DOCSLIB.ORG

Terrestrial Mammal Conservation Terrestrial Mammal

Total Page：16

File Type：pdf, Size：1020Kb

Download full-text PDF Read full-text

Load more

W.J. S Terrestrial Mammal Conservation Terrestrial Mammal Eff ects of interventions for terrestrial mammals excluding bats and primates UTHERLAND Littlewood, N.A., Rocha, R., Smith, R.K., and Sutherland W.J. Conservation Global evidence for the eff ects of interventions for Terrestrial Mammal Conserva� on is the seventeenth publica� on in the Conserva� on Evidence Series Synopses, linked to the online resource www.Conserva� onEvidence.com. ET terrestrial mammals excluding bats and primates Conserva� on Evidence Synopses are designed to promote a more evidence-based approach AL to biodiversity conserva� on. Others in the series include Bat Conserva� on, Primate . Conserva� on, Bird Conserva� on and Forest Conserva� on and more are in prepara� on. Expert assessment of the evidence summarized within synopses is provided online and within the annual publica� on What Works in Conservati on. This synopsis brings together and provides a thorough summary of the available scien� fi c evidence of what is known, or not known, about the eff ec� veness of conserva� on ac� ons for Terrestrial Mammal wild terrestrial mammals across the world (excluding bats and primates, which are covered in separate synopses). Ac� ons are organized into categories based on the Interna� onal Union for Conserva� on of Nature classifi ca� ons of direct threats and conserva� on ac� ons. Conservation This book is designed to be a useful resource for those concerned with the prac� cal conserva� on of terrestrial mammals. The authors consulted an interna� onal group of terrestrial mammal experts and conserva� onists to produce this synopsis. Funding was provided by the MAVA Founda� on, Arcadia and Na� onal Geographic Big Cats Ini� a� ve. As with all Open Book publica� ons, this en� re book is available to read for free on the publisher’s website. Printed and digital edi� ons, together with supplementary digital material, can also be found at www.openbookpublishers.com Cover Image: Cape mountain zebra Equus zebra zebra, by Rebecca K. Smith Cover Design by Anna Ga� . book eebook and OA edi� ons also available Nick A. Littlewood, Ricardo Rocha, Rebecca K. Smith, Philip A. Martin, OPEN ACCESS Sarah L. Lockhart, Rebecca F. Schoonover, Elspeth Wilman, Andrew J. Bladon, Katie A. Sainsbury, Stuart Pimm & William J. Sutherland OBP CONSERVATION EVIDENCE SERIES SYNOPSES https://www.openbookpublishers.com © 2020 Littlewood, N.A., Rocha, R., Smith, R.K., Sutherland W.J. et al. This work is licensed under a Creative Commons Attribution 4.0 International license (CC BY 4.0). This license allows you to share, copy, distribute and transmit the text; to adapt the text and to make commercial use of the text providing attribution is made to the authors (but not in any way that suggests that they endorse you or your use of the work). Attribution should include the following information: N.A. Littlewood, R. Rocha, R.K. Smith, W.J. Sutherland et al., Terrestrial Mammal Conservation: Global evidence for the effects of interventions for terrestrial mammals excluding bats and primates. Synopses of Conservation Evidence Series, University of Cambridge (Cambridge, UK: Open Book Publishers, 2020), https://doi.org/10.11647/OBP.0234 In order to access detailed and updated information on the license, please visit, https:// doi.org/10.11647/OBP.0234#copyright Further details about CC BY licenses are available at https://creativecommons.org/ licenses/by/4.0/ All external links were active at the time of publication unless otherwise stated and have been archived via the Internet Archive Wayback Machine at https://archive.org/web Updated digital material and resources associated with this volume are available at https://doi.org/10.11647/OBP.0234#resources Every effort has been made to identify and contact copyright holders and any omission or error will be corrected if notification is made to the publisher. ISBN Paperback: 9781800640832 ISBN Hardback: 9781800640849 ISBN Digital (PDF): 9781800640856 ISBN Digital ebook (epub): 9781800640863 ISBN Digital ebook (mobi): 9781800640870 ISBN XML: 9781800640887 DOI: 10.11647/OBP.0234 Cover image: Cape mountain zebra (Equus zebra zebra), De Hoop Nature Reserve, South Africa. Photograph by Rebecca K. Smith, CC-BY. Cover design by Anna Gatti. 14. Species management Background Most of the chapters in this book are aimed at minimizing threats, but there are also some interventions which aim specifically to increase population numbers by increasing reproductive rates and by introducing individuals. This chapter describes interventions that can be used to increase population size by translocating wild mammals from one area to another, by breeding or rearing mammals in captivity (ex-situ conservation) to release back into the wild or by enhancing resources available for mammals in ways that can be used to address multiple threats (such as by providing artificial dens or nest boxes). 14.1. Cease/reduce payments to cull mammals https://www.conservationevidence.com/actions/2349 • One study evaluated the effects of ceasing or reducing payments to cull mammals. This study was in Sweden and Norway1. COMMUNITY RESPONSE (0 STUDIES) POPULATION RESPONSE (1 STUDY) • Survival (1 study): A before-and-after study in Sweden and Norway1 found that fewer brown bears were reported killed after the removal of financial hunting incentives. BEHAVIOUR (0 STUDIES) © Book Authors, CC BY 4.0 https://doi.org/10.11647/OBP.0234.14 714 Terrestrial Mammal Conservation Background Financial incentives for hunting particular species of mammal may be awarded for a variety of reasons, including agricultural protection, disease control and human safety. Whilst the intention of making such payments is to increase hunting of focal species, hunter motivations are varied (e.g. Gigliotti & Metcalf 2016) and may include more than financial reward. Hence, removal of payments may or may not have the desired consequence of reducing hunting pressure on species. Gigliotti L.M. & Metcalf E.C. (2016) Motivations of female black hills deer hunters. Human Dimensions of Wildlife, 21, 371–378. A before-and-after study in 1888–1898 in Sweden and a before-and- after study in 1925–1935 in Norway (1) found that after the removal of financial hunting incentives fewer brown bears Ursus arctos were reported killed. In both Sweden and Norway, fewer bears were reported killed during the five years after the removal of financialhunting incentives (Sweden: average 14 bears/county/year; Norway: average 1 bear/county/year) than during the five years before the removal of financial hunting incentives (Sweden: average 25 bears/county/ year; Norway: average 3 bears/county/year). Financial incentives to cull bears were eliminated in 1893 in Sweden and in 1930 in Norway. Additionally, in 1930, bear hunting on someone else’s property was banned in Norway. Numbers of bears killed were obtained from national harvesting records. (1) Swenson J.E., Wabakken P., Sandegren F., Bjärvall A., Franzén R. & Söderberg A. (1995) The near extinction and recovery of brown bears in Scandinavia in relation to the bear management policies of Norway and Sweden. Wildlife Biology, 1, 11–25. 14. Species management 715 14.2. Temporarily hold females and offspring in fenced area to increase survival of young https://www.conservationevidence.com/actions/2351 • We found no studies that evaluated the effects on mammals of temporarily holding females and offspring in a fenced area to increase survival of young. ’We found no studies’ means that we have not yet found any studies that have directly evaluated this intervention during our systematic journal and report searches. Therefore, we have no evidence to indicate whether or not the intervention has any desirable or harmful effects. Background Survival of new-born mammals can be low, due to a variety of factors including predation. Capturing pregnant females and temporarily holding them and their new-born offspring in fenced areas within their native range (short-term or ‘maternal penning’), for the first few weeks of life when young are most vulnerable to predation, may result in increased survival of young. This could help to slow decline, maintain or increase population size. 14.3. Rehabilitate injured, sick or weak mammals https://www.conservationevidence.com/actions/2352 • Thirteen studies evaluated the effects of rehabilitating injured, sick or weak mammals. Four studies were in the UK3,4,5,8, three were in Spain6,9,13, two were in Argentina10,12 and one each was in Uganda1, Australia2, the USA7 and Brazil11. COMMUNITY RESPONSE (0 STUDIES) POPULATION RESPONSE (12 STUDIES) • Survival (11 studies): Five studies, in the UK3,4,5,8 and Spain9, found that varying proportions of European hedgehogs released after being rehabilitated in captivity survived during 716 Terrestrial Mammal Conservation post-release monitoring periods, which ranged from two weeks3 to 136 days9. Five studies, in Australia2, Spain6,13, the USA7 and Brazil11, found that four koalas2, an Iberian lynx6, a gray wolf7, a puma11 and two brown bears13 released following rehabilitation in captivity survived for varying durations during monitoring periods, which ranged in length from three months6 to up to seven years13. A study in Argentina10 found that over half of released rehabilitated and captive-reared giant anteaters survived for at least six months. • Condition (2 studies): A study in Uganda1 found that a snare wound in a white rhinoceros healed after treatment and rehabilitation. A study in the UK3 found that two of three rehabilitated European hedgehogs lost 12–36% of their body weight after release into the wild. BEHAVIOUR (1 STUDY) • Behaviour change (1 study): A controlled study in Argentina12 found that released wild-born rehabilitated giant anteaters were more nocturnal in their activity patterns than captive- bred individuals. Background Mammals that are injured, sick or found in a weak condition are sometimes taken in by wildlife rehabilitators, to be treated and released back into the wild. Often, this is done more for animal welfare reasons than for species conservation though, for rare species, release of such animals may provide opportunities for choosing where to augment populations.
Recommended publications
  • The Mediterranean Forests Are Extraordinarily Beautiful, a Fascinating an Extraordinary Patrimony of Wealth Whose Conservation Can Be Highly Controversy

    The Mediterranean Forests Are Extraordinarily Beautiful, a Fascinating an Extraordinary Patrimony of Wealth Whose Conservation Can Be Highly Controversy

    THE editerraneanFORESTS mA NEW CONSERVATION STRATEGY 1 3 2 4 5 6 the unveiled a meeting point the mediterranean: amazing plant an unknown millennia forests on the global 200 the terrestrial current a brand new the state of WWF a new approach wealth of the of nature a sea of forests diversity animal world of human the wane in the sub-ecoregions mediterranean tool: the gap mediterranean in action for forest mediterranean and civilisations interaction with mediterranean in the forest cover analysis forests protection forests forests mediterranean 23 46 81012141617 18 19 22 24 7 1 Argania spinosa fruits, Essaouira, Morocco. Credit: WWF/P. Regato 2 Reed-parasol maker, Tunisia. Credit: WWF-Canon/M. Gunther 3 Black-shouldered Kite. Credit: Francisco Márquez 4 Endemic mountain Aquilegia, Corsica. Credit: WWF/P. Regato 5 Sacred ibis. Credit: Alessandro Re 6 Joiner, Kure Mountains, Turkey. Credit: WWF/P. Regato 7 Barbary ape, Morocco. Credit: A. & J. Visage/Panda Photo It is like no other region on Earth. Exotic, diverse, roamed by mythical WWF Mediterranean Programme Office launched its campaign in 1999 creatures, deeply shaped by thousands of years of human intervention, the to protect 10 outstanding forest sites among the 300 identified through cradle of civilisations. a comprehensive study all over the region. When we talk about the Mediterranean region, you could be forgiven for The campaign has produced encouraging results in countries such as Spain, thinking of azure seas and golden beaches, sun and sand, a holidaymaker’s Turkey, Croatia and Lebanon. NATURE AND CULTURE, of forest environments in the region. But in recent times, the balance AN INTIMATE RELATIONSHIP Long periods of considerable forest between nature and humankind has paradise.
  • Rewilding Watersheds: Using Nature's Algorithms to Fix Our Broken Rivers

    Rewilding Watersheds: Using Nature's Algorithms to Fix Our Broken Rivers

    Marine and Freshwater Research © CSIRO 2021 https://doi.org/10.1071/MF20335_AC Supplementary material Rewilding watersheds: using nature’s algorithms to fix our broken rivers Natalie K. RideoutA,G,1, Bernhard WegscheiderB,1, Matilda KattilakoskiA, Katie M. McGeeC,D, Wendy A. MonkE, and Donald J. BairdF ACanadian Rivers Institute, Department of Biology, University of New Brunswick, 10 Bailey Drive, Fredericton, NB, E3B 5A3, Canada. BCanadian Rivers Institute, Faculty of Forestry and Environmental Management, University of New Brunswick, 2 Bailey Drive, Fredericton, NB, E3B 5A3, Canada. CEnvironment and Climate Change Canada, Canada Centre for Inland Waters, 867 Lakeshore Road, Burlington, ON, L7R 4A6, Canada. DCentre for Biodiversity Genomics and Department of Integrative Biology, University of Guelph, 50 Stone Road E., Guelph, ON, N1G 2W1, Canada. EEnvironment and Climate Change Canada @ Canadian Rivers Institute, Faculty of Forestry and Environmental Management, University of New Brunswick, 2 Bailey Drive, Fredericton, NB, E3B 5A3, Canada. FEnvironment and Climate Change Canada @ Canadian Rivers Institute, Department of Biology, University of New Brunswick, 10 Bailey Drive, Fredericton, NB, E3B 5A3, Canada. GCorresponding author. Email: [email protected] 1These authors contributed equally to the work. Page 1 of 49 Table S1. References linking ecosystem functions with rewilding goals, providing supporting evidence for Fig. 1 Restore natural flow Mitigate climate Restore riparian Re-introduce Improve water quality Reduce habitat and sediment regime warming vegetation extirpated species fragmentation 1 Metabolism Aristi et al. 2014 Song et al. 2008 Wassenaar et al. 2010 Huang et al. 2018 Jankowski and Schindler 2019 2 Decomposition Delong 2010 Perry et al. 2011 Delong 2010 Wenisch et al.
  • ADOT Herbicide Treatment Program on Bureau of Land Management Lands in Arizona

    ADOT Herbicide Treatment Program on Bureau of Land Management Lands in Arizona

    October 2015 BLM DOI-BLM-AZ-0000-2013-0001-EA ADOT Herbicide Treatment Program on Bureau of Land Management Lands in Arizona Final Environmental Assessment Bureau of Land Management Environmental Assessment and Section 4(f) Evaluation ADOT Herbicide Treatment Program on Bureau of Land Management Lands in Arizona DOI-BLM-AZ-0000-2013-0001-EA Bureau of Land Management Arizona State Office One North Central Avenue, Suite 800 Phoenix, Arizona 85004-4427 October 2015 TABLE OF CONTENTS Table of Contents ............................................................................................................................. i List of Tables ................................................................................................................................... iii List of Figures .................................................................................................................................. iii Acronym List ................................................................................................................................... iv Section 1 – Proposed Action, Purpose and Need, and Background Information ........................... 1 1.1 Introduction...................................................................................................................... 1 1.2 Proposed Action Overview ............................................................................................... 3 1.3 Purpose and Need for Action ..........................................................................................
  • Favourableness and Connectivity of a Western Iberian Landscape for the Reintroduction of the Iconic Iberian Ibex Capra Pyrenaica

    Favourableness and Connectivity of a Western Iberian Landscape for the Reintroduction of the Iconic Iberian Ibex Capra Pyrenaica

    Favourableness and connectivity of a Western Iberian landscape for the reintroduction of the iconic Iberian ibex Capra pyrenaica R ITA T. TORRES,JOÃO C ARVALHO,EMMANUEL S ERRANO,WOUTER H ELMER P ELAYO A CEVEDO and C ARLOS F ONSECA Abstract Traditional land use practices declined through- Keywords Capra pyrenaica, environmental favourableness, out many of Europe’s rural landscapes during the th cen- graph theory, habitat connectivity, Iberian ibex, reintroduc- tury. Rewilding (i.e. restoring ecosystem functioning with tion, ungulate minimal human intervention) is being pursued in many areas, and restocking or reintroduction of key species is often part of the rewilding strategy. Such programmes re- Introduction quire ecological information about the target areas but this is not always available. Using the example of the an has shaped landscapes for centuries (Vos & Iberian ibex Capra pyrenaica within the Rewilding Europe Meekes, ). In the last decades socio-economic M framework we address the following questions: ( ) Are and lifestyle changes have driven a rural exodus and the there areas in Western Iberia that are environmentally fa- abandonment of land throughout many of Europe’s rural vourable for reintroduction of the species? ( ) If so, are landscapes (MacDonald et al., ; Höchtl et al., ). these areas well connected with each other? ( ) Which of In some cases sociocultural and economic problems have these areas favour the establishment and expansion of a vi- created new opportunities for conservation (Theil et al., ). able population
  • Uranium 2001: Resources, Production and Demand

    Uranium 2001: Resources, Production and Demand

    A Joint Report by the OECD Nuclear Energy Agency and the International Atomic Energy Agency Uranium 2001: Resources, Production and Demand NUCLEAR ENERGY AGENCY ORGANISATION FOR ECONOMIC CO-OPERATION AND DEVELOPMENT ORGANISATION FOR ECONOMIC CO-OPERATION AND DEVELOPMENT Pursuant to Article 1 of the Convention signed in Paris on 14th December 1960, and which came into force on 30th September 1961, the Organisation for Economic Co-operation and Development (OECD) shall promote policies designed: − to achieve the highest sustainable economic growth and employment and a rising standard of living in Member countries, while maintaining financial stability, and thus to contribute to the development of the world economy; − to contribute to sound economic expansion in Member as well as non-member countries in the process of economic development; and − to contribute to the expansion of world trade on a multilateral, non-discriminatory basis in accordance with international obligations. The original Member countries of the OECD are Austria, Belgium, Canada, Denmark, France, Germany, Greece, Iceland, Ireland, Italy, Luxembourg, the Netherlands, Norway, Portugal, Spain, Sweden, Switzerland, Turkey, the United Kingdom and the United States. The following countries became Members subsequently through accession at the dates indicated hereafter: Japan (28th April 1964), Finland (28th January 1969), Australia (7th June 1971), New Zealand (29th May 1973), Mexico (18th May 1994), the Czech Republic (21st December 1995), Hungary (7th May 1996), Poland (22nd November 1996), Korea (12th December 1996) and the Slovak Republic (14 December 2000). The Commission of the European Communities takes part in the work of the OECD (Article 13 of the OECD Convention).
  • Reindeer Hunting As World Heritage a Ten Thousan Year-Long Tradition

    Reindeer Hunting As World Heritage a Ten Thousan Year-Long Tradition

    Reindeer hunting as World Heritage A ten thousan year-long tradition Scientific statement 2006 Reindeer hunting as World Heritage Reindeer hunting as World Heritage A ten thousand year-long tradition A ten thousand year-long tradition Contents Preface 4 8 Description of the character of the 1 Wild reindeer hunting as World area (status at the time of nomination) 48 Heritage; a ten-thousand-year-long 8.1 General description of the area 48 tradition Summary 5 8.2 Description of how the four sub-areas 2 Introduction 8 complement one another 52 2.1 Early history of the project 8 8.3 Description of the individual sub-areas 53 8.3.1 Eikesdalsfjella 53 2.2 Information for national and municipal authorities 8 8.3.2 Snøhetta 54 8.3.3 Rondane 56 2.3 Consolidation of the project 8 8.3.4 Reinheimen 60 2.4 Openness and information 9 8.3.5 Buffer zone between the Eikesdalsfjella and This report has been prepared by a team of specialists appointed for the project: ”Wild reindeer 2.5 Broad foundation 9 Snøhetta sub-areas 63 hunting as World Heritage”: 2.6 Revitalisation and regional involvement 9 8.3.6 Buffer zone between the Snøhetta and Rondane - Professor Reidar Andersen, Museum of Archaeology and Natural History, Norwegian sub-areas 63 University of Science and Technology 3 Wild reindeer – history, genetics and - Per Jordhøy, Adviser at the Norwegian Institute for Nature Research habitat use 11 9 History and development 64 - Jostein Bergstøl, Research archaeologist at the Museum of Cultural History, 10 Komparativ analyse 67 University of Oslo 3.1
  • Sustainable Trophy Hunting of Iberian Ibex Por Una Caza Sostenible Del Trofeo De Macho Montés

    Sustainable Trophy Hunting of Iberian Ibex Por Una Caza Sostenible Del Trofeo De Macho Montés

    Forum Galemys, 30: 1-4, 2018 ISSN 1137-8700 e-ISSN 2254-8408 DOI: 10.7325/Galemys.2018.F1 Sustainable trophy hunting of Iberian ibex Por una caza sostenible del trofeo de macho montés João Carvalho1,2*, Paulino Fandos3, Marco Festa-Bianchet4, Ulf Büntgen5,6,7, Carlos Fonseca1 & Emmanuel Serrano2* 1. Department of Biology & Centre for Environmental and Marine Studies (CESAM), University of Aveiro, Aveiro, Portugal. 2. Wildlife Ecology & Health Group (WE&H) and Servei d’Ecopatologia de Fauna Salvatge (SEFaS), Departament de Medicina i Cirurgia Animals, Universitat Autònoma de Barcelona, 08193 Bellaterra, Barcelona, Spain. 3. Agencia de Medio Ambiente y Agua, Isla de la Cartuja, 41092 Sevilla, Spain. 4. Département de Biologie, Université de Sherbrooke, Sherbrooke, Québec J1K 2R1, Canada. 5. Department of Geography, University of Cambridge, Cambridge, United Kingdom. 6. Swiss Federal Research Institute (WSL), 8903 Birmensdorf, Switzerland. 7. Global Change Research Centre and Masaryk University, 613 00 Brno, Czech Republic. *Corresponding authors: [email protected] (JC), [email protected] (ES) Keywords: Capra pyrenaica, horns, mountain ungulates, size-selective harvesting. Selective hunting practices, such as trophy apparently led to an evolutionary decline in horn hunting, remove individuals with specific size (Pigeon et al. 2017). In contrast, we know very phenotypes (Kuparinen & Festa-Bianchet 2017). little about the possible effects of selective harvesting For mountain ungulates, trophy hunting involves on the iconic Iberian ibex (Capra pyrenaica, Fig. 1), the selective harvest of males with large horns. which is experiencing increased pressure not only Trophy hunters usually pay a substantial fee, which from trophy hunting (Pérez et al. 2011), but also in some cases is proportional to the ‘trophy score’ from changes in both climate and land-use practices of the animal they harvest.
  • Line Transect Surveys Underdetect Terrestrial Mammals: Implications for the Sustainability of Subsistence Hunting

    Line Transect Surveys Underdetect Terrestrial Mammals: Implications for the Sustainability of Subsistence Hunting

    RESEARCH ARTICLE Line Transect Surveys Underdetect Terrestrial Mammals: Implications for the Sustainability of Subsistence Hunting José M. V. Fragoso1☯¤*, Taal Levi2‡, Luiz F. B. Oliveira3‡, Jeffrey B. Luzar4‡, Han Overman5‡, Jane M. Read6‡, Kirsten M. Silvius7☯ 1 Stanford University, Stanford, CA, 94305–5020, United States of America, 2 Department of Fisheries and Wildlife, Oregon State University, Corvallis, OR, United States of America, 3 Departamento de Vertebrados, Museu Nacional, UFRJ, RJ, 20.940–040, Brazil, 4 Stanford University, Stanford, CA, 94305–5020, United States of America, 5 Environmental and Forest Biology, State University of New York-College of Environmental Science and Forestry, Syracuse, NY, 13210, United States of America, 6 Geography Department, Syracuse University, Syracuse, NY, 13244, United States of America, 7 Department of Forest Resources and Environmental Conservation, Virginia Tech, Blacksburg, VA, United States of America ☯ These authors contributed equally to this work. ¤ Current address: Biodiversity Science and Sustainability, California Academy of Sciences, San Francisco, California, United States of America OPEN ACCESS ‡ These authors contributed subsets of effort equally to this work. * [email protected] Citation: Fragoso JMV, Levi T, Oliveira LFB, Luzar JB, Overman H, Read JM, et al. (2016) Line Transect Surveys Underdetect Terrestrial Mammals: Implications for the Sustainability of Subsistence Abstract Hunting. PLoS ONE 11(4): e0152659. doi:10.1371/ journal.pone.0152659 Conservation of Neotropical game species must take into account the livelihood and food Editor: Mathew S. Crowther, University of Sydney, security needs of local human populations. Hunting management decisions should there- AUSTRALIA fore rely on abundance and distribution data that are as representative as possible of true Received: January 19, 2016 population sizes and dynamics.
  • Capra Pyrenaica

    Capra Pyrenaica

    Colom-Cadena et al. Acta Veterinaria Scandinavica 2014, 56:83 http://www.actavetscand.com/content/56/1/83 RESEARCH Open Access Management of a caseous lymphadenitis outbreak in a new Iberian ibex (Capra pyrenaica) stock reservoir Andreu Colom-Cadena1, Roser Velarde1, Jes?s Salinas 2, Carmen Borge3, Ignacio Garc?a-Bocanegra 3, Emmanuel Serrano1,4, Diana Gass? 1, Ester Bach1, Encarna Casas-D?az 1, Jorge R L?pez-Olvera 1, Santiago Lav?n 1, Lu?s Le?n-Vizca?no 2 and Gregorio Mentaberre1* Abstract Background: In 2010, an Iberian ibex (Capra pyrenaica hispanica) stock reservoir was established for conservation purposes in north-eastern Spain. Eighteen ibexes were captured in the wild and housed in a 17 hectare enclosure. Once in captivity, a caseous lymphadenitis (CLA) outbreak occurred and ibex handlings were carried out at six-month intervals between 2010 and 2013 to perform health examinations and sampling. Treatment with a bacterin-based autovaccine and penicillin G benzatine was added during the third and subsequent handlings, when infection by Corynebacterium pseudotuberculosis was confirmed. Changes in lesion score, serum anti-C. pseudotuberculosis antibodies and haematological parameters were analyzed to assess captivity effects, disease emergence and treatment efficacy. Serum acute phase proteins (APP) Haptoglobin (Hp), Amyloid A (SAA) and Acid Soluble Glycoprotein (ASG) concentrations were also determined to evaluate their usefulnessasindicatorsofclinical status. Once in captivity, 12 out of 14 ibexes (85.7%) seroconverted, preceding the emergence of clinical signs; moreover, TP, WBC, eosinophil and platelet cell counts increased while monocyte and basophil cell counts decreased. After treatment, casualties and fistulas disappeared and both packed cell volume (PCV) and haemoglobin concentration significantly increased.
  • Sexual Selection and Extinction in Deer Saloume Bazyan

    Sexual Selection and Extinction in Deer Saloume Bazyan

    Sexual selection and extinction in deer Saloume Bazyan Degree project in biology, Master of science (2 years), 2013 Examensarbete i biologi 30 hp till masterexamen, 2013 Biology Education Centre and Ecology and Genetics, Uppsala University Supervisor: Jacob Höglund External opponent: Masahito Tsuboi Content Abstract..............................................................................................................................................II Introduction..........................................................................................................................................1 Sexual selection........................................................................................................................1 − Male-male competition...................................................................................................2 − Female choice.................................................................................................................2 − Sexual conflict.................................................................................................................3 Secondary sexual trait and mating system. .............................................................................3 Intensity of sexual selection......................................................................................................5 Goal and scope.....................................................................................................................................6 Methods................................................................................................................................................8
  • Online Resources Supplemental Material Supplementary Information

    Online Resources Supplemental Material Supplementary Information

    Hystrix (2019) — online resources Supplemental Material Supplementary Information Phylogeny and diversity of moose (Alces alces, Cervidae, Mammalia) revealed by complete mitochondrial genomes M. Świsłocka, M. Matosiuk, M. Ratkiewicz, A. Borkowska, M. Czajkowska, P. Mackiewicz Table S1: List of primer pairs used for PCR and sequencing of mitogenomes in Alces alces. Primer Primer sequence Position Tm [℃] Product [bp] Genes Primer source 12S-FW GGTAAATCTCGTGCCAGCCA 00295 57.3 712 <12s_rRNA> Fajardo et al., 2007† 12S-REV TCCAGTATGCTTACCTTGTTACGAC 01007 56.2 00871c_F TGCTTAGTTGAATTAGGCAATG 00872 51.3 1176 <12s_rRNA...tRNA-Val...16s_rRNA> Matosiuk et al., 2014‡ 02052c_R AGAGAACAAGTGATTATGCTACC 02048 52.2 01950c_F ACCTCCAGCATAACTAGTATTGG 01945 53.7 1455 <16s_rRNA...tRNA-Leu...ND1> Matosiuk et al., 2014‡ 03402c_R AATGGTCCTGCTGCATACTCTA 03400 55.2 03140c_F CTACGAGCAGTAGCTCAAACA 03138 54.1 1025 <ND1...tRNA-Ile...tRNA-Gln...tRNA-Met...ND2> Matosiuk et al., 2014‡ 04165c_R ACAGTTCATTGGCCTGAAAATA 04163 52.5 3910a_F CCTTCCCGTACTAATAAACC 03894 50.0 1519 <tRNA-Met...ND2...tRNA-Trp...tRNA-Ala...> This study 4300a_F2 TCATCAGGCCTAATTCTACT 04279 - <tRNA-Asn...tRNA-Cys...tRNA-Tyr...COX1> 5430a_R TATGCCTGCTCARGCACCAA 05413 56.0 COX1_F TCAGCCATTTTACCTATGTTCA 05315 51.7 826 <tRNA-Tyr...COX1> GenBank§ COX1_R ATRTAGCCAAARGGTTCTTTTT 06141 48.5 06060a_F TCTTTGGACACCCCGAAGTA 06039 55.2 991 <COX1...tRNA-Ser...tRNA-Asp...COX2> This study 07050a_R ATGGGGTAAGCCATATGAGG 07030 53.8 06090a_F TCGTAACATACTACTCAGGG 06099 50.2 1503 <COX1...tRNA-Ser...tRNA-Asp...COX2> This study
  • DESERT BIGHORN COUNCIL TRANSACTIONS VOLUME 8 A

    DESERT BIGHORN COUNCIL TRANSACTIONS VOLUME 8 A

    DESERT BIGHORN COUNCIL TRANSACTIONS VOLUME 8 a Desert Bighorn Council A COMPILATION OF FORMAL PAPERS PRESENTED TO THE COUNCIL AT THE EIGHTH ANNUAL MEETING, APRIL 7, 8, AND 9, 1964, IN MEXICO AT THE AUDITORIO DE SOCIAL SEGURIDO IN MEXICALI AND AT THE HOTEL VILLA DEL MAR AT PUERTO SAN FELIPE, BAJA CALIFORNIA. THE DESERT BIGHORN COUNCIL TRANSACTIONS ARE PUBLISHED ANNUALLY AND ARE AVAILABLE BY WRITING THE . "DESERT BIGHORN COUNCIL" P. 0. BOX 440, LAS VEGAS, NEVADA. COVER DRAWING. BY PAT HANSEN. EIGHTH ANNUAL MEETING DESERT BHGI3ORN COUNCIL April 7, 8, 9, 1964 Mexicali and Puerto San Felipe, Baia California TABLE OF CONTEWS Page .. - program ........................................................ 111 Group Picture ................................................... vii Opening Remarks Dr. Rodolfo Hernandez Corzo, Chairman ............................. xv John P. Russo, Vice-Chairman ................................... x.ix . pp-ppp- . ........................................- -- ... -- --- - .- FORMAL PAPERS AND DISCUSSIONS DESERT BIGHORN SHEEP AT THE SAN DIEGO ZOOLOGICAL GARDEN George H. Pournelle, Curator of hlammals ............................ 1 .~DIXTIOSALNOTES ON PARASITES OF BIGHORN SHEEP ON THE DESERT GAME RANGE, NEVADA Rex W. Allen .............................................. 5 1-OXG-DISTASCE AND NIGHTTLME MOVEMENTS OF DESERT BIGHORh' SHEEP Gale hlonson ............................................... 11 IIESERT BIGHORN MAVAGEMENT NEEDS FROM THE ACADEhllC . porn?; OF VIEW U'ilIiamGraf ..............................................