10.1104/pp.17.00265 1214 Leliaert F, Smith DR, Moreau H, Herron MD, Verbruggen H, Delwiche CF, Clerck OD. 1215 2012. Phylogeny and Molecular Evolution of the Green Algae. Crit Rev Plant Sci 1216 31:1–46. doi:10.1080/07352689.2011.615705 1217 Letunic I, Bork P. 2019. Interactive Tree Of Life (iTOL) v4: recent updates and new 1218 developments. Nucleic Acids Res 47:W256–W259. doi:10.1093/nar/gkz239 1219 Levsh O, Chiang Y-C, Tung CF, Noel JP, Wang Y, Weng J-K. 2016. Dynamic 1220 conformational states dictate selectivity toward the native substrate in a substrate- 1221 permissive acyltransferase. Biochemistry 55:6314–6326. 1222 Loncharich RJ, Brooks BR, Pastor RW. 1992. Langevin dynamics of peptides: the 1223 frictional dependence of isomerization rates of N-acetylalanyl-N’-methylamide. 1224 Biopolymers 32:523–535. doi:10.1002/bip.360320508 1225 Magallón S, Gómez-Acevedo S, Sánchez-Reyes LL, Hernández-Hernández T. 2015. A 1226 metacalibrated time-tree documents the early rise of flowering plant phylogenetic 1227 diversity. New Phytol 207:437–453. doi:10.1111/nph.13264 1228 Mahood E, Kruse L, Moghe G. 2020. Machine learning: A powerful tool for gene function 1229 prediction in plants. Appl Plant Sci 8:e11376–e11376. doi:10.1002/aps3.11376 1230 Martínez L, Andrade R, Birgin EG, Martínez JM. 2009. PACKMOL: A package for building 1231 initial configurations for molecular dynamics simulations. J Comput Chem 1232 30:2157–2164. doi:10.1002/jcc.21224 1233 Matsumura I, Ellington AD. 2001. In vitro evolution of beta-glucuronidase into a beta- 1234 galactosidase proceeds through non-specific intermediates. J Mol Biol 305:331– 1235 339. doi:10.1006/jmbi.2000.4259 1236 McGibbon RT, Beauchamp KA, Harrigan MP, Klein C, Swails JM, Hernández CX, 1237 Schwantes CR, Wang L-P, Lane TJ, Pande VS. 2015. MDTraj: A Modern Open 1238 Library for the Analysis of Molecular Dynamics Trajectories. Biophys J 109:1528– 1239 1532. doi:10.1016/j.bpj.2015.08.015 1240 Moghe GD, Hufnagel DE, Tang H, Xiao Y, Dworkin I, Town CD, Conner JK, Shiu S-H. 1241 2014. Consequences of Whole-Genome Triplication as Revealed by Comparative 1242 Genomic Analyses of the Wild Radish Raphanus raphanistrum and Three Other 1243 Brassicaceae Species. Plant Cell Online 26:1925–1937. 1244 doi:10.1105/tpc.114.124297 1245 Moghe GD, Leong BJ, Hurney SM, Daniel Jones A, Last RL. 2017. Evolutionary routes 1246 to biochemical innovation revealed by integrative analysis of a plant-defense 1247 related specialized metabolic pathway. eLife 6:e28468. doi:10.7554/eLife.28468 1248 Morris GM, Goodsell DS, Halliday RS, Huey R, Hart WE, Belew RK, Olson AJ. 1998. 1249 Automated docking using a Lamarckian genetic algorithm and an empirical binding

47 bioRxiv preprint doi: https://doi.org/10.1101/2020.11.18.385815; this version posted November 20, 2020. The copyright holder for this preprint (which was not certified by peer review) is the author/funder. All rights reserved. No reuse allowed without permission.

1250 free energy function. J Comput Chem 19:1639–1662. doi:http://doi: 1251 10.1002/(SICI)1096-987X(19981115)19:14<1639::AID-JCC10>3.0.CO;2-B 1252 Nguyen L-T, Schmidt HA, von Haeseler A, Minh BQ. 2015. IQ-TREE: A Fast and Effective 1253 Stochastic Algorithm for Estimating Maximum-Likelihood Phylogenies. Mol Biol 1254 Evol 32:268–274. doi:10.1093/molbev/msu300 1255 Nie Y, Foster CSP, Zhu T, Yao R, Duchêne DA, Ho SYW, Zhong B. 2020. Accounting for 1256 Uncertainty in the Evolutionary Timescale of Green Plants Through Clock- 1257 Partitioning and Fossil Calibration Strategies. Syst Biol 69:1–16. 1258 doi:10.1093/sysbio/syz032 1259 Niggeweg R, Michael AJ, Martin C. 2004. Engineering plants with increased levels of the 1260 antioxidant chlorogenic acid. Nat Biotechnol 22:746–754. doi:10.1038/nbt966 1261 Nishiyama T, Sakayama H, de Vries J, Buschmann H, Saint-Marcoux D, Ullrich KK, Haas 1262 FB, Vanderstraeten L, Becker D, Lang D, Vosolsobě S, Rombauts S, Wilhelmsson 1263 PKI, Janitza P, Kern R, Heyl A, Rümpler F, Villalobos LIAC, Clay JM, Skokan R, 1264 Toyoda A, Suzuki Y, Kagoshima H, Schijlen E, Tajeshwar N, Catarino B, 1265 Hetherington AJ, Saltykova A, Bonnot C, Breuninger H, Symeonidi A, 1266 Radhakrishnan GV, Van Nieuwerburgh F, Deforce D, Chang C, Karol KG, Hedrich 1267 R, Ulvskov P, Glöckner G, Delwiche CF, Petrášek J, Van de Peer Y, Friml J, Beilby 1268 M, Dolan L, Kohara Y, Sugano S, Fujiyama A, Delaux P-M, Quint M, Theißen G, 1269 Hagemann M, Harholt J, Dunand C, Zachgo S, Langdale J, Maumus F, Van Der 1270 Straeten D, Gould SB, Rensing SA. 2018. The Chara Genome: Secondary 1271 Complexity and Implications for Plant Terrestrialization. Cell 174:448-464.e24. 1272 doi:10.1016/j.cell.2018.06.033 1273 Notebaart RA, Szappanos B, Kintses B, Pál F, Györkei Á, Bogos B, Lázár V, Spohn R, 1274 Csörgő B, Wagner A, Ruppin E, Pál C, Papp B. 2014. Network-level architecture 1275 and the evolutionary potential of underground metabolism. Proc Natl Acad Sci 1276 111:11762–11767. doi:10.1073/pnas.1406102111 1277 Panchy N, Lehti-Shiu M, Shiu S-H. 2016. Evolution of gene duplication in plants. Plant 1278 Physiol 171:2294–2316. doi:10.1104/pp.16.00523 1279 Paradis E, Schliep K. 2019. ape 5.0: an environment for modern phylogenetics and 1280 evolutionary analyses in R. Bioinformatics 35:526–528. 1281 doi:10.1093/bioinformatics/bty633 1282 Payne JL, Wagner A. 2019. The causes of evolvability and their evolution. Nat Rev Genet 1283 20:24–38. doi:10.1038/s41576-018-0069-z 1284 Peng M, Gao Y, Chen W, Wang W, Shen S, Shi J, Wang C, Zhang Y, Zou L, Wang S, 1285 Wan J, Liu X, Gong L, Luo J. 2016. Evolutionarily Distinct BAHD N- 1286 Acyltransferases Are Responsible for Natural Variation of Aromatic Amine 1287 Conjugates in Rice. Plant Cell 28:1533–50. doi:10.1105/tpc.16.00265 1288 Pettersen EF, Goddard TD, Huang CC, Couch GS, Greenblatt DM, Meng EC, Ferrin TE. 1289 2004. UCSF Chimera--a visualization system for exploratory research and 1290 analysis. J Comput Chem 25:1605–1612. doi:10.1002/jcc.20084

48 bioRxiv preprint doi: https://doi.org/10.1101/2020.11.18.385815; this version posted November 20, 2020. The copyright holder for this preprint (which was not certified by peer review) is the author/funder. All rights reserved. No reuse allowed without permission.

1291 Philippe G, Sørensen I, Jiao C, Sun X, Fei Z, Domozych DS, Rose JK. 2020. Cutin and 1292 suberin: assembly and origins of specialized lipidic cell wall scaffolds. Curr Opin 1293 Plant Biol, Physiology and Metabolism 55:11–20. doi:10.1016/j.pbi.2020.01.008 1294 Piatkowski BT, Imwattana K, Tripp EA, Weston DJ, Healey A, Schmutz J, Shaw AJ. 2020. 1295 Phylogenomics reveals convergent evolution of red-violet coloration in land plants 1296 and the origins of the anthocyanin biosynthetic pathway. Mol Phylogenet Evol 1297 151:106904. doi:10.1016/j.ympev.2020.106904 1298 Pigliucci M. 2008. Is evolvability evolvable? Nat Rev Genet 9:75–82. doi:10.1038/nrg2278 1299 Potter SC, Luciani A, Eddy SR, Park Y, Lopez R, Finn RD. 2018. HMMER web server: 1300 2018 update. Nucleic Acids Res 46:W200–W204. doi:10.1093/nar/gky448 1301 Renault H, Werck-Reichhart D, Weng J-K. 2019. Harnessing lignin evolution for 1302 biotechnological applications. Curr Opin Biotechnol, Food Biotechnology • Plant 1303 Biotechnology 56:105–111. doi:10.1016/j.copbio.2018.10.011 1304 Rostkowski M, Olsson MH, Søndergaard CR, Jensen JH. 2011. Graphical analysis of pH- 1305 dependent properties of proteins predicted using PROPKA. BMC Struct Biol 11:6. 1306 doi:10.1186/1472-6807-11-6 1307 Sander M, Petersen M. 2011. Distinct substrate specificities and unusual substrate 1308 flexibilities of two hydroxycinnamoyltransferases, rosmarinic acid synthase and 1309 hydroxycinnamoyl-CoA:shikimate hydroxycinnamoyl-transferase, from Coleus 1310 blumei Benth. Planta 233:1157–71. doi:10.1007/s00425-011-1367-2 1311 Sanderson MJ. 2002. Estimating Absolute Rates of Molecular Evolution and Divergence 1312 Times: A Penalized Likelihood Approach. Mol Biol Evol 19:101–109. 1313 doi:10.1093/oxfordjournals.molbev.a003974 1314 Schmidt GW, Jirschitzka J, Porta T, Reichelt M, Luck K, Torre JCP, Dolke F, Varesio E, 1315 Hopfgartner G, Gershenzon J, D’Auria JC. 2015. The Last Step in Cocaine 1316 Biosynthesis Is Catalyzed by a BAHD Acyltransferase. Plant Physiol 167:89–101. 1317 doi:10.1104/pp.114.248187 1318 Schnable JC, Springer NM, Freeling M. 2011. Differentiation of the maize subgenomes 1319 by genome dominance and both ancient and ongoing gene loss. Proc Natl Acad 1320 Sci 108:4069–4074. doi:10.1073/pnas.1101368108 1321 Schrödinger – Knowledge Base. 2020. 1322 Schrödinger, LLC. 2020. Schrödinger Release 2020-1: Maestro. 1323 Schrödinger, LLC. 2015. The AxPyMOL Molecular Graphics Plugin for Microsoft 1324 PowerPoint, Version 1.8. 1325 Shannon P, Markiel A, Ozier O, Baliga NS, Wang JT, Ramage D, Amin N, Schwikowski 1326 B, Ideker T. 2003. Cytoscape: A Software Environment for Integrated Models of 1327 Biomolecular Interaction Networks. Genome Res 13:2498–2504. 1328 doi:10.1101/gr.1239303 1329 Shaw WV, Leslie AGW. 1991. Chloramphenicol Acetyltransferase. Annu Rev Biophys 1330 Biophys Chem 20:363–386. doi:10.1146/annurev.bb.20.060191.002051

49 bioRxiv preprint doi: https://doi.org/10.1101/2020.11.18.385815; this version posted November 20, 2020. The copyright holder for this preprint (which was not certified by peer review) is the author/funder. All rights reserved. No reuse allowed without permission.

1331 St Pierre B, De Luca V. 2000. Evolution of acyltransferase genes: Origin and 1332 diversification of the BAHD superfamily of acyltransferases involved in secondary 1333 metabolism In: Romeo JT, Ibrahim R, Varin L, De Luca V, editors. Recent 1334 Advances in Phytochemistry, Evolution of Metabolic Pathways. Elsevier. pp. 285– 1335 315. doi:10.1016/S0079-9920(00)80010-6 1336 St-Pierre B, Vazquez-Flota FA, Luca VD. 1999. Multicellular compartmentation of 1337 Catharanthus roseus alkaloid biosynthesis predicts intercellular translocation of a 1338 pathway intermediate. Plant Cell 11:887–900. doi:10.1105/tpc.11.5.887 1339 Suzuki H, Nakayama T, Nishino T. 2003. Proposed mechanism and functional amino acid 1340 residues of malonyl-CoA : anthocyanin 5-O-glucoside-6 ’ ’ ’-O-malonyltransferase 1341 from flowers of Salvia splendens, a member of the versatile plant acyltransferase 1342 family. Biochemistry 42:1764–1771. doi:10.1021/bi020618g 1343 Tanner KG, Trievel RC, Kuo M-H, Howard RM, Berger SL, Allis CD, Marmorstein R, Denu 1344 JM. 1999. Catalytic Mechanism and Function of Invariant Glutamic Acid 173 from 1345 the Histone Acetyltransferase GCN5 Transcriptional Coactivator. J Biol Chem 1346 274:18157–18160. doi:10.1074/jbc.274.26.18157 1347 Tokuriki N, Tawfik DS. 2009. Protein Dynamism and Evolvability. Science 324:203–207. 1348 doi:10.1126/science.1169375 1349 Trott O, Olson AJ. 2010. AutoDock Vina: improving the speed and accuracy of docking 1350 with a new scoring function, efficient optimization and multithreading. J Comput 1351 Chem 31:455–461. doi:10.1002/jcc.21334 1352 Tuominen LK, Johnson VE, Tsai C-J. 2011. Differential phylogenetic expansions in BAHD 1353 acyltransferases across five angiosperm taxa and evidence of divergent 1354 expression among Populus paralogues. BMC Genomics 12:236. 1355 doi:10.1186/1471-2164-12-236 1356 Unno H, Ichimaida F, Suzuki H, Takahashi S, Tanaka Y, Saito A, Nishino T, Kusunoki M, 1357 Nakayama T. 2007. Structural and Mutational Studies of Anthocyanin 1358 Malonyltransferases Establish the Features of BAHD Enzyme Catalysis. J Biol 1359 Chem 282:15812–15822. doi:10.1074/jbc.M700638200 1360 Vries J de, Rensing SA. 2020. Gene gains paved the path to land. Nat Plants 6:7–8. 1361 doi:10.1038/s41477-019-0579-5 1362 Wagner A. 2008. Robustness and evolvability: a paradox resolved. Proc R Soc B Biol Sci 1363 275:91–100. doi:10.1098/rspb.2007.1137 1364 Wagner A. 2005. Robustness, evolvability, and neutrality. FEBS Lett, Systems Biology 1365 579:1772–1778. doi:10.1016/j.febslet.2005.01.063 1366 Wang J, Marowsky NC, Fan C. 2014. Divergence of Gene Body DNA Methylation and 1367 Evolution of Plant Duplicate Genes. PLOS ONE 9:e110357. 1368 doi:10.1371/journal.pone.0110357 1369 Wang J, Wolf RM, Caldwell JW, Kollman PA, Case DA. 2004. Development and testing 1370 of a general amber force field. J Comput Chem 25:1157–1174. 1371 doi:10.1002/jcc.20035

50 bioRxiv preprint doi: https://doi.org/10.1101/2020.11.18.385815; this version posted November 20, 2020. The copyright holder for this preprint (which was not certified by peer review) is the author/funder. All rights reserved. No reuse allowed without permission.

1372 Wang L-P, Martinez TJ, Pande VS. 2014. Building Force Fields: An Automatic, 1373 Systematic, and Reproducible Approach. J Phys Chem Lett 5:1885–1891. 1374 doi:10.1021/jz500737m 1375 Wang L-P, McKiernan KA, Gomes J, Beauchamp KA, Head-Gordon T, Rice JE, Swope 1376 WC, Martínez TJ, Pande VS. 2017. Building a More Predictive Protein Force Field: 1377 A Systematic and Reproducible Route to AMBER-FB15. J Phys Chem B 1378 121:4023–4039. doi:10.1021/acs.jpcb.7b02320 1379 Wang Y, Backman TWH, Horan K, Girke T. 2013. fmcsR: mismatch tolerant maximum 1380 common substructure searching in R. Bioinformatics 29:2792–2794. 1381 doi:10.1093/bioinformatics/btt475 1382 Weng J-K, Chapple C. 2010. The origin and evolution of lignin biosynthesis. New Phytol 1383 187:273–285. doi:https://doi.org/10.1111/j.1469-8137.2010.03327.x 1384 Yang Q, Reinhard K, Schiltz E, Matern U. 1997. Characterization and heterologous 1385 expression of hydroxycinnamoyl/benzoyl-CoA:anthranilate N- 1386 hydroxycinnamoyl/benzoyltransferase from elicited cell cultures of carnation, 1387 Dianthus caryophyllus L. Plant Mol Biol 35:777–789. 1388 doi:10.1023/A:1005878622437 1389 Zou C, Lehti-Shiu MD, Thomashow M, Shiu S-H. 2009. Evolution of Stress-Regulated 1390 Gene Expression in Duplicate Genes of Arabidopsis thaliana. PLOS Genet 1391 5:e1000581. doi:10.1371/journal.pgen.1000581 1392 1393

51 bioRxiv preprint doi: https://doi.org/10.1101/2020.11.18.385815; this version posted November 20, 2020. The copyright holder for this preprint (which was not certified by peer review) is the author/funder. All rights reserved. No reuse allowed without permission.

1394 SUPPLEMENTARY TABLES

1395 Table S1: Substrate class definitions. Substrates were grouped into different classes based on their 1396 chemical properties and their membership in known compound classes. Also see Fig. S1A.

Scaffold Class Definition Exemplary structures Aromatic alcohols A Substrates were classified as aromatic Benzoyl alcohol, Coniferyl alcohols when they contained a planar ring of alcohol, Shikimate, Quinate carbon atoms and a hydroxy group attached to a sidechain. Compounds containing additional hydroxy groups directly attached to the ring were also classified into this category. All substrates in this class except 2- naphthaleneethanol had one ring. Anthocyanins D Substrates were grouped into the anthocyanins Cyanidin 3-O glucoside, category if they fulfill the classical definition of Cyanidin 3-5-O glucoside, an anthocyanin: contain an anthocyanidin Pelargonidin 3-O rutinoside (flavylium cation) with attached sugar group(s). Flavonoids D Substrates being a flavonoid or isoflavonoid Naringin, Genistin, Quercetin were grouped into this category. Flavonoids a 3-O- sophoroside generally defined as having a 15-carbon skeleton which contains two benzene rings that are connected with a 3-carbon linking chain. Also, flavonoid glucosides were grouped into this class. Aliphatic amines B Aliphatic amines were defined as amines not Agmatine, Putrescine, containing any aromatic rings but were allowed Spermidine to contain more than one amine group and or have additional hydroxy groups. Aliphatic alcohols B Aliphatic alcohols do not contain any aromatic 1-Butanol, 1-Decanol, 16- rings but can range from short chain to very Hydroxypalmitic acid long chains. We also grouped fatty acids into this category because of their high chemical similarity. Monoterpenoids C Compounds formally containing of isoprene Geraniol, Nerol, Linalool that do not contain aromatic rings or had branched chains were classified as terpenoids. Sesquiterpenoids C Compounds build from three isoprene units. Farnesol Aromatic amines A Substrates containing an aromatic ring and an Tyramine, Dopamine, 3- amine group were classified as aromatic Aminobenzoate amines. However, substrates containing an additional hydroxy group were also categorized as aromatic amine because their chemistry was expected to be more similar to amines than to aromatic alcohols, due to presence of the positively charged -NH2 group. Alkaloids Mix Substrates were classified as alkaloids if they Methylecgonine, contained a heterocyclic bound nitrogen atom. Tryptamine, Serotonin

Phenolic glycosides D We classified substrates as phenolic Scopolin, 1-Naphtol glycosides if they contained a sugar group glucoside, Umbelliferone bound via a glycosidic bond to a aromatic glucoside molecule that could not be classified as either flavonoids or anthocyanins. Sugar derivatives G Substrates classified as sugar derivatives are Sucrose, Glucose, S1:5(5) either mono- and disaccharides and their acylated variants. Diterpenoids E Substrates involved in the biosynthesis of Baccatin III, 10- taxenes were grouped into the diterpenoid Deacetylbaccatin III, class Taxadien-5a-ol Triterpenoids F Compounds that consisted of six isoprene units Thalianol, Arabidiol, were grouped into the triterpenoid class. Tirucalla-7,24-dien-3beta-ol

1397

52 bioRxiv preprint doi: https://doi.org/10.1101/2020.11.18.385815; this version posted November 20, 2020. The copyright holder for this preprint (which was not certified by peer review) is the author/funder. All rights reserved. No reuse allowed without permission.

1398 Table S2. BAHD acyltransferases in the Solanum lycopersicum (tomato) genome. For characterized 1399 BAHDs their name and the respective reference is given.

Protein ID PFAM domain Pfam ID Name/ Reference name Annotation Solyc08g005770.2.1 Transferase PF02458.15 SlAAT1 (Goulet et al., 2015)

Solyc08g005760.1.1 Transferase PF02458.15 SlAAT2 (Goulet et al., 2015)

Solyc11g071470.1.1 Transferase PF02458.15 SlACT1 this study

Solyc11g071480.1.1 Transferase PF02458.15 SlACT2 this study

Solyc12g006330.1.1 Transferase PF02458.15 SlASAT1 (Fan et al., 2016)

Solyc04g012020.1.1 Transferase PF02458.15 SlASAT2 (Fan et al., 2016)

Solyc11g067270.1.1 Transferase PF02458.15 SlASAT3 (Fan et al., 2016)

Solyc01g105580.1.1 Transferase PF02458.15 SlASAT4 (Fan et al., 2016)

Solyc03g117600.2.1 Transferase PF02458.15 SlHCT this study

Solyc07g005760.2.1 Transferase PF02458.15 SlHQT (Niggeweg et al., 2004)

Solyc05g052670.1.1 Transferase PF02458.15

Solyc05g052680.1.1 Transferase PF02458.15

Solyc11g008630.1.1 Transferase PF02458.15

Solyc07g015960.1.1 Transferase PF02458.15

Solyc09g014280.1.1 Transferase PF02458.15

Solyc03g097500.2.1 Transferase PF02458.15

Solyc02g079490.2.1 Transferase PF02458.15

Solyc07g014580.2.1 Transferase PF02458.15

Solyc05g014330.1.1 Transferase PF02458.15

Solyc07g049660.2.1 Transferase PF02458.15

Solyc08g005890.2.1 Transferase PF02458.15

Solyc07g049670.2.1 Transferase PF02458.15

Solyc03g025320.2.1 Transferase PF02458.15

Solyc04g078660.1.1 Transferase PF02458.15

Solyc05g015800.2.1 Transferase PF02458.15

Solyc02g093180.2.1 Transferase PF02458.15

Solyc04g079720.2.1 Transferase PF02458.15

Solyc06g074710.1.1 Transferase PF02458.15

Solyc07g006680.1.1 Transferase PF02458.15

Solyc12g096250.1.1 Transferase PF02458.15

Solyc06g051320.2.1 Transferase PF02458.15

Solyc04g082350.1.1 Transferase PF02458.15

Solyc01g105550.1.1 Transferase PF02458.15

Solyc01g107080.2.1 Transferase PF02458.15

Solyc02g062710.1.1 Transferase PF02458.15

53 bioRxiv preprint doi: https://doi.org/10.1101/2020.11.18.385815; this version posted November 20, 2020. The copyright holder for this preprint (which was not certified by peer review) is the author/funder. All rights reserved. No reuse allowed without permission.

Solyc11g066640.1.1 Transferase PF02458.15

Solyc08g013830.1.1 Transferase PF02458.15

Solyc07g006670.1.1 Transferase PF02458.15

Solyc04g080720.2.1 Transferase PF02458.15

Solyc02g081740.1.1 Transferase PF02458.15

Solyc01g105590.2.1 Transferase PF02458.15

Solyc06g051130.1.1 Transferase PF02458.15

Solyc08g014490.1.1 Transferase PF02458.15

Solyc07g043700.1.1 Transferase PF02458.15

Solyc12g088170.1.1 Transferase PF02458.15

Solyc07g043710.2.1 Transferase PF02458.15

Solyc02g081760.1.1 Transferase PF02458.15

Solyc12g096770.1.1 Transferase PF02458.15

Solyc00g040390.1.1 Transferase PF02458.15

Solyc07g043670.1.1 Transferase PF02458.15

Solyc02g081800.1.1 Transferase PF02458.15

Solyc12g010980.1.1 Transferase PF02458.15

Solyc02g081750.1.1 Transferase PF02458.15

Solyc08g075210.1.1 Transferase PF02458.15

Solyc11g069680.1.1 Transferase PF02458.15

Solyc12g096790.1.1 Transferase PF02458.15

Solyc11g067290.1.1 Transferase PF02458.15

Solyc12g096800.1.1 Transferase PF02458.15

Solyc01g068140.2.1 Transferase PF02458.15

Solyc11g067340.1.1 Transferase PF02458.15

Solyc07g008380.1.1 Transferase PF02458.15

Solyc07g008390.1.1 Transferase PF02458.15

Solyc12g005430.1.1 Transferase PF02458.15

Solyc11g067330.1.1 Transferase PF02458.15

Solyc02g081770.1.1 Transferase PF02458.15

Solyc12g005440.1.1 Transferase PF02458.15

Solyc05g039950.1.1 Transferase PF02458.15

Solyc00g040290.1.1 Transferase PF02458.15

Solyc07g017320.1.1 Transferase PF02458.15

Solyc01g008300.1.1 Transferase PF02458.15

Solyc11g020640.1.1 Transferase PF02458.15

Solyc10g079570.1.1 Transferase PF02458.15

Solyc10g008680.1.1 Transferase PF02458.15

Solyc04g009680.1.1 Transferase PF02458.15

54 bioRxiv preprint doi: https://doi.org/10.1101/2020.11.18.385815; this version posted November 20, 2020. The copyright holder for this preprint (which was not certified by peer review) is the author/funder. All rights reserved. No reuse allowed without permission.

Solyc07g052060.2.1 Transferase PF02458.15

Solyc12g087980.1.1 Transferase PF02458.15

Solyc09g092270.2.1 Transferase PF02458.15

Solyc08g075180.1.1 Transferase PF02458.15

Solyc05g052650.2.1 Transferase PF02458.15

Solyc10g055730.1.1 Transferase PF02458.15

Solyc00g135260.1.1 Transferase PF02458.15

Solyc01g107070.2.1 Transferase PF02458.15

Solyc05g050760.1.1 Transferase PF02458.15

Solyc01g005900.2.1 Transferase PF02458.15

Solyc00g134620.1.1 Transferase PF02458.15

Solyc01g107050.2.1 Transferase PF02458.15

Solyc08g007210.2.1 Transferase PF02458.15

Solyc08g078030.2.1 Transferase PF02458.15

Solyc08g075200.1.1 Transferase PF02458.15

Solyc07g026890.1.1 Transferase PF02458.15

Solyc11g067350.1.1 Transferase PF02458.15

Solyc05g015810.1.1 Transferase PF02458.15

Solyc06g071940.1.1 Transferase PF02458.15

Solyc03g078130.1.1 Transferase PF02458.15

Solyc10g008670.2.1 Transferase PF02458.15

Solyc04g009670.1.1 Transferase PF02458.15

Solyc08g036440.1.1 Transferase PF02458.15

Solyc04g078350.1.1 Transferase PF02458.15

Solyc12g044660.1.1 Transferase PF02458.15 1400 1401

55 bioRxiv preprint doi: https://doi.org/10.1101/2020.11.18.385815; this version posted November 20, 2020. The copyright holder for this preprint (which was not certified by peer review) is the author/funder. All rights reserved. No reuse allowed without permission.

1402 Table S3. Primer sequences. Sequences of Primers used to clone enzymes analyzed in this study.

Name Sequence (5’ to 3’ end) Used for Oligo DT17 GTCGACTCGAGAATTCTTTTTTTTTTTTTTTTT cDNA synthesis Gibson_N_6xHis4CL_F2 AGCATGACTGGTGGACAGCAAATGGGTCGGATGCCGAT Cloning of Sl4CL GGATACCGAAACA Gibson_4CL_R2 GCCGGATCTCAGTGGTGGTGGTGGTGGTGCATGCCGAT Cloning of Sl4CL GGATACCGAAACA Gibson_N_6xHis_HCT_F1 AGCATGACTGGTGGACAGCAAATGGGTCGGATGAAGAT Cloning of SlHCT CGAGGTGAAAAACTCA Gibson_HCT_R1 GCCGGATCTCAGTGGTGGTGGTGGTGGTGCTCAAATGT Cloning of SlHCT CATACAAGAACTTCTCAA SlHQT_Gibson_N_6xHis_F1 AGCATGACTGGTGGACAGCAAATGGGTCGGATGGGAAG Cloning of SlHQT TGAAAAAATGATGAAAATTAATATC SlHQT_Gibson_R1 GCCGGATCTCAGTGGTGGTGGTGGTGGTGCTCATAATT Cloning of SlHQT CATATAAATATTTTTCAAATAGTG Gibson_N_6xHis_ACT2_F2 AGCATGACTGGTGGACAGCAAATGGGTCGGATGAATGT Cloning of SlACT GAAAATTGAGAGTTCAAAAATCATCAAGCCATTG Gibson_ACT2_R2 GCCGGATCTCAGTGGTGGTGGTGGTGGTGCTCACTTTG Cloning of SlACT CTTTCAAATCTAGAGAGTAACAAATTTTC Dm3MAT3_W70A_F2 CCTTTTTCGATTTCTTTGCGCTGCGCAGTCCGCC Mutation of Trp36 to Ala Dm3MAT3_W70A_R2 GGCGGACTGCGCAGCGCAAAGAAATCGAAAAAGG Mutation of Trp36 to Ala Dm3MAT3_C322A_F GCATATTTTGGCAATGCCGTGGGTGGTTGCGCC Mutation of Cys320 to Ala Dm3MAT3_C322A_R GGCGCAACCACCCACGGCATTGCCAAAATATGC Mutation of Cys320 to Ala 1403 1404 Table S4: Masses of detected products. Parent ion mass (bold) for each donor was used for isolation 1405 with product specific PRM method (see methods section) and the quantifier ion to quantify this product (if 1406 product was detected). For each product (if detected) the retention time is given in brackets. n.t = not tested; 1407 n.d. = not detected. LC methods are described in Tab. S5.

Substrate + Coumaroyl + Feruloyl + Malonyl Product Ionization LC method Product (m/z) Product (m/z) (m/z) mode Shikimate 319.0817 349.0924 259.0454 negative 4-min method 163.0398 n.d. n.d. (1.6) Quinate 337.0927 367.1034 277.0565 negative 4-min method 191.0555 n.d. 191.0558 (1.4) (1.4) Tyramine 284.1279 314.1386 224.0917 positive 4-min method 147.0443 177.0544 n.d. (1.85) (1.66) Dopamine 300.1229 330.1336 284.0764 positive 4-min method 147.0443 177.0545 n.d. (1.65) (1.6) Agmatine 277.1667 307.1774 217.1295 positive 4-min method 147.0440 177.0546 131.1291 (1.1) (1.3) (1.1) Putrescine 235.1445 265.1552 175.1077 positive 4-min method 147.0440 177.0546 n.d. (0.6) (1.0) 1-Decanol 303.1964 333.2071 243.1601 negative 8-min method n.d. 177.0194 n.d. (5.5) Naringin 725.2091 755.2198 665.1723 negative 4-min method 163.0401 271.0603 271.0608 (1.7) (2.1) (1.8) Genistin 577.1351 607.1458 517.0987 negative 4-min method 269.0434 269.0445 269.0443 (1.65) (2.1) (1.8) Cyanidin 3,5-O 757.1974 787.208 697.1610 positive 4-min method glucoside 287.0546 n.d 287.0546

56 bioRxiv preprint doi: https://doi.org/10.1101/2020.11.18.385815; this version posted November 20, 2020. The copyright holder for this preprint (which was not certified by peer review) is the author/funder. All rights reserved. No reuse allowed without permission.

(1.45) (1.25) Malvidin 3-O 639.1713 669.1820 579.1350 positive 4-min method glucoside 331.0835 331.0829 331.0835 (1.65) (1.6) (1.45) Pelargonidin 3- 725.2080 755.2270 665.1717 positive 4-min method O rutinoside n.d. 271.0604 n.t. (1.5) Cyanidin 3-O 595.1451 625.1558 535.1088 positive 4-min method glucoside 287.0546 287.0541 287.0544 8-min method (1.6) (1.5) (2.5 (8-min method)) Cyanidin 3-O 741.2029 771.2136 681.1666 positive 4-min method rutinoside 287.0546 287.0545 n.t. (1.25) (1.5) Linalool 299.1725 329.183165 239.1362 negative 8-min method n.d. n.d. n.d. Geraniol 299.1654 329.1754 239.1362 negative 8-min method 163.0393 329.1754 n.d. (4.9) (4.9) Cucurbitacin E 701.3380 731.3502 641.2967 negative 8-min method 175.0393 175.0393 n.d. (4.3) (4.4)

1408 Table S5. LC methods used for analyzing enzyme assay reactions. All solvents and reagents used 1409 were LC-MS grade quality. For the 150 mm column, a 2 mm C18 guard column (AJ0-8782, SecurityGuard 1410 Ultra, 2.1 mm, Phenomenex, Torrance, CA) was used. The autosampler was kept at 20 ºC and the column 1411 compartment was heated to 40 ºC. For negative ion mode, the mass spectrometer parameters were as 1412 follows: spray voltage 3800V, capillary temperature 380C, sheath gas pressure 60 psi, auxiliary gas 20 psi, 1413 spare gas 2 psi, max. spray current 100eV, probe 400C, RF lens 50V, and a collision energy ramped from 1414 20 to 40 eV. For positive ion mode MS parameters were the same except for the spray voltage that was 1415 set to 3500V.

4min-C18 Flow %A %B Curve Solvents Column (mL/min) A: Water + 0.01% (v/v) Formic Kinetex PS C18 (00B- acid 4780-AN, 2.6μm particle B: Acetonitrile + 0.01% (v/v) size, 100Å pore size, 50 x Formic acid 2.10 mm, Phenomenex (Torrance, CA)) Initial 0.6 95 5 5 0.5 0.6 95 5 5 3.0 0.6 30 70 5 3.3 0.6 95 5 5 3.6 0.6 5 95 5 4.0 0.6 5 95 5

8min-C18 Flow %A %B Curve Solvents Column (mL/min) A: Water+0.01% (v/v) Formic acid Kinetex C18 (00F-4462- B: Acetonitrile + 0.01% (v/v) AN, 2.6μm particle size, Formic acid 100Å pore size, 150 x 2.10 mm, Phenomenex (Torrance, CA)) Initial 0.6 95 5 5 1 0.6 95 5 5 5.6 0.6 5 95 5 6.6 0.6 5 95 5 6.61 0.6 5 95 5 7.5 0.6 95 5 5 8.0 0.6 95 5 5 1416

57 bioRxiv preprint doi: https://doi.org/10.1101/2020.11.18.385815; this version posted November 20, 2020. The copyright holder for this preprint Figure S1 (which was not certified by peer review) is the author/funder. All rights reserved. No reuse allowed without permission.

Aliphatic amines were de ned as amines not containing Compound is aliphatic Aliphatic amine any aromatic rings but were allowed to contain more than one amine group and or have additional hydroxy groups. Substrates were classi ed as alkaloids if they contained a Alkaloid Nitrogen is in the cyclic ring heterocyclic bound nitrogen atom. Substrates containing an aromatic ring and an amine Yes! group were classi ed as aromatic amines. However, Compound has one or more cyclic rings substrates containing an additional hydroxy group were The nitrogen is not in the cyclic ring Aromatic amine also categorized as aromatic amine because their chemistry was expected to be more similar to amines than to aromatic alcohols, due to presence of the positively charged -NH2 group. Monoterpenoid Sesquiterpenoid Diterpenoid Terpene Triterpenoid Compounds formally containing of isoprene that do not Compound is aliphatic Terpenoid contain aromatic rings or had branched chains were classi ed as terpenoids. Aliphatic alcohols do not contain any aromatic rings but can range from short chain to very long chains. We also Aliphatic alcohol grouped fatty acids into this category because of their high chemical similarity. Substrates were classi ed as aromatic alcohols when they contained a planar ring of carbon atoms and a hydroxy group attached to a sidechain. Compounds containing Single cyclic ring Aromatic alcohol additional hydroxy groups directly attached to the ring BAHD substrates Does the compound have nitrogen? were also classi ed into this category. All substrates in this class except 2-naphthaleneethanol had one ring. Substrates were grouped into the anthocyanins category if they ful ll the classical de nition of an anthocyanin: Anthocyanin contain an anthocyanidin (avylium cation) with attached No! sugar group(s). Substrates being a avonoid or isoavonoid were grouped into this category. Flavonoids are generally de ned as More than one cyclic ring Flavonoid having a 15-carbon skeleton which contains two benzene rings that are connected with a 3-carbon linking chain. Also, avonoid glucosides were grouped into this class. Compound has one or more cyclic rings We classi ed substrates as glycosides if they contained a sugar group that was bound via a glycosidic bond to a Phenolic glycoside molecule that could not be classi ed as either avonoids or anthocyanins. Substrates classi ed as sugar derivatives are either mono- Sugar derivatives Sugar core and disaccharides and their acylated variants. Monoterpenoid Sesquiterpenoid Diterpenoid Terpene Triterpenoid Compounds formally containing of isoprene that do not Terpenoid contain aromatic rings or had branched chains were classi ed as terpenoids.

B N-debenzoyl-(3'-RS)-2'-deoxytaxol

Baccatin III 10-Deacetylbaccatin III

10-Deacetyl-2-debenzoylbaccatin III

T7 T2 T5 T3 T6 T4 Thalaniol(T1) Arabidiol(A1)

Taxadien-5a-ol

A2 Tirucalla-7,24-dien-3beta-ol(Tr1) (Pupchem ID 12302184) 20-Hydroxy-eicosanoic acid 17-hydroxy-heptadecanoic acid Methyl-15-hydroxypentadecanoate 16-hydroxypalmitic acid 15-Hydroxy-pentadecanoic C16:0acid 16-OH FA 13-hydroxylupanine 13-Hydroxymultiflorine 1-Hexadecanol

1-Tetradecanol

1-Dodecanol

Spermine 1-Decanol

1-Nonanol

Spermidine

1-Octanol

1-Heptanol

1-Hexanol Agmatine Methanol

1-Pentanol

3-Methyl-1-butanol

Putrescine Citronellol 2-methyl-1-butanol Malic acid 1-Butanol Methylecgonine Isobutanol Ethanol Galactaric acid Quinate Perilla alcohol

D-glucaric acid Linalool 2-Butanol

1-Propanol

Carveol

Farnesol 2-Propanol

NeroGeraniol l

Glycerol A10, A11 Shikimate

Piscidic acid

A6, A8 trans-2-HeZ-2-hexen-1-oxen-1l -ol Glycitein 7-O-glucoside Dihydrosinapyl alcohol 6,4-dihydroxy-7-O-glucosyl-isoflavone Cyanidin Phenyllactate 3-O-malonyl-5-O-glucoside Tryptamine Glycitin 4-Hydroxyphenyllactic acid Formononetin 7-O-glucoside Coniferyl alcohol Genistein 7-O-glucoside Shisonin Sinapyl alcohol Monodemalonylsalvianin Malvidin DaidziGnenistin 3,4-Dihydroxyphenyllactic acid Pelargonidin Eriodictyol 7-O-glucoside Chavicol 16-Epivellosimine Petunidin-3-O-rhamnosyl-glucoside-5-O-glucosid3-O-rhamnosyl-glucoside-5-O-glucoside e Bisdemalonylsalviani3-O-acetyl-5-O-glucosidn Malvine Cyanidin Naringenin 7-O-glucoside (Z)-3-hexenn-1-ol CyanidinDelphinidin 3,5-O-diglucosid 3,5-O-diglucoside e trans-3-Hexen-1-ol Delphinidin-3-O-rhamnosyl-glucoside-5-O-glucosid3-O-acetyl-5-O-glucoside e Quercetin 3-O-glucoside 2-Phenylethanol Eugenol KaeQmpferuerceolt in7 -O-glu7-O-glucosidcoside e Tyramine Cinnamyl alcohol Pelargonidin-3,5-diglycoside Apigenin 7-O-glucoside Cinnamyl alcohol Anthocyanidin Dopamine Phenethylamine 2-Hydroxy-2-phenylpropanoiIsochavicop-Coumaryll c alcohol 3-rhamnosylglucoside-5-glucoside Isoeugenol 7-Hydroxyflavone glucoside 3-Hydroxyflavone glucoside acid Naringin 2-Ethoxyethanol Luteolin 4'-O-glucoside Naringenin Delfinidin-3-O-glucoside 2-Naphthaleneethanol 4-Methylumbelliferone 3-hydroxyacetophenone Pelargonidin-3-O-beta-D-glucoside Scopoliglun coside Umbelliferone glucoside Anthranilate Benzyl alcohol Furfurylalcohol 3-Hydroxybenzyl alcohol Protocatechuate 3-Hydroxybenzoate 3-aminobenzoate Salicyl alcohol p-Nitrophenyl-ß-d-glucopyranoside 3-Hydroxyanthranilat5-Hydroxyanthranilate e HydroquinonCatechol e 2-Naphtol glucoside 3-hydroxyanthranilate Gardenal Quercetin 3-O- sophoroside 2,3-Dihydroxybenzoate

Kaempferol 3-O-glucoside 5-Hydroxyanthranilate Quercetin 3-O-glucoside Gentisate

1-Naphtol glucoside Pelargonidin 3-O-glucoside Serotonin CyanidinCyanidin 3-O-glucosid 3-O-glucoside e S4:19(2,5,6,6) Myricetin-Rhammnose-Glucose DelphinidinPeonidin 3-O-glucosid 3-O-glucosidee

Malvidin 3-O-glucoside CyanidinCyanidin-3-(6'-malonylglucoside 3-O-rutinoside )

S2:12(6,6) S1:6(6R2) S2:10(S25R2:11(5,5R4,6)) S4:20(2,6,6,6) Maltose S1:5(5R2) Cellobiose Trehalose Sucrose S3:16(5R2,5R4,6R3) Lactose S3:17(5R2.5R4.7R3) S3:18(5R2,5R4,8R3) S1:5(5)

S2:10(5,5) S3:22(5,5,12) S3:15(5,5,5)S2:17(5,12)

SalutaridinoNudaul rine HorhammericinIsochorismoyl-glutamatee Isochorismoyl-glu A tamate B

Deacetylvindoline

I3:22(2,10,10)

I3:24(2,10,12)

Figure S1: Substrate classification and BAHD substrates represented using an alternative layout. (A) Decision tree to group BAHD substrates into different substrate types. Further information about substrate class definitions can be found in Table S1. (B) The network was created in the same way and is colored the same way as Fig. 1A. The “Edge-weighted Spring Embedded” Layout using MCS-Tanimoto coefficient was used to create an edge-weighted network. bioRxiv preprint doi: https://doi.org/10.1101/2020.11.18.385815; this version posted November 20, 2020. The copyright holder for this preprint (which was not certified by peer review) is the author/funder. All rights reserved. No reuse allowed without permission.

Figure S2

OH OH

OH A H2N HO OH O OH NH2 OH NH2 H2N HO O OH O O OH O

O OH O O OH OH O OH HO O O+

O HO O+ HO OH OH O OH

HO O HO O O O O OH NH OH OH OH O O O HN OH HO OH HO OH OH OH OH

NH2 OH OH OH OH OH OH OH NH2 OH OH OH OH

aliphatic aromatic alcohols aromatic amines aliphatic amines flavonoids anthocyanins alcohols Cyanidin 3,5-O Malvidin 3-O Enzyme Donor acceptor concentration Shikimate Quinate Tyramine Dopamine Putrescine Agmatine Decanol Naringin Genistin diglucoside glucoside

CbHQT-like Coumaroyl-CoA 100 µM 0.037 ±0.008 4.763 ±2.812 0.023 ±0.003 0.021 ±0.001 0.016 ±0.006 0.024 ±0.003 0.015 ±0.001 0.028 ±0.006 0.434 ±0.237 0.001 ±0.000 0.001 ±0.001

CbHQT-like* Coumaroyl-CoA 1 mM 6.956 ±0.476 555.346 ±59.314 6.322 ±0.835 16.998 ±3.392 9.289 ±2.779 4.469 ±1.269 0.603 ±0.056 n.t. n.t. n.t. n.t.

MeHFT Coumaroyl-CoA 100 µM 0.052 ±0.008 0.003 ±0.001 0.083 ±0.026 0.134 ±0.015 0.037 ±0.006 0.025 ±0.007 0.000 ±0.000 0.067 ±0.013 0.193 ±0.028 0.009 ±0.001 0.180 ±0.014

MeHFT Feruloyl-CoA 100 µM n.t. n.t. n.t. n.t. n.t. n.t. 8.332 ±0.000 0.041 ±0.004 0.336 ±0.040 0.191 ±0.173 2.588 ±0.083

MeHFT* Feruloyl-CoA 1 mM n.d. n.d. 2.014 ±0.066 0.967 ±0.101 0.296 ±0.032 0.286 ±0.007 n.t. n.t. n.t. n.t. n.t.

SlACT Coumaroyl-CoA 100 µM 0.006 ±0.001 0.009 ±0.001 0.050 ±0.007 0.054 ±0.002 22.673 ±3.164 6.476 ±0.455 0.018 ±0.003 0.022 ±0.006 0.065 ±0.113 0.002 ±0.001 0.008 ±0.002

SlACT* Coumaroyl-CoA 1 mM 1.396 ±0.433 1.854 ±0.679 10.576 ±1.632 17.718 ±7.195 3,614.042 ±1,216.789 1,076.305 ±141.838 0.715 ±0.139 n.t. n.t. n.t. n.t.

SlHCT Coumaroyl-CoA 100 µM 65.378 ±14.824 70.896 ±17.602 2.238 ±0.292 1.093 ±0.136 0.057 ±0.014 0.027 ±0.007 n.t. 0.078 ±0.022 0.228 ±0.079 0.210 ±0.052 6.497 ±1.347

SlHQT Coumaroyl-CoA 100 µM 21.608 ±1.838 160.828 ±27.189 0.041 ±0.009 0.093 ±0.033 0.056 ±0.006 0.030 ±0.004 n.t. 0.102 ±0.008 0.169 ±0.009 0.012 ±0.002 0.015 ±0.011

EcHQT Coumaroyl-CoA 100 µM 9.695 ±1.284 132.568 ±7.869 0.034 ±0.004 0.055 ±0.008 0.111 ±0.091 0.035 ±0.015 n.t. 0.040 ±0.004 0.557 ±0.629 0.001 ±0.000 0.002 ±0.001

EcCS Coumaroyl-CoA 100 µM 25.696 ±3.045 94.034 ±8.686 0.025 ±0.003 0.033 ±0.005 0.021 ±0.001 0.025 ±0.002 n.t. 0.031 ±0.021 0.188 ±0.049 0.001 ±0.000 0.002 ±0.000

At5MAT Malonyl-CoA 100 µM n.d. n.d. n.d. 0.005 ±0.005 n.d. n.d. n.t. 0.042 ±0.015 n.d. 1.876 ±0.317 0.943 ±0.147

GmIF7MAT Malonyl-CoA 100 µM n.d. 0.039 ±0.050 n.d. n.d. n.d. 0.017 ±0.015 n.t. 0.043 ±0.011 0.638 ±0.049 0.004 ±0.001 0.029 ±0.020

Dm3MAT3 Malonyl-CoA 100 µM n.d. n.d. n.d. 0.002 ±0.003 n.d. 0.195 ±0.041 n.t. 0.000 ±0.000 1.229 ±0.116 2.683 ±0.163 13.098 ±4.598

Dm3MAT3 Coumaroyl-CoA 100 µM n.d. n.d. n.t. n.t. n.t. n.t. n.t. n.t. n.t. n.t. n.t.

Pc3MAT3 Malonyl-CoA 100 µM n.d. 0.016 ±0.007 n.d. n.d. n.d. n.d. n.t. 0.057 ±0.014 0.030 ±0.006 3.751 ±0.888 108.880 ±3.219

Mock Coumaroyl-CoA 100 µM 0.597 ±0.049 0.940 ±0.367 0.047 ±0.001 0.093 ±0.026 0.034 ±0.002 0.023 ±0.003 0.001 ±0.002 0.071 ±0.011 0.296 ±0.200 0.017 ±0.004 0.018 ±0.007

Mock* Coumaroyl-CoA 1 mM 22.757 ±3.350 0.212 ±0.084 6.018 ±0.530 14.886 ±4.448 3.156 ±2.660 4.539 ±0.643 0.111 ±0.000 n.t. n.t. n.t. n.t.

Mock Malonyl-CoA 100 µM n.d. n.d. n.d. n.d. n.d. n.d. n.t. 0.039 ±0.005 0.000 ±0.000 0.003 ±0.000 0.006 ±0.001

MeHFT Feruloyl-CoA 100 µM n.d. n.d. 0.045 ±0.004 n.d. 0.189 ±0.005 0.124 ±0.070 n.d. n.t. n.t. n.t. n.t.

Mock* Feruloyl-CoA 1 mM n.t. n.t. n.t. n.t. n.t. n.t. n.t. 0.006 ±0.001 0.014 ±0.004 0.064 ±0.040 0.057 ±0.007

OH OH O OH OH

O OH OH OH HO O+ O B + C O HO O+ OH

+ O HO O+ HO O OH O O O OH OH OH OH OH O HO O HO O O O O HO OH OH OH OH OH O O O O O O O O OH OH HO O OH HO OH HO OH OH HO OH OH OH OH

OH OH OH OH OH OH OH OH O

anthocyanins Monoterpenoids Triterpenoids

Cyanidin 3,5-O Malvidin 3-O Pelargonidin 3-O Cyanidin 3-O Enzyme Donor acceptor concentration Cyanidin 3-O rutinoside acceptor diglucoside glucoside rutinoside glucoside Enzyme Donor Linalool Geraniol Curcubitacine E concentration CbHCT Coumaroyl-CoA 100 µM 0.063 ±0.015 0.111 ±0.024 1.337 ±0.112 1.341 ±0.354 0.133 ±0.028 CbHQT-like Coumaroyl-CoA 100 µM 3.383 ±0.358 0.000 ±0.000 0.436 ±0.042 MeHFT Feruloyl-CoA 100 µM 0.191 ±0.173 2.588 ±0.083 54.127 ±8.146 3.243 ±0.468 0.431 ±0.101 MeHFT Feruloyl-CoA 100 µM 0.034 ±0.011 45.255 ±20.153 10.589 ±0.421 SlACT Coumaroyl-CoA 100 µM 0.059 ±0.014 0.105 ±0.085 1.143 ±0.256 0.549 ±0.228 0.053 ±0.052 SlHCT Coumaroyl-CoA 100 µM 2.350 ±0.034 1.386 ±0.307 10.975 ±0.466 SlACT Malonyl-CoA 100 µM 0.002 ±0.001 0.000 ±0.000 0.001 ±0.001 0.007 ±0.003 0.011 ±0.000 SlHQT Coumaroyl-CoA 100 µM 2.893 ±0.163 0.000 ±0.000 0.529 ±0.029 SlHCT Coumaroyl-CoA 100 µM 1.127 ±0.332 38.458 ±19.705 0.908 ±0.313 2.445 ±0.955 1.550 ±2.472

SlHQT Malonyl-CoA 100 µM 0.001 ±0.000 0.000 ±0.000 0.001 ±0.000 0.033 ±0.047 0.007 ±0.001 Dm3MAT3 Malonyl-CoA 100 µM 3.952 ±0.643 3.900 ±0.334 0.000 ±0.000

EcHQT Coumaroyl-CoA 100 µM 0.037 ±0.064 0.060 ±0.103 0.443 ±0.768 0.726 ±1.258 0.080 ±0.070 Mock Coumaroyl-CoA 100 µM 2.742 ±0.399 0.000 ±0.000 0.651 ±0.193

Mock Coumaroyl-CoA 100 µM 0.063 ±0.057 0.166 ±0.007 0.987 ±0.069 0.770 ±0.169 0.121 ±0.048 Mock Feruloyl-CoA 100 µM 0.095 ±0.031 0.101 ±0.020 1.236 ±0.081

Mock Feruloyl-CoA 100 µM 0.064 ±0.040 0.057 ±0.007 0.052 ±0.025 0.915 ±0.049 0.000 ±0.000 Mock Malonyl-CoA 100 µM 4.217 ±0.580 4.497 ±0.689 0.000 ±0.000 Mock Malonyl-CoA 100 µM 0.000 ±0.000 0.000 ±0.000 0.000 ±0.000 0.000 ±0.000 0.000 ±0.000

Figure S2. Specific activities of selected enzymes against representative substrates. Enzymes are ordered by the phylogenetic relationship to each other, starting with the most basal at the top. The average enzyme activity and standard deviation of three technical replicates is given as nmol/mg/min. Each enzyme was tested with its preferred donor substrate (300 uM) and 100 uM of the acceptor substrate. Main activities for each enzyme are colored dark red, medium activities in orange, and low/trace activities in light red. Each activity considered had to be three times higher than the respective Mock control (empty vector). (A) Enzyme activities of selected enzymes against a large panel of substrates. In case of EcCS, coumaroyl-CoA was used instead of benzoyl-CoA which had been shown to be used previously. MeHFT was assayed with coumaroyl-CoA and feruloyl-CoA. n.d. = not detected n.t. = not tested. * = higher acceptor substrate concentration than other assays. In addition to the shown activities, all enzymes were tested with glucose and sucrose as acceptor substrates but no activities were observed. (B) Enzyme assays testing the ability of selected enzymes to acylate anthocyanins with their preferred donor. To exclude that such enzymes can acylate anthocyanins with a different donor, SlHQT and SlACT were also tested with malonyl-CoA, a donor not previously shown to be used by those enzymes. As expected, changing the donor did not allow those enzymes to acylate anthocyanins. (C) Enzyme assays testing the ability to use terpenoids. Two monoterpenoids and one triterpenoid were tested using different enzymes with their preferred donor. Mock controls for each donor were performed to exclude the unspecific formation of the analyzed reaction products. bioRxiv preprint doi: https://doi.org/10.1101/2020.11.18.385815; this version posted November 20, 2020. The copyright holder for this preprint (which was not certified by peer review) is the author/funder. All rights reserved. No reuse allowed without permission.

Alkaloids Sugar derivatives Figure S3 Phenolic glycosides Anthocyanins Flavonoids Triterpenoids Diterpenoids Sesquiterpenoids Monoterpenoids Aliphatic amines Aliphatic alcohols Aromatic amines Aromatic alcohols

Lp3MAT1 AY500352 Vh3MAT1 AY500350

Ss5MAT1 AF405707

Pf3AT AB029340 Dm3MAT1 AY298809 NtMAT1 AB176525 Dm3MAT2 AY298810Gt5AT AB010708

Dm3MAT3 AB290338.1Pc3MAT AY190121 Dp3MAT AF489108 MtMaT1 EU272030.1 GmIF7MaT NM 001250831.1MtMaT2 EU272032.1 MtMaT3 EU272031.1 AtCER2 AY087262 gen AY087262 AtCER2 Kni kfl00513 0110 v1.1 GmIMaT1 KY399789.1 Kni kfl00302 0150 v1.1 Kni kfl00070 0280 v1.1 Mpus 49937 Oluc 28702 Mpus 123940 Cbra bGBG71901.1 Cbra aGBG71897.1 Cbra dGBG76279.1 Cbra cGBG71902.1 GmMT7 EU192928.1 MeHFT MeHFT GmIMaT3 KY399790.1 MpolFHT Mapoly0157s0023.1.p AtDCF BT010448.1 AtFACT AY142537.1 At5Mat NM 113880.2 StFHT NM 001288261.1 AtASFT HHT1 AY062996.1 AtACT NM 125509.3 PtFHT1 JX515962.1 AtSCT BT009686.1 At3AT1 NM 100275.3 AtSDT NM 127915.2 At3AT2 NM 100232.5 TcDBNTBT AF466397 TcDBAT AF193765 LanAAT2 DQ886905.1 TcTAT AF190130 ObCAAT1 QKK36036.1 TcBAPT AY082804 AtDCR BT000770.1 gen TcDBBT AF297618 CcAT1 AXB26761.1 1. 184 AtEPS1 NM 126116.2 CcAT2 AXB26762.1 67510MX5 PaxASAT3 KT716260.1 Ih3AT1 AB217625.1 Ih3AT2 AB242298.1 SsiASAT3 KY978748.1 MsAATMP TAX025506 sO ShASAT2 KT359561.1 SlASAT2 NM 001329392.1 BdPMT HG421450.1 gen ZmpCAT BT042717.1 2 OsSAT1 gen OsSAT2 XM 015763244.1 gen PaxASAT2 KT716259.1SlASAT3 CmAAT1 CAA94432.1 SlASAT1 NM 001329403.1 CbBEBT AF500200 SsiASAT2 KY978747.1 CmAAT3 AY859053 NtBEBT AF500202 PaxASAT4 KT716261.1 1 PhBPBT AY611496 0 PaxASAT1 KT716258.1 PtBEBT KP228019.1 PtSABT KP228018.1 SsiASAT1 KY978746.1 7 Tree scale: 0.1 AtCHAT AF500201.1 CaPun1 NM 001324769 gen LaHMT HLT AB181292 CrDAT AF053307 5 VlAMAT AY705388 CrMAT AF253415 MdAAT1 AY707098 3 MdAAT2 AY517491.1 gen EcBAHD8 KC140150.1 4 SlAAT1 KM975322.1 EcCS KC140149.1 SpAAT1 KM975321.1 6 ArHPT1 QAA12830.1 SsiASAT5 KY978749.1 PvHHHT KX443573.1 FaAAT AF193789 TfHCT2 EU861219.1 FvVAAT AX025504 AtSHT AT2G19070.1 CiSHT1 MG457243.1 RhAAT1 AY850287 CiSHT2 MG457244.1 CmAAT4 AY859054 OsHCT XM 015786263.1 PvHCTLike1 AFY17066.1 AtTHAA1 At5g47980 MoRAS FR670523.1 LanAAT1 DQ886904.1 AtBIA1 NP 193275.1 gen PsRAS AM283092.1 AtTHAA2 At5g47950 DcHCBT2 Z84386 ECHQT JQ413187.1 SmSpmHT AKP24035.1 CcaHQT EF153931.1 NtHQT AJ582651 SrSpmHT AMB21755.1 SlHQT AJ582652.1 SlASAT4 SlHQT Solyc07g005760.2.1 NaCV86NaDH29 JN390825.1 JN390824.1 gen CiHQT1 KT222893.1 AsFMT JA758320.1 CcHQT1 AM690438.2 CiHQT3 KT222895.1 Vv3AT KM267559.1 CcHQT2 EU839580.1 CiHQT2 KT222894.1 PvHCT1a AB723827.1 AsaHHT1 AB076980 PvHCT2a KC696573.1 SbHCT XM 002452390.2 SqTAITAT MT024677 PrHCT EF121452.1 MpolHCT Mapoly0003s0277.1.p CbBEAT AF043464 PpHCT1 KU513965.1 SmHCT1a XM 002979015.2 AtHCT NM 124270.4 PtHCT1 EU603313.1 PtHCT6 XM 006368430.2 CsHCT JN005932.1 gen Ss5MAT2RsACT AY383734 AJ556780 TfHCT1A EU861218.1

1.98415

PsSALAT AF339913

ObCAAT2 QKK36037.1 PaxCFAT DQ767969.1 1J NaAT1HvACT JN390826.1 AY228552

F F

SlACT1 Solyc11g071470.1 1TC

OsTBT1 Os11g42290 NtHCT AJ507825 OsTBT2 Os11g42370 OsTHT1 AK287765.1 SlACT2 Solyc11g071480.1.1

CiHCT2 KT222892.1 H CiHCT1 KT222891.1

CcaHCT EF137954.1 PsHCT2 FN647681.1

OsTHT2 XM 015757482.1

SlHCT Solyc03g117600.2.1

Figure S3. Defining BAHD clades. The tree was rooted using the algal enzyme clade (Clade 0a). Maroon circles on branches refer to clades with bootstrap values > 70. Clades were defined based on deepest, high-confidence monophyletic clades. Clades 1-4 are same as D’Auria et al, 2006 definitions, while Clade V from that study is divided into Clades 5-7 here, based on the above criterion. Branch colors indicate the different clades. Branch lengths indicate number of amino acid substitutions per site. bioRxiv preprint doi: https://doi.org/10.1101/2020.11.18.385815; this version posted November 20, 2020. The copyright holder for this preprint (which was not certified by peer review) is the author/funder. All rights reserved. No reuse allowed without permission. Figure S4

A E-value

bits 2 1.9e-248 1. SF P R E T N K 1 VI L H H H F Y H M H S C T LT S R DL Y K L I L Q H A Y Y S PT I H R F TG K LAD K S V V MV RT ET Q Q F V R F A Q A A E TI I H VPYNKLKQSVY RHVQT I LAR 1 LS2 3 4 5 6 7 8 9 0 S I F P Y 10 11 12 L13 P14 15 16 17 18 19 L20 21 22 23 24 25 26 S27 28 29 PLTF L P Y P MEME (no SSC) 19.09.2020 01:00 4 FD W F

bits 2 1.2e-402 2. V NS A L SV I 1 I N R G Y R F V K I C FS G L N Y A M T V TLM T I G S I S ST L Q L V L S A Q L S K S H A A V V K EV G S SLT R H T LT S R TN M I P H S V T H I RKN G N T FN NVY L GQ V N FTE I N H S L M F Y MY S E L I T T AAA F LI V KD FVAMA ASAN C I SA A NVLG GEM I E 1 0 2 3 V4 5 6 7 8 9 C A A 10 11 12 13 14 15 16 S17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 32 33 34 35 36 37 38 39 K40 41 S Q P G I G H A T K MEME (no SSC) 19.09.2020 01:01 4 T F H D F W

bits 2 4.2e-248 3. E F 1 H Q I W LFQS VY Y VI Q K DK I T L T L V K S T T R Q Y L HN V DT N K D N T V R S F I T K FY T YR S I R V H R R P SK D L N KM H R S MH A A AC ALF I E KK I I D VLVTCHVI 1 2 3 4 5 V6 7 8 9 F L 0 L 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 K S S T HY P AG MEME (no SSC) 19.09.2020 01:01 4 F P L L L

bits 2 4.5e-221 4. TT RVD L D L E VAPC V K F L K 1 E H D PG K G A V A I L G K I K SN Y S V E AV S NM V L E L S VA Y L V K P VA R A V I KV G S G S V S N G V S SA I N Y T Y T K E F H ENG A SR F R W A R N K L Q I R T I A C S AF Q TNNN Y DG S TQ K G LV M K M EK I E L S PE TH K L G AE DA S Q H M A G F F L L C C AH ST C AMT AI I QK EKYSAD CALVT TSA VTD M D 1 0 2 3 4 5 6 7 8 9 L K A

10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 30 31 V32 33 34 35 36 37 38 39 40 41 P FG C E G I MEME (no SSC)I 19.09.2020 01:01 4 Y N

bits 2 9.9e-192 5. E V I LVGD G S A Q G D 1 S V E I K SRKE F M H S E V A V E Q ES VPKVF L NKEVF SDPMP T SN LY S N ADR G I C R E K P QL T I CT A TA A EN I SN S T V K I LST GAAT N M S HD F D M F A K N I D K E SL H A G T G A A F D D QD C MV F A VT M A D I SH LI G VI 1 0 2 3 4 5 6 7 G8 9 WA A TST A 10 11 12 13 14 15 16 17 18 19 20 21 22 23 24 25 26 27 28 29 S FT T Y C K MEME (no SSC) 19.09.2020 01:02 B

Lp3MAT1 AY500352 Vh3MAT1 AY500350 Group 1 Ss5MAT1 AF405707 Pf3AT AB029340 Dm3MAT1 AY298809 NtMAT1 AB176525 Dm3MAT2 AY298810Gt5AT AB010708

Dm3MAT3 AB290338.1Pc3MAT AY190121 Dp3MAT AF489108 MtMaT1 EU272030.1 GmIF7MaT NM 001250831.1MtMaT2 EU272032.1 MtMaT3 EU272031.1 AtCER2 AY087262 gen Kni kfl00513 0110 v1.1 GmIMaT1 KY399789.1 Kni kfl00302 0150 v1.1 Kni kfl00070 0280 v1.1 Mpus 49937 Oluc 28702 Mpus 123940 Cbra bGBG71901.1 Cbra aGBG71897.1 Cbra dGBG76279.1 Cbra cGBG71902.1 GmMT7 EU192928.1 MeHFT MeHFT GmIMaT3 KY399790.1 MpolFHT Mapoly0157s0023.1.p AtDCF BT010448.1 AtFACT AY142537.1 At5Mat NM 113880.2 StFHT NM 001288261.1 AtASFT HHT1 AY062996.1 AtACT NM 125509.3 PtFHT1 JX515962.1 AtSCT BT009686.1 At3AT1 NM 100275.3 AtSDT NM 127915.2 At3AT2 NM 100232.5 TcDBNTBT AF466397 Group 2 TcDBAT AF193765 LanAAT2 DQ886905.1 TcTAT AF190130 ObCAAT1 QKK36036.1 2a 7b TcBAPT AY082804 AtDCR BT000770.1 gen TcDBBT AF297618 1b 7e CcAT1 AXB26761.1 1.418567510MXTMPsO AtEPS1 NM 126116.2 CcAT2 AXB26762.1 PaxASAT3 KT716260.1 Ih3AT1 AB217625.1 0a 7f Ih3AT2 AB242298.1 SsiASAT3 KY978748.1 7a MsAAT AX025506

ShASAT2 KT359561.1 Clade 2 7g SlASAT2 NM 001329392.1 BdPMT HG421450.1 gen 1a ZmpCAT BT042717.1 7d OsSAT1 gen 1c Clade 1 OsSAT2 XM 015763244.1 gen PaxASAT2 KT716259.1SlASAT3 CmAAT1 CAA94432.1 SlASAT1 NM 001329403.1 7c CbBEBT AF500200 SsiASAT2 KY978747.1 CmAAT3 AY859053 NtBEBT AF500202 PaxASAT4 KT716261.1 Clade 7 PhBPBT AY611496 PaxASAT1 KT716258.1 PtBEBT KP228019.1 PtSABT KP228018.1 SsiASAT1 KY978746.1 AtCHAT AF500201.1 CaPun1 NM 001324769 gen 3b LaHMT HLT AB181292 Group 5 CrDAT AF053307 VlAMAT AY705388 CrMAT AF253415 Clade 5 MdAAT1 AY707098 MdAAT2 AY517491.1 gen Clade 3 EcBAHD8 KC140150.1 SlAAT1 KM975322.1 EcCS KC140149.1 5a 5c SpAAT1 KM975321.1 3a ArHPT1 QAA12830.1 SsiASAT5 KY978749.1 5b PvHHHT KX443573.1 FaAAT AF193789 TfHCT2 EU861219.1 FvVAAT AX025504 AtSHT AT2G19070.1 CiSHT1 MG457243.1 RhAAT1 AY850287 3c CiSHT2 MG457244.1 CmAAT4 AY859054 OsHCT XM 015786263.1 Clade 4 Clade 6 PvHCTLike1 AFY17066.1 AtTHAA1 At5g47980 MoRAS FR670523.1 LanAAT1 DQ886904.1 AtBIA1 NP 193275.1 gen PsRAS AM283092.1 AtTHAA2 At5g47950 3d 6a DcHCBT2 Z84386 ECHQT JQ413187.1 SmSpmHT AKP24035.1 CcaHQT EF153931.1 SrSpmHT AMB21755.1 4a NtHQT AJ582651 SlHQT AJ582652.1 SlASAT4 SlHQT Solyc07g005760.2.1 NaCV86NaDH29 JN390825.1 JN390824.1 gen 4b CiHQT1 KT222893.1 AsFMT JA758320.1 CcHQT1 AM690438.2 CiHQT3 KT222895.1 Vv3AT KM267559.1 CcHQT2 EU839580.1 CiHQT2 KT222894.1 PvHCT1a AB723827.1 AsaHHT1 AB076980 PvHCT2a KC696573.1 SbHCT XM 002452390.2 SqTAITAT MT024677 PrHCT EF121452.1 MpolHCT Mapoly0003s0277.1.p CbBEAT AF043464 PpHCT1 KU513965.1 SmHCT1a XM 002979015.2 AtHCT NM 124270.4 PtHCT1 EU603313.1

CsHCT JN005932.1 gen PtHCT6 XM 006368430.2 Ss5MAT2RsACT AY383734 AJ556780 TfHCT1A EU861218.1

1.984151JF B1TCHfT 1.984151JF Group 4 PsSALAT AF339913 ObCAAT2 QKK36037.1 PaxCFAT DQ767969.1 NaAT1JN390826.1HvACT AY228552

SlACT1 Solyc11g071470.1

OsTBT1 Os11g42290 NtHCT AJ507825 OsTBT2 Os11g42370 OsTHT1 AK287765.1 SlACT2 Solyc11g071480.1.1

CiHCT2 KT222892.1 CiHCT1 KT222891.1

CcaHCT EF137954.1 PsHCT2 FN647681.1

OsTHT2 XM 015757482.1

Group 3 SlHCT Solyc03g117600.2.1

Figure S4. Sequences used for motif enrichment analysis. (A) Five top most enriched motifs in anthocyanin/flavonoid-acylating BAHD acyltransferases. (B) Groups of sequences that were further analyzed with respect to the TFFDxxW (1. motif) and YFGNC (4. motif). The same tree as in Fig. 4 is shown. Black circles on branches refer to clades with bootstrap values > 70. Clades not analyzed in more detail are displayed in light gray and bootstrap values are not indicated. Groups of sequences correspond to Fig. 4. Group 5, highlighted in purple, contains the sequences of anthocyanin/flavonoid-acylating BAHDs that were analyzed in more detail. bioRxiv preprint doi: https://doi.org/10.1101/2020.11.18.385815; this version posted November 20, 2020. The copyright holder for this preprint (which was not certified by peer review) is the author/funder. All rights reserved. No reuse allowed without permission. Figure S5

A B Clade 1a/b Clade 1a/b Clade 5a/b Clade 5a/b

Figure S5. Alignment of HCT/HQT-like and anthocyanin/flavonoid-acylating BAHDs. (A) Alignment of the TFFDxxW region of sequences belonging to clade 1a/b (anthocyanin/flavonoid) and 5a/b (HCT/HQT). (B) Alignment of the same sequences for the YFGNC region. Conserved (95%) residues are highlighted in colors. The positions of the highly conserved Trp and Cys residues are highlighted with a box. bioRxiv preprint doi: https://doi.org/10.1101/2020.11.18.385815; this version posted November 20, 2020. The copyright holder for this preprint (which was not certified by peer review) is the author/funder. All rights reserved. No reuse allowed without permission. Figure S6

A B

W36A Distance (Å) Distance Distance (Å) Distance C320A C/A320:HA - F32:pi-system C/A320:HA - F32:pi-system

Time (ns) Time (ns)

C D E

2.77 Å

4.82 Å 3.14 Å

3.74 Å 3.73 Å 13.29 Å

F G

3.19 Å A

∩ C3G A B θ Ring B evaluate B stacking 13.73 Å interaction

Ring A

Figure S6. Analysis of distance fluctuations in Dm3MAT3 variants. (A) Distance calculations between backbone hydrogen of C/A320 and the center of mass of the aromatic ring of F32 for the apo simulation. WT is represented as purple, W36A is represented as orange-red, and C320A is represented as green. (B) Distance calculations for the holo simulation (C) Stacking rearrangements of phenylalanine aromatic sidechains within the TFFDXXW motif of C320A Dm3MaT3. Amino acid coloring: F31, cornflower blue; F32, hot pink; F35, spring green; W36, H170, A320, and C3G are colored as in previous images. Malo- nyl-CoA and W383 are hidden for simplicity. Distance fluctuations between A320 alpha hydrogen and F32 aromatic system cause aromatic stacking reorganization in the TFFDXXW motif. A catalytically competent distance between C3G-6”-OH and H170 is maintained. (D) C3G can still undergo reaction as F35 breaks its t-stacking with W36 to stabilize F31 and F32. (E) F31 and F32 have been stabilized. F32 moves closer to A320 while F35 returns to t-stack with W36, although C3G has distanced itself from H170. (F) Stacking interactions between residues in the active site and across the TFFDXXW motif have been reset, but now C3G is excluded from re-entering the active site due to steric and non-conventional bonding interactions with peripher- al residues. (G) Schematic demonstrating θ calculations for discriminating between face-to-face and edge-to-face stacking interactions along the TFFDXXW motif. Figure and methodology as described in the Data Analysis subsection from the Main Text. Rings A and B represent the aromatic systems of two different residues. The normal vectors for each ring were then calcu- lated so that the point of intersection between Rings A and B could be determined. Solving for the angle between the center of mass of Ring A, the center of mass of Ring B, and the intersection of the rings’ normal vectors, allowed for the supplementary angle, θ, to be determined. When θ ≤ 30° or 150° ≥ θ and the distance between the aromatic systems’ centers of mass is ≤ 4.4 Å, face-to-face stacking is occurring. When 60° ≤ θ ≤ 120° and the distance between the aromatic systems’ centers of mass is ≤ 5.5 Å, edge-to-face stacking is occurring. When 30° < θ < 60° or 120° < θ < 150° or the distance requirements for either form of stacking are unmet, no stacking interaction is occurring. bioRxiv preprint doi: https://doi.org/10.1101/2020.11.18.385815; this version posted November 20, 2020. The copyright holder for this preprint (which was not certified by peer review) is the author/funder. All rights reserved. No reuse allowed without permission. Figure S7

A aC320 stackings 32 0A F31-F32 distance (Å) 32 0A F31-F35 distance (Å) aC aC Time (ns) Time (ns) an ce (Å) 32 0A F32-F35 distance (Å) 32 0A F35-W36 dist aC aC Time (ns) Time (ns) face-to-face stacking edge-to-face stacking no stacking (can include) θ ≤ 30° or 150° ≥ θ 60° ≤ θ ≤ 120° 30° < θ < 60°or120°< θ < 150° distance ≤ 4.4 Å distance ≤ 5.5 Å distance criteria for stacking unmet B hC320A stackings 32 0A F31-F32 distance (Å) 32 0A F31-F35 distance (Å) hC hC Time (ns) Time (ns) an ce (Å) 32 0A F32-F35 distance (Å) 32 0A F35-W36 dist hC hC Time (ns) Time (ns)

face-to-face stacking edge-to-face stacking no stacking (can include) θ ≤ 30° or 150° ≥ θ 60° ≤ θ ≤ 120° 30° < θ < 60°or120°< θ < 150° distance ≤ 4.4 Å distance ≤ 5.5 Å distance criteria for stacking unmet

Figure S7. Stacking interactions for the C320A mutant. (A) Apo C320A (aC320A) stacking interactions categorized as face-to-face stacking, edge-to-face stacking, or no stacking interactions. (B) Holo C320A (hC320A) stacking interactions. Face-to-face stacking is represented as blue, edge-to-face stacking as orange, and no stacking as gray. Distance measurements were taken between the centers of mass of each residue listed on the y-axis of each panel. bioRxiv preprint doi: https://doi.org/10.1101/2020.11.18.385815; this version posted November 20, 2020. The copyright holder for this preprint (which was not certified by peer review) is the author/funder. All rights reserved. No reuse allowed without permission. Figure S8 A aW36A stacking aW36A F31-F35 aW36A distance (Å) aW36A F31-F32 aW36A distance (Å) Time (ns) Time (ns)

face-to-face stacking θ ≤ 30° or 150° ≥ θ distance ≤ 4.4 Å

edge-to-face stacking 60° ≤ θ ≤ 120° distance ≤ 5.5 Å

no stacking (can include) 30° < θ < 60°or120°< θ < 150° distance criteria for stacking unmet aW36A F32-F35 aW36A distance (Å) Time (ns)

B hW36A stacking hW36A F31-F35 hW36A distance (Å) hW36A F31-F32 hW36A distance (Å) Time (ns) Time (ns)

face-to-face stacking θ ≤ 30° or 150° ≥ θ distance ≤ 4.4 Å

edge-to-face stacking 60° ≤ θ ≤ 120° distance ≤ 5.5 Å

no stacking (can include) 30° < θ < 60°or120°< θ < 150° distance criteria for stacking unmet hW36A F32-F35 hW36A distance (Å) Time (ns)

Figure S8. Stacking interactions for the W36A mutant. (A) Apo W36A (aW36A) stacking interactions categorized as face-to-face stacking, edge-to-face stacking, or no stacking interactions. (B) Holo W36A (hW36A) stacking interactions. Face-to-face stacking is represented as blue, edge-to-face stacking as orange, and no stacking as gray. Distance measurements were taken between the centers of mass of each residue listed on the y-axis of each panel. Only three panels are provided because W36A substitution prevents F35-W36 stacking from occurring. bioRxiv preprint doi: https://doi.org/10.1101/2020.11.18.385815; this version posted November 20, 2020. The copyright holder for this preprint Figure S9(which was not certified by peer review) is the author/funder. All rights reserved. No reuse allowed without permission.

A aWT stackings an ce (Å) an ce (Å) aWT F31-F32 dist aWT F31-F35 dist Time (ns) Time (ns) an ce (Å) aWT F32-F35 dist aWT F35-W36 distance (Å) Time (ns) Time (ns)

Time (ns) Time (ns) an ce (Å) hWT F32-F35 dist hWT F35-W36 distance (Å) Time (ns) Time (ns) face-to-face stacking edge-to-face stacking no stacking (can include) θ ≤ 30° or 150° ≥ θ 60° ≤ θ ≤ 120° 30° < θ < 60°or120°< θ < 150° distance ≤ 4.4 Å distance ≤ 5.5 Å distance criteria for stacking unmet

Figure S9. Stacking interactions for the WT Dm3MAT3. (A) Apo WT (aWT) stacking interactions categorized as face-to-face stacking, edge-to-face stacking, or no stacking interactions. (B) Holo WT (hWT) stacking interactions. Face-to-face stacking is represented as blue, edge-to-face stacking as orange, and no stacking as gray. Distance measurements were taken between the centers of mass of each residue listed on the y-axis of each panel. Figure S10 A is representedasorange-red,andC320A isrepresentedasgreen. acceptor sitefor(A)WT, (B)W36A,and(C)C320A variants.WT isrepresentedaspurple,W36A Figure S10.Substratedocking. Frequency bioRxiv preprint (which wasnotcertifiedbypeerreview)istheauthor/funder.Allrightsreserved.Noreuseallowedwithoutpermission. doi: https://doi.org/10.1101/2020.11.18.385815 Cyanidin 3-O-glucoside (C3G)dockingintotheDm3MaT3 Cyanidin3-O-glucoside B Binding affinity (kcal/mol) WT ; this versionpostedNovember20,2020. W36A C320A C The copyrightholderforthispreprint bioRxiv preprint doi: https://doi.org/10.1101/2020.11.18.385815; this version posted November 20, 2020. The copyright holder for this preprint (which was not certified by peer review) is the author/funder. All rights reserved. No reuse allowed without permission. Figure S11 A

WT Dm3MAT3W36A variantC320A variant WT Dm3MAT3W36A variantC320A variant

75 kDa 75 kDa

expected size of purified protein 50 kDa 50 kDa

20 ug protein 40 ug protein

B 200 180 160 140 120 100 WT mAU 80 W36A 60 40 C320A 20 0 25 75 125 175 225 275 Elution Volume (mL)

Figure S11. SDS-PAGE and Size Exclusion Chromatography of Dm3MAT3 variants. (A) Coomassie-stained SDS-PAGE of Dm3MAT3 variants purified to homogeneity using Ni-NTA-agarose. 20 and 40 ug protein were separated on a 12% gel. Similar migration pattern and purity for all variants was observed. (B) Size exclusion chromatography traces of the different Dm3MAT3 variants show that mutant proteins retain to similar elution volumes as wild-type, indicating proper size and shape of the protein.