Occurrence and Taxonomy of Arctic Warblers (Phylloscopus Borealis) Sensu Lato in North America

The Wilson Journal of Ornithology 128(2):268–277, 2016

OCCURRENCE AND TAXONOMY OF ARCTIC WARBLERS (PHYLLOSCOPUS BOREALIS) SENSU LATO IN NORTH AMERICA

JACK J. WITHROW,1,4 DANIEL D. GIBSON,1 YURI GERASIMOV,2 NICKOLAY GERASIMOV,2 ALEXANDER SHESTOPALOV,3 AND KEVIN WINKER1

ABSTRACT.—We reviewed the taxonomic status of Arctic Warblers (Phylloscopus borealis) sensu lato occurring in North America following the splitting of the complex into three species by the American Ornithologists’ Union (Chesser et al. 2014). We used phenotypic and genetic markers to assess the status of this species complex in North America and identified Arctic-type warblers occurring in the Aleutian Islands as Kamchatka Leaf Warblers (P. examinandus). This species occurs at least occasionally through the Bering Sea, to the Alaska mainland, and as far east as arctic Canada. Measurements of Arctic and Kamchatka Leaf warblers were found to differ by only a small degree, offering no simple diagnostic characteristics. In addition, we recommend maintaining the long-recognized Alaska subspecies P. b. kennicotti as a synonym of P. b. borealis. Received 19 February 2015. Accepted 18 September 2015.

Key words: Alaska, Arctic Warbler, Kamchatka Leaf Warbler, Northwest Territories, Phylloscopus examinandus,Russia.

The recent splitting of the Arctic Warbler into Furthermore, the sole record of an Arctic Warbler three species by the American Ornithologists’ from high-arctic Canada had been assessed as Union (Chesser et al. 2014) – Arctic Warbler P. b. borealis, because it was “too large to be of (Phylloscopus borealis), Kamchatka Leaf Warbler the Alaska race” (Godfrey 1966:305). We clarify (P. examinandus), and Japanese Leaf Warbler the status of the Arctic Warbler complex in North (P. xanthodryas) – based on differences in America using genetic and morphometric data. morphology, song, and mitochondrial DNA (Saitoh et al. 2008, 2010; Alstro¨m et al. 2011), prompted METHODS us to review and clarify the status of these forms in We sequenced the cytochrome oxidase subunit North America. Spring and fall migrants through b gene (cyt b), in whole or in part, for a total of the western and central Aleutian Islands had 26 individuals considered to be (or likely to be) been phenotypically identified as belonging to from populations other than those breeding in one of the larger Asian-breeding taxa (Gibson and Alaska or individuals likely to provide compara- Byrd 2007), and not as examples of the supposedly tive value: 14 collected in the western Aleutian smaller Alaska-breeding birds, historically dis- Islands, two from St. Lawrence Island, one cussed as P. borealis kennicotti (Hellmayr 1934, from St. Matthew Island, two from mainland Gabrielson and Lincoln 1959, Gibson and Kessel Alaska, six from Kamchatka, Russia, and one 1997). In part because of the morphological from Canada (Appendix A). These sequences similarity of the taxa formerly maintained within were compared to published sequences (Saitoh P. borealis, the identification and taxonomic status et al. 2010, Alstro¨m et al. 2011; see Appendix B) of the complex in general and of the migrant birds representing the three species formerly recognized occurring in parts of western Alaska has been as constituting the Arctic Warbler to confirm the complicated and inconsistent (see Hartert 1920; identity of North American specimens. Portenko 1938, 1973; Ticehurst 1938; Vaurie 1954, We extracted DNA from frozen and ethanol- 1959; Dement’ev and Gladkov 1968; Ornitholog- preserved tissues with a DNeasy tissue kit ical Society of Japan 1974, 2000; Williamson 1976; (QIAGEN Inc., Valencia, CA, USA) by following Gibson 1981; Watson 1986; Bairlein et al. 2006). the manufacturer’s protocol. Polymerase chain reaction (PCR) amplifications were performed 1 University of Alaska Museum, 907 Yukon Drive, using cyt b primers H16065 (Helbig et al. 1995) Fairbanks, Alaska 99775, USA. and L14970 (Leisler et al. 1997) following the 2 Kamchatka Branch of Pacific Institute of Geography, protocols in Withrow et al. (2014). PCR thermal Far East Branch of Russian Academy of Sciences, Pr. regime started with 6 mins at 96 C followed by Rybakov, 19a, Petropavlovsk-Kamchatsky, 683024, Russia. u 3 Research Institute of Experimental and Clinical Med- 4 cycles of 92uC for 2 mins, 56uC for 30 secs, and icine, Novosibirsk, 630559, Russia. 72uC for 40 secs and a further 24 cycles of 92uC 4 Corresponding author; e-mail: [email protected] for 20 secs, 50uC for 30 secs, 72uC for 40 secs. 268 Withrow et al. N ARCTIC WARBLERS IN NORTH AMERICA 269

PCR cleanup and sequencing were done at the much as by plumage coloration (Ticehurst 1938, High-Throughput Genomics Unit (University of Vaurie 1954, Gibson 1991, Saitoh et al. 2008). Washington, Seattle, USA), using an ExoSAP We assessed size differences using statistical cleaning process, cycle-sequenced using BigDye differences (t-tests); however, because this method chemistry on an ABI 3730KL high-throughput can be hard to interpret and is influenced by sample capillary sequencer (Applied Biosystems Inc., size (Nakagawa and Cuthill 2007) we also used Foster City, CA, USA) using the same primers a percent overlap of populations that allowed us to as initial sequencing. We aligned and edited estimate the number of birds falling in the zone of the sequences with Sequencher 4.7 (Gene Codes equivocal measurements. To do this, we assumed Corp., Ann Arbor, MI, USA) and archived them in population measurements were normally distribut- GenBank (Appendix A). ed and calculated the percentage of birds falling For older specimens (see Appendix A) for which below the 97.5 percentile of examinandus and frozen tissues did not exist, DNA was extracted above the 97.5 percentile of borealis, i.e., those in from specimen toe pads, again using a DNeasy the zone of overlap for all but the most extreme tissue kit and following the manufacturer’s proto- 5% of a population. Using both methods max- cols except that the elution step used just half imizes the utility and interpretability of our data the volume to obtain a higher concentration of for field and in-hand identifications of borealis and DNA. PCR amplifications were performed on skin examinandus. material following Alstro¨m et al. (2011; U. Olsson, JJW measured 29 examinandus and 27 borealis in litt. 2014). These primers were TGCCTAGT- for bill length (nares to tip), bill width (at distal TACACAAATCGTCACA (exam1F) with reverse end of nares), and wing chord (sensu Winker primer AGGCGGTTGCTATTAGGGTCAGTA 2000; see Appendix C), measurements reported to (exam1R) and an overlapping section with forward be representative or indicative of differences primer CAATGGCGCTTCCTTCTTCTTTAT between these taxa (Vaurie 1954, Saitoh et al. (exam2F) and reverse primer TGTTTGATCCC 2008). Two birds from Amchitka Island at USNM GTTTCGTGTAGTA (exam2R). PCR thermal were measured by Brian Schmidt, and the Canada regime started with 5 mins at 95uC followed by bird was measured by Michel Gosselin (for a total four cycles of 95uC for 30 secs, 60uC for 30 secs, of 32 examinandus). Birds whose species status and 72uC for 30 secs, then four-cycles of 95uC was not confirmed by sequencing were all taken for 30 secs, 58uC for 30 secs, 72uC for 30 secs, in June, July, or August from known breeding and finally 36-cycles of 95uC for 30 secs, 56uC for sites in Alaska or Kamchatka (our northernmost 30 secs, 72uC for 30 secs, ending with 72uC Russian specimen was taken at 56.35u N) and were for 5 mins. This protocol resulted in a diagnostic thus assumed to represent borealis or examinandus, ,480 bp fragment near the beginning of the cyt b respectively. Our sample consisted of 44 males, gene. All sequence data were visualized and com- 9 females, and 6 individuals of unknown sex. pared to other published sequences using a median- Plumage variation was examined by eye under joining haplotype network (Bandelt et al. 1999) as full-spectrum lighting against a neutral-gray implemented in Network Publisher (Fluxus Tech- background by JJW, KW, and DDG, although nology Ltd., Suffolk, United Kingdom). sample sizes of uniform age, season, sex, and Published phenotypic comparisons between preparation were small (see Appendix C). examinandus and borealis (sensu stricto)are effectively lacking, because most authors since RESULTS Ticehurst (1938) have treated examinandus as a synonym of xanthodryas (Vaurie 1959, William- Our cyt b haplotype network (Fig. 1) clearly son 1976, Watson 1986, Bairlein et al. 2006; shows that all of the sequenced Aleutian Islands but see Saitoh et al. 2008), the most phenotypically birds are examinandus. In addition, one indivi- distinct member of this complex, resulting in dual from St. Matthew Island in the northern Bering exaggerated reported differences because exam- Sea and one from Old Chevak on the Yukon- inandus is phenotypically intermediate between Kuskokwim Delta had examinandus haplotypes xanthodryas and borealis (Ticehurst 1938, (Fig. 1, 2). High-arctic Canada’s extralimital re- Saitoh et al. 2008). Traditionally and more record also turned out to be examinandus. In contrast, cently, differences between borealis and exami- the two specimens from St. Lawrence Island nandus/xanthodryas were determined by size as and one from Fairbanks had borealis haplotypes. 270 THE WILSON JOURNAL OF ORNITHOLOGY N Vol. 128, No. 2, June 2016

FIG. 1. We constructed a haplotype network by using 82 sequences from three species formerly constituting Arctic Warbler, sensu lato; see Appendix A and B for details. White represents Phylloscopus xanthodryas, dark gray P. borealis, and light gray P. examinandus. Black circles and areas denote sequences generated for this study. Small open circles denote unsampled haplotypes. Circles are proportional to the number of individuals with that haplotype; the number of individuals with a given haplotype is presented if more than one.

No birds showed haplotypes associated with the Wing chords of examinandus (mean 69.1 mm, Japanese Leaf Warbler. SD 5 2.77) and borealis (mean 64.6 mm, Bivariate plots of wing chord vs. bill length SD 5 2.97) were significantly different (Fig. 3) showed two relatively distinct clusters. (t 5 5.95, df 5 56, P , 0.001). Bill lengths of

FIG. 2. Sampling distribution of Phylloscopus xanthodryas (open circles), P. borealis (dark grey circles), and P. examinandus (light grey circles) based on haplogroup association (see Fig. 1) used to assess the genetic affinities of North American records. North American records of P. examinandus show a clear pattern of spring over-shoot migration. Withrow et al. N ARCTIC WARBLERS IN NORTH AMERICA 271

FIG. 3. Wing and bill measurements of 32 P. examinandus and 27 P. borealis. See Appendix C for specimens examined. examinandus (mean 7.5 mm, SD 5 0.40) and minute differences, and in the birds visually borealis (mean 6.6 mm, SD 5 0.36) were also examined we found individual plumage varia- significantly different (t 5 8.15, df 5 56, tion to be greater than any other differences P , 0.001). Bill width (data not shown) also between examinandus and Alaska borealis (see showed differences, with examinandus (mean Appendix C). 3.12 mm, SD 5 0.16, n 5 24, range 2.9–3.5) and borealis (mean 2.68 mm, SD 5 0.16, range DISCUSSION 2.4–3.0) again showing significant differences Kamchatka Leaf Warblers are intermittent (t 5 9.57, df 5 49, P , 0.001), with little spring (date range 1–22 June) and casual fall (date overlap between the specimens (some examinan- range 16 Sep–23 Oct) migrants in the western dus had damaged bills, hence the smaller sample Aleutians, occasionally reaching as far east as the size). Although significant, these differences are central Aleutians (Amchitka Island; Kenyon 1961, small. The percentages of birds falling in the areas Gibson and Byrd 2007). All Aleutian specimens of overlap were high. Wing chord showed the known to us of “Arctic” warblers are examinandus. most overlap, with 65.3% of individuals display- Echoing Gabrielson’s own hesitance, we are ing equivocal wing measurements. Percentages inclined to dismiss his sight report of an Arctic were lower for bill length (34.4%) and bill width Warbler from St. Matthew Island (Gabrielson (23.5%); both would approach or exceed 50% if 1944, Gabrielson and Lincoln 1959, Winker et al. the full range of variation (99% or more) was 2002), especially because the specimen taken by considered. In an attempt to use all measurements him at Brooks Lake on the Alaska Peninsula to diagnose individuals, we summed wing chord, and widely reported (Gabrielson 1944, Cahalane bill length, and bill width into a single value. 1959, Gabrielson and Lincoln 1959) as an Arctic The combined measurements had an estimated Warbler is instead an Orange-crowned Warbler overlap of 43.8%, similar to the actual overlap of (Oreothlypis celata; USNM 591957, examined 20 of 51 (39.2%) shown by our birds (Fig. 3). DDG). Thus, the only record from St. Matthew Females averaged smaller than males (data not Island, 11 July 1985, is of examinandus. A record shown), and the percentage overlaps when only from Old Chevak on the Yukon–Kuskokwim males were considered were (53.6%), (50.3%), River Delta on 5 July 1975 is of examinandus. and (24.5%) respectively. One fall specimen from Nunivak Island appears Putative color differences between taxa within to be P. borealis (Swarth 1934; CAS 30761, the old Arctic Warbler complex have usually examined DDG), although we did not sequence the been prefaced by adjectives that suggested bird. In the Pribilof Islands Arctic-type warblers 272 THE WILSON JOURNAL OF ORNITHOLOGY N Vol. 128, No. 2, June 2016

TABLE 1. Records of Kamchatka Leaf Warbler (Phylloscopus examinandus) in North America arranged by date. All locations except for the first one are in Alaska. The United States National Museum is abbreviated USNM, University of Alaska Museum as UAM, and Canadian Museum of Nature as CMN. Ad 5 adult, HY 5 hatch year, unk 5 unknown.

Voucher number Age, sex Date Location CMN 35173 Ad, = 21 July 1949 NW Territories, Prince Patrick I. USNM 465415a unk, = 17 October 1957 Aleutian Islands, Amchitka Island USNM 465421a unk, = 23 October 1957 Aleutian Islands, Amchitka Island UAM 7053 Ad, = 5 July 1975 Yukon-Kuskokwim Delta, Old Chevak UAM 3583a Ad, = 13 June 1977 Aleutian Islands, Attu Island UAM 4876a Ad, unk 18 July 1978 Aleutian Islands, Buldir Island UAM 3692a Ad, = 25 September 1978 Aleutian Islands, Shemya Island UAM 5248 Ad, = 11 July 1985 St. Matthew Island UAM 5343 Ad, = 9 June 1986 Aleutian Islands, Attu Island UAM 11451 Ad, = 5 June 1999 Aleutian Islands, Shemya Island UAM 17665 Ad, = 10 June 2002 Aleutian Islands, Shemya Island UAM 17702 HY, R 20 September 2002 Aleutian Islands, Shemya Island UAM 18003 HY, =? 11 October 2002 Aleutian Islands, Shemya Island UAM 18004 HY, = 11 October 2002 Aleutian Islands, Shemya Island UAM 27030 unk, = 19 September 2005 Aleutian Islands, Shemya Island UAM 27032 HY, = 24 September 2007 Aleutian Islands, Shemya Island UAM 27031 HY, = 24 September 2007 Aleutian Islands, Shemya Island UAM 27029 unk, R 27 September 2007 Aleutian Islands, Shemya Island UAM 28150 HY, = 27 September 2007 Aleutian Islands, Shemya Island UAM 28149 HY, unk 29 September 2007 Aleutian Islands, Shemya Island UAM 24554 HY, unk 11 October 2007 Aleutian Islands, Shemya Island UAM 27636 HY, = 26 September 2010 Aleutian Islands, Shemya Island

a Denotes that bird was not sequenced for cyt b and is assessed as examinandus based on a combination of measurements and probability (P. borealis is unknown in the Aleutian Islands). are intermittent or very rare in spring and fall from Baja California, Mexico (Pyle and Howell (Thompson and DeLong 1969; S. Schuette, in 1993; 12 Oct). litt., 2014). No specimens exist from these Despite statistically significant differences be- islands, where either species might occur. On St. tween borealis and examinandus in all three Lawrence Island, Arctic Warblers are regular measurements, reflecting mean differences in size, migrants (see Lehman 2005). Both Murie (1936) the degree of overlap suggests that while some and Friedmann (1937) discussed such migrants as extreme individuals may be identified, a substantial “P. b. kennicotti,” and the two UAM specimens are percentage will show equivocal measurements indeed P. borealis, thus, this species clearly and thus be impossible to diagnose as one species reaches and departs Alaska via the Bering Strait or the other. Furthermore, it should be pointed region. The only New World record of examinan- out that the bill width measurement is extremely dus outside of Alaska is from Mould Bay, Prince sensitive to inter-observer variation, because less Patrick Island, Northwest Territories on 21 July than half a millimeter separates the taxa, a problem 1949 (Godfrey 1966; see Table 1). South and east also noted by Portenko (1973). Based on these of Alaska there are no Arctic-type warbler records data, measurements alone will identify only a small from British Columbia (Campbell et al. 2001), percentage of birds, and differences are too small Washington (Wahl et al. 2005), or Oregon (OBRC to be instructive in the field. Of course, with birds 2014), but Sinclair et al. (2003) listed one of known age and sex, measurement overlaps hypothetical record of presumed “P. b. kennicotti” among individuals of the same category between from northern Yukon Territory. California has the two species will be less, but without a speci- eight accepted records of Arctic-type warblers men, such information is usually unavailable. but still lacks a specimen (Hamilton et al. 2007, Our morphometric results differ from Saitoh et al. Pike et al. 2014; date range 7–28 September) (2008), who discriminated between the species and currently treats it as a taxon pair (Arctic/ using a size-based principal component analysis. Kamchatka Leaf Warbler), and there is one report However, their limited sample size (6 borealis, Withrow et al. N ARCTIC WARBLERS IN NORTH AMERICA 273

13 examinandus), failure to quantify the size of given disagreement on this issue (e.g., Vaurie their observed differences and thus its robustness 1954, Watson 1986), substantial amounts of when extrapolated to larger sample sizes (popula- genetic structure in this mtDNA clade (Reeves tions), inclusion of measurements from both live et al. 2008, Alstro¨m et al. 2011), and a lack thus and museum specimens (Winker 1993), and use of far of adequate population genetic analyses and a measurement not available from most specimens a modern range-wide phenotypic evaluation, it is (total head length) make their results less than premature to consider the case of subspecies definitive and not directly comparable to our data. within the Arctic Warbler as a whole to be It is useful here to also consider the validity and resolved. history of the long-recognized Alaska subspecies Few Old World passerines have successfully P. b. kennicotti. In his original description, Baird colonized North America, and most of these nest in (1869:314) described kennicotti, from a single disturbed, low brush, or alpine habitats. Arctic specimen, as a species only marginally separable Warblers (sensu stricto), generally preferring from the Willow Warbler (Phylloscopus trochilus), shrubby, partly forested nesting habitat, have stating “if not a distinct species then, as a permanent a larger North American range than all but the geographical variety of P. Eversmanni [5P. Northern Wheatear (Oenanthe oenanthe), which trochilus]”. Ridgway (1904) discussed Alaska probably colonized the continent from both the east birds as P. borealis kennicotti using a series of and west (Bairlein et al. 2012). Both Arctic and seven birds, but he compared them to birds from the Kamchatka Leaf warblers breed on the Kamchatka Commander Islands and Petropavlovsk (P. exam- Peninsula, but their ranges there in relation to one inandus), in retrospect an inappropriate compari- another are not well known. They occur within at son. Ticehurst (1938:132) was able to examine least 320 km of one another (e.g., an Arctic from only two birds identified as kennicotti and so did 59.1uN [Alstro¨m et al. 2011]; a Kamchatka Leaf not judge its validity himself, including it despite from 56.35uN [UAM specimens]) suggesting they reservations communicated by James L. Peters that may be parapatric, because most authorities do not it was “a rather unsatisfactory race.” Portenko describe a break in distribution on the Kamchatka (1938), working with only one Alaska specimen, Peninsula, so from an ecological perspective the did not recognize kennicotti, but later (Portenko two species probably could occur together in 1973), after examining more material, recognized North America as well. Given that the Kamchatka it based on narrower bill widths, dismissing Leaf Warbler is a regular, if intermittent, spring Vaurie’s (1954) color differences. Vaurie migrant through the Commander and Aleutian (1954:18), working from 30 specimens, accepted islands (Johansen 1961, this paper), it certainly has kennicotti based on a smaller (shorter and the potential to colonize North America. However, narrower) bill and “probably valid color it appears to prefer shrubby areas in and near forest difference[s],” an opinion that was followed by of greater stature than the Arctic Warbler (KW, most subsequent authors (Williamson 1976, Wat- pers. obs.). Thus, like many Old World taxa, the son 1986), until Saitoh et al. (2008) and Alstro¨m Kamchatka Leaf Warbler may be too far removed et al. (2011). from suitable New World breeding habitat to The Bering Strait does not appear to be successfully colonize. a significant barrier to gene flow (Reeves et al. 2008) or song type (Matsuda 2002, fide Saitoh ACKNOWLEDGMENTS et al. 2008) in Arctic Warblers, and Phylloscopus warblers in general exhibit extreme morphologi- Brian Schmidt at the Smithsonian Institution, Washington D. C. provided measurements of the two Amchitka Island cal conservatism. Based on the evidence to date, specimens at USNM. Michel Gosselin at the Canadian we agree with Alstro¨m et al. (2011) that it is Museum of Nature, Ottawa, provided measurements and probably a better working hypothesis to consider a toe pad cutting of the Canada specimen. Urban Olsson kennicotti as a synonym of borealis (whose provided primer sequences and protocols for sequencing of type locality is the [northern] Sea of Okhotsk), toe pads. Kyle Campbell generated four of the sequences until series of taxonomically useful material used. CRDF provided support for Kamchatka fieldwork (and we thank Irene Lerman for her invaluable support in making from either side of the Bering Strait are collected that possible), and the Friends of Ornithology provided and can be compared. Other authors have treated funding for the molecular work. Finally, we thank Paul borealis (sensu stricto) as monotypic (e.g., Lehman and an anonymous reviewer for helpful comments Ticehurst 1938, Williamson 1976); however, on a previous version of the manuscript. 274 THE WILSON JOURNAL OF ORNITHOLOGY N Vol. 128, No. 2, June 2016

LITERATURE CITED GIBSON,D.D.AND G. V. BYRD. 2007. Birds of the Aleutian Islands, Alaska. Series in Ornithology 1:1–351. ALSTRO¨ M, P., T. SAITOH,D.WILLIAMS,I.NISHIUMI,Y. GIBSON,D.D.AND B. KESSEL. 1997. Inventory of the SHIGETA,K.UEDA,M.IRESTEDT,M.BJO¨ RKLUND, AND species and subspecies of Alaska birds. Western Birds U. OLSSON. 2011. The Arctic Warbler Phylloscopus 28:45–95. borealis – three anciently separated cryptic species GODFREY, W. E. 1966. The birds of Canada. National revealed. Ibis 153:395–410. Museum of Natural Sciences, Ottawa, Canada. BAIRD,S.F.1869.Phyllopneuste kennicotti Baird: HAMILTON, R. A., M. A. PATTEN, AND R. A. ERICKSON Kennicott’s Warbler. Transactions of the Chicago (EDITORS). 2007. Rare birds of California. Western Academy of Science 1:313–314. Field Ornithologists, Camarillo, California, USA. ¨ ´ BAIRLEIN, F., P. ALSTROM,R.AYMI,P.CLEMENT,A. HARTERT, E. 1920. The birds of the Commander Islands. DYRCZ,G.GARGALLO,F.HAWKINS,S.MADGE,D. Novitates Zoologicae 27:128–158. PEARSON, AND L. SVENSSON. 2006. Family Sylviidae HELBIG, A. J., I. SEIBOLD,J.MARTENS, AND M. WINK. (Old World warblers). Pages 492–709 in Handbook 1995. Genetic differentiation and phylogenetic rela- of the birds of the world. Volume 11. Old World tionships of Bonelli’s Warbler Phylloscopus bonelli flycatchers to Old World warblers (J. del Hoyo, A. and Green Warbler P. nitidus. Journal of Avian Elliott, and D. A. Christie, Editors). Lynx Edicions, Biology 26:139–153. Barcelona, Spain. HELLMAYR, C. E. 1934. Catalogue of birds of the Americas BAIRLEIN, F., D. R. NORRIS,R.NAGEL,M.BULTE,C.C. and the adjacent islands. Part 7. Zoological Series of VOIGT,J.W.FOX,D.J.T.HUSSELL, AND H. the Field Museum of Natural History 13(7):1–531. SCHMALJOHANN. 2012. Cross-hemisphere migration JOHANSEN, H. 1961. Revised list of the birds of the of a 25 g songbird. Biology Letters DOI: 10.1098/ Commander Islands. Auk 78:44–56. rsbl.2011.1223. KENYON, K. W. 1961. Birds of Amchitka Island, Alaska. BANDELT,H.-J., P. FORSTER, AND A. RO¨ HL. 1999. Median- Auk 78:305–326. joining networks for inferring intraspecific phyloge- LEHMAN, P. E. 2005. Fall bird migration at Gambell, St. nies. Molecular Biology and Evolution 16:37–48. Lawrence Island, Alaska. Western Birds 36:2–55. CAHALANE, V. H. 1959. A biological survey of Katmai National Monument. Smithsonian Miscellaneous LEISLER, B., P. HEIDRICH,K.SCHULZE-HAGEN, AND M. Collections 138(5):1–246. WINK. 1997. Taxonomy and phylogeny of reed warblers (genus Acrocephalus) based on mtDNA CAMPBELL, R. W., N. K. DAWE,I.MCTAGGART-COWAN, sequences and morphology. Journal fu¨r Ornithologie J. M. COOPER,G.W.KAISER,A.D.STEWART, AND 138:469–496. M. C. E. MCNALL. 2001. The birds of British Columbia. Volume 4. Passerines. University of British MURIE, O. J. 1936. The birds of St. Lawrence Island, Columbia Press, Vancouver, Canada. Alaska. University of Alaska Miscellaneous Publica- tions 2:361–376. CHESSER, R. T., R. C. BANKS,C.CICERO,J.L.DUNN,A.W. KRATTER,I.J.LOVETTE,A.G.NAVARRO-SIGU¨ ENZA, NAKAGAWA,S.AND I. C. CUTHILL. 2007. Effect size, P. C. RASMUSSEN,J.V.REMSEN JR., J. D. RISING,D.F. confidence interval and statistical significance: a prac- STOTZ, AND K. WINKER. 2014. Fifty-fifth supplement tical guide for biologists. Biological Reviews 82: to the American Ornithologists’ Union Check-list of 591–605. North American Birds. Auk: Ornithological Advances OLSSON, U., P. ALSTRO¨ M, AND P. SUNDBERG. 2004. 131:CSi–CSxv. Non-monophyly of the avian genus Seicercus (Aves: CHIKUNI,K.,N.MINAKA, AND H. IKENAGA. 1995. Sylviidae) revealed by mitochondrial DNA. Zoologica Molecular phylogeny of some Passeriformes, based Scripta. 33:501–510. on cytochrome b sequences. Journal of the Yamashina OREGON BIRD RECORD COMMITTEE (OBRC). 2014. Official Institude for Ornithology 28:1–8. checklist of Oregon birds, April 2014. Oregon Birding DEMENT’EV,G.P.AND N. A. GLADKOV (EDITORS). 1968. Association, Lincoln, OR, USA. www.orbirds.org/ Birds of the Soviet Union. Volume 6. Israel Program checklist2014.pdf (accessed 17 Nov 2014). for Scientific Translations, Jerusalem, Israel. ORNITHOLOGICAL SOCIETY OF JAPAN. 1974. Check-list of FRIEDMANN, H. 1937. Further additions to the known Japanese birds. Fifth Edition. Ornithological Society avifauna of St. Lawrence Island, Alaska. Condor of Japan, Tokyo, Japan. 39:91. ORNITHOLOGICAL SOCIETY OF JAPAN. 2000. Check-list of GABRIELSON, I. N. 1944. Some Alaska notes. Auk 61: Japanese birds. Sixth Edition. Ornithological Society 105–130. of Japan, Tokyo, Japan. GABRIELSON,I.N.AND F. C. LINCOLN. 1959. The birds of PIKE, J. E., K. L. GARRETT, AND A. J. SEARCY. 2014. The Alaska. Stackpole Co., Harrisburg, Pennsylvania, USA. 38th annual report of the California Bird Records GIBSON, D. D. 1981. Migrant birds at Shemya Island, Committee: 2012 records. Western Birds 45:246–275. Aleutian Islands, Alaska. Condor 83:65–77. PORTENKO,L.A.1938. GIBSON, D. D. 1991. Old World genera (Phylloscopus, (Phylloscopus borealis) [New observations “Locustella”). Pages 16–19 in The known birds of on the Arctic Warbler]. Izvestiya Akademi Nauk SSSR North and Middle America. Part II (A. R. Phillips, Otdelenie Matematicheskikh i Estestvennykh Nauk Editor). A. R. Phillips, Denver, Colorado, USA. 5/6:1051–1056. Withrow et al. N ARCTIC WARBLERS IN NORTH AMERICA 275

P ORTENKO,L.A.1973. THOMPSON,M.C.AND R. L. DELONG. 1969. Birds new to [Birds of the North America and the Pribilof Islands, Alaska. Auk Chukotski Peninsula and Wrangel Island]. 2 86:747–749. [Part 2]. Izdatel’stvo “Nauka” Leningradskoe Otde- TICEHURST, C. B. 1938. A systematic review of the genus lenie, Leningrad, USSR. Phylloscopus. British Museum, London, UK. PYLE,P.AND S. N. G. HOWELL. 1993. An Arctic Warbler in VAURIE, C. 1954. Systematic notes on Palearctic birds. Baja California, Mexico. Western Birds 24:53–56. Number 9. Sylviinae: the genus Phylloscopus. Amer- REEVES,A.B.,S.V.DROVETSKI, AND I. V. FADEEV. ican Museum Novitates 1685:1–23. 2008. Mitochondrial DNA data imply a stepping- VAURIE, C. 1959. The birds of the Palearctic fauna, stone colonization of Beringia by Arctic Warbler a systematic reference: Order Passeriformes. H. F. & Phylloscopus borealis. Journal of Avian Biology G. Witherby Ltd., London, UK. 39:567–575. WAHL,T.R.,B.TWEIT, AND S. G. MLODINOW (EDITORS). RICHMAN, A. D. 1996. Ecological diversification and 2005. Birds of Washington: status and distribution. community structure in the Old World leaf warblers Oregon State University Press, Corvallis, USA. (genus Phylloscopus): a phylogenetic perspective. WATSON, G. E. 1986. Phylloscopus borealis. Pages 241– Evolution 50:2461–2470. 242 in Checklist of birds of the World. Volume 11 RIDGWAY, R. 1904. The birds of North and Middle (E. Mayr and G. W. Cottrell, Editors.). Museum of Com- America. Part 3. Bulletin of the U. S. National parative Zoology, Cambridge, Massachusetts, USA. Museum 50(3):1–801. WILLIAMSON, K. 1976. Identification for ringers 2. The SAITOH, T., P. ALSTRO¨ M,I.NISHIUMI,Y.SHIGETA,D. genus Phylloscopus. Second Edition. British Trust for WILLIAMS,U.OLSSON, AND K. UEDA. 2010. Old Ornithology, Tring, United Kingdom. divergences in a boreal bird supports long-term WINKER, K. 1993. Specimen shrinkage in Tennessee survival through the ice ages. BMC Evolutionary Warblers and “Traill’s” Flycatchers. Journal of Field Biology 10:35 doi: 10.1186/1471-2148-10-35 Ornithology 64:331–336. SAITOH, T., Y. SHIGETA, AND K. UEDA. 2008. Morpholog- WINKER, K. 2000. Obtaining, preserving, and preparing bird ical differences among populations of the Arctic specimens. Journal of Field Ornithology 71:250–297. Warbler with some intraspecific taxonomic notes. WINKER, K., D. D. GIBSON,A.L.SOWLS,B.E.LAWHEAD, Ornithological Science 7:135–142. P. D. MARTIN,E.P.HOBERG, AND D. CAUSEY. 2002. SINCLAIR, P. H., W. A. NIXON,C.D.ECKERT, AND N. L. The birds of St. Matthew Island, Bering Sea. Wilson HUGHES (EDITORS). 2003. Birds of the Yukon Bulletin 114:491–509. Territory. University of British Columbia Press, WITHROW, J. J., S. G. SEALY, AND K. WINKER. 2014. Vancouver, Canada. Genetics of divergence in the Northern Saw-whet Owl SWARTH, H. S. 1934. Birds of Nunivak Island, Alaska. (Aegolius acadicus). Auk: Ornithological Advances Pacific Coast Avifauna 22:17–64. 131:73–85. 276 THE WILSON JOURNAL OF ORNITHOLOGY N Vol. 128, No. 2, June 2016

APPENDIX A. Cytochrome-b sequences generated in this study with voucher number, fragment length, GenBank accession number, and location.

Voucher number Fragment bp GenBank accession # Location Phylloscopus examinandus CMN 35173a 491 KP245890 Prince Patrick Island UAM 7053a 491 KP245894 Old Chevak UAM 5248a 481 KP245891 St. Matthew Island UAM 5343a 461 KP245892 Attu Island UAM 11451 1011 KP245882 Shemya Island UAM 17665 982 KP245875 Shemya Island UAM 17702 1009 KP245876 Shemya Island UAM 18003 1010 KP245877 Shemya Island UAM 18004 1010 KP245878 Shemya Island UAM 27030 1011 KP245879 Shemya Island UAM 27032 1011 KP245881 Shemya Island UAM 27031 982 KP245895 Shemya Island UAM 27029 1011 KP245880 Shemya Island UAM 28150 982 KP245897 Shemya Island UAM 28149 982 KP245898 Shemya Island UAM 24554 1000 KP245887 Shemya Island UAM 27636 982 KP245896 Shemya Island UAM 29471 982 KP245873 Kamchatka, near Petropavlovsk UAM 29476 982 KP245874 Kamchatka, near Petropavlovsk UAM 30464 1011 KP245883 Kamchatka, near Esso UAM 30463 1011 KP245884 Kamchatka, near Esso UAM 30462 1011 KP245885 Kamchatka, near Klyuchi UAM 30461 1011 KP245886 Kamchatka, near Apacha P. borealis UAM 5620a 491 KP245893 St. Lawrence Island UAM 14874 982 KP245888 St. Lawrence Island UAM 6940 474 KP245889 Fairbanks, Alaska

a These five birds were sequenced from toe pads.

APPENDIX B. Cytochrome b sequences used for comparison in the haplotype network and their sources.

GenBank accession number Sources Phylloscopus examinandus AB362424 – AB362434, AB362436, AB362434, HQ243661. Saitoh et al. 2008, Alstro¨m et al. 2011. P. borealis AB362435 – AB362446, AB362461, AB362462, Helbig et al. 1995, Richman 1996, Olsson et al. 2004, AB530997 – AB531003, AY635052, HQ243657 – HQ243660, Saitoh et al. 2008,, Alstro¨m et al. 2011. L77143, Z73484. P. xanthodryas AB362447 – AB362458, AB362465, AB362466, D38316, Chikuni et al. 1995, Saitoh et al. Alstro¨m et al. 2011. HQ243662, HQ243663. Withrow et al. N ARCTIC WARBLERS IN NORTH AMERICA 277

APPENDIX C. Specimens measured for construction of Fig. 1. Unless otherwise noted, all specimen numbers are University of Alaska Museum (UAM; available on Arctos arctos.database.museum/home.cfm). The specimen from Canadian Museum of Nature (CMN) was measured by Michel Gosselin. The two specimens from the Smithsonian Institution (USNM) were measured by Brian Schmidt. Bold numbers indicate that the individual was sequenced and correspond with those in Appendix B.

Alaska/Canada, P. examinandus 3583, 3692, 4876, 5248, 5343, 7053, 11451, 17665, 17702, 18003, 18004, 24554, 27029, 27030, 27031, 27032, 27636, 28149, 28150, USNM 4654115, USNM 465421, CMN 35173. Kamchatka, P. examinandus 29471, 29472, 29471, 29474, 29475, 29476, 30461, 30462, 30463, 30464. Alaska, P. borealis 723, 2419, 2762, 3149, 3295, 3296, 3298, 3837, 4115, 4296, 4299, 5620, 6571, 6940, 6992, 7364, 7366, 7371, 7372, 7373, 7375, 13972, 14874, 18682, 20151, 34059, 34708.