A Dissertation Entitled Studies on the Functional Relevance of Genetic

Home , Afimoxifene, SULT1E1, Triclocarban, Triclosan

A Dissertation

entitled

Studies on the Functional Relevance of Genetic Polymorphisms of the Human Cytosolic

Sulfotransferase 1E1 (SULT1E1)

Amal El Daibani

Submitted to the Graduate Faculty as partial fulfillment of the requirements for the

Doctor of Philosophy Degree in Pharmacology and Experimental Therapeutics

______Dr. Ming-Cheh Liu, Committee Chair

______Dr. Ezdihar A. Hassoun, Committee Member

______Dr. Youssef Sari, Committee Member

______Dr. Zahoor Shah, Committee Member

______Dr. Amanda Bryant-Friedrich, Dean College of Graduate Studies

The University of Toledo

August 2018

This document is copyrighted material. Under copyright law, no parts of this document may be reproduced without the expressed permission of the author. An Abstract of

Studies on the Functional Relevance of Genetic Polymorphisms of the Human Cytosolic Sulfotransferase 1E1 (SULT1E1)

Amal El Daibani

Submitted to the Graduate Faculty as partial fulfillment of the requirements for the Doctor of Philosophy Degree in Pharmacology and Experimental Therapeutics

The University of Toledo

August 2018

Cytosolic sulfotransferases (SULTs), one of the major group of phase II conjugating enzymes in humans, mediate the sulfoconjugation of numerous key endogenous compounds and xenobiotics. SULT1E1, also known as the estrogen

- sulfotransferase, catalyzes the transfer of the sulfonate moiety (SO3 ) of the active donor compound, 3'-phosphoadenosine 5'-phosphosulfate (PAPS), to the phenolic acceptor group of steroidal estrogens including endogenous estrogens (17-β estradiol, estrone and estriol) as well as structurally related xenobiotics. Genetic polymorphisms of SULT1E1 have been reported to correlate with the increase in the risk for breast, ovarian, prostate, and endometrial cancers. The current study was designed to evaluate the impact of the genetic polymorphisms of the SULT1E1 gene on the sulfating activities of coded

SULT1E1 allozymes toward endogenous estrogens and structurally related xenobiotics.

Following a systematic analysis of SULT1E1 genotypes, five non-synonymous

(missense) coding SNPs (cSNPs) of SULT1E1 were selected. Corresponding cDNAs were generated by site-directed mutagenesis and recombinant SULT1E1 allozymes were iii bacterially expressed and purified by affinity chromatography. By performing sulfotransferase assays, the sulfating activities of the recombinant SULT1E1 allozymes were analyzed with endogenous substrates (17-β estradiol, estrone, and estriol), xenobiotics (17α-ethinylestradiol, 4-hydroxytamoxifen, and diethylstilbestrol), and a known inhibitor for SULT1E, triclosan.

Results obtained indicated that the five SULT1E1 allozymes (SULT1E1-A43D,

SULT1E1-A131P, SULT1E1-R186L, SULT1E1-P214T, and SULT1E1-D220V) exhibited differential sulfating activities toward each of the seven substrate compounds.

Moreover, SULT1E1 allozymes displayed lower 17-β estradiol-sulfating activities in the presence of triclosan compared to the wild-type SULT1E1. Further, kinetic analysis revealed the distinct substrate affinity (Km) and catalytic efficiency (Vmax) of different

SULT1E1 allozymes toward 17-β estradiol, 4-hydroxytamoxifen and diethylstilbestrol.

In addition, pH-dependence studies on the sulfation of 17-β estradiol indicated that the optimal pH for the sulfating activity of the wild-type SULT1E1, SULT1E1-A43D, and

SULT1E1-A131P was 8.5, while for SULT1E1-R186L, SULT1E1-P214T, and

SULT1E1-D220V it was 8. Taken together, these findings clearly indicated the influence of genetic polymorphisms on the sulfating activities of coded SULT1E1 allozymes, which may affect the differential metabolism of endogenous estrogens as well as xenobiotics in individuals with different SULT1E1 genotypes. Additionally, this study provided further evidence that triclosan may differentially act as a substrate and inhibitor for human SULT1E1 allozymes, which may interfere with the hemostasis of endogenous estrogens such as 17-β estradiol in individuals with different SULT1E1 genotypes.

Acknowledgements

The completion of this study could not have been possible without the expertise, support and excellent guidance of my outstanding adviser, Dr. Ming-Cheh Liu. I attribute this research and my degree to his encouragement and thoughtful mentorship. His help motivated me to think critically and conduct scientific research.

I would like to thank my committee members, Dr. Ezdihar Hassoun, Dr. Zahoor

Shah, and Dr. Youssef Sari for their insightful advice and appreciated time. I am also very thankful to Dr. Caren Steinmiller for being my graduate representative.

I owe my deepest gratitude to my father and my mother. Without their immeasurable support, infinite reassurance and care, I would not have achieved my goals.

To my husband, who has shown me unconditional support, I thank you for being a great partner and an amazing father to our children.

I am grateful for Mrs. Hafida Belkacemi for being a caregiver for my children during my Ph.D. journey. I am also appreciative to all my lab mates as well, especially

Dr. Katsuhisa Kurogi, Dr. Fatemah Alherz, and Maryam Abunnaja. Thank you for helping, listening, and supporting me through this entire process.

Table of Contents

Abstract ...... iii

Acknowledgements ...... v

Table of Contents ...... vi

List of Tables ...... xi

List of Figures ...... xii

List of Abbreviations ...... xiv

List of Symbols ...... xvii

1 Introduction ...... 1

1.1 Metabolism of endobiotics and xenobiotics ...... 1

1.1.1 Phase I functionalization reactions ...... 2

1.1.2 Phase II conjugation reactions ...... 3

1.2 Sulfate conjugation ...... 3

1.3 Cytosolic sulfotransferases (SULTs) ...... 5

1.3.1 Human cytosolic sulfotransferase 1E1 (SULT1E1) ...... 11

1.3.2 The structure of human cytosolic sulfotransferase 1E1

(SULT1E1) ...... 11

1.4 Overview of the biosynthesis of estrogens ...... 13

1.4.1 Role of SULT1E1 in estrogens sulfation ...... 14

1.4.2 The xenobiotics that are biotransformed by SULT1E1 ...... 15

1.5 Genetic polymorphisms of human cytosolic sulfotransferases ...... 16

1.6 Human SULT1E1 genetic polymorphisms: Physiological implications ..... 18

1.7 Rationale and objectives ...... 20

2 General Materials and Methods ...... 23

2.1. Materials ...... 23

2.2. Molecular cloning of human cytosolic sulfotransferase 1E1

(SULT1E1) ...... 24

2.3. Identification and analysis of human SULT1E1 SNPs ...... 26

2.4. Generation of SULT1E1 allozymes cDNAs ...... 36

2.5. Expression and purification of recombinant SULT1E1 allozymes ...... 37

2.6. Sulfotransferase assay ...... 41

2.7. pH-dependence studies ...... 42

2.8. Kinetics studies ...... 42

3 Sulfation of Endogenous Estrogens and 17α-Ethinylestradiol by

SULT1E1 Allozymes ...... 44

3.1. Abstract ...... 44

3.2. Introduction ...... 45

3.3. Materials and Methods ...... 47

3.3.1. Materials ...... 47

3.3.2. Database search ...... 48

3.3.3. Generation of cDNAs encoding different human SULT1E1

allozymes ...... 49

3.3.4. Expression and purification of recombinant SULT1E1 vii

allozymes ...... 49

3.3.5. Enzymatic assay ...... 50

3.3.6. Kinetic studies ...... 51

3.4. Results ...... 51

3.4.1. Identification and analysis of different SULT1E1 SNPs ...... 51

3.4.2. Preparations of recombinant human SULT1E1 allozymes ...... 52

3.4.3. Enzymatic characterization of the wild-type SULT1E1

and allozymes ...... 53

3.4.3.1. With E2 as a substrate ...... 55

3.4.3.2. With E1 as a substrate ...... 57

3.4.3.3. With E3 as a substrate ...... 59

3.4.3.4. With EE2 as a substrate ...... 60

3.4.4. Kinetic Analysis ...... 63

3.5. Discussion ...... 64

3.6. Conclusion ...... 68

4 Impact of Human SULT1E1 Polymorphisms on the Sulfation of 4-

Hydroxytamoxifen and Diethylstilbestrol by SULT1E1 Allozymes ...... 69

4.1. Abstract ...... 70

4.2. Introduction ...... 71

4.3. Materials and Methods ...... 73

4.3.1. Materials ...... 73

4.3.2. Identification and analysis of the human SULT1E1 SNPs ...... 74

4.3.3. Generation of cDNAs encoding different human SULT1E1

viii

allozymes ...... 75

4.3.4. Expression and purification of recombinant SULT1E1

allozymes ...... 75

4.3.5. Sulfotransferase assay ...... 76

4.3.6. Kinetics studies ...... 77

4.4. Results ...... 77

4.4.1. Identification and analysis of different SULT1E1 SNPs ...... 77

4.4.2. Preparations of recombinant human SULT1E1 allozymes ...... 78

4.4.3. Characterization of the 4-HT-sulfating activity of human SULT1E1

allozymes ...... 79

4.4.4. Characterization of DES-sulfating activity of human SULT1E1

allozymes ...... 83

4.5. Discussion ...... 88

4.6. Conclusion ...... 92

5 Inhibitory Effect of Triclosan on the Sulfation of 17-β Estradiol by Human

SULT1E1 Allozymes ...... 93

5.1. Abstract ...... 93

5.2. Introduction ...... 94

5.3. Materials and Methods ...... 97

5.3.1. Materials ...... 97

5.3.2. Detection and analysis of human SULT1E1 SNPs ...... 98

5.3.3. Generation of cDNAs encoding different human SULT1E1

allozymes ...... 98

5.3.4. Expression and purification of recombinant SULT1E1

allozymes ...... 99

5.3.5. Sulfotransferase assay ...... 100

5.3.6. pH-dependence studies ...... 101

5.3.7. Kinetics studies ...... 101

5.4. Results ...... 102

5.4.1. Identification and analysis of different SULT1E1 SNPs ...... 102

5.4.2. Preparations of recombinant human SULT1E1 allozymes ...... 103

5.4.3. Characterization of TCS sulfation and its inhibitory effect

on E2 sulfation by recombinant human SULT1E1 wild-type ...... 103

5.4.4. Sulfating activity of SULT1E1 allozymes toward E2 with TCS as an

inhibitor ...... 105

5.4.5. pH-dependence ...... 106

5.5. Discussion ...... 109

5.6. Conclusion ...... 110

6 Summary ...... 111

References ...... 113

List of Tables

1.1 List of human cytosolic sulfotransferases ...... 9

1.2 Xenobiotics metabolized by human SULT1E1 ...... 16

1.3 Examples of the reported SNPs in human SULTs ...... 17

1.4 List of SULT1E1 SNPs reported in scientific literature ...... 19

2.1 Designed oligonucleotide primers used in the cDNA cloning of

human wild-type SULT1E1 ...... 25

2.2 List of single nucleotide polymorphisms in human SULT1E1 gene ...... 27

2.3 List of missense coding SNPs in human SULT1E1 gene ...... 28

2.4 Primer sets used in the site-directed mutagenesis of the cDNA encoding human

SULT1E1 allozymes ...... 35

3.1 Kinetic parameters of the sulfation of endogenous estrogens and EE2 by the

human wild-type SULT1E1 ...... 55

3.2 Kinetic constants of the human SULT1E1 allozymes in catalyzing the sulfation of

E2 ...... 64

4.1 Kinetic constants of the human SULT1E1 allozymes in catalyzing the sulfation of

4-HT ...... 83

4.2 Kinetic constants of the human SULT1E1 allozymes in catalyzing the sulfation of

DES...... 88

List of Figures

1-1 Sulfation reaction catalyzed by sulfotransferase enzyme ...... 4

1-2 Synthesis of PAPS via two-step enzymatic reactions ...... 5

1-3 The sulfate conjugation pathway ...... 6

1-4 Ribbon diagram of the structure of human SULT1E1 (dimer) in presence of E2

and PAPS ...... 12

1-5 The biosynthesis and metabolism of estrogens ...... 13

2-1 Agarose gel electrophoresis of the colony PCR of the transformed wild-type

SULT1E1 cDNAs in DH5α E. coli cells...... 26

2-2 Amino acid sequence of human SULT1E1 highlighted with key structural

residues ...... 36

2-3 Agarose gel electrophoresis of the colony PCR of the transformed SULT1E1

cDNAs in DH5α E. coli cells...... 39

2-4 Agarose gel electrophoresis of the colony PCR of the transformed SULT1E1

cDNAs in BL21 E. coli cells...... 39

2-5 SDS gel electrophoretic pattern of the purified human SULT1E1

allozymes ...... 40

3-1 Kinetic analysis of the sulfation of endogenous estrogens and EE2 by

human wild-type SULT1E1 ...... 54

3-2 Specific activities of the human SULT1E1 allozymes toward E2 ...... 56

3-3 Specific activities of the human SULT1E1 allozymes toward E1 ...... 58 xii

3-4 Specific activities of the human SULT1E1 allozymes toward E3 ...... 60

3-5 Specific activities of the human SULT1E1 allozymes toward EE2 ...... 62

4-1 The concentration dependence of the sulfation of 4-HT by

human wild-type SULT1E1 ...... 79

4-2 Specific activities of the human SULT1E1 allozymes toward 4-HT ...... 80

4-3 The concentration dependence of the sulfation of DES by human

wild-type SULT1E1 ...... 84

4-4 Specific activities of the human SULT1E1 allozymes toward DES ...... 85

5-1 TCS sulfation by human SULT1E1 wild-type ...... 104

5-2 Inhibitory effect of TCS on E2 sulfation by human SULT1E1

wild-type ...... 105

5-3 E2 Sulfation by SULT1E1 allozymes with and without TCS

as an inhibitor ...... 106

5-4 pH-dependence of E2-sulfating activity of the human wild-type

SULT1E1 and allozymes ...... 107

xiii

List of Abbreviations

ADP ...... Adenosine-5’-Diphosphate Ala/A ...... Alanine APS ...... Adenosine-5’-Phosphosulfate Arg /R ...... Arginine Asn/N ...... Asparagine Asp/D ...... Aspartic acid ATP ...... Adenosine-5’-Triphosphate cDNA ...... Complementary Deoxyribonucleic Acid CHES ...... Sodium acetate, 2- (Cyclohexylamino) Ethanesulfonic Acid CYP ...... Cytochrome P-450 Cys/C ...... Cysteine DA ...... Dopamine DES ...... Diethylstilbestrol DHEA ...... Dehydroepiandrosterone DMSO ...... Dimethyl Sulfoxide DNA ...... Deoxyribonucleic Acid Dntp...... Deoxynucleoside Triphosphate DTT ...... Dithiothreitol E1 ...... Estrone E2 ...... 17-β Estradiol E3 ...... Estriol E. coli ...... Escherichia Coli EP ...... Epinephrine HEPES ...... N-2-Hydroxylpiperazine-N2-Ethanesulfonic His/H ...... Histidine HRT...... Hormone Replacement Therapy HSDs ...... Hydroxysteroid Dehydrogenases HST ...... Hydroxysteroid Sulfotransferase 4-HT ...... 4-Hydroxytamoxifen 5-HT ...... Serotonin Ile/I ...... Isoleucine IPTG ...... Isopropyl-β-D-thiogalactopyranoside GIT ...... Gastrointestinal Tract Gln/Q ...... Glutamine Glu/E ...... Glutamic acid Gly/G ...... Glycine GST ...... Glutathione S-Transferase KDa ...... Kilodalton LB ...... Luria Broth xiv

Leu/L ...... Leucine Lys/K ...... Lysine MES ...... 2- Morpholinoethanesulfonic Acid Met/M ...... Methionine MOPS ...... β-naphthol, 3-(N-Morpholino) Propanesulfonic Acid NATs ...... N-Acetyltransferases NCBI ...... National Center for Biotechnology Information NE ...... Norepinephrine OD600 nm ...... Optical Density at 600 nm wavelength PAPS ...... 3‘-Phosphoadenosine-5‘-Phosphosulfate PCR ...... Polymerase Chain Reaction PharmGKB ...... Pharmacogenomics Knowledge Base Phe/F ...... Phenylalanine Pnp ...... p-Nirtophenol Pro/P ...... Proline PSB ...... 5’-Phosphosulphate-Binding PST ...... Phenolic Sulfotransferase Ser/S ...... Serine S.D ...... Standard Deviation SDS ...... Sodium Dodecyl Sulfate SDS–PAGE ...... Sodium Dodecyl Sulfate–Polyacrylamide Gel Electrophoresis SERM ...... Selective Estrogen Receptor Modulator SNPs ...... Single Nucleotides Polymorphisms SULTs ...... Human Cytosolic Sulfotransferases Enzymes SULT1A1 ...... Human Cytosolic Sulfotransferases Family 1A Member 1 SULT1A2 ...... Human Cytosolic Sulfotransferases Family 1A Member 2 SULT1A3 ...... Human Cytosolic Sulfotransferases Family 1A Member 3 SULT1B1 ...... Human Cytosolic Sulfotransferases Family 1B Member 1 SULT1C1 ...... Human Cytosolic Sulfotransferases Family 1C Member 1 SULT1C2 ...... Human Cytosolic Sulfotransferases Family 1C Member 2 SULT1C4 ...... Human Cytosolic Sulfotransferases Family 1C Member 4 SULT1E1 ...... Human Cytosolic Sulfotransferases Family 1E Member 1 SULT2A1 ...... Human Cytosolic Sulfotransferases Family 2A Member 1 SULT2B1a ...... Human Cytosolic Sulfotransferases Family 2B Member 1a SULT2B1b ...... Human Cytosolic Sulfotransferases Family 2B Member 1b SULT4A1 ...... Human Cytosolic Sulfotransferases Family 4A Member 1 SULT6B1 ...... Human Cytosolic Sulfotransferases Family 6B Member 1 TCS ...... Triclosan TAPS ...... 3-[N-Tris-(hydroxymethyl) Methylamino[-propanesulfonic acid] Thr/T ...... Threonine TLC ...... Cellulose Thin-Layer Chromatography TMX ...... Tamoxifen Tris-HCl ...... Trisaminomethane Hydrocholoride Trp/W ...... Tryptophan Tyr/Y ...... Tyrosine UGTs ...... Uridine 5'-Diphospho-Glucuronosyltransferases xv

UniProt ...... Universal Protein Resource 3’UTR ...... 3’-Untranslated Region 5’UTR ...... 5’-untranslated Region Val/V ...... Valine

xvi

List of Symbols

L ...... Liter ml ...... Milliliter µl ...... Microliter g...... Gram mg ...... Milligram µg ...... Mirogram mM ...... Millimolar µM ...... Micromolar SO3 ...... Sulfonate Group SO42 ...... Inorganic Sulfate nmol ...... Nanomole mmol ...... Millimole pmol ...... Picomole Sec ...... Second min ...... Minute h...... Hour oC ...... Celsius Ci ...... Curie Vmax ...... Maximal Velocity Km ...... Michaelis Constant α ...... Angle of incidence β ...... Angle of distortion

xvii

Chapter 1

Introduction

1.1. Metabolism of endobiotics and xenobiotics

The human body is frequently exposed to numerous xenobiotic compounds, such as drugs, nutrients, environmental contaminants, and plant and animal toxins, in addition to endobiotic compounds that are synthesized within the cells. Renal and biliary excretions of these compounds depend on their physicochemical properties, particularly hydrophilicity. The ability of the kidney and bile duct to remove these compounds increases as does their hydrophilicity. To maintain the homeostasis of endobiotics and protect the body from the harmful effects of xenobiotics, both types of compounds are subjected to metabolism or biotransformation. The biotransformation is catalyzed by metabolizing enzymes that are expressed in most tissues, with the highest levels being in the liver and gastrointestinal tract (GIT). In general, the metabolic pathway is a biphasic process (phase I and phase II) that results in compounds, which are more polarized than their parent compounds, thus improving their elimination from the body (Gonzalez et al.,

2011).

1.1.1. Phase I functionalization reactions

In phase I reactions, which include oxidation, reduction, and hydrolysis, the metabolizing enzymes introduce one of the functional groups (–OH, –COOH, –SH, –O–, or –NH2) to the substrate. The most common phase I reaction is oxidation, which is mediated by cytochrome P450s (CYPs) and occurs in the endoplasmic reticulum and mitochondria (Parkinson, 2001). CYPs are heme-containing enzymes that are categorized into 18 families and 44 subfamilies (Estabrook, 2003). Among them, three families (CYP1, CYP2, and CYP3) are involved in the metabolism of xenobiotics, while the remaining families are involved in the metabolism of endobiotics (Danielson, 2002;

Zanger and Schwab, 2013). It has been found that CYP2C, CYP2D, and CYP3A are the main subfamilies that are involved in xenobiotics metabolism (Gonzalez et al., 2011). In particular, the CYP3A4 enzyme, which is highly expressed in the liver and GIT, has been shown to metabolize nearly 50% of approved drugs (Danielson, 2002). Other phase I reactions include hydrolysis and reduction reactions. Hydrolysis reactions are mediated by esterases and amidases that remove ester and amide groups, respectively, from the parent compounds, while reduction reactions are mediated by enzymes that remove ketone, aldehyde, and sulfoxide groups from the parent compounds (Parkinson, 2001).

Generally, the resulting metabolites of phase I reactions are more hydrophilic and may be further subjected to phase II reactions.

1.1.2. Phase II conjugation reactions

Phase II reactions include glucuronidation, sulfation, acetylation, glutathione conjugation, and methylation that are catalyzed by UDP-glucuronosyltransferases

(UGTs), sulfotransferases (SULTs), N-acetyltransferases (NATs), glutathione S- transferases (GSTs), and methyltransferases, respectively (Gonzalez et al., 2011;

Parkinson, 2001). All of these reactions occur in the cytoplasm except those catalyzed by

UGTs, which occur in the endoplasmic reticulum (Gonzalez et al., 2011; Parkinson,

2001). The conjugation of polar moieties in phase II reactions results in highly hydrophobic metabolites that are biologically inactive, and are thereby easily excreted from the body (Gonzalez et al., 2011; Parkinson, 2001). In some cases, however, the formed metabolite is more biologically active than the prodrug, such as sulfate conjugation of morphine and codeine (Zuckerman et al., 1999).

1.2. Sulfate conjugation

In the late 19th century, Eugen Baumann first discovered sulfation as one of the major phase II conjugation reactions (Baumann, 1876). Phase II sulfate conjugation that is catalyzed by cytosolic sulfotransferases (SULTs) represents a major pathway for the biotransformation and excretion of a wide variety of endobiotics, including steroid hormones, neurotransmitters, thyroid hormone, catecholamines, as well as numerous xenobiotics (Coughtrie, 2012). Sulfation generally results in an increase in the hydrophilicity of the substrate compounds and contributes to their inactivation and subsequent removal from the body (Falany and Roth, 1993; Mulder and Jakoby,1990;

Weinshilboum and Otterness, 1994). Studies have indicated the involvement of these enzymes in modulating the activity of xenobiotics and maintaining the homeostasis of key endobiotics such as hormones, catecholamine neurotransmitters, and cholesterol

(Strott, 2002). Furthermore, several studies revealed that SULTs are one of the major group of conjugating enzymes that are capable of detoxifying xenobiotics in the developing human fetus (Duanmu et al., 2006; Wood et al, 2003). Sulfation is an enzymatic reaction in which cytosolic sulfotransferases (SULTs) mediate the transfer of the sulfonate moiety (SO3-) from the universal sulfate donor, 3‘-phosphoadenosine-5‘- phosphosulfate (PAPS), to a nucleophilic moiety of the substrate compounds that carry hydroxyl or amino groups (cf. Figure 1.1) (Falany and Roth, 1993; Mulder and

Jakoby,1990; Weinshilboum and Otterness, 1994).

Figure 1.1. Sulfation reaction catalyzed by sulfotransferase enzyme.

The cofactor for the sulfation reaction, PAPS, is synthesized in the cytosol through two consecutive step reactions (Figure 1.2) (Strott, 2002). These reactions are

first catalyzed by ATP sulfurylase into adenosine-5’- phosphosulfate (APS), followed by

APS kinase to form PAPS (Cho et al., 2004; Strott, 2002). Generally, sulfoconjugation

results in hydrophilic and biological inactive metabolites that are easily excreted from the

body (Glatt et al., 2001; Strott, 2002). In some cases, however, sulfation of certain

compounds such as the procarcinogen N-hydroxy-2-acetylaminofluorene, may involve in

the formation of genotoxic metabolites (Glatt, 1997).

Figure 1.2. Synthesis of PAPS via two-step enzymatic reactions.

1.3. Cytosolic Sulfotransferases (SULTs)

In humans and other mammals, the sulfotransferases are categorized into two

groups: the membrane-bound sulfotransferases and cytosolic sulfotransferases (SULTs).

The membrane-bound sulfotransferases are involved in the metabolism of endogenous

macromolecules such as, proteins, glycoproteins, and lipids, while the SULTs are

involved in the metabolism of low-molecular weight compounds including both

endobiotics (e.g., bile acids, hormones, and catecholamine neurotransmitters) and

xenobiotics (Figure 1.3) (Falany, 1997; Strott, 2002; Weinshilboum et al., 1997). SULTs

are widely distributed throughout various tissues including the liver, kidneys, gut, lungs, thyroid glands, adrenal glands, brain, breast tissue, blood, and reproductive organs (Chen et al., 2003). In humans, four distinct SULT gene families of have been identified:

SULT1, SULT2, SULT4 and SULT6 (Allali-Hassani et al., 2007; Strott, 2002). In general, the SULTs that belong to the same family share at least 45% of amino acid sequence identity, while the SULTs that belong to the same subfamily share at least 60% of amino acid sequence identity (Blanchard et al., 2004).

Sulfate Transporter

SO4-2 SO4-2 + ATP APS PAPS + H PPi ATP ADP+H+

Golgi sulfotransferases Cytosolic sulfotransferases SULT1 SULT2

SULT1A1 SULT2A1 SULT1A2 (Dehydroepiandrosterone SULT1A3 SULT) (Phenolic SULTs) SULT2B1a SULT1B1 (Pregnenolone SULT) Nucleus (Thyroid hormone) SULT2B1b SULT1C2 (Cholesterol SULT) SULT1C3 Glycoprotein SULT1C4 (Hydroxy-arylamine (SULT4A1) SULTs) SULT4 SULT6 (SULT6B1) SULT1E1 (Unknown) Hormones Protein (Estrogen SULT) Neurotransmitters Bile acid Xenobiotics Lipid

Figure 1.3. The sulfate conjugation pathway.

Previous studies have shown that the SULT1 family, previously known as phenolic sulfotransferase (PST), is involved in metabolizing phenolic compounds such as 6

catecholamines, estrogens, and thyroid hormones (Coughtrie, 2012; Lindsay et al., 2008).

The SULT1 family is further subdivided into four sub-families that include SULT1A,

SULT1B, SULT1C, and SULT1E (Gonzalez et al., 2011). SULT1A subfamily is further categorized into SULT1A1, SULT1A2, and SULT1A3, which are all encoded by genes located on chromosome 16p11.2-12.1 (Freimuth et al., 2004). SULT1A1 and SULT1A2 share 96% of their encoded amino acid sequence identity and are capable of sulfating the same substrates such as p-nirtophenol (pNP), minoxidil, and b-naphthol; however,

SULT1A2 has been shown to have a lower sulfating activity (Coughtrie, 2012).

SULT1A3, which known as catecholamine sulfotransferase, is involved in metabolizing amine neurotransmitters such as dopamine (DA), epinephrine (EP), norepinephrine (NE), and serotonin (5-HT) (Dajani et al., 1999; Taskinen et al., 2003; Yasuda et al., 2009).

The SULT1B subfamily has only one isoform, the SULT1B1 enzyme, which has been shown to display a high substrate specificity toward thyroid hormones (3,3'- diiodothyronine, triiodothyronine, reverse triiodothyronine and thyroxine) and is also capable of sulfating other compounds, such as pNP and 1-naphthol (Fujita et al., 1997;

Wang et al., 1998). The SULT1C subfamily, including SULT1C2, SULT1C3, and

SULT1C4, has been shown to display sulfating activities toward hydroxylamine containing compounds such as N-hydroxy-2-acetylaminofluorene, N-hydroxy-4- aminobiphenyl, and b-naphthylamine (Runge-Morris and Kocarek, 2013). Finally,

SULT1E1, also known as the estrogen sulfotransferase, has been shown to exhibit the highest efficiency in mediating the sulfation of estrogenic compounds including estrone

(E1), 17β-estradiol (E2), and estriol (E3) as well as structurally related xenobiotics (Adjei and Weinshilboum, 2002; Falany et al., 1995; Schrag et al., 2004; Zhang et al., 1998). 7

The SULT2 family, previously known as hydroxysteroid sulfotransferase (HST) family, is involved in metabolizing steroids and hydroxysteroids including dehydroepiandrosterone (DHEA), pregnenolone, cholesterol, and oxysterols (Strott,

2002). The SULT2 family is classified into two subfamilies based on their substrate specificity: SULT2A1, known as the dehydroepiandrosterone sulfotransferase, and

SULT2B1 (Falany and Rohn-Glowacki, 2013; Javitt et al., 2001). SULT2B1 is further classified into two isoforms: SULT2B1a and SULT2B1b, also known as pregnenolone sulfotransferase and cholesterol sulfotransferase, respectively (Falany and Rohn-

Glowacki, 2013; Javitt et al., 2001).

The two remaining families, SULT4 and SULT6, both comprise of single members, are designated as SULT4A1 and SULT6B1, respectively (Freimuth et al.,

2004; Sidharthan et al., 2014). There is currently limited information regarding their tissue distribution, sulfating activity, and substrate specificity. Table 1.1 summarizes the human SULT families and sub-families, together with their amino acid lengths, chromosomal locations, mass, organ distribution, and examples of the main known substrates.

Table 1.1. List of human cytosolic sulfotransferases

SULT SULT Mass Gene Length Organ Distribution Substrate Reference Family Isoform (Da) Location

Thyroid hormones, E pNP, (Dooley et al., 1994; Wilborn GIT, liver, kidney, lung, brain. 2., SULT1A1 295 34,165 16p12.1 minoxidil, paracetamol. et al., 1993)

(Her et al., 1996; Zhu et al., SULT1A2 295 34,310 16p12.1 Liver, stomach. pNP, minoxidil. 1996)

(Aksoy and Weinshilboum, DA, EP, NP,5-HT, salbutamol, SULT1A3 295 34,196 16p11.2 Brain, platelet, GIT, Kidney. 1995; Dooley et al., 1994; Zhu opioids. et al., 1993)

Colon, small intestine, liver, Thyroid hormones, pNP, SULT1B1 296 34,899 4q13.3 (Fujita et al.,1997) leukocyte. 1-naphthol

(Freimuth et al., 2000; Her et Kidney, stomach, thyroid gland, N-hydroxy-2-

SULT1 SULT1C2 296 34,880 2q12.3 al., 1997; Sakakibara et al., liver, fetal liver. acetylaminofluorene, pNP. 1998)

(Freimuth et al., 2000; Freimuth SULT1C3 304 35,674 2q12.3 Fetal liver and spleen. Bile acid, thyroid hormones. rt al., 2004; Kurogi et al., 2017)

Fetal liver, lung, kidney, and (Freimuth et al., 2000; 2q12.3 heart. Adult kidney, ovary, Paracetamol, pNP. SULT1C4 302 35,520 Sakakibara et al., 1998) spinal cord, and stomach.

Liver, breast, skin jejunum, E E E , 17α-ethinylestradiol SULT1E1 294 35,126 4q13.1 2, 1, 3 (Aksoy et al., 1994) breast, brain, reproductive organs. (EE2),

SULT Mass Gene SULT Isoform Length Organ Distribution Substrate Reference Family (Da) Location (Kong et al., 1992; Otterness et Liver, adrenal cortex, jejunum, SULT2A1 285 33,780 19q13.3 DHEA, pregnenolone. al., 1992) brain, bone marrow.

(Falany et al., 2006a; Her et al., Prostate, placenta, skin, respiratory SULT2B1a 350 39,599 19q13.3 DHEA, pregnenolone. 1998) system. SULT2

(Falany et al., 2006a; Her et al., Lung, prostate, breast, brain, Cholesterol DHEA, SULT2B1b 365 41,308 19q13.3 1998) placenta, skin. pregnenolone.

(Falany et al., 2000; Brain, GIT, bladder, cervix, testis, SULT4 SULT4A1 284 33,085 22q13 Not known Sidharthan et trachea, prostate. al., 2014) (Freimuth et al., 2004) SULT6 SULT6B1 303 34,919 2p22.3 Testis, kidney. Not known

1.3.1. Human cytosolic sulfotransferase 1E1 (SULT1E1)

In 1994, SULT1E1 cDNA was first cloned from the human liver cDNA library

(Aksoy et al., 1994). It was later reported that a single gene located in chromosomal region 4q13.1 encodes the key enzyme for estrogen biotransformation named estrogen sulfotransferase (SULT1E1). The enzyme encoded by the SULT1E1 cDNA has been shown to display high efficiency in mediating the sulfation of endogenous estrogens including E1, E2, E3, catecholestrogens, as well as the structurally related xenobiotics

(Adjei and Weinshilboum, 2002; Falany et al., 1995; Schrag et al., 2004; Zhang et al.,

1998). SULT1E1 has been shown to be expressed in the human liver, breast, endometrium, adrenal gland, placenta, jejunum, lung, skin, and testis (Falany et al., 1995;

J. L. Falany and Falany, 1996a, 1996b; Qian et al., 1998; Schrag et al., 2004; Song et al.,

1997; Zhang et al., 1998), as well as human fetal kidney, liver, lung, thyroid gland, and choroid plexus (Stanley et al., 2005).

1.3.2. The structure of human cytosolic sulfotransferase 1E1 (SULT1E1)

Among all SULTs, the first resolved crystal structure was that of the mouse

SULT1E1 (Kakuta et al., 1997). Later, the crystal structure of human SULT1E1 was resolved in the presence of PAP and E2 (Figure 1.4) or PAP and hydroxylated polychlorinated biphenyl (Pedersen et al., 2002; Shevtsov et al., 2003; Thomas and

Potter, 2013). The protein structure of SULT1E1 shows a single domain globular molecule, which is comprised of α/β motifs with a central 5-standard parallel β-sheet

(Pedersen et al., 2002). The 5’-phosphosulphate-binding (PSB) loop (45TYPKSGT51), 3’- 11

phosphate-binding region (R129, S137, and 256RKG258), and the PAP adenine-binding group (W52, Y192 and T226) represent the main regions where the binding of the

SULT1E1 and PAPS molecule occurs (Kakuta et al., 1997; Thomas and Potter, 2013). In addition, the amino acid residues (Y20, F23, P46, F75, F80, C83, K85, M89, K105,

H107, F138, F141, 145VAGH148, Y168, Y239, L242, and 246IM247) are involved in substrate-binding, while the C-terminal motif (265KNHFTVALNE274) and H107 are responsible for the dimerization and the catalytic activity of SULT1E1, respectively

(Kakuta et al., 1997; Petrotchenko et al., 2001; Thomas and Potter, 2013).

Figure 1.4. Ribbon diagram of the structure of human SULT1E1 (dimer) in presence of E2 (green) and PAPS (yellow). The figure was generated using PyMOL software and the reported crystal structure of SULT1E1 (Protein Data Bank code: 4JVL).

1.4. Overview of the biosynthesis of estrogens

In humans, the ultimate biosynthetic precursor for all steroid hormones is cholesterol. In the adrenal gland, the cytochrome P450 (P450scc) catalyzes the biotransformation of cholesterol to pregnenolone, which serves as a precursor for DHEA.

In sex-steroid responsive tissues, particularly ovaries, both locally produced and adrenally synthesized DHEA act as precursors for steroidal estrogens that are essential for the growth and maintenance of reproductive organs. The CYPA19 aromatase enzyme mediates the biosynthesis of E2 and E1 from testosterone and androstenedione, respectively (Figure 1.5) (Payne and Hales, 2004; Shoham and Schachter, 1996). In addition, 17β-hydroxysteroid dehydrogenases (17β-HSDs) are the enzymes responsible for reversible interconversion between the secreted E2 and E1. Afterward, E1 can be further oxidized to 16α-hydroxyesterone intermediate that is metabolized to E3 by 17β-

HSD (Shoham and Schachter, 1996; Thomas and Potter, 2013).

Figure 1.5. The biosynthesis and metabolism of estrogens. The red boxes indicate the sulfate conjugation reaction mediated by SULT1E1.

1.4.1. Role of SULT1E1 in estrogens sulfation

In hormone-responsive tissues, high levels of estrogens have been attributed to estrogen receptor-mediated carcinogenicity, leading to breast, endometrial and ovarian tumors (Bernstein and Ross, 1993; Miller and Langdon, 1997). SULT1E1 is also involved in the pathophysiology of prostate cancer as it acts as a mediator of estrogen activated signal transduction in human prostate cancer CA-HPV-10 cell line (Kapoor and

Sheng, 2008). Similarly, estrogen exposure through hormone replacement therapy

(HRT) has been reported to increase the risk of breast carcinoma in women (Althuis et al., 2003). Furthermore, epidemiological studies have indicated that HRT that utilizes estrogen compounds can also lead to the development of ovarian cancer (Lacey et al.,

2002; Morch et al., 2009). Two of the potential molecular mechanisms underlying the carcinogenic effect of estrogen are the cell proliferation via ER-mediated hormonal activity and the formation of catecholestrogens, which are genotoxic pro-carcinogens

(Chang, 2011). The oxidized compounds of catecholestrogens, semiquinones and quinones, are highly reactive oxygen species that cause DNA damage and mutation

(Russo and Russo, 2006; Yue et al., 2003). Consequently, the biotransformation of estrogens is considered one of the major pathways for estrogen detoxification. There are two types of enzymes that are responsible for estrogen biotransformation: the SULTs and the UGTs (Raftogianis et al., 2000). The main pathway, however, is the SULT-mediated sulfation of estrogens since the conjugated estrogen sulfate is the most prominent estrogen in the circulation system (Hobkirk, 1985; Pasqualini et al., 1989). In the body, sulfate conjugation of estrogens is known to be one of the main detoxification

mechanisms that protect the cells from the estrogen-mediated mitogenicity and genotoxicity (Raftogianis et al., 2000). Therefore, sulfation has been shown to modulate the activity of endogenous estrogens as well as xenoestrogens. Of the thirteen known human SULTs, SULT1E1 has been shown to display the highest efficiency in mediating the sulfation of endogenous estrogens and structurally-related xenobiotics (Falany et al.,

1995; Schrag et al., 2004; Zhang et al., 1998). SULT1E1 catalyzes the transfer of sulfonate moiety (SO3-) from the active donor compound, 3'-phosphoadenosine 5'- phosphosulfate (PAPS), to the 3-phenolic acceptor group of estrogens (Falany, 1997;

Hobkirk, 1993). Estrogen sulfation produces biologically inactive sulfated estrogens that have a longer half-life than unconjugated compounds and act as estrogen precursors in the peripheral circulation (Hobkirk, 1985; Zhu and Conney, 1998). Sulfated estrogens are also involved in the transport of estrogen to target tissues via organic anion transporters (Eckhardt et al., 1999). The active hormones, generated under the action of the sulfatase enzyme, can resume their bioactivity and interact with estrogen receptor

(Coughtrie et al., 1998). Considering the involvement of SULT1E1 in the sulfation of estrogens, SULT1E1 expression and activity may have a protective role against tumorigenesis in steroid hormone-responsive tissues.

1.4.2. The xenobiotics that are biotransformed by SULT1E1

In addition to metabolizing endogenous compounds, SULT1E1 can also mediate the sulfation of some structurally related xenobiotics (Table 1.2).

Table 1.2. Xenobiotics metabolized by human SULT1E1

Xenobiotic Examples Reference Categories

Diethylstilbestrol 4-Hydroxytamoxifen (Falany et al., 2006b; Hui Cancer therapy Fulvestrant et al., 2015; Suiko et al., Abiraterone 2000; Yip et al., 2018) Galeterone

Oral contraceptive EE2 (Schrag et al., 2004)

Hydroxylated metabolites of Environmental polyhalogenated aromatic (Kester et al., 2002) pollutants hydrocarbons

Antimicrobial (James et al., 2010; Wang Triclosan agents et al., 2004)

Nonsteroidal anti- Sulinidac (Alherz et al., 2017) inflammatory drug Ibuprofen (King, et al., 2006) 6-O-Desmethylnaproxen

Dietary flavonoids Hesperetin (Huang et al., 2009)

1.5. Genetic polymorphisms of human cytosolic sulfotransferases

Single nucleotides polymorphisms (SNPs), which may influence the functional consequences of translated proteins, have been reported in SULT gene superfamily

(Nowell and Falany, 2006). Table 1.3 summarizes some examples of the reported human

SULT SNPs.

Table 1.3. Examples of the reported SNPs in human SULTs

SNPs of SULTs Effects Reference

Change activation rate of N- SULT1A1*2 (Arg213His) hydroxy-2-acetylaminofluorene (Glatt et al., 2001) and 1-hydroxymethylpyrene

Decrease K value of 4- SULT1A1*3 (Met223Val) m (Raftogianis et al., 1999) nitrophenol and PAPS

Increase risk of esophageal SULT1A1*4 (Shah et al., 2016) squamous cell carcinoma

SULT1A2*2 (Ile7Thr, Dramatic change in K value of m (Raftogianis et al., 1999) Asn235Thr) 4-nitrophenol

SULT1A3 (Lys234Asn) SULT1A3 (Pro101Leu) (Hui and Liu, 2015; Decrease DA-sulfating activity SULT1A3 (Pro101His) Thomae et al., 2003) SULT1A3 (Arg144Cys)

Decrease DHEA-sulfating SULT2A1 (Glu186Val) (Glatt et al., 2001) activity

Dramatic decrease in sulfating SULT2A1 (Pro76Thr) activity toward DHEA and (Abunnaja et al., 2018) pregnelolone

Implicated in autosomal- recessive congenital ichthyosis. (Alherz et al., 2018; SULT2B1b (Arg274Gln) Dramatic decrease in sulfating Heinz et al., 2017) activity toward cholesterol.

1.6. Human SULT1E1 genetic polymorphisms: Physiological implications

For SULT1E1, the distribution of SNPs has been shown to vary between ethnicities and has been reported to be associated with the risk for different cancers, disease etiologies, and responses to therapies (Daniels and Kadlubar, 2013; Nowell and

Falany, 2006). A prior study has shown that imbalance between the expression of the enzymes that are involved in the biosynthesis of estrogen (e.g., CYP1A1) and biotransformation (e.g., SULT1E1) could be a risk factor for endometrial tissue cancer

(Hirata et al., 2008). Moreover, the SULT1E1-64G/A has been shown to be associated with a significant increase in the chance of developing endometrial tissue cancer particularly in women receiving long-term HRT (Rebbeck et al., 2006). Furthermore, the non-synonymous cSNPs of SULT1E1 Asp22Tyr and Ala32Val showed significant decreases in their sulfating activity (Adjei et al., 2003). Based on an epidemiological study of Korean women that included 989 breast cancer patients and 1054 controls without history of cancer, patients with SULT1E1 *959G>A (rs3775778) and SULT1E1

IVS4-1653 T>C (rs3775775) base changes showed a 4-fold increase in the risk for breast cancer (Choi et al., 2005). Additionally, missense mutation (His224Gln) in SULT1E1 protein may be considered a risk factor for breast cancer in Jewish women (Cohen et al.,

2009). Furthermore, recent clinical studies have demonstrated a correlation between genetic polymorphisms of SULT1E1 and both, the inter-individual variations of plasma concentrations of 4-hydroxytamoxifen in breast cancer patients treated with tamoxifen, and the time to treatment failure in prostate cancer patients administered with abiraterone acetate (Agarwal et al., 2016; Woo et al., 2017). As a result, SNPs of SULT1E1 play a

significant role in the tumorigenesis of estrogen dependent tissues and responses to therapies (Pasqualini, 2009; Xu et al., 2012). SNPs of conjugating enzymes including

SULT1E1 may interfere with the conjugation pathways of estrogenic compounds and may represent a risk factor for cancer in steroid-responsive tissues (Raftogianis et al.,

2000).

Table 1.4. List of SULT1E1 SNPs reported in scientific literature

SULT1E1 SNPs Pathophysiological implications Reference

SULT1E1-64G/A (Hirata et al., 2008; High risk of endometrial cancer (rs3736599) Rebbeck et al., 2006)

SULT1E1 (Asp22Tyr) Significance decrease in enzyme (Adjei et al., 2003) SULT1E1 (Ala32Val) activity

SULT1E1 *959G>A (rs3775778) Increase in the risk of breast cancer (Choi et al., 2005) SULT1E1 IVS4-1653 T>C (rs3775775)

Risk factor for breast cancer in SULT1E1 (His224Gln) (Cohen et al., 2009) Jewish women Low endoxifen concentration in (Fernandez- SULT1E1 -64G>A breast cancer patients treated with Santander et al., (rs3736599) tamoxifen. 2013) SULT1E1 -9-899G>A Inter-individual variations of SULT1E1 -9-682A>G plasma concentrations of 4-HT in (Woo et al., 2017) SULT1E1 -9-469A>G breast cancer patients treated with tamoxifen. SULT1E1 (rs3775777) SULT1E1 (rs4149534) Time to treatment failure in SULT1E1 (rs10009305) (Agarwal et al., prostate cancer patients treated SULT1E1 (rs3775770) 2016) with abiraterone acetate. SULT1E1 (rs4149527) SULT1E1 (rs3775768)

1.7. Rationale and objectives

Sulfate conjugation as mediated by the estrogen sulfotransferase, SULT1E1, plays a major role in the homeostasis of estrogen. As such, the genetic polymorphisms of

SULT1E1 may potentially influence estrogen homeostasis in different individuals.

Incidentally, it has been reported that SULT1E1 polymorphisms may pose a risk for the development of tumors that are associated with hormone-dependent tissues such as breast, ovarian, prostate, and endometrial tissues (O'Mara et al., 2011; Pasqualini, 2009;

Xu et al., 2012). The principal objective of this study is to investigate how the genetic polymorphisms of SULT1E1 may influence its enzymatic activity toward endogenous estrogens and estrogen-like drugs. In view of the crucial role of SULT1E1 in the homeostasis of estrogens, we hypothesize that SULT1E1 SNPs may affect the sulfating activity of SULT1E1 allozymes present in different individuals, thereby influencing estrogen homeostasis and the metabolism of estrogen-like drugs. To validate this hypothesis, the specific aims of this research are as follows:

Specific Aim 1: To systematically identify and analyze different genotypes of human

SULT1E1 gene and collect epidemiological data concerning different human

SULT1E1 genotypes.

The SNP databases at the U.S. National Center for Biotechnology Information

(NCBI), the Universal Protein Resource (UniProt), and the Pharmacogenomics

Knowledge Base (PharmGKB) websites were searched to identify different SULT1E1 genotypes (Sim, Altman et al. 2011). The SULT1E1 genotypes identified were analyzed and classified based on their locations into (introns, 5’- untranslated region (5’UTR), 3’-

untranslated region (3’UTR), and the exons). Furthermore, the epidemiological studies concerning SULT1E1 polymorphisms in regard to their pathophysiological relevance in different diseases and tumors were collected and analyzed.

Specific Aim 2: To clone the human cytosolic sulfotransferase 1E1 (SULT1E1).

On the basis of human SULT1E1 sequence information, sense and antisense oligonucleotide primers were designed. PCR technique was used to amplify the cDNA encoding the human SULT1E1. Subsequently, the PCR product was applied onto a 1% agarose gel and separated by electrophoresis. The visualized band excised from the gel and then subjected to spin filtration. Finally, the isolated DNA fragment was subjected to

XmaI restriction, subcloned into XmaI-restricted pGEX-2TK vector, and then transformed into competent DH5α E. coli cells.

Specific Aim 3: To generate cDNAs encoding different human SULT1E1 allozymes and to express and purify recombinant SULT1E1 allozymes.

By employing site directed mutagenesis, cDNA encoding SULT1E1 allozymes were generated. A wild-type SULT1E1 cDNA packaged in PGEX-2TK prokaryotic expression vector was used as a template in conjugation with specific mutagenic primers.

The vector harboring individual mutated SULT1E1 was transformed into E. coli competent cells. The recombinant allozymes expressed were purified from the homogenates of transformed E. coli and analyzed by SDS- polyacrylamide gel electrophoresis. 21

Specific Aim 4: To characterize human SULT1E1 allozymes with regard to their sulfating activity toward representative endogenous estrogens and estrogenic drugs/xenobiotics.

Purified SULT1E1 allozymes were analyzed with regard to their substrate specificity, pH-dependence, and kinetic properties toward representative endogenous compounds (E2, E1, and E3) and xenobiotics (EE2, diethylstilbestrol, and 4- hydroxytamoxifen).

Specific Aim 5: To examine the inhibitory effect of triclosan, an antimicrobial agent, on the sulfating activity of human SULT1E1 allozymes.

The sulfotransferase assays for SULT1E1 allozymes were performed in the presence of triclosan, a representative SULT1E1 inhibitor, to assess its inhibitory effect on the sulfation of E2 by different SULT1E1 allozymes.

Chapter 2

General Materials and Methods

2.1. Materials

17-β Estradiol (E2), estrone (E1), estriol (E3), 17α-ethinylestradiol (EE2), Triclosan

(TCS), and 4-hydroxytamoxifen (4OH-tamoxifen) were products of Cayman Chemical

Company (Ann Arbor, MI, USA). Diethylstilbestrol, adenosine 5’-triphosphate (ATP), dimethyl sulfoxide (DMSO), dithiothreitol (DTT), 3’-phosphoadenosine-5’- phosphosulfate (PAPS), isopropyl-1-thio-β-D-galactopyranoside (IPTG), and N-2- hydroxylpiperazine-N’-2-ethanesulfonic acid (HEPES) were from Sigma-Aldrich

Chemical Company (St. Louis, MO, USA). Ecolume scintillation cocktail was obtained from MP Biomedicals (Solon, OH, USA). Carrier-free sodium [35S]sulfate was from

American Radiolabeled Chemicals, Inc. (St. Louis, MO, USA). Recombinant human bifunctional ATP sulfulyase/adenosine 5‘-phosphosulfate kinase was prepared as previously described (Yanagisawa et al., 1998), and used to synthesize PAP[35S] from

ATP and [35S]sulfate based on an established procedure (Yanagisawa et al., 1998).

Cellulose thin-layer chromatography (TLC) plates were products of Macherey-Nagel

(Düren, Germany). Silica gel thin-layer chromatography (TLC) plates and Ultrafree-MC

5000 NMWL filter units were from EMD Millipore Corporation (Burlington, MA, USA). 23

Dpn I was purchased from New England BioLabs (Ipswich, MA, USA). PrimeStar Max

DNA polymerase was a product of Takara Bio Inc. (Mountain View, CA, USA).

QIAprep® Spin Miniprep Kit was purchased from QIAGEN (Germantown, MD, USA).

All blue prestained protein markers were obtained from BioLand Scientific LLC.

(Paramount, CA, USA). Glutathione Sepharose 4B GST-tagged protein purification resin was purchased from GE Healthcare Bio-Sciences (Pittsburgh, PA, USA).

Oligonucleotide primers were synthesized by Eurofins Genomics (Louisville, KY, USA).

All other reagents and chemicals used were of the highest grades commercially available.

2.2. Molecular cloning of human cytosolic sulfotransferase 1E1 (SULT1E1)

Based on the human SULT1E1 sequence information, sense and antisense oligonucleotide primers that are listed in Table 2.1 were designed. By using these primers and the human cDNA clone SC122715 purchased from OriGene Technologies as a template, cDNA encoding the human SULT1E1 was PCR-amplified under the action of

PrimeSTAR® Max DNA polymerase. Amplification conditions were 30 cycles of 1 min at 94°C, 1 min at 55°C, and 3 min at 72°C. Upon completion of PCR, the PCR product

(amplicon) was applied onto a 1% agarose gel stained with ethidium bromide and separated by electrophoresis. The visualized band was excised from the gel and subjected to spin filtration to isolate the DNA fragment. After purification, the final product was subjected to XmaI restriction, subcloned into XmaI-restricted pGEX-2TK vector, and then transformed into competent DH5α E. coli cells. For a high efficiency transformation, 1 µL of plasmid DNA was added to a tube of DH5α E. coli cells, and the

tube was gently tapped 4-5 times to mix the cell and DNA. The tube was placed on ice for 10 min, subjected to heat shock at 42°C for 30 s, and then placed again on ice for 5 min. Afterward, a 150 µL of SOC medium at room temprature was added to the mixture and incubated at 37°C for 10 min with vigorous shaking (250 rpm). After that, the mixture was spread on an agar plate and incubated at 37°C overnight. The colony PCR was conducted to confirm that the grown bacterial colony contained the correct insert.

The pGEX-5' primer (GGGCTGGCAAGCCACGTTTGGTG) and the pGEX-3' primer

(CCGGGAGCTGCATGTGTCAGAGG) were used for PCR amplification that involved

35 cycles of 30 s at 95°C, 1 min at 55°C, and 6 min at 68°C. The amplicon was then loaded in a 1% agarose gel stained with ethidium bromide and separated by gel electrophoresis to visualize and estimate the size of the amplicon. As shown in Figure

2.1, the size of the insert was similar to the expected size of nearly 1000 base pairs (bp).

After that, the colony that contained the confirmed insert size was grown in a 10 mL LB medium supplemented with ampicillin at 37°C overnight. Following plasmid purification by using the QIAprep® Spin Miniprep Kit from the transformed cells, the cDNA insert was subjected to nucleotide sequencing to verify the authenticity.

Table 2.1. Designed oligonucleotide primers used in the cDNA cloning of human wild- type SULT1E1

Oligonucleotide Primers Sense 5’-ATCCCCCCGGGAATGAATTCTGAACTTGACTATTATGAAAAGTTTGAAG-3’

Antisense 5’-ATCCCCCCGGGATTAGATCTCAGTTCGAAACTTCAGTGTAGATTC-3’

Figure 2.1. Agarose gel electrophoresis of the colony PCR of the transformed wild- type SULT1E1 cDNAs in DH5α E. coli cells.

2.3. Identification and analysis of human SULT1E1 SNPs

The U.S. National Center for Biotechnology Information (NCBI), the Universal

Protein Resource (UniProt), and the Pharmacogenomics Knowledge Base (PharmGKB) are the focal SNP databases that were systematically searched using the keywords (homo sapiens or human SULT1E1). This information was used to conduct a comprehensive analysis for missense coding SNPs of the human SULT1E1 gene. A total of 5,291

SULT1E1 SNPs were identified and classified into coding SNPs (synonymous, nonsense, and non-synonymous (missense)) and non-coding SNPs (introns, 3’-untranslated region

(3’UTR), and 5’-untranslated region (5’UTR)) (cf. Table 2.2). The SULT1E1 missense coding SNPs (cSNPs) are listed in Table 2.3. By analyzing both the resolved SULT1E1 crystal structure and the physiochemical properties of the altered amino acid residues

(e.g., acidic to/from basic, polar to/from non-polar, turn inducing to/from non-turn inducing residues), five SULT1E1 missense cSNPs were selected for further investigation. Table 2.4 shows the sense and antisense oligonucleotide primers designed

for PCR-amplification and the documented allelic frequency of each of the five SULT1E1 cSNPs. Figure 2.2 illustrates the amino acid sequence of human SULT1E1 highlighted with the key structural elements that are essential for proper enzyme function as well as the locations of the five selected cSNPs (Kakuta et al., 1997; Omasits et al., 2014;

Pedersen et al., 2002; Petrotchenko, Pedersenet al., 2001; Shevtsov et al., 2013).

Table 2.2. List of single nucleotide polymorphisms in human SULT1E1 gene

SNPs Location SNPs Number

3’-untranslated region (3’-UTR) 215

5’-untranslated region (5’-UTR) 34

Intron regions 4129

Synonymous coding SNPs 84

Nonsense coding SNPs 15

Missense coding SNPs 204

Table 2.3. List of missense coding SNPs in human SULT1E1 gene

No. SNP Code Position of Nucleotide Amino Acid Amino Acid No. Nucleotide Change Position Change Change 1 rs11569705 177 G A 22 D N G T 22 D Y 2 rs11569712 871 C A 253 P H 3 rs17852473 573 T C 154 F L 4 rs34547148 208 C T 32 A V 5 rs75140571 520 T C 136 V A 6 rs140157798 786 C T 225 H Y 7 rs140624175 544 T G 144 M R 8 rs140959829 220 G C 36 R T 9 rs143807523 670 G A 186 R H 10 rs150180382 217 C G 35 A G 11 rs151059452 280 T C 56 I T 12 rs181450741 934 A C 274 K T 13 rs187665009 636 G A 175 V I 14 rs200323054 590 G T 159 E D 15 rs200443686 546 G A 145 V M 16 rs200590298 504 G C 131 A P 17 rs200630976 922 C T 270 A V 18 rs201005072 772 A T 220 D V 19 rs201072711 558 C G 149 P A 20 rs201713752 364 G A 84 R K 21 rs201902818 793 C T 227 S L 22 rs202059677 582 T C 157 F L 23 rs369506037 481 A G 123 K R 24 rs369730845 460 C T 116 S L 25 rs369931271 375 C T 88 L F 26 rs370310742 241 C A 43 A D 27 rs370876189 685 T C 191 F S 28 rs372760545 892 C T 260 T I 29 rs373853968 753 C A 214 P T

No. SNP Code Position of Nucleotide Amino Acid Amino Acid No. Nucleotide Change Position Change Change 30 rs374660092 289 T G 59 M R 31 rs375271880 891 A G 260 T A 32 rs375695702 662 G C 183 K N 33 rs375864132 951 G A 280 E K 34 rs377482558 638 T A 176 S T 35 rs377668366 474 G C 121 D H 36 rs546191623 845 C G 244 D E 37 rs546818174 331 T C 73 V A 38 rs561070029 343 G A 77 R Q 39 rs565167986 291 A G 60 I V 40 rs746067466 874 T G 254 F C 41 rs746411706 327 G A 72 D N 42 rs746588635 646 G T 178 W L 43 rs747589749 165 C A 18 L I 44 rs748291221 895 G A 261 G E 45 rs748563147 985 G A 291 R Q 46 rs749832097 883 A G 257 K R 47 rs749963767 571 C G 153 S C 48 rs750534499 673 T A 187 V E T G 187 V G 49 rs751266095 448 T A 112 L H 50 rs751883127 599 G A 162 M I 51 rs753982089 669 C G 186 R G C T 186 R C 52 rs754969833 817 C A 235 P Q C G 235 P R 53 rs756055656 914 T G 267 F L 54 rs756363002 790 C T 226 T I 55 rs756748070 634 A T 174 H L 56 rs756987917 159 G A 16 G R 57 rs757040136 948 T C 279 Y H 58 rs757187819 444 G A 111 E K

No. SNP Code Position of Nucleotide Amino Acid Amino Acid No. Nucleotide Change Position Change Change 59 rs757281208 799 A G 229 Q R 60 rs757405253 519 G A 136 V I 61 rs758171863 469 A C 119 E A 62 rs758649472 348 C A 79 P T 63 rs759418370 127 T C 5 L P 64 rs760355185 732 A G 207 I V A T 207 I L 65 rs760568556 139 A G 9 E G 66 rs761102787 651 G A 180 E K G C 180 E Q 67 rs761157490 686 C T 252 S L 68 rs761297230 594 T G 161 F V 69 rs761632873 264 A G 51 T A 70 rs762141758 643 C G 177 S C 71 rs762229711 498 C T 129 R W 72 rs762363288 290 G C 59 M I 73 rs763005303 688 A G 192 Y C 74 rs763360917 604 G T 164 G V 75 rs764414923 600 C A 163 Q K 76 rs765790939 992 G T 293 E D 77 rs766053586 613 C T 167 P L 78 rs766932921 480 A G 123 K E 79 rs767220507 858 C G 249 Q E 80 rs767488336 382 A G 90 N S 81 rs767962674 490 A C 126 Y S A G 126 Y C 82 rs768994692 877 T C 225 M T 83 rs769456468 690 G A 193 E K 84 rs769898905 516 G A 135 A T 85 rs770155636 301 A T 63 E V 86 rs770525356 724 T A 204 I K T C 204 I T

No. SNP Code Position of Nucleotide Amino Acid Amino Acid No. Nucleotide Change Position Change Change 87 rs771011878 250 C T 46 P L 88 rs771777989 160 G A 16 G E 89 rs772175816 894 G A 261 G R 90 rs772834116 846 G A 245 E K 91 rs772895034 751 A G 213 K R 92 rs774700339 499 G A 129 R Q 93 rs775733144 513 G A 134 V M G T 134 V L 94 rs776448035 129 G A 6 D N G T 6 D Y 95 rs777085255 501 A C 130 N H 96 rs778190574 648 T C 179 W R 97 rs778407495 172 A G 20 Y C 98 rs779072453 370 A G 86 E G A T 86 E V 99 rs779178976 658 G T 182 G V 100 rs779280969 765 C A 218 L I C G 218 L V 101 rs779900694 555 C A 148 H N 102 rs780646274 202 T C 30 V A 103 rs780948555 633 C T 174 H Y 104 rs781100262 395 A C 94 Q H 105 rs781501252 213 C A 34 Q K 106 rs865944040 981 T C 290 F L 107 rs899287541 559 C T 149 P L 108 rs928404497 636 G C 175 S T 109 rs936988870 610 T A 166 D E 110 rs951769166 153 G A 14 V I 111 rs961222753 717 G A 202 E K 112 rs965838849 200 T A 29 N K 113 rs980448935 562 A G 150 N S 114 rs990652773 625 G T 171 W L

No. SNP Code Position of Nucleotide Amino Acid Amino Acid No. Nucleotide Change Position Change Change 115 rs993068760 116 G T 1 M I 116 rs994190559 237 A G 42 I V 117 rs995933228 199 A T 29 N I 118 rs998851317 933 A G 274 K E 119 rs1007085224 993 A T 294 I F 120 rs1020568528 973 C T 287 T I 121 rs1027244955 840 C A 243 P T 122 rs1028422269 832 C G 240 T R 123 rs1029957861 921 G T 270 A S 124 rs1039261878 387 G C 92 V L G T 92 V L 125 rs1052854963 255 T C 48 S P 126 rs1165860521 292 T C 60 I T 127 rs1167660789 577 C T 155 P L 128 rs1169474896 274 G A 54 S N 129 rs1170826222 265 C T 51 T I 130 rs1181745949 831 A G 240 T A 131 rs1185755140 750 A G 213 K E 132 rs1188553969 854 G C 247 M I 133 rs1193885357 946 A G 278 H R 134 rs1198182168 686 C A 191 F L 135 rs1208001735 924 C A 271 L M 136 rs1208507410 552 T C 137 S P 137 rs1210226778 258 G A 49 G S 138 rs1212237289 136 A G 8 Y C 139 rs1212729292 141 A C 10 K Q 140 rs1215845180 532 A T 140 Y F 141 rs1220949195 536 C A 141 F L 142 rs1221033541 949 A G 279 Y C 143 rs1229728603 394 A T 94 Q L 144 rs1230054260 870 C T 253 P S 145 rs1231316037 649 G T 179 W L

No. SNP Code Position of Nucleotide Amino Acid Amino Acid No. Nucleotide Change Position Change Change 146 rs1250466056 478 G C 122 C S 147 rs1253443841 124 A G 4 E G 148 rs1260261039 385 G A 91 G E 149 rs1265277815 615 A G 168 N S 150 rs1271614778 876 A G 255 M V 151 rs1279885651 878 G A 255 M I 152 rs1291656655 157 A G 15 H R 153 rs1295363573 234 G T 41 V F 154 rs1298507007 656 G C 181 K N 155 rs1315010797 143 G T 10 K N 156 rs1316115370 433 A G 107 H R 157 rs1318565962 745 A G 211 E G 158 rs1329995417 617 A G 169 I V 159 rs1333400088 723 A G 204 I V 160 rs1334143781 495 T G 128 C G 161 rs1336407598 256 C G 48 S C 162 rs1337948815 130 A G 6 D G 163 rs1340652336 243 A G 44 T A 164 rs1342112380 423 G A 104 V M 165 rs1346169151 317 G T 68 K N 166 rs1346200852 333 A G 74 I V 167 rs1347002481 529 A T 139 Y F 168 rs1352776526 961 T C 283 M T 169 rs1356472094 163 T A 17 I N 170 rs1361781887 252 A G 47 K E 171 rs1373462403 373 A C 87 N T 172 rs1380820438 240 G A 43 A T 173 rs1381627195 437 G T 108 L F 174 rs1385185213 312 G A 67 E K 175 rs1389330164 441 C T 110 P S 176 rs1390191954 453 C G 114 P A 177 rs1400776691 181 T G 23 F C

No. SNP Code Position of Nucleotide Amino Acid Amino Acid No. Nucleotide Change Position Change Change 178 rs1393123762 270 G A 53 V I G T 53 V F 179 rs1403778910 834 A G 241 T A 180 rs1405231725 574 T C 154 F S 181 rs1409331095 913 T C 267 F S 182 rs1410720963 553 G C 147 G A 183 rs1413235220 849 A C 246 I L 184 rs1413605093 183 G T 24 V F 185 rs1414567936 561 A G 150 N D 186 rs1417899524 115 T A 1 M K 187 rs1422748137 456 G A 115 A T 188 rs1426530600 610 T C 166 V A 189 rs1431397129 361 G T 83 C F 190 rs1431509890 681 C A 190 L I 191 rs1433851522 687 T C 192 Y H 192 rs1438726969 492 C G 127 L V 193 rs1444588366 784 A G 224 H R 194 rs1448400065 408 A T 99 N Y 195 rs1449446835 620 G T 170 D Y 196 rs1452112056 169 T C 19 M T 197 rs1453193404 988 C G 292 T S 198 rs1457203016 979 A G 289 K R 199 rs1460190031 259 G T 49 G V 200 rs1462302523 205 A G 31 E G 201 rs1472692670 593 A T 160 K N 202 rs1481185629 910 A G 266 H R 203 rs1485404575 609 A T 166 D V 204 rs1489081047 935 A C 274 K N

Table 2.4. Primer sets used in the site-directed mutagenesis of the cDNA encoding human SULT1E1 allozymes

SULT1E1 Allozyme & Corresponding Minor Allele Mutagenic Primer Set Amino Acid Substitution Frequency

5’-GATGATCTTGTCATTGACACCTACCCTAAATCTGGT-3’ SULT1E1-A43D 5’-ACCAGATTTAGGGTAGGTGTCAATGACAAGATCATC-3’

5’-TATCTTTGCCGGAATCCAAAGGATGTGGCTGTTTCC-3’ SULT1E1-A131P (0.00007-0.0002) 5’-GGAAACAGCCACATCCTTTGGATTCCGGCAAAGATA-3’

(0.000008- 5’-AAGGGAAAGAGTCCACTTGTACTATTTCTTTTCTAC-3’ SULT1E1-R186L 5’-GTAGAAAAGAAATAGTACAAGTGGACTCTTTCCCTT-3’ 0.00002)

(0.000008- 5’-TTCCTGGAAAGGAAGACATCAGAGGAGCTTGTGGAC-3’ SULT1E1-P214T 5’-GTCCACAAGCTCCTCTGATGTCTTCCTTTCCAGGAA-3’ 0.00008)

5’-TCAGAGGAGCTTGTGGTCAGGATTATACATCATACT-3’ SULT1E1-D220V (0.000008) 5’-AGTATGATGTATAATCCTGACCACAAGCTCCTCTGA-3’

Figure 2.2. Amino acid sequence of human SULT1E1 highlighted with key structural residues (substrate-binding, PAPS-binding, and dimerization motif) reported to be essential for the enzyme function with the locations of the five selected missense coding SNPs.

2.4. Generation of SULT1E1 allozymes cDNAs

The site-directed mutagenesis protocol employed by a PCR-based approach was utilized to generate mutated cDNAs encoding SULT1E1 allozymes. The PCR reaction was conducted in a tube that contained a high fidelity PrimeSTAR® Max DNA polymerase, wild-type SULT1E1 cDNA ligated in the pGEX-2TK prokaryotic expression vector as a template, dNTP, and a pair of mutagenic oligonucleotide primers (listed in 36

Table 2.4). The amplification conditions were 12 cycles of template denaturation for 30 s at 95°C, mutagenic primer annealing for 1 min at 55°C, and extension for 15 min at

72°C. At the end of PCR, the restriction enzyme (5 units of Dpn I endonuclease) was added to each reaction mixture and incubated for 1 h at 37°C to degrade the wild-type template. The Dpn I-digested mixtures that contained the “mutated” SULT1E1 cDNA/pGEX-2TK plasmids were individually transformed into competent DH5α E. coli cells to amplify and purify the mutated plasmids as mentioned above in section 2.2. The bacterial-grown colonies were analyzed and visualized by performing a colony PCR, and then their final products were loaded into a 1% agarose gel as previously described

(Figure 2.3). The resulting “mutated” SULT1E1 cDNAs, harbored in pGEX-2TK prokaryotic expression vector, were subjected to nucleotide sequencing to confirm the desired nucleotide substitutions.

2.5. Expression and purification of recombinant SULT1E1 allozymes

The individual wild-type SULT1E1 cDNA and “mutated” SULT1E1 cDNAs harbored by the pGEX-2TK vector were transformed into competent BL21 E. coli cells to express the recombinant wild-type SULT1E1 and allozymes, respectively. As previously described in section 2.2, the colony PCR and agarose gel electrophoresis were performed

(Figure 2.4). The transformed cells (with the confirmed insert size) were allowed to grow in 1 L of Luria broth (LB) medium supplemented with 100 µg/ml ampicillin at

37°C with vigorous shaking (250 rpm). Once it reached to A600 nm = 0.5, 0.1 mM IPTG was added and incubated for 8 h at 25°C to induce protein expression. The cells were

centrifuged at 3,000 × g for 20 min at 4oC and the obtained cell pellets were resuspended in 20 ml of an ice-cold lysis buffer (10 mM Tris-HCl, pH 8.0, 1 mM EDTA, and 150 mm

NaCl). 100 µl of a protease inhibitor was added to the resuspended cells and then homogenized using an Aminco French press. The obtained crude homogenate was subjected to centrifugation at 10,000 × g for 30 min at 4°C. Glutathione-Sepharose (0.5 ml) was added to fractionate the collected supernatant, followed by the addition of 2 ml of a thrombin digestion buffer (50 mM Tris-HCl, pH 8.0, 150 mM NaCl, and 2.5 mM

CaCl2) containing 5 units/ml bovine thrombin to cleave the bound GST-SULT1E1 fusion protein. The resulting preparation was incubated at room temperature for 15 min with constant agitation and then centrifuged. To analyze the purities and measure the concentrations of the recombinant wild-type SULT1E1 and allozymes present in the collected supernatants, SDS-polyacrylamide gel electrophoresis (SDS-PAGE) and

Bradford methods were performed, respectively (Bradford, 1976). As shown in Figure

2.5, SDS-polyacrylamide gel electrophoretic pattern confirmed that the apparent molecular weights of the purified wild-type SULT1E1 and allozymes were consistent with the documented molecular weight (35,126) of the wild-type SULT1E1.

Figure 2.3. Agarose gel electrophoresis of the colony PCR of the transformed

SULT1E1 cDNAs in DH5α E. coli cells. Samples analyzed in lanes 1 through 6 correspond to SULT1E1-WT, SULT1E-A43D, SULT1E1-A131P, SULT1E1-R186L,

SULT1E1-P214T, and SULT1E1-D220V.

Figure 2.4. Agarose gel electrophoresis of the colony PCR of the transformed

SULT1E1 cDNAs in BL21 E. coli cells. Samples analyzed in lanes 1 through 6

correspond to A) SULT1E1-WT, SULT1E-A43D, and SULT1E1-A131P. B) SULT1E1-

R186L, SULT1E1-P214T, and SULT1E1-D220V.

Figure 2.5. SDS gel electrophoretic pattern of the purified human SULT1E1 allozymes. SDS-PAGE was performed on a 12% gel, followed by Coomassie blue staining. Samples analyzed in lanes 1-7. Lane 1 corresponds to the migrating positions of protein molecular weight markers co-electrophoresed. Samples analyzed in lanes 2 through 7 correspond to SULT1E1-WT, SULT1E-A43D, SULT1E1-A131P, SULT1E1-

R186L, SULT1E1-P214T, and SULT1E1-D220V.

2.6. Sulfotransferase assay

To measure the sulfating activity of the recombinant SULT1E1 allozymes toward the selected substrates, PAP[35S] was used to perform radio-enzymatic activity assays.

The mixture, with a 20 µl final volume, consisted of 50 mM HEPES buffer at pH 7.4, 1 mM DTT, 14 µM PAP[35S], and a substrate dissolved in DMSO. A control with a substrate solvent (DMSO) alone was carried out for each assay, separately. In regard to the inhibitory study, the enzymatic assay was performed with 0.5 µM of E2 as a substrate in the absence (control) and presence of varying concentrations of TCS as the SULT1E1 inhibitor. These specific settings were carried out to determine the inhibitory effect of

TCS on the sulfating of E2 by the purified wild-type SULT1E1. In all assays, the enzymatic reactions were initiated by adding 2 µl (containing 0.5 µg) of wild-type or

SULT1E1 allozymes to each assay mixture tube. It was then incubated in a water bath for 10 min at 37oC and terminated by placing the mixture-filled tube in a heating block at

100°C for 3 min. The reaction mixtures were subjected to centrifugation at 13,000 rpm for 3 min to clear the reaction mixture from precipitates. The resulting supernatants were then analyzed using TLC plate. Afterwards, using a precise solvent system as described later for each examined substrate, the TLC separations were performed. The radiolabeled conjugated substrates were detected on the TLC plates by using an autoradiography on x- ray film. The radiolabeled product spot was cut out, eluted with 500 µl of water for 45 min and mixed thoroughly with 2 ml of the Ecolume scintillation liquid in each vial.

According to a previously described method, a liquid scintillation counter was used to quantify the conjugated substrate (Hui & Liu, 2015). Subsequently, the obtained

radioactivity was expressed in unit of nmol or pmol of the sulfated conjugate that formed per min per mg of the added enzyme.

2.7. pH-dependence studies

pH-dependence experiments were performed to analyze the pH profile of the sulfating activity of the wild-type SULT1E1 and allozymes toward E2 as a substrate. The enzymatic assays for pH-dependence studies were the same as those mentioned in section

2.5, except different buffers at various pH values were used individually for each assay.

These buffers were sodium acetate at (4.5, 5, or 5.5), MES at (6 or 6.5), HEPES at (7, 7.5, or 8), TAPS at (8.5 or 9), CHES at (9.5 or 10), and CAPS at (10.5, 11, or 11.5), all at a final concentration of 50 mM in the assay mixtures.

2.8. Kinetics studies

The GraphPad Prism® 7.0 software, which aligned with the Michaelis-Menten kinetics, was used to obtain non-linear regression curves and determine the kinetic parameters (Km and Vmax). In regard to the inhibitory study, the 50% inhibitory concentration (IC50) of TCS on the sulfating of E2 by recombinant SULT1E1 wild-type was calculated according to the non-linear regression of the log (inhibitor) versus response by GraphPad Prism® 7 software. Furthermore, to analyze the specific activity differences between SULT1E1 allozymes and the wild-type SULT1E1, one-way analysis

of variance (ANOVA) was implemented, followed by Tukey's post hoc analysis, with P- values < 0.05 being determined as statistically significant.

Chapter 3

Sulfation of Endogenous Estrogens and 17α-Ethinylestradiol by SULT1E1 Allozymes

3.1. Abstract: In humans and other mammals, endogenous estrogens (17-β estradiol, estrone and estriol) and exogenous estrogens such as 17α-ethinylestradiol represent the major group of steroid hormones that play an important role in regulation of reproductive function and the menstrual cycle. Among the thirteen known human cytosolic sulfotransferases (SULTs), SULT1E1 has been identified as the main enzyme responsible for the sulfation of estrogenic compounds. Therefore, SULT1E1 may play a role as the principle regulator of estrogens metabolism. The current study aimed to investigate the impact of the genetic polymorphisms of SULT1E1 on the sulfation of endogenous estrogens as well as a xenoestrogen (17α-ethinylestradiol). Following a systematic analysis of SULT1E1 genotypes, five non-synonymous (missense) coding SNPs (cSNPs) of SULT1E1 were selected. The corresponding cDNAs encoding these five SULT1E1 were generated, expressed and purified. It was found that the purified SULT1E1 allozymes demonstrated differential sulfating activities toward each of the four examined estrogenic compounds. Kinetic analysis revealed further their distinct substrate affinity and catalytic efficiency toward the most potent endogenous estrogen, 17-β estradiol. 44

Collectively, these findings clearly indicated the influence of genetic polymorphisms of

SULT1E1 on the estrogenic compounds-sulfating activity, which may emphasize the differential metabolism of estrogens in individuals with different SULT1E1 genotypes.

3.2. Introduction

Endogenous estrogens, including 17-β estradiol (E2), estrone (E1), and estriol (E3), as well as exogenous ones, such as 17α-ethinylestradiol (EE2), constitute the major group of steroid hormones that exert their effects through binding to the nuclear estrogen receptor (ERα/β) and the G protein-coupled estrogen receptor (GPER), respectively

(Maggiolini and Picard, 2010; O'Lone et al., 2004; S. Safe and Kim, 2008). In humans and other mammals, estrogens are recognized to be involved in variety of essential physiological processes including, but not limited to, reproductive function and the female menstrual cycle as well as regulation of cell proliferation and apoptosis, particularly in endometrial, ovarian, and breast tissues (Albrecht and Pepe, 2010; Carreau et al., 2012; Kamel, 2010; Lippman and Bolan, 1975; O'Donnell et al., 2001; Pepe and

Albrecht, 1995; S. H. Safe, 1998; Silberstein and Merriam, 2000; Yager and Liehr, 1996).

In these hormone-dependent organs, high levels of estrogens have been correlated with estrogen receptor-mediated carcinogenicity, leading to breast, endometrial and ovarian tumors (Bernstein and Ross, 1993; Miller and Langdon, 1997). Similarly, exposure to

EE2, an active ingredient that is widely used in oral contraceptive formulations and

hormone replacement therapy (HRT), has been reported to increase the risk of breast carcinoma in women (Althuis et al., 2003). Furthermore, epidemiological studies have indicated that using HRT that contains estrogen can also contribute to the development of ovarian cancer (Lacey et al., 2002; Morch et al., 2009). In the body, sulfate conjugation of estrogens is known to be one of the detoxification mechanisms that protect the cells from the estrogen-mediated mitogenicity and genotoxicity (Raftogianis et al., 2000).

Therefore, sulfation has been shown to modulate the activity of endogenous estrogens as well as xenoestrogens.

Cytosolic sulfotransferases (SULTs), one of the major phase II conjugating enzymes in humans, mediate the sulfoconjugation and inactivation of numerous key endogenous compounds and xenobiotics (Strott, 2002). Among the thirteen known human SULTs, SULT1E1, also known as estrogen sulfotransferase, has been shown to display the highest efficiency in mediating the sulfation of endogenous estrogens and EE2

(Falany et al., 1995; Schrag et al., 2004; Zhang et al., 1998). SULT1E1 catalyzes the

- transfer of sulfonate moiety (SO3 ) from the active donor compound, 3'- phosphoadenosine 5'-phosphosulfate (PAPS), to the 3-phenolic acceptor group of estrogens (Falany, 1997; Hobkirk, 1993). Single nucleotide polymorphisms (SNPs) of the SULT1E1 gene, like other genes, have been widely documented (Agarwal et al.,

2016; Choi et al., 2005; Cohen et al., 2009; Daniels and Kadlubar, 2013; Hirata et al.,

2008; Rebbeck et al., 2006; Woo et al., 2017). As SULT1E1 is known to decrease the activity of estrogens, an important question is whether the genetic polymorphisms of 46

SULT1E1 may affect sulfating activity of SULT1E1 allozymes in individuals with diverse SULT1E1 genotypes, thereby influencing the physiological homeostasis of endogenous estrogens, as well as the metabolism via sulfation and, consequently, the efficacy of estrogen-like drugs.

In this research, the major SNP databases were comprehensively searched to identify, analyze, and categorize the SULT1E1 SNPs. From these databases, five

SULT1E1 allozymes coded by missense cSNPs were generated, expressed and purified. The sulfation of E2, E1, E3, and EE2 by purified SULT1E1 allozymes was determined. Furthermore, kinetic parameters that reflect the substrate affinity and catalytic efficiency in mediating the sulfation of E2, the most potent endogenous substrate, were measured by conducting kinetic studies.

3.3. Materials and Methods

3.3.1. Materials

E2, E1, E3, and EE2 were products of Cayman Chemical Company (Ann Arbor,

MI, USA). Adenosine 5’-triphosphate (ATP), dimethyl sulfoxide (DMSO), dithiothreitol

(DTT), 3’-phosphoadenosine-5’-phosphosulfate (PAPS), isopropyl-1-thio-β-D- galactopyranoside (IPTG), and N-2-hydroxylpiperazine-N’-2-ethanesulfonic acid

(HEPES) were from Sigma-Aldrich Chemical Company (St. Louis, MO, USA). Ecolume 47

scintillation cocktail was obtained from MP Biomedicals (Solon, OH, USA). Carrier-free sodium [35S]sulfate was from American Radiolabeled Chemicals, Inc. (St. Louis, MO,

USA). PAP[35S], the sulfate donor, was prepared from ATP and carrier-free [35S]sulfate using the recombinant human bifunctional ATP sulfulyase/adenosine 5‘-phosphosulfate kinase as previously described (Yanagisawa et al., 1998). Cellulose thin-layer chromatography (TLC) plates were products of Macherey-Nagel (Düren, Germany). Dpn

I was purchased from New England BioLabs (Ipswich, MA, USA). PrimeStar Max DNA polymerase was a product of Takara Bio Inc. (Mountain View, CA, USA). All blue prestained protein markers were obtained from BioLand Scientific LLC. (Paramount,

CA, USA). Oligonucleotide primers were synthesized by Eurofins Genomics (Louisville,

KY, USA). All other reagents and chemicals used were of the highest grades commercially available.

3.3.2. Database search

For the non-synonymous cSNPs of the human SULT1E1 gene, three genomic databases were thoroughly searched to identify, analyze, and categorized them based on the position of the changed nucleotide. This includes the U.S. National Center for

Biotechnology Information (NCBI), the Pharmacogenomics Knowledge Base

(PharmGKB), and the Universal Protein Resource (UniProt).

3.3.3. Generation of cDNAs encoding different human SULT1E1 allozymes

For the generation of cDNAs encoding different SULT1E1 allozymes, a PCR- based site-directed mutagenesis technique was applied. The sense and antisense primers listed in Table 2.4 were used in conjugation with the template (the wild-type SULT1E1 cDNA), which was packaged in the pGEX-2TK prokaryotic expression vector. Initially,

PCR-amplification conditions were 12 cycles of 30 s at 95°C, 1 min at 55°C, and 6 min at

72°C. Once the PCR amplification was completed, reaction mixtures were treated with

Dpn I endonuclease to degrade the wild-type template. For amplification and purification of the plasmids, the “mutated” SULT1E1 cDNA/pGEX-2TK plasmids were individually transformed into competent DH5α E. coli cells. Afterward, the SULT1E1 cDNA/pGEX-

2TK plasmids that were isolated from the transformed cells were examined by nucleotide sequencing to verify the preferred “mutations”.

3.3.4. Expression and purification of recombinant SULT1E1 allozymes

In order to express the recombinant SULT1E1 allozymes, each pGEX-2TK carrying a “mutated” SULT1E1 cDNA was transformed into competent BL21 E. coli cells. These transformed cells were developed in 1 liter of LB medium containing 100

µg/ml ampicillin. After the OD600 nm =~0.5, IPTG was added to induce the cells. After an 8-hrs induction at 37°C, the cells were collected by centrifugation and finally resuspended in 20 ml of an ice-cold lysis buffer containing 10 mM Tris-HCl, pH 8.0, 1 mM

EDTA, and 150 mm NaCl. The resuspended cells were homogenized via Aminco French press after the addition of 100 µl of a protease inhibitor mixture. The crude homogenate

was subjected to centrifugation at 10,000 × g for 30 min at 4°C. Then 2 ml of 50% slurry glutathione-Sepharose was used to fractionate the collected supernatant. A treatment with 2 ml of a thrombin digestion buffer (50 mM Tris-HCl, pH 8.0, 150 mM NaCl, and

2.5 mM CaCl2) that contained 5 units/ml bovine thrombin was used to remove unbound protein. After incubation at 25oC with constant agitation for 20 min, the supernatant was collected by centrifugation. Subsequently, the purity of recombinant SULT1E1 allozyme present in the eluted fractions was analyzed using SDS-polyacrylamide gel electrophoresis (SDS-PAGE).

3.3.5. Enzymatic assay

The sulfating activity of the recombinant SULT1E1 allozymes towards E2, E1, E3,

35 and EE2 was quantified by using, a sulfate donor, radiolabeled PAP[ S]. The assay mixture having a final volume of 20 µl, contained 50 mM HEPES buffer at pH 7.4, 1 mM

DTT, 14 µM PAP[35S], and a substrate dissolved in DMSO. At the same time, a control with DMSO replacing the substrate was carried out. The reaction initiated upon adding 2

µl (containing 0.5 µg) of a recombinant SULT1E1 allozyme to the mixture. It was then incubated at 37oC for 10 min and stopped by heating the mixture at 100°C for 3 min.

After the reaction mixture was subjected to centrifugation at 13,000 rpm for 3 min, 2 µl of the cleared supernatant was spotted on a cellulose TLC plate. The TLC was then separated using a solvent system made up of n-butanol/isopropanol/formic acid/water in a ratio of 3:1:1:1 (by volume). Afterwards, the plate was air-dried and then exposed to X- ray film for autoradiography to visualized the radiolabeled conjugated product.

Accordingly, the [35S]sulfated product spot was located, cut out, eluted with 500 µl of water in a vial for 45 min, and then mixed thoroughly with 2 ml of the Ecolume scintillation liquid. After that, using a liquid scintillation counter, the [35S]radioactivity therein was measured (Hui and Liu, 2015). According to the determined radioactivity expressed in unit of count per min (cpm), the sulfating activity was measured in the unit of sulfated product formed per min per mg.

3.3.6. Kinetic studies

In the kinetic assays, different concentrations of substrate (E2, E1, E3, or EE2) were used in the SULT experiments. The apparent kinetic constants were determined using the GraphPad Prism® v 7.0 software that aligned with non Michaelis-Menten kinetics (substrate inhibition). A one-way analysis of variance (ANOVA) was implemented for inter-group comparison, followed by Tukey's post hoc analysis, while statistical significance was set at P-values < 0.05.

3.4. Results

3.4.1. Identification and analysis of different SULT1E1 SNPs

The U.S. National Center for Biotechnology Information (NCBI), the

Pharmacogenomics Knowledge Base (PharmGKB), and the Universal Protein Resource

(UniProt) were the three focal SNP databases used for the systemic search of SULT1E1 genotypes. As a result, 5,291 SULT1E1 SNPs were identified. These identified

SULT1E1 genotypes were analyzed and categorized into two groups, coding and non- coding SNPs. The coding SNPs include synonymous, non-synonymous (missense), and nonsense SNPs, whereas the non-coding SNPs include introns, 3’-untranslated region

(3’UTR), and 5’-untranslated region (5’UTR) SNPs. Among the 204 identified

SULT1E1 missense coding SNPs (cSNPs), five were selected for further investigation.

This selection was made considering the locations (e.g., proximity to substrate-binding- and PAPS-binding site) and changes in physiochemical properties (e.g., acidic to/from basic, polar to/from non-polar, turn inducing to/from non-turn inducing residues) of the altered amino acid residues. As mentioned in Materials and Methods, Table 2.4 illustrates the sense and antisense primers designed for PCR-amplification, the amino acid variations and locations, and the documented allelic frequency of these five

SULT1E1 cSNPs.

3.4.2. Preparations of recombinant human SULT1E1 allozymes

The bacterial expression vector (pGEX-2TK) harboring individual cDNA encoding different SULT1E1 allozymes was transformed into BL21 E. coli cells. The induction of recombinant protein expression was then initiated by IPTG. In further detail, the glutathione-Sepharose affinity chromatography was performed to fractionate the recombinant SULT1E1 allozymes from the homogenates of E. coli cells. Then, the untagged recombinant SULT1E1 allozymes were released from the bound GST fusion proteins when treated with bovine thrombin. As indicated in Figure 2.5 in Materials and

Methods, the SDS-polyacrylamide gel electrophoretic pattern confirmed that the evident

molecular weights of the purified SULT1E1 allozymes were consistent to the reported molecular weight (35,126kDa) of the wild-type SULT1E1.

3.4.3. Enzymatic characterization of the wild-type SULT1E1 and allozymes

Initially, the concentration-dependent sulfation for each of the four examined substrates (E2, E1, E3, and EE2) by the purified wild-type SULT1E1 was analyzed. The sulfation of the four examined substrates follow atypical Michaelis-Menten kinetics

(substrate inhibition). Figure 3.1 reveals that after an initial hyperbolic increase, the rate of the reactions yielded curves that were concave downward at higher substrate concentrations. Table 3.1 compiles the determined kinetic parameters for the wild-type

SULT1E1 in mediating the sulfation of the four tested substrates. Based on the data obtained, three different concentrations (one well below the calculated Km, one close to

Km and one well above the Km) for each of the four substrates were chosen to assess the sulfating activities of SULT1E1 allozymes.

A) B)

8 6 (nmol/min/mg)

Specific Activity 4

2 0 0 10 20 30 40 50 60 70 80 90 100 [E ] (µM) 2 C) D)

Figure 3.1. Kinetic analysis of the sulfation of endogenous estrogens and EE2 by human wild-type SULT1E1. Panels (A-D) depict the non-Michaelis-Menten curves for the sulfation of E2, E1, E3, and EE2, respectively. Data shown represent calculated mean

± standard deviation derived from three independent experiments.

Table 3.1. Kinetic parameters of the sulfation of endogenous estrogens and EE2 by the human wild-type SULT1E1

Substrate Vmax Km Vmax/Km (nmol/min/mg) (µM) (ml/min/mg) E2 19.30 ± 1.2 2.07 ± 0.42 9.51 ± 1.38

E1 12.93 ± 0.11 1.67 ± 0.41 7.74 ± 1.97

E3 28.88 ± 3.89 10.17 ± 2.47 2.89± 0.33

EE2 42.63 ± 7.55 15.16 ± 3.78 2.85± 0.24

Data shown represent mean ± SD derived from three independent experiments.

3.4.3.1. With E2 as a substrate

At a low substrate concentration (0.5 µM), the sulfating activities of all five

SULT1E1 allozymes (SULT1E1-A43D, SULT1E1-A131P, SULT1E1-R186L,

SULT1E1-P214T, and SULT1E1-D220V) were comparable to that of the wild-type enzyme (Figure 3.2A). Similarly, at a mid-substrate concentration (2 µM), the same patterns of E2-sulfating activities were found for four allozymes (SULT1E1-A43D,

SULT1E1-A131P, SULT1E1-R186L, and SULT1E1-P214T), while the sulfating activity of SULT1E1-D220V was 11% higher than the wild-type (Figure 3.2B). At a high substrate concentration (4 µM), the sulfating activity of SULT1E1-A131P was comparable to that of the wild-type enzyme, while the other four (SULT1E1-A43D,

SULT1E1-R186L, SULT1E1-P214T, and SULT1E1-D220V) exhibited significantly lower sulfating activities (Figure 3.3C). Of them, SULT1E1-P214T showed the lowest

E2-sulfating activity (3.27 ± 0.10 nmol/min/mg), being only 24% of that determined for the wild-type. The remaining three (SULT1E1-A43D, SULT1E1-R186L, and SULT1E1-

D220V) showed sulfating activities that were approximately 28%, 70%, and 60% lower, respectively, than the wild-type enzyme.

Figure 3.2. Specific activities of the human SULT1E1 allozymes toward E2. (A)

Using 0.5 µM E2. (B) Using 2 µM E2. (C) Using 4 µM E2. Data shown represent mean ± standard deviation derived from three independent determinations. One-way ANOVA

was performed followed by Dunnett’s test. **** Statistical significant p<0.0001 from

SULT1E1-WT.

3.4.3.2. With E1 as a substrate

At low- and mid-substrate concentrations (0.1 µM and 1µM), the same patterns of

E1-sulfating activities were observed for the five SULT1E1 allozymes (Figures 3.3A-B).

Among them, SULT1E1-A43D and SULT1E1-D220V showed sulfating activities that were approximately 2 and 1.2 times higher, respectively, than the wild-type enzyme, whereas that of SULT1E1-R186L was at least 15% lower than SULT1E1-WT. The sulfating activity of two remaining allozymes (SULT1E1-A131P and SULT1E1-P214T) were comparable to that of the wild-type enzyme. At a high substrate concentration (5

µM), the sulfating activity of SULT1E1-A131P was 18% higher than the wild-type enzyme, while the rest of SULT1E1 allozymes (SULT1E1-A43D, SULT1E1-R186L,

SULT1E1-P214T, and SULT1E1-D220V) displayed significantly lower sulfating activities compared to the wild-type enzyme (Figure 3.3C). Of them, the sulfating activity of SULT1E1-P214T was 36% lower than the wild-type enzyme. The other three showed much lower sulfating activities than the wild-type, with SULT1E1-A43D and

SULT1E1-R186L showing sulfating activities nearly 42% and 52% lower, respectively.

SULT1E1-D220V displayed the lowest E1-sulfating activity, being two-thirds lower than the wild-type enzyme.

Figure 3.3. Specific activities of the human SULT1E1 allozymes toward E1. (A)

Using 0.1 µM E1. (B) Using 1 µM E1. (C) Using 5 µM E1. Data shown represent mean ± standard deviation derived from three independent determinations. One-way ANOVA was performed followed by Dunnett’s test. **** Statistical significant p<0.0001 from

SULT1E1-WT.

3.4.3.3. With E3 as a substrate

At a low substrate concentration (1 µM), the sulfating activity of SULT1E1-

A131P was comparable to that of the wild-type enzyme, while the four remaining allozymes showed differential sulfating activities toward E3 (Figure 3.4A). Among them, the sulfating activities of two allozymes (SULT1E1-A43D and SULT1E1-D220V) were 2- and 1.2-fold, respectively, higher than the wild type. In contrast, the sulfating activities of other two (SULT1E1-R186L and SULT1E1-P214T) were at least 10% lower than SULT1E1-WT. At a mid-substrate concentration (10 µM), the sulfating activities of

SULT1E1-A131P and SULT1E1-P214T were comparable to that of the wild-type enzyme, while the other three SULT1E1 allozymes (SULT1E1-A43D, SULT1E1-R186L, and SULT1E1-D220V) displayed significantly lower sulfating activities (Figure 3.4B).

Among them, SULT1E1-D220V showed the lowest E3-sulfating activity (7.32 ± 0.22 nmol/min/mg), being approximately half of that determined for the wild-type, while the other two (SULT1E1-A43D and SULT1E1-R186L) showed sulfating activities that were at least 15% lower than the wild-type enzyme. At a high substrate concentration (25

µM), the sulfating activity of SULT1E1-A131P was approximately 2 times higher than wild-type enzyme, while the other four SULT1E1 allozymes (SULT1E1-A43D,

SULT1E1-R186L, SULT1E1-P214T, and SULT1E1-D220V) exhibited significantly lower sulfating activities (Figure 3.4C). Among them, SULT1E1-D220V showed the lowest E3-sulfating activity (6.13 ± 0.05 nmol/min/mg), being only 40% of that determined for the wild-type. The other three (SULT1E1-A43D, SULT1E1-R186L, and

SULT1E1-P214T) showed sulfating activities that were approximately 41%, 50%, and

27% lower, respectively, than the wild-type enzyme. 59

Figure 3.4. Specific activities of the human SULT1E1 allozymes toward E3. (A)

Using 1 µM E3. (B) Using 10 µM E3. (C) Using 25 µM E3. Data shown represent mean ± standard deviation derived from three independent determinations. One-way ANOVA was performed followed by Dunnett’s test. **** Statistical significant p<0.0001 from

SULT1E1-WT.

3.4.3.4. With EE2 as a substrate

At a low substrate concentration (1 µM), the sulfating activity of SULT1E1-

P214T was comparable to that of the wild-type enzyme, while the rest of SULT1E1 60

allozymes showed differential EE2-sulfating activities (Figure 3.5A). Of them, the sulfating activities of two allozymes (SULT1E1-A43D and SULT1E1-D220V) were 2.2- and 1.3-fold higher, respectively, than the wild type, while that of other two (SULT1E1-

A131P and SULT1E1-R186L) were at least 8% lower than SULT1E1-WT. At a mid- substrate concentration (10 µM), the sulfating activity of SULT1E1-A131P was comparable to that of the wild-type enzyme, while the other four (SULT1E1-A43D,

SULT1E1-R186L, SULT1E1-P214 and SULT1E1-D220V) displayed significantly lower sulfating activities (Figure 3.5B). Among them, the sulfating activity of SULT1E1-

P214T was 18% lower than the wild-type enzyme, while the other three showed much lower sulfating activities, being at least 50% lower than SULT1E1-WT. At a high substrate concentration (25 µM), the sulfating activity of SULT1E1-A131P was over 2 times higher than wild-type enzyme, while the other four (SULT1E1-A43D, SULT1E1-

R186L, SULT1E1-P214T, and SULT1E1-D220V) exhibited significantly lower sulfating activities (Figure 3.5C). Of them, SULT1E1-D220V showed the lowest EE2-sulfating activity (4.42 ± 0.27 nmol/min/mg), being less than half of that determined for the wild- type. The other three (SULT1E1-A43D, SULT1E1-R186L, and SULT1E1-P214T) exhibited sulfating activities that were approximately 17%, 44%, and 20% lower, respectively, than the wild-type enzyme.

Figure 3.5. Specific activities of the human SULT1E1 allozymes toward EE2. (A)

Using 1 µM EE2. (B) Using 10 µM EE2. (C) Using 25 µM EE2. Data shown represent mean ± standard deviation derived from three independent determinations. One-way

ANOVA was performed followed by Dunnett’s test. **** Statistical significant p<0.0001 from SULT1E1-WT.

3.4.4. Kinetic Analysis

Kinetic assays were performed using different concentrations of E2 to investigate further the effect of genetic polymorphisms on the sulfation of E2 by the recombinant

SULT1E1 allozymes. The calculated kinetic constants for the wild-type and SULT1E1 allozymes that include Vmax (reflecting the catalytic activity), Km (reflecting the substrate affinity), and Vmax/Km (reflecting the catalytic efficiency) are compiled in Table 3.2.

Among the five SULT1E1 allozymes, the Km values of SULT1E1-R186L and SULT1E1-

P214T were at least 25% lower than that of SULT1E1-WT. In contract, the Km values for the remaining allozymes (SULT1E1-A43D, SULT1E1-A131P, and SULT1E1-D220V) were all more than 2 times higher than the wild-type enzyme. Regarding Vmax, the values determined for two allozymes (SULT1E1-R186L and SULT1E1-P214T) were 47% and

60% lower, respectively, than that of the wild-type. On the other hand, the values for the remaining three (SULT1E1-A43D, SULT1E1-A131P, and SULT1E1-D220V) were 30%,

17%, and 19% higher, respectively. Based on these results, the calculated parameters that reflect the catalytic efficiency (Vmax/Km) values were significantly lower for all five

SULT1E1 allozymes, compared with the wild-type. Of them, SULT1E1-A43D and

SULT1E1-D220V exhibited values 42% and 47% lower, respectively, than the wild-type enzymes.

Table 3.2. Kinetic constants of the human SULT1E1 allozymes in catalyzing the

sulfation of E2

SULT1E1 Vmax Km Vmax/Km

allozyme (nmol/min/mg) (µM) (ml/min/mg) SULT1E1-WT 19.30 ± 1.2 2.07 ± 0.42 9.51 ± 1.38

SULT1E1-A43D 24.98 ±2.92**** 5.12 ± 0.9**** 4.91 ± 0.23****

SULT1E1-A131P 22.48 ± 2.66**** 3.99 ± 0.94**** 5.74 ± 0.71****

SULT1E1-R186L 10.31 ± 1.29**** 1.55 ± 0.42**** 6.84 ± 1.06****

SULT1E1-P214T 7.79 ± 0.89**** 1.53 ± 0.41**** 5.24 ± 0.85****

SULT1E1-D220V 23.15 ± 4.35**** 5.27 ± 1.4**** 4.49 ± 1.99****

Data shown represent mean ± SD derived from three independent experiments. One-way

ANOVA was performed followed by Dunnett’s test. **** Statistical significant p<0.0001

from SULT1E1-WT.

3.5. Discussion

Estrogens represent a major group of steroid hormones that are involved

particularly in development and maintenance of reproductive organs (Albrecht and Pepe,

2010; Carreau et al., 2012; Kamel, 2010; O'Donnell et al., 2001; Pepe and Albrecht,

1995). Estrogens are extensively biotransformed to the predominant circulating

estrogens, sulfated estrogens, mainly by the SULT1E1 enzyme (Falany et al., 1995;

Pasqualini et al., 1989; Schrag et al., 2004; Zhang et al., 1998). Several studies have

shown that sulfated estrogens act as a precursor for steroidal estrogens mainly in 64

estrogen-dependent organs and are also involved in estrogen transportation to target tissues via organic anion transporters (Eckhardt et al., 1999; Hobkirk, 1985; Zhu and

Conney, 1998). SULT1E1 has been shown to be expressed in the human liver, breast, endometrium, adrenal gland, placenta, jejunum, lung, and testis, and to exhibit high efficiency in mediating the sulfation of E1, E2, E3, catecholestrogens, as well as structurally related xenobiotics (Adjei and Weinshilboum, 2002; Falany et al., 1995;

Falany and Falany, 1996a, 1996b; Riches et al., 2009; Qian et al., 1998; Schrag et al.,

2004; Song et al., 1997; Zhang et al., 1998). Considering the pivotal role of SULT1E1 in catalyzing estrogen sulfoconjugation, SULT1E1 may act as a key regulator of estrogen hemostasis. Previous epidemiological studies have demonstrated the correlation between genetic polymorphisms of SULT1E1 and the increase in the risk of breast cancer in

Korean and Jewish women as well as endometrial cancer in Caucasian women (Choi et al., 2005; Cohen et al., 2009; Hirata et al., 2008). Another study has shown that genetic variations in the human SULT1E1 gene affect the encoded enzyme-sulfating activity toward E2, an endogenous estrogen (Adjei et al., 2003). The purpose of this study was to examine the impact of genetic polymorphisms on the sulfating activity of coded

SULT1E1 allozymes toward endogenous estrogens as well as a structurally related xenobiotic, EE2. Five missense cSNPs of SULT1E1 were selected and their corresponding cDNAs were generated by employing site-directed mutagenesis.

Recombinant SULT1E1 allozymes were expressed, purified, and characterized for their sulfating activity towards E1, E2, E3, and EE2.

Initial experiments of the sulfating activities showed differential E1, E2, E3, and 65

EE2-sulfating activities among all five SULT1E1 allozymes (Figures 3.2-3.5). The kinetics studies shown in Table 3.2 further reveals the distinct kinetic parameters Vmax

(reflecting the catalytic activity), Km (reflecting the substrate affinity), and Vmax/Km

(reflecting the catalytic efficiency) for these SULT1E1 allozymes in mediating E2 sulfation. Taken together, the findings of this study demonstrated clearly the effects of

SULT1E1 missense coding SNPs (cSNPs) on the sulfation of E1, E2, E3, and EE2 by coded SULT1E1 allozymes.

The crystal structures of human SULT1E1 have been previously resolved, revealing key elements/residues that are essential for the activity of the enzyme (Pedersen et al., 2002; Shevtsov et al., 2003; Thomas and Potter, 2013). In regard to the interaction with cofactor (PAPS), the key elements include a 5’-phosphosulphate-binding (PSB) loop

(45TYPKSGT51), a PAP adenine-binding region (W52, Y192 and T226), a 3’-phosphate- binding region (R129, S137, and 256RKG258) (Kakuta et al., 1997; Thomas and Potter,

2013). Other key elements are the residues that constitute the substrate binding region

(Y20, F23, P46, F75, F80, C83, K85, M89, K105, H107, F138, F141, 145VAGH148, Y168,

Y239, L242, and 246IM247), and a C-terminal dimerization motif (265KNHFTVALNE274)

(Petrotchenko et al., 2001; Thomas and Potter, 2013). Interestingly, three of SULT1E1 allozymes (SULT1E1-A131P, SULT1E1-R186L, SULT1E1-D220V) investigated in this study contain amino acid variations that fall within or are in close proximity to the PAPS- binding pocket. Of them, SULT1E1-D220V was found to exert significant reductions in the sulfating activities toward the four examined substrates at high concentrations and has the lowest catalytic efficiency in mediating the sulfation of E2. D220V replacement that

is located downstream from threonine residue (Thr226) has been proposed to form a hydrogen bond with the PAPS adenine moiety (Thomas and Potter, 2013). Therefore, the substitution of aspartic acid, an acidic side change, with valine residue, which carries isopropyl side chain, in SULT1E1D220V might have disrupted the hydrogen bond formation between the PAPS adenine moiety and (Thr226). Similarly, the replacement of arginine, which has positively charged side chain, by leucine in SULT1E1-R186L may weaken the hydrogen bond formation between the PAPS adenine moiety and tyrosine residue (Tyr192), leading to a decrease in the catalytic efficiency (Thomas and Potter,

2013). In the case of SULT1E1-A131P, the differential sulfating activities, ranging from comparable activity with E2 and higher activities with high concentrations of E1, E3, EE2, were due to the substitution of alanine with proline that carries a cyclic secondary amine.

As a result of this replacement, proline might impose a kink in the peptide bonds that enhances the proper positions for two conserved residues arginine (Arg129) and serine

(Ser137) to form hydrogen bonds with a 3’-phosphate of the PAPS molecule (Thomas and Potter, 2013). For SULT1E1-A43D, the amino acid change was found to significantly reduce the catalytic efficiency toward E2 compared to the wild-type enzyme.

The substitution of alanine to aspartic acid, which carries an acidic side change, may negatively impact both the cleavage of 5’-sulfate moiety from PAPS molecule that is mediated by the conserved lysine (Lys47) residue and the binding of substrate to proline

(Pro46) residue (Pedersen et al., 2002; Thomas and Potter, 2013). In the case of

SULT1E1-P214T, the significant reductions in the sulfating activities at high concentrations of the four tested substrates were found. Substitution of proline residue, a cyclic imino acid that introduces a kink in the alpha-helix region, with threonine may 67

result in more restricted conformation that negatively affect the enzyme catalytic efficiency toward E2.

3.6. Conclusion. The obtained findings clearly indicated differential sulfating activities of the five assessed SULT1E1 allozymes toward E2, E1, E3, and EE2 as substrates. These determinations strongly suggest that individuals with various SULT1E1 genotypes may have differential metabolizing capacity in sulfating estrogenic compounds. Pending additional studies, such information may have implications for predicting risk of breast, ovarian, and endometrial cancers, as well as aiding in development of personalized regimens for EE2 for patients with distinct SULT1E1 genotypes, thus enhancing their therapeutic efficacy and minimizing their risk of toxicity.

Chapter 4

Impact of Human SULT1E1 Polymorphisms on the Sulfation of 4- Hydroxytamoxifen and Diethylstilbestrol by SULT1E1 Allozymes

Running Title: Sulfation of 4-Hydroxytamoxifen and Diethylstilbestrol by Human SULT1E1 Allozymes

Amal A. El Daibania, Fatemah A. Alherza, Maryam S. Abunnajaa, Ahsan F. Bairama,b, Mohammed I. Rasoola,c, Katsuhisa Kurogia,d, Ming-Cheh Liua,*

aDepartment of Pharmacology, College of Pharmacy and Pharmaceutical Sciences, University of Toledo Health Science Campus, Toledo, OH 43614 USA bDepartment of Pharmacology, College of Pharmacy, University of Kufa, Najaf, Iraq cDepartment of Pharmacology, College of Pharmacy, University of Karbala, Karbala, Iraq dBiochemistry and Applied Biosciences, University of Miyazaki, Miyazaki 889-2192 Japan

*Corresponding Author: Ming-Cheh Liu, Ph.D. Professor Department of Pharmacology College of Pharmacy and Pharmaceutical Sciences University of Toledo Health Science Campus 3000 Arlington Avenue Toledo, OH 43614 USA

Tel: (419) 383-1918 Fax: (419) 383-1909 E-mail: [email protected] 69

4.1. Abstract: Previous studies have revealed that sulfation, as mediated by the estrogen-sulfating cytosolic sulfotransferase (SULT) SULT1E1, is involved in the metabolism of 4-hydroxytamoxifen and diethylstilbestrol in humans. It is an interesting question whether the genetic polymorphisms of SULT1E1, the gene that encodes the

SULT1E1 enzyme, may impact on the metabolism of these two drugs through sulfation.

In this study, five missense coding single nucleotide polymorphisms (SNPs) of the

SULT1E1 gene were selected for investigating the sulfating activity of the coded

SULT1E1 allozymes toward 4-hydroxytamoxifen and diethylstilbestrol. Corresponding cDNAs were generated by site-directed mutagenesis and recombinant SULT1E1 allozymes were bacterially expressed and purified by affinity chromatography. Purified

SULT1E1 allozymes were shown to display differential sulfating activities toward 4- hydroxytamoxifen and diethylstilbestrol. Kinetic analysis revealed further distinct Km

(reflecting substrate affinity) and Vmax (reflecting catalytic activity) values of the five

SULT1E1 allozymes with 4-hydroxytamoxifen and diethylstilbestrol as substrates.

Taken together, these findings highlighted the significant differences in the drug-sulfating activities of SULT1E1 allozymes, which may have implications in the metabolism of 4- hydroxytamoxifen and diethylstilbestrol in individuals with different SULT1E1 genotypes.

Keywords: Cytosolic sulfotransferase; SULT; sulfate conjugation; estrogen sulfotransferase; SULT1E1; single nucleotide polymorphisms; 4-hydroxytamoxifen; 4-

HT; diethylstilbestrol; DES. 70

4.2. Introduction

Tamoxifen (TMX), a selective estrogen receptor modulator (SERM), is widely used to treat metastatic breast cancer in pre- as well as post-menopausal women

(Osborne, 1998). The hepatic cytochrome P450, CYP2D6, mediates the metabolism of

TMX to form 4-hydroxytamoxifen (4-HT), which is highly potent in antagonizing the estrogenic effects in mammalian tissues and may effectively suppress the proliferation of breast cancer cells (Crewe et al., 1997; Crewe et al., 2002; Jordan et al., 1977). Despite the common use of tamoxifen as a first-line therapy, breast cancer in tamoxifen-treated patients may eventually relapse due to the development of de novo or acquired resistance, which remains an obstacle in breast cancer therapy (Chang, 2012). To cope with this challenge, diethylstilbestrol (DES), an established treatment for prostate cancer in some

European countries (Turo et al., 2015), has been investigated for use as an adjuvant therapy to enhance the quality of life and improve the survival rate of patients with advanced breast cancer (Iwase and Yamamoto, 2015; Lonning et al., 2001; Mahtani et al.,

2009). Both TMX and DES, however, may cause serious side effects that include, for example, the induction of endometrial cancer, ocular toxicity, and venous thromboembolic events (associated with the use of TMX) and cardiovascular complications (associated with the administration of DES) (de Voogt et al., 1986; Fisher et al., 1994; Latifyan et al., 2017; Manikandan et al., 2005; Nayfield and Gorin, 1996;

Salomao et al., 2007; Smith et al., 1998). In view of their adverse effects, it is important to understand in greater detail the metabolism and deactivation mechanisms of 4-HT as 71

an active metabolite of TMX, as well as DES. In relation to this latter notion, previous studies have demonstrated the involvement of sulfation in the metabolism of 4-HT and

DES (Falany et al, 2006; Hui et al., 2015; Nishiyama et al., 2002; Suiko et al., 2000).

Sulfation, which is catalyzed by the cytosolic sulfotransferase (SULT) enzymes, provides a major pathway for the biotransformation and excretion of a wide range of xenobiotics including drugs (Falany and Roth, 1993; Mulder and Jakoby,1990;

Weinshilboum and Otterness, 1994). Sulfation generally results in the increase in the hydrophilicity of the substrate compounds and contributes to their inactivation and subsequent removal from the body (Falany and Roth, 1993; Mulder and Jakoby,1990;

Weinshilboum and Otterness, 1994). In humans, thirteen distinct SULTs have been identified (Blanchard et al, 2004; Freimuth et al, 2004). Estrogen sulfotransferase,

SULT1E1, has been recognized as one of the major SULTs capable of sulfating DES and

4-HT (Falany et al, 2006; Hui et al., 2015; Suiko et al., 2000). It is noted that while

SULT1A1 displayed higher sulfating activity toward 4-HT and DES (Falany et al., 2006;

Nishiyama et al., 2002; Suiko et al., 2000), SULT1E1 has been shown to be more abundantly expressed in estrogen-responsive tissues and thus is likely a major responsible enzyme that metabolizes these drugs in breast tissue (Falany and Falany, 1996; Qian et al., 1998). Like many other genes, single nucleotide polymorphisms (SNPs) of the

SULT1E1 gene have been reported (Agarwal et al., 2016; Choi et al., 2005; Cohen et al.,

2009; Daniels and Kadlubar, 2013; Hirata et al., 2008; Rebbeck et al., 2006; Woo et al.,

2017). It is an important question whether SULT1E1 non-synonymous coding SNPs 72

(cSNPs), leading to amino acid variations, may affect the sulfating activity of the coded

SULT1E1 allozymes toward 4-HT and DES, thereby influencing their metabolism in individuals with different SULT1E1 genotypes.

In this study, the SULT1E1 SNPs deposited in major SNP databases were systematically analyzed. Five SULT1E1 allozymes coded by selected missense cSNPs identified in these databases were generated, expressed and purified. The sulfating activity of purified SULT1E1 allozymes toward 4-HT and DES were analyzed. In addition, kinetic experiments were conducted to determine their kinetic parameters for evaluating their substrate affinity and catalytic efficiency in mediating the sulfation of 4-

HT and DES.

4.3. Materials and Methods

4.3.1. Materials

4-HT was a product of Cayman Chemical Company (Ann Arbor, MI, USA).

DES, adenosine 5’-triphosphate (ATP), dimethyl sulfoxide (DMSO), dithiothreitol

(DTT), 3’-phosphoadenosine-5’-phosphosulfate (PAPS), isopropyl-1-thio-β-D- 73

galactopyranoside (IPTG), and N-2-hydroxylpiperazine-N’-2-ethanesulfonic acid

(HEPES) were from Sigma-Aldrich Chemical Company (St. Louis, MO, USA). Ecolume scintillation cocktail was obtained from MP Biomedicals (Solon, OH, USA). Carrier-free sodium [35S]sulfate was from American Radiolabeled Chemicals, Inc. (St. Louis, MO,

USA). Recombinant human bifunctional ATP sulfulyase/adenosine 5‘-phosphosulfate kinase was prepared as previously described (Yanagisawa et al., 1998), and used to synthesize PAP[35S] from ATP and [35S]sulfate based on an established procedure

(Yanagisawa et al., 1998). Cellulose thin-layer chromatography (TLC) plates were products of Macherey-Nagel (Düren, Germany). Dpn I was purchased from New

England BioLabs (Ipswich, MA, USA). PrimeStar Max DNA polymerase was a product of Takara Bio Inc. (Mountain View, CA, USA). All blue prestained protein markers were obtained from BioLand Scientific LLC. (Paramount, CA, USA). Oligonucleotide primers were synthesized by Eurofins Genomics (Louisville, KY, USA). All other reagents and chemicals used were of the highest grades commercially available.

4.3.2. Identification and analysis of the human SULT1E1 SNPs

Three genomic databases, including the U.S National Center for Biotechnology

Information (NCBI), the Pharmacogenomics Knowledge Base (PharmGKB), and the

Universal Protein Resource (UniProt), were comprehensively searched for the non- synonymous cSNPs of the human SULT1E1 gene.

4.3.3. Generation of cDNAs encoding different human SULT1E1 allozymes

A PCR-based site-directed mutagenesis procedure was used to generate cDNAs encoding different SULT1E1 allozymes. Each pair of mutagenic oligonucleotide primers that is listed in Table 2.4 was used in conjugation with the template (the wild-type

SULT1E1 cDNA) packaged in the pGEX-2TK prokaryotic expression vector. PCR- amplification conditions were an initial denaturation for 30 s at 94°C, followed by 12 cycles of template denaturation for 30 s at 95°C, mutagenic primer annealing for 1 min at

55°C, and extension for 15 min at 72°C. Upon completion of PCR amplification, reaction mixtures were supplemented with Dpn I endonuclease to digest the wild-type

SULT1E1 cDNA/pGEX-2TK. The “mutated” SULT1E1 cDNA/pGEX-2TK plasmids were individually transformed into competent DH5α E. coli cells. SULT1E1 cDNA/pGEX-2TK plasmids isolated from the transformed cells were analyzed by nucleotide sequencing to verify the desired “mutations”.

4.3.4. Expression and purification of recombinant SULT1E1 allozymes

To express SULT1E1 allozymes, each pGEX-2TK harboring a “mutated”

SULT1E1 cDNA was individually transformed into competent BL21 E. coli cells. The transformed cells were grown at 37°C in 1 liter of LB medium containing 100 µg/ml ampicillin to OD600 nm =~0.5. Afterwards, the cells were induced with 0.1 mM IPTG at

25°C for 8 h, collected by centrifugation, and resuspended in 20 ml of an ice-cold lysis buffer containing 10 mM Tris-HCl, pH 8.0, 1 mM EDTA, and 150 mm NaCl. After the 75

addition of 100 µl of a protease inhibitor mixture, the cells were homogenized using an

Aminco French press apparatus. The crude homogenate was centrifuged at 10,000 × g for 30 min at 4°C, and the collected supernatant was fractionated using 0.5 ml glutathione-Sepharose. The bound fusion protein was treated with 2 ml of a thrombin digestion buffer (50 mM Tris-HCl, pH 8.0, 150 mM NaCl, and 2.5 mM CaCl2) that contained 0.5 unit/ml bovine thrombin. After incubation at room temperature for 15 min with constant agitation, the preparation was subjected to centrifugation. SDS- polyacrylamide gel electrophoresis (SDS-PAGE) was performed to analyze the purity of recombinant SULT1E1 allozyme present in the collected supernatant.

4.3.5. Sulfotransferase assay

The sulfating activity of the recombinant SULT1E1 allozymes towards DES or 4-

HT was determined using radiolabeled PAP[35S] as a sulfate donor. The reaction mixture, with a final volume of 20 µl, contained 50 mM HEPES buffer at pH 7.4, 1 mM

DTT, 14 µM PAP[35S], and a substrate (DES or 4-HT) dissolved in DMSO. A control with DMSO replacing the substrate was analyzed in parallel. The reaction was initiated by adding 2 µl (containing 0.5 µg) of a recombinant SULT1E1 allozyme to the reaction mixture and incubated at 37oC for 10 min. Afterwards, the reaction was terminated by heating at 100°C for 3 min. After centrifugation of reaction mixture at 13,000 rpm for 3 min, 2 µl of the cleared supernatant was applied onto a cellulose TLC plate. TLC separation was conducted using a solvent system containing n-

butanol/isopropanol/formic acid/water in a ratio of 3:1:1:1 (by volume). Upon completion of TLC, the plate was air-dried and then subjected to autoradiography to localize the radiolabeled sulfated product. The detected [35S]sulfated product spot was cut out and eluted with 500 µl of water in a vial for 45 min. Afterwards, 2 ml of the

Ecolume scintillation liquid was added to each vial and mixed thoroughly with the eluate, and the [35S]radioactivity therein was determined using a liquid scintillation counter (Hui and Liu, 2015). Based on the measured count per min (cpm), the specific activity was calculated in the unit of nmol of sulfated product produced per min per mg enzyme.

4.3.6. Kinetics studies

In the kinetic experiments, varying concentrations of 4-HT or DES were used in the SULT assays. The apparent kinetic constants were determined using the GraphPad

Prism® 7.0 software that aligned with the Michaelis-Menten kinetics with non-linear regression. One-way analysis of variance (ANOVA) was implemented for inter-group comparison, followed by Tukey's post hoc analysis. Statistical significance was set at P- values < 0.05.

4.4. Results

4.4.1. Identification and analysis of different SULT1E1 SNPs

Three online SNP databases, located at the websites of the U.S. National Center 77

for Biotechnology Information (NCBI), the Pharmacogenomics Knowledge Base

(PharmGKB), and the Universal Protein Resource (UniProt), were systematically searched for SULT1E1 genotypes. A total of 5,291 SULT1E1 SNPs were identified. The identified SULT1E1 genotypes were analyzed and categorized into coding including

(synonymous, non-synonymous (missense), and nonsense SNPs) and non-coding SNPs including (introns, 3’-untranslated region (3’UTR), and 5’-untranslated region (5’UTR)

SNPs) (cf. Table 2.2). Of the 204 identified SULT1E1 missense coding SNPs (cSNPs), five were selected for further investigation based on the locations (e.g., proximity to substrate-binding- and PAPS-binding site) and changes in physiochemical properties

(e.g., acidic to/from basic, polar to/from non-polar, turn inducing to/from non-turn inducing residues) of the altered amino acid residues. Table 2.4 shows the amino acid variations and locations, the documented allelic frequency of these five SULT1E1 cSNPs, as well as the mutagenic primers sets designed for PCR-amplification.

4.4.2. Preparations of recombinant human SULT1E1 allozymes

pGEX-2TK prokaryotic expression vector carrying individual cDNAs encoding different SULT1E1 allozymes were transformed into BL21 E. coli cells. Following induction of recombinant protein expression by IPTG, the glutathione-Sepharose affinity chromatography was performed to fractionate the recombinant SULT1E1 allozymes from the homogenates of E. coli cells. The untagged recombinant SULT1E1 allozymes were released from the bound GST fusion proteins upon treatment with bovine thrombin. As shown in Figure 2.5, SDS-polyacrylamide gel electrophoretic pattern confirmed that the 78

apparent molecular weights of the purified SULT1E1 allozymes were consistent with the reported molecular weight (35,126kDa) of the wild-type SULT1E1.

4.4.3. Characterization of the 4-HT-sulfating activity of human SULT1E1 allozymes

The concentration dependence of the sulfation of 4-HT by wild-type SULT1E1 was first examined. A shown in Figure 4.1, the rate of reaction continued to increase up to a substrate concentration of 300 µM. At higher 4-HT concentration, substrate inhibition was observed. Based on these results, three substrate concentrations, 10 µM,

50 µM, and 200 µM, were selected for screening the 4-HT-sulfating activity of SULT1E1 allozymes. Results obtained are shown in Figure 4.2.

Figure 4.1. The concentration dependence of the sulfation of 4-HT by human wild- type SULT1E1. The fitting curve was generated based on Michaelis-Menten kinetics.

Data shown represent calculated mean ± standard deviation derived from three

experiments.

Figure 4.2. Specific activities of the human SULT1E1 allozymes toward 4-HT. (A)

Using 10 µM 4-HT. (B) Using 50 µM 4-HT. (C) Using 200 µM 4-HT. Data shown represent mean ± standard deviation derived from three independent determinations.

One-way ANOVA was performed followed by Tukey's post hoc analysis. **** Statistical significant p<0.0001 from SULT1E1-WT.

With 10 µM 4-HT as substrate (Figure 4.2A), all five SULT1E1 allozymes

(SULT1E1-A43D, SULT1E1-A131P, SULT1E1-R186L, SULT1E1-P214T, and

SULT1E1-D220V) showed lower sulfating activities compared with the wild-type enzyme. Of the five, SULT1E1-D220V displayed the lowest 4-HT-sulfating activity

(30.70 ± 0.001 pmol/min/mg), being only 24% of that determined for the wild-type. Of the remaining four allozymes, the sulfating activities of three (SULT1E1-A131P,

SULT1E1-R186L, and SULT1E1-P214T) were at least 20% lower than the wild-type, while that of SULT1E1-A43D was over two-thirds lower than SULT1E1-WT. With 50

µM 4-HT as substrate (Figure 4.2B), the sulfating activities of SULT1E1-A131P and

SULT1E1-P214T were comparable to that of the wild-type enzyme, while the other three

SULT1E1 allozymes (SULT1E1-A43D, SULT1E1-R186L, and SULT1E1-D220V) displayed significantly lower sulfating activities. Among them, SULT1E1- A43D showed the lowest 4-HT-sulfating activity, being only 18% of that determined for the wild-type, while the other two (SULT1E1-R186L, and SULT1E1-D220V) showed sulfating activities that were approximately 42% and 64%, respectively, lower than the wild-type enzyme. With 200 µM 4-HT as substrate (Figure 4.2C), all five allozymes

(SULT1E1-A43D, SULT1E1-A131P, SULT1E1-R186L, SULT1E1-P214T, and

SULT1E1-D220V) displayed significantly lower sulfating activities than the wild-type enzyme. Of them, SULT1E1-A43D showed the lowest 4-HT-sulfating activity (130.30 ±

0.01 pmol/min/mg), being only 17% of that determined for the wild-type. Of the other four allozymes, the sulfating activities of two (SULT1E1-A131P and SULT1E1-P214) were at least 12% lower than the wild-type, while the sulfating activities of the other two

(SULT1E1-R186L and SULT1E1-D220V) were approximately 61% lower than the wild- type enzyme. 81

To examine further the effects of genetic polymorphisms on the 4-HT-sulfating activity of SULT1E1 allozymes, kinetic experiments were conducted using varying concentrations of 4-HT as substrates. The kinetic parameters Vmax (reflecting the catalytic activity), Km (reflecting the substrate affinity), and Vmax/Km (reflecting the catalytic efficiency) determined for the wild-type and SULT1E1 allozymes are compiled in Table

4.1. Among the five SULT1E1 allozymes, SULT1E1-R186L displayed a Km value close to that of the wild-type enzyme, while the Km values for the remaining allozymes

(SULT1E1-A43D, SULT1E1-A131P, SULT1E1-P214T, and SULT1E1-D220V) were all significantly higher. Of them, the Km values of SULT1E-A43D and SULT1E1-P214T were at least 45% higher than that of the wild-type, while the Km values of SULT1E1-

A131P and SULT1E1-D220V were 71% and 79% higher, respectively. In regard to Vmax, the values determined for all SULT1E1 allozymes, except SULT1E1-A131P, were all significantly lower than that of the wild-type, with SULT1E1-A43D showing the lowest

Vmax value, being only 19% of that determined for the wild-type. Based the determined

Vmax and Km values, the calculated Vmax/Km values were significantly lower for all five

SULT1E1 allozymes, compared with the wild-type. Of them, SULT1E1- D220V and

SULT1E1-A43D showed much lower values (~ 7.5 and 10 times, respectively, lower than the wild-type enzymes) than the other three allozymes.

Table 4.1. Kinetic constants of the human SULT1E1 allozymes in catalyzing the sulfation of 4-HT

SULT1E1 Vmax Km Vmax/Km

allozyme (pmol/min/mg) (µM) (ml/min/mg) SULT1E1-WT 907.20 ± 0.03 29.42 ± 3.17 0.031 ± 0.002

SULT1E1-A43D 178.90 ± 0.01**** 54 ± 8.18 0.003 ± 0.000****

SULT1E1-A131P 944.05 ± 0.03 101.79 ± 10.90**** 0.009 ± 0.000****

SULT1E1-R186L 324.80 ± 0.02**** 29.43 ± 6.93 0.011 ± 0.002****

SULT1E1-P214T 770.25 ± 0.02*** 56.18 ± 4.52 0.014 ± 0.000****

SULT1E1-D220V 510.60 ± 0.04**** 144.80 ± 24.10**** 0.004 ± 0.000****

Data shown represent mean ± SD derived from 3 independent experiments. One-way

ANOVA was performed followed by Tukey's post hoc analysis. **** Statistical significant p<0.0001 from SULT1E1-WT.

4.4.4. Characterization of DES-sulfating activity of human SULT1E1 allozymes

The concentration dependence of the sulfation of DES by wild-type SULT1E1 was first examined. A shown in Figure 4.3, the rate of reaction continued to increase up to a substrate concentration of 6 µM. At higher DES concentration, substrate inhibition was observed. Based on these results, three substrate concentrations, 0.5 µM, 3 µM, and

6 µM, were selected for screening the DES-sulfating activity of SULT1E1 allozymes.

Results obtained are shown in Figure 4.4.

Figure 4.3. The concentration dependence of the sulfation of DES by human wild- type SULT1E1. The fitting curve was generated based on Michaelis-Menten kinetics.

Data shown represent calculated mean ± standard deviation derived from three experiments.

Figure 4.4. Specific activities of the human SULT1E1 allozymes toward DES. (A)

Using 0.5 µM DES. (B) Using 3 µM DES. C) Using 6 µM DES. Data shown represent mean ± standard deviation derived from three independent determinations. One-way

ANOVA was performed followed by Tukey's post hoc analysis. **** Statistical significant p<0.0001 from SULT1E1-WT.

With 0.5 µM DES as substrate (Figure 4.4A), all five SULT1E1 allozymes

(SULT1E1-A43D, SULT1E1-A131P, SULT1E1-R186L, SULT1E1-P214T, and

SULT1E1-D220V) exhibited significantly lower sulfating activities compared with the wild-type enzyme. Among them, SULT1E1-P214T displayed the lowest DES-sulfating activity, being 20 times lower than that of the SULT1E1-WT. Of the remaining four

allozymes, the sulfating activities of two (SULT1E1-A131P and SULT1E1-R186L) were approximately 15% lower than the wild-type, while the activities of the other two

(SULT1E1-A43D and SULT1E1-D220V) were at least 35% lower than the wild-type enzyme. With 3 µM of DES as substrate (Figure 4.4B), the sulfating activity of

SULT1E1-R186L was comparable to that of the wild-type, while the other four allozymes (SULT1E1-A43D, SULT1E1-A131P, SULT1E1-P214T, and SULT1E1-

D220V) displayed significantly lower sulfating activities compared to the wild-type enzyme. The sulfating activity of SULT1E1-A131P was 19% lower than the wild-type, whereas the remaining three SULT1E1 allozymes showed much lower activities than the wild-type enzyme. Among the three, SULT1E1- P214T displayed the lowest DES- sulfating activity, being 12 times lower than that of the wild-type, while SULT1E1-A43D and SULT1E1-D220V showed sulfating activities that were approximately two-thirds lower than the wild-type enzyme. With 6 µM of DES as substrate (Figure 4.4C), the sulfating activities of SULT1E1-A131P and SULT1E1- R186L were comparable to that of the wild-type enzyme, while three other SULT1E1 allozymes (SULT1E1-A43D,

SULT1E1-P214T, and SULT1E1-D220V) displayed significantly lower sulfating activities compared to the wild-type enzyme. Of the three, the sulfating activity of

SULT1E1-A43D was 18% lower than the wild-type enzyme, while the other two showed much lower sulfating activities than the wild-type, with SULT1E1-D220V showing a sulfating activity approximately 41% lower and SULT1E1-P214T displaying a sulfating activity 6 times lower than the wild-type enzyme.

To investigate further the impact of genetic polymorphisms on the DES-sulfating activity of SULT1E1 allozymes, kinetic experiments were performed using varying concentrations of DES. The kinetic parameters (Vmax, Km, and Vmax /Km) determined for the wild-type and SULT1E1 allozymes are compiled in Table 4.2. Of the five SULT1E1 allozymes tested, SULT1E1-P214T showed a Km value close to that of the wild-type enzyme, while the Km values of SULT1E-A43D and SULT1E1-D220V were more than

30% lower and those of SULT1E1-A131P and SULT1E1-R186L were 40% and 79%, respectively, higher than the wild-type. In regard to Vmax, SULT1E1-A43D, SULT1E1-

D220V, and SULT1E1-P214T showed values 27%, 58%, and 81%, respectively, lower than the wild-type. In contrast, SULT1E1-A131P and SULT1E1-R186L displayed Vmax values 8% and 32% higher values than the wild-type enzyme. Consequently, SULT1E1-

P214T showed the lowest Vmax /Km value, being approximately 6-fold lower than the wild- type. SULT1E1-A131P, SULT1E1-R186L, and SULT1E1-D220 showed Vmax /Km values that were over 21% lower than the wild-type. In contrast, the Vmax/Km value for

SULT1E1-A43D was nearly 25% higher than the wild-type enzyme.

Table 4.2. Kinetic constants of the human SULT1E1 allozymes in catalyzing the sulfation of DES

SULT1E1 Vmax Km Vmax/Km

allozyme (nmol/min/mg) (µM) (ml/min/mg) SULT1E1-WT 8.54 ± 0.30 2.27 ± 0.19 3.77 ± 0.18

SULT1E1-A43D 6.10 ± 0.12**** 1.00 ± 0.08**** 4.70 ± 0.19***

SULT1E1-A131P 9.32 ± 0.65**** 3.17± 0.23**** 2.94 ± 0.01***

SULT1E1-R186L 11.18 ± 0.38**** 4.07± 0.36**** 2.76 ± 0.15***

SULT1E1-P214T 1.56 ± 0.04**** 2.32 ± 0.15 0.68 ± 0.03***

SULT1E1-D220V 3.56 ± 0.16**** 1.53 ± 0.24**** 2.35 ± 0.27***

Data shown represent mean ± SD derived from 3 independent experiments. One-way

ANOVA was performed followed by Tukey's post hoc analysis. **** Statistical significant p<0.0001 from SULT1E1-WT.

4.5. Discussion

4-HT has been shown to be a Phase I metabolite of tamoxifen capable of suppressing the cell proliferation of breast cancer (Crewe et al., 1997; Crewe et al., 2002;

Jordan et al., 1977). It is under investigation for use in a topical gel formulation to alleviate the symptoms of cyclical mastalgia (Mansel et al., 2007). DES has been proposed for use in an adjunctive estrogen treatment, together with other endocrine agents such as tamoxifen, to improve the beneficial effects of the combination therapy for metastatic breast cancer in postmenopausal patients (Iwase and Yamamoto, 2015;

Lonning et al., 2001; Mahtani et al., 2009). SULT1E1, which is known to be expressed in estrogen-responsive tissues, including breast and prostate tissues (Falany and Falany,

1996; Nakamura et al., 2006; Qian et al., 1998), has been shown to be capable of sulfating both DES and 4-HT (Falany et al, 2006; Hui et al., 2015; Suiko et al., 2000).

Variations in tamoxifen metabolism have been reported (Areepium et al., 2013; de Vries et al., 2015; Fernandez-Santander et al., 2013; Gjerde et al., 2008; Lim et al., 2011;

Murdter et al., 2011; Woo et al., 2017; Zafra-Ceres et al., 2013). Interestingly, a recent clinical study has demonstrated a correlation between genetic polymorphisms of tamoxifen-metabolizing enzymes including SULT1E1 and inter-individual variations of plasma concentrations of 4-HT in breast cancer patients treated with tamoxifen (Woo et al., 2017). The current study was carried out to investigate how genetic polymorphisms of the SULT1E1 gene may affect the sulfating activity of coded SULT1E1 allozymes toward 4-HT and DES. Following a comprehensive database search for human SULT1E1 gene, five missense cSNPs of SULT1E1 were selected and their corresponding cDNAs were generated by site-directed mutagenesis. Recombinant SULT1E1 allozymes were expressed, purified, and characterized for their sulfating activity towards 4OH-tamoxifen and diethylstilbestrol.

An initial investigation of the sulfating activities showed differential 4OH- tamoxifen-sulfating activities among all five SULT1E1 allozymes (Figure 4.2). The kinetics studies shown in Table 4.1 further reveals the distinct kinetic parameters Vmax

(reflecting the catalytic activity), Km (reflecting the substrate affinity), and Vmax/Km

(reflecting the catalytic efficiency) for these SULT1E1 allozymes in mediating 4OH- 89

tamoxifen sulfation. In regard to diethylstilbestrol, the sulfating activities shown in

Figure 4.4 indicates significant variations in diethylstilbestrol-sulfating activities among the five examined SULT1E1 allozymes. The kinetics studies shown in Table 4.2 reveals significant changes in Vmax, Km, and Vmax/Km values of the five SULT1E1 allozymes with diethylstilbestrol as a substrate. Overall, the findings of this study showed clearly an impact of SULT1E1 missense coding SNPs (cSNPs) on the sulfation of 4OH-tamoxifen and diethylstilbestrol by coded SULT1E1 allozymes.

Several crystal structures of human SULT1E1 have been reported (Pedersen et al.,

2002; Shevtsov et al., 2003; Thomas and Potter, 2013). Some key elements/ residues revealed in these structures include a 5’-phosphosulphate-binding (PSB) loop

(45TYPKSGT51), a PAP adenine-binding region (W52, Y192 and T226), a 3’-phosphate- binding region (R129, S137, and 256RKG258), substrate-binding residues (Y20, F23, P46,

F75, F80, C83, K85, M89, K105, H107, F138, F141, 145VAGH148, Y168, Y239, L242, and 246IM247), and a C-terminal dimerization motif (265KNHFTVALNE274) (Kakuta et al.,

1997; Pedersen et al., 2002; Petrotchenko et al, 2001; Shevtsov et al., 2003; Thomas and

Potter, 2013). It is interesting to note that many of the amino acid residues associated with the SULT1E1 cSNPs examined in the current study fall within or are in close proximity to these important structural elements. For example, SULT1E1-A131P which showed a significantly lower catalytic efficiency is located between two conserved residues (Arg129 and Ser137) where the PAPS binding occurred (Thomas and Potter,

2013). The replacement of alanine (a non-turn-inducing residue) to proline (a turn-

inducing residue) in SULT1E1-A131P may have disrupted the hydrogen bond interactions of the 3’-phosphate of the PAPS molecule with both Arg129 and Ser137

(Pedersen et al., 2002; Thomas and Potter, 2013). Similarly, the substitutions of polar to non-polar residues that occur in SULT1E1-R186L and SULT1E1-D220V were found to significantly decrease the catalytic efficiency. R186L and D220V substitutions might disrupt the capability of the PAPS adenine moiety to form hydrogen bonds to tyrosine

(Tyr192) and threonine (Thr226) residues that are located downstream from the R186L and D220V amino acid substitutions (Thomas and Potter, 2013). The substitution of proline (a turn-inducing residue) with threonine (a non-turn-inducing residue) in SULT-

P214T may lead to a conformational change in this originally alpha-helix region, and thus led to a significant reduction in the catalytic efficiency. Interestingly, SULT1E1-A43D was shown to display differential catalytic efficiencies toward DES and 4-HT. It is noted that in SULT1E1 molecule, A43 is close to proline (Pro46) and lysine (Lys47) that are involved in, respectively, the substrate- and cofactor-binding sites (Pedersen et al., 2002;

Thomas and Potter, 2013). The differential catalytic efficiencies of SULT1E1-A43D toward DES and 4-HT could be attributed to differences in the chemical structures of these two substrates. The substitution of alanine (non-polar and hydrophobic residue) with aspartic acid (an acidic residue) in SULT1E1-A43D might lead to an increased binding affinity for DES and a decreased binding affinity for 4-HT. Overall, the findings of this study showed clearly an impact of SULT1E1 missense coding SNPs (cSNPs) on the sulfation of 4-HT and DES by coded SULT1E1 allozymes.

4.6. Conclusion. The current study represented a first attempt aiming to clarify the impact of the genetic polymorphisms of the SULT1E1 gene on the enzymatic properties of the coded SULT1E1 protein products. Results obtained demonstrated clearly the differential sulfating activities of coded SULT1E1 allozymes toward 4-HT and DES.

Pending additional studies, such information may in the future assist in designing individualized regimens of HT and DES for patients with distinct SULT1E1 genotypes, thereby enhancing efficacy and minimizing risk for toxicity of these two drugs.

Acknowledgments: This work was supported in part by a grant from National Institutes of Health (Grant # R03HD071146).

Chapter 5

Inhibitory Effect of Triclosan on the Sulfation of 17-β Estradiol by Human SULT1E1 Allozymes

5.1. Abstract: Triclosan is a ubiquitously used antimicrobial agent in several pharmaceutical formulations and household products. Previous studies have reported that triclosan inhibits the sulfation of different phenolic compounds and endogenous estrogens, which are mediated by human cytosolic sulfotransferases including SULT1E1.

The current study aimed to investigate the inhibitory effect of triclosan on the sulfation of

17-β estradiol by SULT1E1 allozymes. From online single nucleotide polymorphism

(SNP) databases, five missense coding SNPs of the SULT1E1 gene were chosen. The site-directed mutagenesis technique was employed to generate the cDNAs coded by selected SULT1E1 cSNPs, and the corresponding SULT1E1 allozymes were expressed and purified. Kinetic parameters of the purified human wild-type SULT1E1 with triclosan as a substrate were measured along with the inhibitory effect of triclosan on the sulfation of 17-β estradiol. Based on the determined IC50 for human wild-type

SULT1E1, purified SULT1E1 allozymes were shown to display lower 17-β estradiol- sulfating activities in the presence of triclosan. These results provide further support that the investigated triclosan can act as both substrate and inhibitor for the human SULT1E1,

which may interfere with the physiological hemostasis of endogenous estrogens such as

17-β estradiol in individuals with various SULT1E1 genotypes.

5.2. Introduction

Triclosan (TCS), an antimicrobial additive, is ubiquitously used in topical and oral pharmaceutical formulations including mouthwash, toothpaste, hand sanitizer, surgical soaps, deodorant, and skin cream, in addition to many fabric and plastic products

(Dhillon et al., 2015; Perencevich et al., 2001; Schweizer, 2001). TCS is an effective broad-spectrum antibacterial agent that possess some antifungal and antiviral activities, which are known to be acutely non-toxic (Jones et al., 2000); however, several studies have reported the detrimental effects of TCS on mammalian organisms (Ajao et al., 2015;

Bertelsen et al., 2013; Clayton et al., 2011; Dhillon et al., 2015; Feng et al., 2016; Foran et al., 2000; Gee et al., 2008; Honkisz et al., 2012; Koeppe et al., 2013; Moss et al., 2000;

Olaniyan et al., 2016; Paul et al., 2012; Philippat et al., 2014; Schiffer et al., 2014; Syed et al., 2014; Teplova et al., 2017; Weatherly and Gosse, 2017; Weatherly et al., 2016;

Zorrilla et al., 2009). TCS has been characterized as an endocrine disruptor (ED) since it interferes with the endocrine system through its oestrogenic, androgenic and anti-thyroid effects (Feng et al., 2016; Foran et al., 2000; Gee et al., 2008; Honkisz et al., 2012;

Zorrilla et al., 2009). Moreover, several in-vitro studies conducted by using human cells have shown that TCS affects mast cell signaling that are associated with various conditions and disorders (infectious disease, asthma, allergy, inflammatory bowel 94

disease, CNS disorders, and cancer) and suppresses sperm motility (Ajao et al., 2015;

Schiffer et al., 2014; Weatherly et al., 2016). In humans, epidemiological studies have indicated that TCS exposure through dermal, oral and inhalation routes are associated with symptoms such as allergies or hay fever, and may also adversely affect infant head circumference through neonatal exposure as well as disrupting thyroid hormone hemostasis (Bertelsen et al., 2013; Clayton et al., 2011; Koeppe et al., 2013; Philippat et al., 2014; Syed et al., 2014).

TCS’s widespread use, lipophilicity, chemical stability, possibility for promoting microbial resistance, and reported adverse effects have posed an important question for identifying potential detoxification pathways that may facilitate excretion of TCS from the human body. Previous studies have showed that glucuronidation and sulfation are the main pathways for TCS phase II biotransformation (James et al., 2010).

Cytosolic sulfotransferases (SULTs), major phase II detoxifying enzymes, catalyze the sulfation of various endogenous and xenobiotic compounds through the transfer of sulfonyl moiety from 3'-phosphoadenosine 5'-phosphosulfate (PAPS) to the hydroxyl or amino groups of the substrate (Falany C, 1992; GJ Mulder 1990; R.

Weinshilboum, 1994), resulting in a biologically inactive conjugated substrate that has higher water solubility, and thus is removed easily from the body (Falany C, 1992; GJ

Mulder 1990; R. Weinshilboum, 1994). Being a substrate for sulfate conjugation, previous studies showed that TCS acts as a potent inhibitor for the sulfation of different phenolic compounds and endogenous estrogens, which are mediated by purified human 95

cytosolic sulfotransferases including SULT1E1 and sheep placental cytosolic sulfotransferase, respectively (James et al., 2010; L. Q. Wang et al., 2004).

Sulfoconjugation, which is mediated by SULT1E1, plays a major role in the physiological homeostasis of key endogenous compounds, particularly estrogens. Like most other genes, the genetic polymorphisms of SULT1E1 have been previously reported

(Agarwal et al., 2016; Choi et al., 2005; Cohen et al., 2009; Daniels and Kadlubar, 2013;

Hirata et al., 2008; Rebbeck et al., 2006; Woo et al., 2017). An intriguing question is whether the genetic polymorphisms of the gene encoding SULT1E1 impacts the inhibitory effect of TCS on the sulfation of 17-β estradiol (E2), a potent endogenous estrogen, influencing the bioavailability and hemostasis of E2 in individuals with various

SULT1E1 genotypes.

In this paper, following a comprehensive search of SULT1E1 SNPs deposited in the major genomic databases, five SULT1E1 allozymes coded by missense SNPs were selected, generated, expressed and purified. The kinetic analyses were conducted to characterize both the kinetic parameters of TCS sulfation and the inhibitory effect of TCS on the sulfation of E2 by purified wild-type SULT1E1. The determined 50% inhibitory concentration (IC50) was then used to assess the inhibitory effects of TCS on the sulfating activity of E2 by five examined SULT1E1 allozymes.

5.3. Materials and Methods

5.3.1. Materials

TCS and E2 were products of Cayman Chemical Company (Ann Arbor, MI,

USA). Adenosine 5’-triphosphate (ATP), dimethyl sulfoxide (DMSO), dithiothreitol

(DTT), isopropyl-1-thio-β-D-galactopyranoside (IPTG), and N-2-hydroxylpiperazine-N’-

2-ethanesulfonic acid (HEPES) were products of Sigma-Aldrich Chemical Company (St.

Louis, MO, USA). Ecolume scintillation cocktail was obtained from MP Biomedicals

(Solon, OH, USA). ATP and carrier-free [35S]sulfate was used to synthesized 3’-

Phosphoadenosine-5’-phospho[35S] sulfate (PAP[35S]) based on a previously established protocol (Yanagisawa et al., 1998). Silica gel thin-layer chromatography (TLC) plates and Ultrafree-MC 5000 NMWL filter units were from EMD Millipore Corporation

(Burlington, MA, USA). Cellulose thin-layer chromatography (TLC) plates were products of Macherey-Nagel (Düren, Germany). Dpn I was purchased from New

England BioLabs (Ipswich, MA, USA), and PrimeStar Max DNA polymerase was a product of Takara Bio Inc. (Mountain View, CA, USA). QIAprep Spin Miniprep Kit was purchased from QIAGEN (Germantown, MD, USA). Glutathione Sepharose was product of GE Healthcare Life Sciences (Pittsburgh, PA, USA). All blue prestained protein markers were obtained from Bioland Scientific LLC. (Paramount, CA, USA). X-

Rays films were purchased from Research Products International Corporation (Mt

Prospect, IL, USA). Oligonucleotide primers were synthesized by Eurofins Genomics

(Louisville, KY, USA). All other reagents and chemicals used were of the highest grades commercially available. 97

5.3.2. Detection and analysis of human SULT1E1 SNPs

The U.S National Center for Biotechnology Information (NCBI), the

Pharmacogenomics Knowledge Base (PharmGKB), and the Universal Protein Resource

(UniProt) were the main accessible databases used to conduct a comprehensive analysis for missense coding SNPs of the human SULT1E1 gene.

5.3.3. Generation of cDNAs encoding different human SULT1E1 allozymes

To generate cDNAs encoding SULT1E1 allozymes packaged in pGEX-2TK vector, the site-directed mutagenesis protocol was employed via PCR-based approach.

The PCR reaction was conducted in a separate tube that contains a pair of mutagenic oligonucleotide primers (listed in Table 2.4), a high fidelity PrimeSTAR® Max DNA polymerase, wild-type SULT1E1 cDNA ligated in the pGEX-2TK prokaryotic expression vector as a template, and dNTP. 12 cycles of different thermal conditions (30 s at 94°C,

1 min at 55°C, and 15 min at 72°C) were used for PCR amplification. Following PCR, the restriction enzyme (Dpn I endonuclease) was added to each reaction mixture and incubated for 1 h at 37°C to degrade the wild-type template. The Dpn I-digested mixtures that contain the “mutated” SULT1E1 cDNA/pGEX-2TK plasmids were individually transformed into competent DH5α E. coli cells to amplify and purify the plasmids. The resulting “mutated” SULT1E1 cDNAs, packaged in pGEX-2TK prokaryotic expression vector, were subjected to nucleotide sequencing to confirm the desired nucleotide substitutions.

5.3.4. Expression and purification of recombinant SULT1E1 allozymes

For recombinant SULT1E1 allozymes expression, the pGEX-2TK vector harboring individual “mutated” SULT1E1 cDNAs were transformed into competent

BL21 E. coli cells. The transformed cells were allowed to grow at 37°C with shaking at

250 rpm in 1 L of Luria broth (LB) medium supplemented with 100 µg/ml ampicillin. At

A600 nm = 0.5, 0.1 mM IPTG was added and incubated for 8 h at 25°C. The cells were centrifuged and the obtained cell pellets were resuspended in 20 ml of an ice-cold lysis buffer (10 mM Tris-HCl, pH 8.0, 1 mM EDTA, and 150 mm NaCl). 100 µl of a protease inhibitor was added to the resuspended cells and then homogenized using an Aminco

French press. The obtained crude homogenate was subjected to centrifugation at 10,000

× g for 30 min at 4°C. Glutathione-Sepharose (0.5 ml) was added to fractionate the collected supernatant, followed by adding 2 ml of a thrombin digestion buffer (50 mM

Tris-HCl, pH 8.0, 150 mM NaCl, and 2.5 mM CaCl2) containing 5 units/ml bovine thrombin to cleave the bound GST-SULT1E1 fusion protein. The resulting preparation was incubated at room temperature for 15 min with constant agitation and then centrifuged. To analyze the purity of the recombinant SULT1E1 allozymes present in the collected supernatants, SDS-polyacrylamide gel electrophoresis (SDS-PAGE) was performed.

5.3.5. Sulfotransferase assay

Radioenzymatic activity assays were performed using PAP[35S] to measure the sulfating activity of the recombinant SULT1E1 allozymes toward TCS. The enzymatic reaction mixtures contained 50 mM HEPES buffer at pH 7.4, 1 mM DTT, 14 µM

PAP[35S], and a substrate (TCS) dissolved in DMSO in a final volume of 20 µl. For each assay, a control with a substrate solvent (DMSO) alone was carried out. To determine the inhibitory effect of TCS on the sulfation of E2 by a purified SULT1E1 wild-type, the above-mentioned enzymatic assay was performed with 0.5 µM of E2 as a substrate in the absence (control) and presence of varying concentrations of TCS (ranging from 0 to 500

µM) as the SULT1E1 inhibitor. By adding 2 µl (containing 0.5 µg) of wild-type or

SULT1E1 allozymes to each assay mixture tube, the enzymatic reaction was initiated and incubated in a water bath for 10 min at 37oC and then terminated by heating at 100°C for

3 min. The reaction mixtures were subjected to centrifugation at 13,000 rpm for 3 min, and the resulting supernatants were analyzed using cellulose TLC plate (TCS kinetics analysis) and silica TLC Plate (TCS inhibitory effect analysis). Afterwards, the TLC separations were performed using solvent system n-butanol/isopropanol/formic acid/water in a ratio of 3:1:1:1 and n-butanol/isopropanol in a ratio of 1:6 (by volume) for

TCS kinetics analysis and TCS inhibitory effect analysis, respectively. TLC plates were autoradiographed on x-ray film to visualized the radiolabeled conjugated substrates. The radiolabeled product spot was cut out and eluted with 500 µl of water for 45 min.

Afterwards, the Ecolume scintillation liquid was added to each vial and mixed thoroughly. A liquid scintillation counter was used to quantify the conjugated substrate according to a previously described method (Hui and Liu, 2015). Subsequently, the 100

specific activity was expressed in nmol of the sulfated conjugate that formed per min per mg of the added enzyme.

5.3.6. pH-dependence studies

To analyze the pH-dependence of the sulfation of E2 by the wild-type SULT1E1 and allozymes, pH-dependence experiments were conducted. As mentioned above in section 5.3.5, the sulfotransferase assays were the same except that 50 mM of different buffers (sodium acetate at 4.5, 5, or 5.5; MES at 6 or 6.5; HEPES at 7, 7.5, or 8; TAPS at

8.5 or 9; CHES at 9.5 or 10; CAPS at 10.5, 11, or 11.5) were used instead of HEPES

(7.4) in presence of E2 (2 µM) as a substrate.

5.3.7. Kinetics studies

To characterize the kinetic parameters (Km and Vmax) for TCS sulfation by purified wild-type SULT1E1, varying concentrations of TCS were used in the SULT assays, and the GraphPad Prism 7.0 software that aligned with the Michaelis-Menten kinetics with non-linear regression was performed. The inhibitory effect of TCS on the sulfation of E2 by recombinant SULT1E1 wild-type was analyzed according to the non-linear regression of the log (inhibitor) versus response by GraphPad Prism 7 software to estimate the 50% inhibitory concentration (IC50). Afterwards, two-way analysis of variance (ANOVA) was implemented, followed by Tukey’s multiple comparison tests, to analyze the specific activity differences between SULT1E1 allozymes versus the wild-type SULT1E1. P- values < 0.05 was determined to be statistically significant.

101

5.4. Results

5.4.1. Identification and analysis of different SULT1E1 SNPs

A comprehensive search to identify SULT1E1 genotypes was conducted using the genomic-related databases accessed at the websites of the U.S. National Center for

Biotechnology Information (NCBI), the Pharmacogenomics Knowledge Base

(PharmGKB), and the Universal Protein Resource (UniProt). A total of 5,291 SULT1E1

SNPs were identified, analyzed, and classified into coding SNPs (cSNPs) and non-coding

SNPs (cf. Table 2.2). Of the 303 SULT1E1 cSNPs, 204 were found to be non- synonymous (missense) cSNPs that resulted in altering the encoded amino acid residues via substituting a single nucleotide in the coding region. These SULT1E1 cSNPs were then further scrutinized according to their positions (e.g., proximity to substrate-binding and PAPS-binding region) and their physiochemical characteristics (acidic to/from basic, polar to/from non-polar, turn inducing to/from non-turn inducing residues) of the altered amino acid residues. On the basis of these criteria, five missense SULT1E1 cSNPs were chosen for further examination as described below. Table 2.4 compiles the designated name, sense and anti-sense mutagenic primers designed for PCR-amplification, and the positions of the altered amino acids, together with the recorded allelic frequencies of these five missense SULT1E1 cSNPs.

102

5.4.2. Preparations of recombinant human SULT1E1 allozymes

The corresponding cDNAs of the five selected SULT1E1 missense genotypes ligated to pGEX-2TK prokaryotic expression vector were generated and then individually transformed in host cells of BL21 E. coli. for expressing the recombinant enzymes.

Glutathione-Sepharose was conducted to fractionate the GST-SULT1E1 proteins from the E. coli cell homogenates. After that, the recombinant SULT1E1 allozymes were released from the bound GST fusion proteins under the action of bovine thrombin, thus permitting the collection of the purified allozymes of SULT1E1. As shown in Figure

2.5, SDS-polyacrylamide gel electrophoretic pattern indicated that the recombinant

SULT1E1 allozymes to be highly homogenous. The apparent molecular weights of the purified SULT1E1 allozymes were similar to the documented molecular weight

(35,126kDa) of the wild –type.

5.4.3. Characterization of TCS sulfation and its inhibitory effect on E2 sulfation by recombinant human SULT1E1 wild-type

Kinetic assays were performed, as described in the Materials and Methods section, using varying concentrations of TCS (ranging from 0.5 - 40 µM). The GraphPad

Prism 7 software based on Michaelis-Menten equation with non-linear regression was used to calculate the apparent Km (24.94 µM) and Vmax (42.14 nmol/min/mg) as shown in

Figure 5.1. The inhibitory effect of TCS on the sulfation of E2 by recombinant

SULT1E1 wild-type was determined with 0.5 µM of E2 as a substrate in the presence of

103

varying concentrations of TCS (ranging from 0 to 500 µM) as an inhibitor. As shown in

Figure 5.2, as the concentrations of TCS increased, the sulfating activity of E2 by wild- type SULT1E1 steadily decreased. The measured IC50 of TCS was 150 µM. Although, the reported mean plasma concentration of TCS ranges between 0.035 nM and 1200 nM, the daily exposure to multiple TCS sources could increase its levels in blood and tissues, thus interfering with E2 sulfation by acting as SULT1E1 inhibitor.

10 (nmol/min/mg)

Specific Activity

0 0 10 20 30 40 50 [Triclosan] (µM)

Figure 5.1. TCS sulfation by human SULT1E1 wild-type. The fitting curve was generated based on Michaelis-Menten kinetics. Data shown represent calculated mean ± standard deviation derived from three experiments.

104

Figure 5.2. Inhibitory effect of TCS on E2 sulfation by human SULT1E1 wild-type.

Data shown represent calculated mean ± standard deviation derived from three experiments.

5.4.4. Sulfating activity of SULT1E1 allozymes toward E2 with TCS as an inhibitor

As shown in Figure 5.3, four allozymes of SULT1E1 (SULT1E-A43D,

SULT1E1-A131P, SULT1E1-R186L, and SULT1E1-D220V) demonstrated significantly lower E2-sulfating activity in the presence of TCS as compared to SULT1E1-WT enzyme. Among these allozymes, SULT1E1- A43D and SULT1E1-D220V displayed more than a 70% significant decrease in E2-sulfating activity, while SULT1E1-A131P and SULT1E1-R186L exhibited 9% and 22% significant reduction in E2-sulfating activity, respectively. SULT1E1-P214T displayed similar E2-sulfating activity in presence of TCS to the wild-type.

105

E2 (0.5 µM)

E2 (0.5 µM) + Triclosan (200 µM)

**** *** 2.0 ** **** 1.5

1.0 (nmol/min/mg)

Specific Activity 0.5

0.0

SULT1E1-WT SULT1E1-A43DSULT1E1-A131PSULT1E1-R186LSULT1E1-P214TSULT1E1-D220V

Figure 5.3. E2 Sulfation by SULT1E1 allozymes with and without TCS as an inhibitor. Data shown represent calculated mean ± standard deviation derived from three experiments.

5.4.5. pH-dependence

As shown in Figure 5.4, the optimal pH for the sulfating activity of the wild-type

SULT1E1, SULT1E1-A43D, and SULT1E1-A131P was 8.5, while for SULT1E1-

R186L, SULT1E1-P214T, and SULT1E1-D220V optimal pH was 8. Although the wild- type SULT1E1 and allozymes exhibited E2-sulfating activities over wide range of pH values, SULT1E1 allozymes, except SULT1E1-A43D, showed lower sulfating activities toward E2 in comparison to the wild type enzyme.

106

107

Figure 5.4. pH-dependence of E2-sulfating activity of the human wild-type

SULT1E1 and allozymes. A) SULT1E1-WT, B) SULT1E1-A43D, C) SULT1E1-

A131P, D) SULT1E1-R186L, E) SULT1E1-P214T, and F) SULT1E1-D220V. The 108

enzymatic assays were performed as described in Materials and Methods. Data shown represent calculated mean ±S.D. derived from three independent determinants.

5.5. Discussion

Several studies have revealed that TCS, a broad spectrum antimicrobial agent, exerts adverse effects on living organisms (Ajao et al., 2015; Bertelsen et al., 2013;

Clayton et al., 2011; Dhillon et al., 2015; Feng et al., 2016; Foran et al., 2000; Gee et al.,

2008; Honkisz et al., 2012; Koeppe et al., 2013; Moss et al., 2000; Olaniyan et al., 2016;

Paul et al., 2012; Philippat et al., 2014; Schiffer et al., 2014; Syed et al., 2014; Teplova et al., 2017; Weatherly and Gosse, 2017; Weatherly et al., 2016; Zorrilla et al., 2009). In the United States, 75% of the population is probably exposed to TCS by using personal care products and goods, and also through exposure to TCS-contaminated water, animal, and food products (Weatherly and Gosse, 2017). As a result, TCS has been detected in human body fluid including serum, plasma, urine, and breast milk at concentrations ranging from (sub-µM - µM) (Olaniyan et al., 2016). Likewise, the presence of sulfated

TCS in skin and TCS in human tissues have been documented (Geens et al., 2012; L.

Wang et al., 2015; Yin et al., 2016). Along with being a substrate for SULT1E1, previous kinetic studies have indicated that TCS acts as a mixed inhibitor for the sulfation of E2 in sheep placental cytosolic sulfotransferase as well (James et al., 2010). Since

SULT1E1 is known to be expressed in the skin, lung, small intestine, and liver (Kushida et al., 2011; Riches et al., 2009), sulfation as mediated by SULT1E1 plays an important

109

role in the metabolism and excretion of TCS that is absorbed via oral, dermal and inhalation routes of exposures. Sulfate conjugation as catalyzed by SULT1E1 is known to play an important role in the homeostasis of endogenous estrogens, so an interesting question is whether, by serving as an inhibitor for the sulfation of E2, TCS may further suppress the sulfoconjugation of E2 in individuals with different SULT1E1 genotypes. To gain insight into this question, the inhibitory effect of TCS on E2 sulfation of SULT1E1 allozymes resulting from non-synonymous cSNPs of the SULT1E1 gene was investigated. As shown in Figure 5.3, four allozymes of SULT1E1 (SULT1E-A43D,

SULT1E1-A131P, SULT1E1-R186L, and SULT1E1-D220V) demonstrated significantly lower E2-sulfating activity in the presence of TCS as compared to SULT1E1-WT enzyme. Overall, the results of this study showed clearly the significant inhibitory effect of TCS on the sulfation of E2 by coded SULT1E1 allozymes.

5.6. Conclusion. The findings of this study provide further support that the investigated

TCS can act as substrate and inhibitor for the human SULT1E1. Additionally, the concluded results also demonstrate the significant inhibitory effect of TCS on the mutant

SULT1E1 allozymes. As a result, exposure to TCS could lower the sulfating activity of the SULT1E1 wild-type as well as the mutant allozymes toward endogenous substrates and xenobiotics including drugs. This indicates that TCS may influence the physiological level of endogenous substrate, E2, as well as the bioavailability of the drugs that are subjected to sulfation by SULT1E1.

110

Chapter 6

Summary

This study was carried out to investigate how genetic polymorphisms of the

SULT1E1 gene may impact the sulfating activity of the coded SULT1E1 protein products. The obtained data clearly indicated differential sulfating activities of the five assessed SULT1E1 allozymes (SULT1E1-A43D, SULT1E1-A131P, SULT1E1-R186L,

SULT1E1-P214T, and SULT1E1-D220V) toward all examined substrates.

Subsequently, these determinations strongly suggest that individuals with various

SULT1E1 genotypes may have differential metabolizing capacity in sulfating endogenous estrogens as well as xenobiotics including drugs. Furthermore, the obtained results demonstrated the significant inhibitory effect of TCS on the sulfating activity of

SULT1E1 allozymes toward E2 that may influence the physiological hemostasis of endogenous substrate as well as the bioavailability of the drugs that are subjected to sulfation by SULT1E1. The optimal pH for the sulfating activity of the wild-type

SULT1E1, SULT1E1-A43D, and SULT1E1-A131P was 8.5, while for SULT1E1-

R186L, SULT1E1-P214T, and SULT1E1-D220V it was 8.

Such information may assist in future studies to design individualized regimens of

EE2, 4-HT, and DES for patients with distinct SULT1E1 genotypes, thereby enhancing

111

efficacy and minimizing the risks for toxicity. It may also have implications for predicting risks of breast, ovarian, endometrial, and prostate cancers in individuals with different SULT1E1 genotypes.

112

References

Chapter 1

Abunnaja, M. S., Alherz, F. A., El Daibani, A. A., Bairam, A. F., Rasool, M. I., Gohal, S.

A., Kurogi, K., Sakakibara. Y., Suiko. M., Liu, M. C. (2018). Effects of Genetic

Polymorphisms on the Sulfation of Dehydroepiandrosterone and Pregnenolone by

Human Cytosolic Sulfotransferase SULT2A1. Biochem Cell Biol.

doi:10.1139/bcb-2017-0341

Adjei, A. A., Thomae, B. A., Prondzinski, J. L., Eckloff, B. W., Wieben, E. D.,

Weinshilboum, R. M. (2003). Human estrogen sulfotransferase (SULT1E1)

pharmacogenomics: gene resequencing and functional genomics. Br J Pharmacol,

139(8), 1373-1382. doi:10.1038/sj.bjp.0705369

Adjei, A. A., & Weinshilboum, R. M. (2002). Catecholestrogen sulfation: possible role in

carcinogenesis. Biochem Biophys Res Commun, 292(2), 402-408.

doi:10.1006/bbrc.2002.6658

Agarwal, N., Alex, A. B., Farnham, J. M., Patel, S., Gill, D., Buckley, T. H., Stephenson,

R. A., Cannon-Albright, L. (2016). Inherited Variants in SULT1E1 and Response

to Abiraterone Acetate by Men with Metastatic Castration Refractory Prostate

Cancer. J Urol, 196(4), 1112-1116. doi:10.1016/j.juro.2016.04.079

113

Aksoy, I. A., Wood, T. C., Weinshilboum, R. (1994). Human liver estrogen

sulfotransferase: identification by cDNA cloning and expression. Biochem

Biophys Res Commun, 200(3), 1621-1629. doi:10.1006/bbrc.1994.1637

Aksoy, I. A., & Weinshilboum, R. M. (1995). Human thermolabile phenol

sulfotransferase gene (STM): molecular cloning and structural characterization.

Biochem Biophys Res Commun, 208(2), 786-795. doi:10.1006/bbrc.1995.1406

Alherz, F. A., Almarghalani, D. A., Hussein, N. A., Kurogi, K., Liu, M. C. (2017). A

reappraisal of the 6-O-desmethylnaproxen-sulfating activity of the human

cytosolic sulfotransferases. Can J Physiol Pharmacol, 95(6), 647-651.

doi:10.1139/cjpp-2016-0403

Alherz, F. A., El Daibani, A. A., Bairam, A. F., Abunnaja, M. S., Rasool, M. I., Kurogi,

K., Sakakibara. Y., Suiko. M., Liu, M. C. (2018). On the Role of Genetic

Polymorphisms in the Sulfation of Cholesterol by Human Cytosolic

Sulfotransferase SULT2B1b. J Biochem. doi:10.1093/jb/mvy042

Allali-Hassani, A., Pan, P. W., Dombrovski, L., Najmanovich, R., Tempel, W., Dong, A.,

Loppnau, P., Martin, F., Thonton, J., Edwards, A. M., Bochkarev, A., Plotnikov,

A. N., Vedadi, M., Arrowsmith, C. H. (2007). Structural and chemical profiling of

the human cytosolic sulfotransferases. PLoS Biol, 5(5), e97.

doi:10.1371/journal.pbio.0050097

Althuis, M. D., Brogan, D. R., Coates, R. J., Daling, J. R., Gammon, M. D., Malone, K.

E., Schoenberg, J. B., Brinton, L. A. (2003). Hormonal content and potency of

oral contraceptives and breast cancer risk among young women. Br J Cancer,

88(1), 50-57. doi:10.1038/sj.bjc.6600691 114

Baumann, E., (1876). Ueber Sulfosäuren im Harn. Berichte der deutschen chemischen

Gesellschaft, 9:54-58.

Bernstein, L., & Ross, R. K. (1993). Endogenous hormones and breast cancer risk.

Epidemiol Rev, 15(1), 48-65.

Blanchard, R. L., Freimuth, R. R., Buck, J., Weinshilboum, R. M., Coughtrie, M. W.

(2004). A proposed nomenclature system for the cytosolic sulfotransferase

(SULT) superfamily. Pharmacogenetics, 14(3), 199-211.

Chang, M. (2011). Dual roles of estrogen metabolism in mammary carcinogenesis. BMB

Rep, 44(7), 423-434. doi:10.5483/BMBRep.2011.44.7.423

Chen, G., Zhang, D., Jing, N., Yin, S., Falany, C. N., Radominska-Pandya, A. (2003).

Human gastrointestinal sulfotransferases: identification and distribution. Toxicol

Appl Pharmacol, 187(3), 186-197.

Cho, Y. R., Lee, S. J., Jeon, H. B., Park, Z. Y., Chun, J. S., Yoo, Y. J. (2004). Under-

sulfation by PAPS synthetase inhibition modulates the expression of ECM

molecules during chondrogenesis. Biochem Biophys Res Commun, 323(3), 769-

775. doi:10.1016/j.bbrc.2004.08.173

Choi, J. Y., Lee, K. M., Park, S. K., Noh, D. Y., Ahn, S. H., Chung, H. W., Han, W.,

Kim, J. S., Shin, S, G, Jang I. J., Yoo, K. Y., Hirvonen, A., Kang, D. (2005).

Genetic polymorphisms of SULT1A1 and SULT1E1 and the risk and survival of

breast cancer. Cancer Epidemiol Biomarkers Prev, 14(5), 1090-1095.

doi:10.1158/1055-9965.EPI-04-0688

Cohen, S., Laitman, Y., Kaufman, B., Milgrom, R., Nir, U., Friedman, E. (2009).

SULT1E1 and ID2 genes as candidates for inherited predisposition to breast and 115

ovarian cancer in Jewish women. Fam Cancer, 8(2), 135-144.

doi:10.1007/s10689-008-9218-4

Coughtrie, M. W., Sharp, S., Maxwell, K., Innes, N. P. (1998). Biology and function of

the reversible sulfation pathway catalysed by human sulfotransferases and

sulfatases. Chem Biol Interact, 109(1-3), 3-27.

Coughtrie, M. W., (2012). Sulfotransferases in Metabolism of Drugs and Other

Xenobiotics Pavel, A. Ulrich, M. Z., eds, pp. 117-145, Wiley-VCH, Weinheim,

Germany.

Dajani, R., Cleasby, A., Neu, M., Wonacott, A. J., Jhoti, H., Hood, A. M., Modi, S.,

Hersey, A., Taskineni, J., Cooke, R. M., Manchee G. R., Coughtrie, M. W.

(1999). X-ray crystal structure of human dopamine sulfotransferase, SULT1A3.

Molecular modeling and quantitative structure-activity relationship analysis

demonstrate a molecular basis for sulfotransferase substrate specificity. J Biol

Chem, 274(53), 37862-37868.

Daniels, J., & Kadlubar, S. (2013). Sulfotransferase genetic variation: from cancer risk to

treatment response. Drug Metab Rev, 45(4), 415-422.

doi:10.3109/03602532.2013.835621

Danielson, P. B. (2002). The cytochrome P450 superfamily: biochemistry, evolution and

drug metabolism in humans. Curr Drug Metab, 3(6), 561-597.

Dooley, T. P., Mitchison, H. M., Munroe, P. B., Probst, P., Neal, M., Siciliano, M. J.,

Deng, Z., Doggett, N. A., Callen, D. F., Gardiner, P. M., Mole, S. E. (1994).

Mapping of two phenol sulphotransferase genes, STP and STM, to 16p: candidate

genes for Batten disease. Biochem Biophys Res Commun, 205(1), 482-489. 116

Duanmu, Z., Weckle, A., Koukouritaki, S. B., Hines, R. N., Falany, J. L., Falany, C. N.,

Kocarek, T. A., Runge-Morris, M. (2006). Developmental expression of aryl,

estrogen, and hydroxysteroid sulfotransferases in pre- and postnatal human liver.

J Pharmacol Exp Ther, 316(3), 1310-1317. doi:10.1124/jpet.105.093633

Eckhardt, U., Schroeder, A., Stieger, B., Hochli, M., Landmann, L., Tynes, R., Meier, P.

J., Hagenbuch, B. (1999). Polyspecific substrate uptake by the hepatic organic

anion transporter Oatp1 in stably transfected CHO cells. Am J Physiol, 276(4 Pt

1), G1037-1042.

Estabrook, R. W. (2003). A passion for P450s (rememberances of the early history of

research on cytochrome P450). Drug Metab Dispos, 31(12), 1461-1473.

doi:10.1124/dmd.31.12.1461

Falany, C., Roth, J. A., (1993). Properties of human cytosolic sulfotransferases involved

in drug metabolism, in: Jeffery, E. H., (Eds.), Human Drug Metabolism; From

Molecular Biology to Man, CRC Press, FL, pp. 101-115.

Falany, C. N. (1997). Enzymology of human cytosolic sulfotransferases. FASEB J, 11(4),

206-216.

Falany, C. N., Krasnykh, V., Falany, J. L. (1995). Bacterial expression and

characterization of a cDNA for human liver estrogen sulfotransferase. J Steroid

Biochem Mol Biol, 52(6), 529-539.

Falany, J. L., & Falany, C. N. (1996a). Expression of cytosolic sulfotransferases in

normal mammary epithelial cells and breast cancer cell lines. Cancer Res, 56(7),

1551-1555.

117

Falany, J. L., & Falany, C. N. (1996b). Regulation of estrogen sulfotransferase in human

endometrial adenocarcinoma cells by progesterone. Endocrinology, 137(4), 1395-

1401. doi:10.1210/endo.137.4.8625916

Falany, C. N., Xie, X., Wang, J., Ferrer, J., Falany, J. L. (2000). Molecular cloning and

expression of novel sulphotransferase-like cDNAs from human and rat brain.

Biochem J, 346 Pt 3, 857-864.

Falany, C. N., He, D., Dumas, N., Frost, A. R., Falany, J. L. (2006a). Human cytosolic

sulfotransferase 2B1: isoform expression, tissue specificity and subcellular

localization. J Steroid Biochem Mol Biol, 102(1-5), 214-221.

doi:10.1016/j.jsbmb.2006.09.011

Falany, J. L., Pilloff, D. E., Leyh, T. S., Falany, C. N. (2006b). Sulfation of raloxifene

and 4-hydroxytamoxifen by human cytosolic sulfotransferases. Drug Metab

Dispos, 34(3), 361-368. doi:10.1124/dmd.105.006551

Falany, C. N., & Rohn-Glowacki, K. J. (2013). SULT2B1: unique properties and

characteristics of a hydroxysteroid sulfotransferase family. Drug Metab Rev,

45(4), 388-400. doi:10.3109/03602532.2013.835609

Fernandez-Santander, A., Gaibar, M., Novillo, A., Romero-Lorca, A., Rubio, M.,

Chicharro, L. M., Tejerina, A., Bandres, F. (2013). Relationship between

genotypes Sult1a2 and Cyp2d6 and tamoxifen metabolism in breast cancer

patients. PLoS One, 8(7), e70183. doi:10.1371/journal.pone.0070183

Freimuth, R. R., Raftogianis, R. B., Wood, T. C., Moon, E., Kim, U. J., Xu, J., Siciliano,

M. J., Weinshilboum, R. M. (2000). Human sulfotransferases SULT1C1 and

118

SULT1C2: cDNA characterization, gene cloning, and chromosomal localization.

Genomics, 65(2), 157-165. doi:10.1006/geno.2000.6150

Freimuth, R. R., Wiepert, M., Chute, C. G., Wieben, E. D., Weinshilboum, R. M. (2004).

Human cytosolic sulfotransferase database mining: identification of seven novel

genes and pseudogenes. Pharmacogenomics J, 4(1), 54-65.

doi:10.1038/sj.tpj.6500223

Fujita, K., Nagata, K., Ozawa, S., Sasano, H., Yamazoe, Y. (1997). Molecular cloning

and characterization of rat ST1B1 and human ST1B2 cDNAs, encoding thyroid

hormone sulfotransferases. J Biochem, 122(5), 1052-1061.

Glatt, H. (1997). Sulfation and sulfotransferases 4: bioactivation of mutagens via

sulfation. FASEB J, 11(5), 314-321.

Glatt, H., Boeing, H., Engelke, C. E., Ma, L., Kuhlow, A., Pabel, U., Pomplun, D.,

Teubner, W., Meinl, W. (2001). Human cytosolic sulphotransferases: genetics,

characteristics, toxicological aspects. Mutat Res, 482(1-2), 27-40.

Gonzalez, F. J., Coughtrie, M., Tukey, R. H., (2011). Drug Metabolism in Goodman &

Gilman's: The Pharmacological Basis of Therapeutics Chabner B.A., Brunton

L.L., Knollmann B.C. (eds.), pp. 123-144, McGraw-Hill, New York.

Heinz, L., Kim, G. J., Marrakchi, S., Christiansen, J., Turki, H., Rauschendorf, M. A.,

Lathrop, M., Hausser, I., Zimmer, A. D., Fischer, J. (2017). Mutations in

SULT2B1 Cause Autosomal-Recessive Congenital Ichthyosis in Humans. Am J

Hum Genet, 100(6), 926-939. doi:10.1016/j.ajhg.2017.05.007

Her, C., Szumlanski, C., Aksoy, I. A., Weinshilboum, R. M. (1996). Human jejunal

estrogen sulfotransferase and dehydroepiandrosterone sulfotransferase: 119

immunochemical characterization of individual variation. Drug Metab Dispos,

24(12), 1328-1335.

Her, C., Kaur, G. P., Athwal, R. S., Weinshilboum, R. M. (1997). Human sulfotransferase

SULT1C1: cDNA cloning, tissue-specific expression, and chromosomal

localization. Genomics, 41(3), 467-470.

Her, C., Wood, T. C., Eichler, E. E., Mohrenweiser, H. W., Ramagli, L. S., Siciliano, M.

J., Weinshilboum, R. M. (1998). Human hydroxysteroid sulfotransferase

SULT2B1: two enzymes encoded by a single chromosome 19 gene. Genomics,

53(3), 284-295. doi:10.1006/geno.1998.5518

Hirata, H., Hinoda, Y., Okayama, N., Suehiro, Y., Kawamoto, K., Kikuno, N., Rabban, J.

T., Chen, L. M., Dahiya, R. (2008). CYP1A1, SULT1A1, and SULT1E1

polymorphisms are risk factors for endometrial cancer susceptibility. Cancer,

112(9), 1964-1973. doi:10.1002/cncr.23392

Huang, C., Chen, Y., Zhou, T., & Chen, G. (2009). Sulfation of dietary flavonoids by

human sulfotransferases. Xenobiotica, 39(4), 312-322.

doi:10.1080/00498250802714915

Hui, Y., & Liu, M. C. (2015). Sulfation of ritodrine by the human cytosolic

sulfotransferases (SULTs): Effects of SULT1A3 genetic polymorphism. Eur J

Pharmacol, 761, 125-129. doi:10.1016/j.ejphar.2015.04.039

Hui, Y., Luo, L., Zhang, L., Kurogi, K., Zhou, C., Sakakibara, Y., Suiko, M., Liu, M. C.

(2015). Sulfation of afimoxifene, endoxifen, raloxifene, and fulvestrant by the

human cytosolic sulfotransferases (SULTs): A systematic analysis. J Pharmacol

Sci, 128(3), 144-149. doi:10.1016/j.jphs.2015.06.004 120

Hobkirk, R. (1985). Steroid sulfotransferases and steroid sulfate sulfatases: characteristics

and biological roles. Can J Biochem Cell Biol, 63(11), 1127-1144.

Hobkirk, R. (1993). Steroid sulfation Current concepts. Trends Endocrinol Metab, 4(2),

69-74.

James, M. O., Li, W., Summerlot, D. P., Rowland-Faux, L., Wood, C. E. (2010).

Triclosan is a potent inhibitor of estradiol and estrone sulfonation in sheep

placenta. Environ Int, 36(8), 942-949. doi:10.1016/j.envint.2009.02.004

Jancova, P., Anzenbacher, P., Anzenbacherova, E. (2010). Phase II drug metabolizing

enzymes. Biomed Pap Med Fac Univ Palacky Olomouc Czech Repub, 154(2),

103-116.

Javitt, N. B., Lee, Y. C., Shimizu, C., Fuda, H., Strott, C. A. (2001). Cholesterol and

hydroxycholesterol sulfotransferases: identification, distinction from

dehydroepiandrosterone sulfotransferase, and differential tissue expression.

Endocrinology, 142(7), 2978-2984. doi:10.1210/endo.142.7.8244

Kakuta, Y., Pedersen, L. G., Carter, C. W., Negishi, M., Pedersen, L. C. (1997). Crystal

structure of estrogen sulphotransferase. Nat Struct Biol, 4(11), 904-908.

Kapoor, R., & Sheng, J. J. (2008). Transfection of human prostate cancer CA-HPV-10

cells with cytosolic sulfotransferase SULT1E1 affects estrogen signaling and gene

transcription. Drug Metab Dispos, 36(2), 316-321. doi:10.1124/dmd.107.017632

Kester, M. H., Bulduk, S., van Toor, H., Tibboel, D., Meinl, W., Glatt, H., Falany, C. N.,

Coughtrie, M. W., Schuur A. G., Brouwer, A., Visser, T. J. (2002). Potent

inhibition of estrogen sulfotransferase by hydroxylated metabolites of

polyhalogenated aromatic hydrocarbons reveals alternative mechanism for 121

estrogenic activity of endocrine disrupters. J Clin Endocrinol Metab, 87(3), 1142-

1150. doi:10.1210/jcem.87.3.8311

King, R. S., Ghosh, A. A., Wu, J. (2006). Inhibition of human phenol and estrogen

sulfotransferase by certain non-steroidal anti-inflammatory agents. Curr Drug

Metab, 7(7), 745-753.

Kong, A. N., Yang, L., Ma, M., Tao, D., Bjornsson, T. D. (1992). Molecular cloning of

the alcohol/hydroxysteroid form (hSTa) of sulfotransferase from human liver.

Biochem Biophys Res Commun, 187(1), 448-454.

Kurogi, K., Shimohira, T., Kouriki-Nagatomo, H., Zhang, G., Miller, E. R., Sakakibara,

Y., Suiko, M., Liu, M. C. (2017). Human Cytosolic Sulphotransferase SULT1C3:

genomic analysis and functional characterization of splice variant SULT1C3a and

SULT1C3d. J Biochem, 162(6), 403-414. doi:10.1093/jb/mvx044

Lacey, J. V., Jr., Mink, P. J., Lubin, J. H., Sherman, M. E., Troisi, R., Hartge, P.,

Schatzkin, A., Schairer, C. (2002). Menopausal hormone replacement therapy and

risk of ovarian cancer. JAMA, 288(3), 334-341.

Lindsay, J., Wang, L. L., Li, Y., Zhou, S. F. (2008). Structure, function and

polymorphism of human cytosolic sulfotransferases. Curr Drug Metab, 9(2), 99-

105.

Miller, W. R., & Langdon, S. P. (1997). Steroid hormones and cancer: (III) observations

from human subjects. Eur J Surg Oncol, 23(2), 163-177; quiz 177-168, 183.

Morch, L. S., Lokkegaard, E., Andreasen, A. H., Kruger-Kjaer, S., Lidegaard, O. (2009).

Hormone therapy and ovarian cancer. JAMA, 302(3), 298-305.

doi:10.1001/jama.2009.1052 122

Mulder G. J., Jakoby W. B., (1990). Sulfation in conjugation reactions, in: Mulder G. J.,

Jakoby W. B., (Ed.), Drug Metabolism, Taylor and Francis, London, pp. 107-161.

Nowell, S., & Falany, C. N. (2006). Pharmacogenetics of human cytosolic

sulfotransferases. Oncogene, 25(11), 1673-1678. doi:10.1038/sj.onc.1209376

O'Mara, T. A., Ferguson, K., Fahey, P., Marquart, L., Yang, H. P., Lissowska, J.,

Chanock, S., Garcia-Closas, S., Thompson, D. J., Dunning, A. M., Easton, D. F.,

ANECS, Webb, P. M., Spurdle, A. B. (2011). CHEK2, MGMT, SULT1E1 and

SULT1A1 polymorphisms and endometrial cancer risk. Twin Res Hum Genet,

14(4), 328-332. doi:10.1375/twin.14.4.328

Otterness, D. M., Wieben, E. D., Wood, T. C., Watson, W. G., Madden, B. J.,

McCormick, D. J., Weinshilboum, R. M. (1992). Human liver

dehydroepiandrosterone sulfotransferase: molecular cloning and expression of

cDNA. Mol Pharmacol, 41(5), 865-872.

Parkinson, A., (2001) Biotransformation of Xenobiotic in Casarett and Doull's

Toxicology: The Basic Science of Poisons (Curtis, D. K., ed) pp. 133-224,

McGraw-Hill, New York.

Pasqualini, J. R. (2009). Estrogen sulfotransferases in breast and endometrial cancers.

Ann N Y Acad Sci, 1155, 88-98. doi:10.1111/j.1749-6632.2009.04113.x

Pasqualini, J. R., Gelly, C., Nguyen, B. L., Vella, C. (1989). Importance of estrogen

sulfates in breast cancer. J Steroid Biochem, 34(1-6), 155-163.

Payne, A. H., & Hales, D. B. (2004). Overview of steroidogenic enzymes in the pathway

from cholesterol to active steroid hormones. Endocr Rev, 25(6), 947-970.

doi:10.1210/er.2003-0030 123

Pedersen, L. C., Petrotchenko, E., Shevtsov, S., Negishi, M. (2002). Crystal structure of

the human estrogen sulfotransferase-PAPS complex: evidence for catalytic role of

Ser137 in the sulfuryl transfer reaction. J Biol Chem, 277(20), 17928-17932.

doi:10.1074/jbc.M111651200

Petrotchenko, E. V., Pedersen, L. C., Borchers, C. H., Tomer, K. B., Negishi, M. (2001).

The dimerization motif of cytosolic sulfotransferases. FEBS Lett, 490(1-2), 39-43.

Qian, Y., Deng, C., Song, W. C. (1998). Expression of estrogen sulfotransferase in MCF-

7 cells by cDNA transfection suppresses the estrogen response: potential role of

the enzyme in regulating estrogen-dependent growth of breast epithelial cells. J

Pharmacol Exp Ther, 286(1), 555-560.

Raftogianis, R. B., Wood, T. C., Weinshilboum, R. M. (1999). Human phenol

sulfotransferases SULT1A2 and SULT1A1: genetic polymorphisms, allozyme

properties, and human liver genotype-phenotype correlations. Biochem

Pharmacol, 58(4), 605-616.

Raftogianis, R., Creveling, C., Weinshilboum, R., Weisz, J. (2000). Estrogen metabolism

by conjugation. J Natl Cancer Inst Monogr(27), 113-124.

Rebbeck, T. R., Troxel, A. B., Wang, Y., Walker, A. H., Panossian, S., Gallagher, S.,

Shatalova, E. G., Blanchard, R., Bunin, G., DeMichele, A., Rubin, S. C.,

Baumgarten, M., Berlin, M., Schinnar, R., Berlin, J. A., Strom, B. L. (2006).

Estrogen sulfation genes, hormone replacement therapy, and endometrial cancer

risk. J Natl Cancer Inst, 98(18), 1311-1320. doi:10.1093/jnci/djj360

124

Runge-Morris, M., & Kocarek, T. A. (2013). Expression of the sulfotransferase 1C

family: implications for xenobiotic toxicity. Drug Metab Rev, 45(4), 450-459.

doi:10.3109/03602532.2013.835634

Russo, J., & Russo, I. H. (2006). The role of estrogen in the initiation of breast cancer. J

Steroid Biochem Mol Biol, 102(1-5), 89-96. doi:10.1016/j.jsbmb.2006.09.004

Sakakibara, Y., Yanagisawa, K., Katafuchi, J., Ringer, D. P., Takami, Y., Nakayama, T.,

Suiko. M., Liu, M. C. (1998). Molecular cloning, expression, and characterization

of novel human SULT1C sulfotransferases that catalyze the sulfonation of N-

hydroxy-2-acetylaminofluorene. J Biol Chem, 273(51), 33929-33935.

Schrag, M. L., Cui, D., Rushmore, T. H., Shou, M., Ma, B., Rodrigues, A. D. (2004).

Sulfotransferase 1E1 is a low km isoform mediating the 3-O-sulfation of ethinyl

estradiol. Drug Metab Dispos, 32(11), 1299-1303. doi:10.1124/dmd.32.11.

Shah, I. A., Bhat, G. A., Mehta, P., Lone, M. M., Dar, N. A. (2016). Genotypes of

CYP1A1, SULT1A1 and SULT1A2 and risk of squamous cell carcinoma of

esophagus: outcome of a case-control study from Kashmir, India. Dis Esophagus,

29(8), 937-943. doi:10.1111/dote.12427

Shevtsov, S., Petrotchenko, E. V., Pedersen, L. C., Negishi, M. (2003). Crystallographic

analysis of a hydroxylated polychlorinated biphenyl (OH-PCB) bound to the

catalytic estrogen binding site of human estrogen sulfotransferase. Environ Health

Perspect, 111(7), 884-888.

Shoham, Z., & Schachter, M. (1996). Estrogen biosynthesis--regulation, action, remote

effects, and value of monitoring in ovarian stimulation cycles. Fertil Steril, 65(4),

687-701. 125

Sidharthan, N. P., Butcher, N. J., Mitchell, D. J., Minchin, R. F. (2014). Expression of the

orphan cytosolic sulfotransferase SULT4A1 and its major splice variant in human

tissues and cells: dimerization, degradation and polyubiquitination. PLoS One,

9(7), e101520. doi:10.1371/journal.pone.0101520

Song, W. C., Qian, Y., Sun, X., Negishi, M. (1997). Cellular localization and regulation

of expression of testicular estrogen sulfotransferase. Endocrinology, 138(11),

5006-5012. doi:10.1210/endo.138.11.5512

Stanley, E. L., Hume, R., Coughtrie, M. W. (2005). Expression profiling of human fetal

cytosolic sulfotransferases involved in steroid and thyroid hormone metabolism

and in detoxification. Mol Cell Endocrinol, 240(1-2), 32-42.

doi:10.1016/j.mce.2005.06.003

Strott, C. A. (2002). Sulfonation and molecular action. Endocr Rev, 23(5), 703-732.

doi:10.1210/er.2001-0040

Suiko, M., Sakakibara, Y., Liu, M. C. (2000). Sulfation of environmental estrogen-like

chemicals by human cytosolic sulfotransferases. Biochem Biophys Res Commun,

267(1), 80-84. doi:10.1006/bbrc.1999.1935

Taskinen, J., Ethell, B. T., Pihlavisto, P., Hood, A. M., Burchell, B., Coughtrie, M. W.

(2003). Conjugation of catechols by recombinant human sulfotransferases, UDP-

glucuronosyltransferases, and soluble catechol O-methyltransferase: structure-

conjugation relationships and predictive models. Drug Metab Dispos, 31(9),

1187-1197. doi:10.1124/dmd.31.9.1187

Thomae, B. A., Rifki, O. F., Theobald, M. A., Eckloff, B. W., Wieben, E. D.,

Weinshilboum, R. M. (2003). Human catecholamine sulfotransferase (SULT1A3) 126

pharmacogenetics: functional genetic polymorphism. J Neurochem, 87(4), 809-

819.

Thomas, M. P., & Potter, B. V. (2013). The structural biology of oestrogen metabolism. J

Steroid Biochem Mol Biol, 137, 27-49. doi:10.1016/j.jsbmb.2012.12.014

Wang, J., Falany, J. L., Falany, C. N. (1998). Expression and characterization of a novel

thyroid hormone-sulfating form of cytosolic sulfotransferase from human liver.

Mol Pharmacol, 53(2), 274-282.

Wang, L. Q., Falany, C. N., James, M. O. (2004). Triclosan as a substrate and inhibitor of

3'-phosphoadenosine 5'-phosphosulfate-sulfotransferase and UDP-glucuronosyl

transferase in human liver fractions. Drug Metab Dispos, 32(10), 1162-1169.

doi:10.1124/dmd.104.000273

Weinshilboum R., Otterness D., (1994). Sulfotransferase enzymes, in: Kaufmann F. C.,

(Ed.), Conjugation-Deconjugation Reactions in Drug Metabolism and Toxicity,

Springer-Verlag, Berlin, pp. 45-78.

Weinshilboum, R. M., Otterness, D. M., Aksoy, I. A., Wood, T. C., Her, C., Raftogianis,

R. B. (1997). Sulfation and sulfotransferases 1: Sulfotransferase molecular

biology: cDNAs and genes. FASEB J, 11(1), 3-14.

Wilborn, T. W., Comer, K. A., Dooley, T. P., Reardon, I. M., Heinrikson, R. L., Falany,

C. N. (1993). Sequence analysis and expression of the cDNA for the phenol-

sulfating form of human liver phenol sulfotransferase. Mol Pharmacol, 43(1), 70-

77.

Woo, H. I., Lee, S. K., Kim, J., Kim, S. W., Yu, J., Bae, S. Y., Lee, J. E., Nam, S. J., Lee,

S. Y. (2017). Variations in plasma concentrations of tamoxifen metabolites and 127

the effects of genetic polymorphisms on tamoxifen metabolism in Korean patients

with breast cancer. Oncotarget, 8(59), 100296-100311.

doi:10.18632/oncotarget.22220

Wood, C. E., Gridley, K. E., Keller-Wood, M. (2003). Biological activity of 17beta-

estradiol-3-sulfate in ovine fetal plasma and uptake in fetal brain. Endocrinology,

144(2), 599-604. doi:10.1210/en.2002-220764

Xu, Y., Liu, X., Guo, F., Ning, Y., Zhi, X., Wang, X., Chen, S., Yin, L., Li, X. (2012).

Effect of estrogen sulfation by SULT1E1 and PAPSS on the development of

estrogen-dependent cancers. Cancer Sci, 103(6), 1000-1009. doi:10.1111/j.1349-

7006.2012.02258.x

Yasuda, S., Yasuda, T., Hui, Y., Liu, M. Y., Suiko, M., Sakakibara, Y., Liu, M. C.

(2009). Concerted action of the cytosolic sulfotransferase, SULT1A3, and

catechol-O-methyltransferase in the metabolism of dopamine in SK-N-MC human

neuroblastoma cells. Neurosci Res, 64(3), 273-279.

doi:10.1016/j.neures.2009.03.011

Yip, C. K. Y., Bansal, S., Wong, S. Y., Lau, A. J. (2018). Identification of Galeterone and

Abiraterone as Inhibitors of Dehydroepiandrosterone Sulfonation Catalyzed by

Human Hepatic Cytosol, SULT2A1, SULT2B1b, and SULT1E1. Drug Metab

Dispos, 46(4), 470-482. doi:10.1124/dmd.117.078980

Yue, W., Santen, R. J., Wang, J. P., Li, Y., Verderame, M. F., Bocchinfuso, W. P.,

Korach, K. S., Devanesan, P., Todorovic, R., Rogan, E. G., Cavalieri, E. L.

(2003). Genotoxic metabolites of estradiol in breast: potential mechanism of

estradiol induced carcinogenesis. J Steroid Biochem Mol Biol, 86(3-5), 477-486. 128

Zanger, U. M., & Schwab, M. (2013). Cytochrome P450 enzymes in drug metabolism:

regulation of gene expression, enzyme activities, and impact of genetic variation.

Pharmacol Ther, 138(1), 103-141. doi:10.1016/j.pharmthera.2012.12.007

Zhang, H., Varlamova, O., Vargas, F. M., Falany, C. N., Leyh, T. S. (1998). Sulfuryl

transfer: the catalytic mechanism of human estrogen sulfotransferase. J Biol

Chem, 273(18), 10888-10892.

Zhu, X., Veronese, M. E., Bernard, C. C., Sansom, L. N., McManus, M. E. (1993).

Identification of two human brain aryl sulfotransferase cDNAs. Biochem Biophys

Res Commun, 195(1), 120-127.

Zhu, X., Veronese, M. E., Iocco, P., McManus, M. E. (1996). cDNA cloning and

expression of a new form of human aryl sulfotransferase. Int J Biochem Cell Biol,

28(5), 565-571.

Zhu, B. T., & Conney, A. H. (1998). Functional role of estrogen metabolism in target

cells: review and perspectives. Carcinogenesis, 19(1), 1-27.

Zuckerman, A., Bolan, E., de Paulis, T., Schmidt, D., Spector, S., Pasternak, G. W.

(1999). Pharmacological characterization of morphine-6-sulfate and codeine-6-

sulfate. Brain Res, 842(1), 1-5.

Chapter2

Bradford, M. M. (1976). A rapid and sensitive method for the quantitation of microgram

quantities of protein utilizing the principle of protein-dye binding. Anal Biochem,

72, 248-254. 129

Hui, Y., & Liu, M. C. (2015). Sulfation of ritodrine by the human cytosolic

sulfotransferases (SULTs): Effects of SULT1A3 genetic polymorphism. Eur J

Pharmacol, 761, 125-129. doi:10.1016/j.ejphar.2015.04.039

Kakuta, Y., Pedersen, L. G., Carter, C. W., Negishi, M., & Pedersen, L. C. (1997).

Crystal structure of estrogen sulphotransferase. Nat Struct Biol, 4(11), 904-908.

Omasits, U., Ahrens, C. H., Muller, S., & Wollscheid, B. (2014). Protter: interactive

protein feature visualization and integration with experimental proteomic data.

Bioinformatics, 30(6), 884-886. doi:10.1093/bioinformatics/btt607

Pedersen, L. C., Petrotchenko, E., Shevtsov, S., & Negishi, M. (2002). Crystal structure

of the human estrogen sulfotransferase-PAPS complex: evidence for catalytic role

of Ser137 in the sulfuryl transfer reaction. J Biol Chem, 277(20), 17928-17932.

doi:10.1074/jbc.M111651200

Petrotchenko, E. V., Pedersen, L. C., Borchers, C. H., Tomer, K. B., & Negishi, M.

(2001). The dimerization motif of cytosolic sulfotransferases. FEBS Lett, 490(1-

2), 39-43.

Shevtsov, S., Petrotchenko, E. V., Pedersen, L. C., & Negishi, M. (2003).

Crystallographic analysis of a hydroxylated polychlorinated biphenyl (OH-PCB)

bound to the catalytic estrogen binding site of human estrogen sulfotransferase.

Environ Health Perspect, 111(7), 884-888.

Thomas, M. P., & Potter, B. V. (2013). The structural biology of oestrogen metabolism. J

Steroid Biochem Mol Biol, 137, 27-49. doi:10.1016/j.jsbmb.2012.12.014

Yanagisawa, K., Sakakibara, Y., Suiko, M., Takami, Y., Nakayama, T., Nakajima, H.,

Takayanagi, K., Natori, Y., Liu, M. C. (1998). cDNA cloning, expression, and 130

characterization of the human bifunctional ATP sulfurylase/adenosine 5'-

phosphosulfate kinase enzyme. Biosci Biotechnol Biochem, 62(5), 1037-1040.

Chapter 3

Adjei, A. A., & Weinshilboum, R. M. (2002). Catecholestrogen sulfation: possible role in

carcinogenesis. Biochem Biophys Res Commun, 292(2), 402-408.

doi:10.1006/bbrc.2002.6658

Adjei, A. A., Thomae, B. A., Prondzinski, J. L., Eckloff, B. W., Wieben, E. D., &

Weinshilboum, R. M. (2003). Human estrogen sulfotransferase (SULT1E1)

pharmacogenomics: gene resequencing and functional genomics. Br J Pharmacol,

139(8), 1373-1382. doi:10.1038/sj.bjp.0705369

Agarwal, N., Alex, A. B., Farnham, J. M., Patel, S., Gill, D., Buckley, T. H., Stephenson,

R. A., Cannon-Albright, L. (2016). Inherited Variants in SULT1E1 and Response

to Abiraterone Acetate by Men with Metastatic Castration Refractory Prostate

Cancer. J Urol, 196(4), 1112-1116. doi:10.1016/j.juro.2016.04.079

Albrecht, E. D., & Pepe, G. J. (2010). Estrogen regulation of placental angiogenesis and

fetal ovarian development during primate pregnancy. Int J Dev Biol, 54(2-3), 397-

408. doi:10.1387/ijdb.082758ea

Althuis, M. D., Brogan, D. R., Coates, R. J., Daling, J. R., Gammon, M. D., Malone, K.

E., Schoenberg, J. B., Brinton, L. A. (2003). Hormonal content and potency of

131

oral contraceptives and breast cancer risk among young women. Br J Cancer,

88(1), 50-57. doi:10.1038/sj.bjc.6600691

Bernstein, L., & Ross, R. K. (1993). Endogenous hormones and breast cancer risk.

Epidemiol Rev, 15(1), 48-65.

Carreau, S., Bouraima-Lelong, H., & Delalande, C. (2012). Estrogen, a female hormone

involved in spermatogenesis. Adv Med Sci, 57(1), 31-36. doi:10.2478/v10039-

012-0005-y

Choi, J. Y., Lee, K. M., Park, S. K., Noh, D. Y., Ahn, S. H., Chung, H. W., Han, W.,

Kim, J. S., Shin, S. G., Jang, I. J., Yoo, K. Y., Hirvonen, A., Kang, D. (2005).

Genetic polymorphisms of SULT1A1 and SULT1E1 and the risk and survival of

breast cancer. Cancer Epidemiol Biomarkers Prev, 14(5), 1090-1095.

doi:10.1158/1055-9965.EPI-04-0688

Cohen, S., Laitman, Y., Kaufman, B., Milgrom, R., Nir, U., & Friedman, E. (2009).

SULT1E1 and ID2 genes as candidates for inherited predisposition to breast and

ovarian cancer in Jewish women. Fam Cancer, 8(2), 135-144.

doi:10.1007/s10689-008-9218-4

Daniels, J., & Kadlubar, S. (2013). Sulfotransferase genetic variation: from cancer risk to

treatment response. Drug Metab Rev, 45(4), 415-422.

doi:10.3109/03602532.2013.835621

Eckhardt, U., Schroeder, A., Stieger, B., Hochli, M., Landmann, L., Tynes, R., Meier, P.

J., Hagenbuch, B. (1999). Polyspecific substrate uptake by the hepatic organic

anion transporter Oatp1 in stably transfected CHO cells. Am J Physiol, 276(4 Pt

1), G1037-1042. 132

Falany, C. N. (1997). Enzymology of human cytosolic sulfotransferases. FASEB J, 11(4),

206-216.

Falany, C. N., Krasnykh, V., & Falany, J. L. (1995). Bacterial expression and

characterization of a cDNA for human liver estrogen sulfotransferase. J Steroid

Biochem Mol Biol, 52(6), 529-539.

Falany, J. L., & Falany, C. N. (1996a). Expression of cytosolic sulfotransferases in

normal mammary epithelial cells and breast cancer cell lines. Cancer Res, 56(7),

1551-1555.

Falany, J. L., & Falany, C. N. (1996b). Regulation of estrogen sulfotransferase in human

endometrial adenocarcinoma cells by progesterone. Endocrinology, 137(4), 1395-

1401. doi:10.1210/endo.137.4.8625916

Hirata, H., Hinoda, Y., Okayama, N., Suehiro, Y., Kawamoto, K., Kikuno, N., Rabban, J.

T., Chen, L. M., Dahiya, R. (2008). CYP1A1, SULT1A1, and SULT1E1

polymorphisms are risk factors for endometrial cancer susceptibility. Cancer,

112(9), 1964-1973. doi:10.1002/cncr.23392

Hobkirk, R. (1985). Steroid sulfotransferases and steroid sulfate sulfatases: characteristics

and biological roles. Can J Biochem Cell Biol, 63(11), 1127-1144.

Hobkirk, R. (1993). Steroid sulfation Current concepts. Trends Endocrinol Metab, 4(2),

69-74.

Hui, Y., & Liu, M. C. (2015). Sulfation of ritodrine by the human cytosolic

sulfotransferases (SULTs): Effects of SULT1A3 genetic polymorphism. Eur J

Pharmacol, 761, 125-129. doi:10.1016/j.ejphar.2015.04.039

133

Kakuta, Y., Pedersen, L. G., Carter, C. W., Negishi, M., & Pedersen, L. C. (1997).

Crystal structure of estrogen sulphotransferase. Nat Struct Biol, 4(11), 904-908.

Kamel, R. M. (2010). The onset of human parturition. Arch Gynecol Obstet, 281(6), 975-

982. doi:10.1007/s00404-010-1365-9

Lacey, J. V., Jr., Mink, P. J., Lubin, J. H., Sherman, M. E., Troisi, R., Hartge, P.,

Schatzkin, A., Schairer, C. (2002). Menopausal hormone replacement therapy and

risk of ovarian cancer. JAMA, 288(3), 334-341.

Lippman, M. E., & Bolan, G. (1975). Oestrogen-responsive human breast cancer in long

term tissue culture. Nature, 256(5518), 592-593.

Maggiolini, M., & Picard, D. (2010). The unfolding stories of GPR30, a new membrane-

bound estrogen receptor. J Endocrinol, 204(2), 105-114. doi:10.1677/JOE-09-

0242

Miller, W. R., & Langdon, S. P. (1997). Steroid hormones and cancer: (III) observations

from human subjects. Eur J Surg Oncol, 23(2), 163-177; quiz 177-168, 183.

Morch, L. S., Lokkegaard, E., Andreasen, A. H., Kruger-Kjaer, S., & Lidegaard, O.

(2009). Hormone therapy and ovarian cancer. JAMA, 302(3), 298-305.

doi:10.1001/jama.2009.1052

O'Donnell, L., Robertson, K. M., Jones, M. E., & Simpson, E. R. (2001). Estrogen and

spermatogenesis. Endocr Rev, 22(3), 289-318. doi:10.1210/edrv.22.3.0431

O'Lone, R., Frith, M. C., Karlsson, E. K., & Hansen, U. (2004). Genomic targets of

nuclear estrogen receptors. Mol Endocrinol, 18(8), 1859-1875.

doi:10.1210/me.2003-0044

134

Pasqualini, J. R., Gelly, C., Nguyen, B. L., & Vella, C. (1989). Importance of estrogen

sulfates in breast cancer. J Steroid Biochem, 34(1-6), 155-163.

Pedersen, L. C., Petrotchenko, E., Shevtsov, S., & Negishi, M. (2002). Crystal structure

of the human estrogen sulfotransferase-PAPS complex: evidence for catalytic role

of Ser137 in the sulfuryl transfer reaction. J Biol Chem, 277(20), 17928-17932.

doi:10.1074/jbc.M111651200

Pepe, G. J., & Albrecht, E. D. (1995). Actions of placental and fetal adrenal steroid

hormones in primate pregnancy. Endocr Rev, 16(5), 608-648. doi:10.1210/edrv-

16-5-608

Petrotchenko, E. V., Pedersen, L. C., Borchers, C. H., Tomer, K. B., & Negishi, M.

(2001). The dimerization motif of cytosolic sulfotransferases. FEBS Lett, 490(1-

2), 39-43.

Qian, Y., Deng, C., & Song, W. C. (1998). Expression of estrogen sulfotransferase in

MCF-7 cells by cDNA transfection suppresses the estrogen response: potential

role of the enzyme in regulating estrogen-dependent growth of breast epithelial

cells. J Pharmacol Exp Ther, 286(1), 555-560.

Raftogianis, R., Creveling, C., Weinshilboum, R., & Weisz, J. (2000). Estrogen

metabolism by conjugation. J Natl Cancer Inst Monogr(27), 113-124.

Rebbeck, T. R., Troxel, A. B., Wang, Y., Walker, A. H., Panossian, S., Gallagher, S.,

Shatalova, E. G., Blanchard, R., Bunin, G., DeMichele, A., Rubin, S. C.,

Baumgarten, M., Berlin, M., Schinnar, R., Berlin, J. A. Strom, B. L. (2006).

Estrogen sulfation genes, hormone replacement therapy, and endometrial cancer

risk. J Natl Cancer Inst, 98(18), 1311-1320. doi:10.1093/jnci/djj360 135

Riches, Z., Stanley, E. L., Bloomer, J. C., & Coughtrie, M. W. (2009). Quantitative

evaluation of the expression and activity of five major sulfotransferases (SULTs)

in human tissues: the SULT "pie". Drug Metab Dispos, 37(11), 2255-2261.

doi:10.1124/dmd.109.028399

Safe, S., & Kim, K. (2008). Non-classical genomic estrogen receptor (ER)/specificity

protein and ER/activating protein-1 signaling pathways. J Mol Endocrinol, 41(5),

263-275. doi:10.1677/JME-08-0103

Safe, S. H. (1998). Interactions between hormones and chemicals in breast cancer. Annu

Rev Pharmacol Toxicol, 38, 121-158. doi:10.1146/annurev.pharmtox.38.1.121

Schrag, M. L., Cui, D., Rushmore, T. H., Shou, M., Ma, B., & Rodrigues, A. D. (2004).

Sulfotransferase 1E1 is a low km isoform mediating the 3-O-sulfation of ethinyl

estradiol. Drug Metab Dispos, 32(11), 1299-1303. doi:10.1124/dmd.32.11.

Shevtsov, S., Petrotchenko, E. V., Pedersen, L. C., & Negishi, M. (2003).

Crystallographic analysis of a hydroxylated polychlorinated biphenyl (OH-PCB)

bound to the catalytic estrogen binding site of human estrogen sulfotransferase.

Environ Health Perspect, 111(7), 884-888.

Silberstein, S. D., & Merriam, G. R. (2000). Physiology of the menstrual cycle.

Cephalalgia, 20(3), 148-154. doi:10.1046/j.1468-2982.2000.00034.x

Song, W. C., Qian, Y., Sun, X., & Negishi, M. (1997). Cellular localization and

regulation of expression of testicular estrogen sulfotransferase. Endocrinology,

138(11), 5006-5012. doi:10.1210/endo.138.11.5512

Strott, C. A. (2002). Sulfonation and molecular action. Endocr Rev, 23(5), 703-732.

doi:10.1210/er.2001-0040 136

Thomas, M. P., & Potter, B. V. (2013). The structural biology of oestrogen metabolism. J

Steroid Biochem Mol Biol, 137, 27-49. doi:10.1016/j.jsbmb.2012.12.014

Woo, H. I., Lee, S. K., Kim, J., Kim, S. W., Yu, J., Bae, S. Y., Lee, J. E., Nam, S. J., Lee,

S. Y. (2017). Variations in plasma concentrations of tamoxifen metabolites and

the effects of genetic polymorphisms on tamoxifen metabolism in Korean patients

with breast cancer. Oncotarget, 8(59), 100296-100311.

doi:10.18632/oncotarget.22220

Yager, J. D., & Liehr, J. G. (1996). Molecular mechanisms of estrogen carcinogenesis.

Annu Rev Pharmacol Toxicol, 36, 203-232.

doi:10.1146/annurev.pa.36.040196.001223

Yanagisawa, K., Sakakibara, Y., Suiko, M., Takami, Y., Nakayama, T., Nakajima, H.,

Takayanagi, K., Natori, Y., Liu, M. C. (1998). cDNA cloning, expression, and

characterization of the human bifunctional ATP sulfurylase/adenosine 5'-

phosphosulfate kinase enzyme. Biosci Biotechnol Biochem, 62(5), 1037-1040.

Zhang, H., Varlamova, O., Vargas, F. M., Falany, C. N., & Leyh, T. S. (1998). Sulfuryl

transfer: the catalytic mechanism of human estrogen sulfotransferase. J Biol

Chem, 273(18), 10888-10892.

Zhu, B. T., & Conney, A. H. (1998). Functional role of estrogen metabolism in target

cells: review and perspectives. Carcinogenesis, 19(1), 1-27.

Chapter 4

137

Agarwal, N., Alex, A. B., Farnham, J. M., Patel, S., Gill, D., Buckley, T. H., Stephenson,

R. A., Cannon-Albright, L. (2016). Inherited Variants in SULT1E1 and Response to

Abiraterone Acetate by Men with Metastatic Castration Refractory Prostate Cancer. J

Urol, 196(4), 1112-1116. doi:10.1016/j.juro.2016.04.079

Areepium, N., Panomvana, D., Rungwanonchai, P., Sathaporn, S., Voravud, N. (2013).

Effects of CYP2D6 and UGT2B7 polymorphisms on pharmacokinetics of tamoxifen

in Thai breast cancer patients. Breast Cancer (Dove Med Press), 5, 73-78.

doi:10.2147/BCTT.S47172

Blanchard, R. L., Freimuth, R. R., Buck, J., Weinshilboum, R. M., Coughtrie, M. W.

(2004). A proposed nomenclature system for the cytosolic sulfotransferase (SULT)

superfamily. Pharmacogenetics, 14(3), 199-211.

Chang, M. (2012). Tamoxifen resistance in breast cancer. Biomol Ther (Seoul), 20(3),

256-267. doi:10.4062/biomolther.2012.20.3.256.

Choi, J. Y., Lee, K. M., Park, S. K., Noh, D. Y., Ahn, S. H., Chung, H. W., Han, W.,

Kim, J. S., Shin, S. G., Jang, I. J., Yoo, K. Y., Hirvonen, A., Kang, D. (2005). Genetic

polymorphisms of SULT1A1 and SULT1E1 and the risk and survival of breast

cancer. Cancer Epidemiol Biomarkers Prev, 14(5), 1090-1095. doi:10.1158/1055-

9965.EPI-04-0688

Cohen, S., Laitman, Y., Kaufman, B., Milgrom, R., Nir, U., Friedman, E. (2009).

SULT1E1 and ID2 genes as candidates for inherited predisposition to breast and

ovarian cancer in Jewish women. Fam Cancer, 8(2), 135-144. doi:10.1007/s10689-

008-9218-4

138

Crewe, H. K., Ellis, S. W., Lennard, M. S., Tucker, G. T. (1997). Variable contribution of

cytochromes P450 2D6, 2C9 and 3A4 to the 4-hydroxylation of tamoxifen by human

liver microsomes. Biochem Pharmacol, 53(2), 171-178. doi:10.1016/s0006-

2952(96)00650-8

Crewe, H. K., Notley, L. M., Wunsch, R. M., Lennard, M. S., Gillam, E. M. (2002).

Metabolism of tamoxifen by recombinant human cytochrome P450 enzymes:

formation of the 4-hydroxy, 4'-hydroxy and N-desmethyl metabolites and

isomerization of trans-4-hydroxytamoxifen. Drug Metab Dispos, 30(8), 869-874.

doi:10.1124/dmd.30.8.869

Daniels, J., Kadlubar, S. (2013). Sulfotransferase genetic variation: from cancer risk to

treatment response. Drug Metab Rev, 45(4), 415-422.

doi:10.3109/03602532.2013.835621 de Voogt, H. J., Smith, P. H., Pavone-Macaluso, M., de Pauw, M., Suciu, S. (1986).

Cardiovascular side effects of diethylstilbestrol, cyproterone acetate,

medroxyprogesterone acetate and estramustine phosphate used for the treatment of

advanced prostatic cancer: results from European Organization for Research on

Treatment of Cancer trials 30761 and 30762. J Urol, 135(2), 303-307.

doi:10.1016/s0022-5347(17)45620-5 de Vries Schultink, A. H., Zwart, W., Linn, S. C., Beijnen, J. H., Huitema, A. D. (2015).

Effects of Pharmacogenetics on the Pharmacokinetics and Pharmacodynamics of

Tamoxifen. Clin Pharmacokinet, 54(8), 797-810. doi:10.1007/s40262-015-0273-3

139

Falany C, Roth JA (1993). Properties of human cytosolic sulfotransferases involved in

drug metabolism, in: Jeffery EH, (Ed.), Human Drug Metabolism; From Molecular

Biology to Man, CRC Press, FL, pp. 101-115.

Falany, J. L., Falany, C. N. (1996). Expression of cytosolic sulfotransferases in normal

mammary epithelial cells and breast cancer cell lines. Cancer Res, 56(7), 1551-1555.

Falany, J. L., Pilloff, D. E., Leyh, T. S., Falany, C. N. (2006). Sulfation of raloxifene and

4-hydroxytamoxifen by human cytosolic sulfotransferases. Drug Metab Dispos,

34(3), 361-368. doi:10.1124/dmd.105.006551

Fernandez-Santander, A., Gaibar, M., Novillo, A., Romero-Lorca, A., Rubio, M.,

Chicharro, L. M., Tejerina, A., Bandres, F. (2013). Relationship between genotypes

Sult1a2 and Cyp2d6 and tamoxifen metabolism in breast cancer patients. PLoS One,

8(7), e70183. doi:10.1371/journal.pone.0070183

Fisher, B., Costantino, J. P., Redmond, C. K., Fisher, E. R., Wickerham, D. L., Cronin,

W. M. (1994). Endometrial cancer in tamoxifen-treated breast cancer patients:

findings from the National Surgical Adjuvant Breast and Bowel Project (NSABP) B-

14. J Natl Cancer Inst, 86(7), 527-537.

Freimuth, R. R., Wiepert, M., Chute, C. G., Wieben, E. D., Weinshilboum, R. M. (2004).

Human cytosolic sulfotransferase database mining: identification of seven novel

genes and pseudogenes. Pharmacogenomics J, 4(1), 54-65.

doi:10.1038/sj.tpj.6500223

GJ Mulder , W. J. (1990). Sulfation. In G. J. Mulder (Ed.), Conjugation reactions in Drug

Metabolism (pp. 107-161). London: Taylor & Francis.

140

Gjerde, J., Hauglid, M., Breilid, H., Lundgren, S., Varhaug, J. E., Kisanga, E. R.,

Mellgren, G., Steen, V. M., Lien, E. A. (2008). Effects of CYP2D6 and SULT1A1

genotypes including SULT1A1 gene copy number on tamoxifen metabolism. Ann

Oncol, 19(1), 56-61. doi:10.1093/annonc/mdm434

Hirata, H., Hinoda, Y., Okayama, N., Suehiro, Y., Kawamoto, K., Kikuno, N., Rabban, J.

T., Chen, L. M., Dahiya, R. (2008). CYP1A1, SULT1A1, and SULT1E1

polymorphisms are risk factors for endometrial cancer susceptibility. Cancer, 112(9),

1964-1973. doi:10.1002/cncr.23392

Hui, Y., Liu, M. C. (2015). Sulfation of ritodrine by the human cytosolic

sulfotransferases (SULTs): Effects of SULT1A3 genetic polymorphism. Eur J

Pharmacol, 761, 125-129. doi:10.1016/j.ejphar.2015.04.039

Hui, Y., Luo, L., Zhang, L., Kurogi, K., Zhou, C., Sakakibara, Y., Suiko, M., Liu, M. C.

(2015). Sulfation of afimoxifene, endoxifen, raloxifene, and fulvestrant by the human

cytosolic sulfotransferases (SULTs): A systematic analysis. J Pharmacol Sci, 128(3),

144-149. doi:10.1016/j.jphs.2015.06.004

Iwase, H., Yamamoto, Y. (2015). Clinical benefit of sequential use of endocrine therapies

for metastatic breast cancer. Int J Clin Oncol, 20(2), 253-261. doi:10.1007/s10147-

015-0793-8

Jordan, V. C., Collins, M. M., Rowsby, L., Prestwich, G. (1977). A monohydroxylated

metabolite of tamoxifen with potent antioestrogenic activity. J Endocrinol, 75(2),

305-316. doi:10.1677/joe.0.0750305

141

Kakuta, Y., Pedersen, L. G., Carter, C. W., Negishi, M., Pedersen, L. C. (1997). Crystal

structure of estrogen sulphotransferase. Nat Struct Biol, 4(11), 904-908.

doi:10.1038/nsb1197-904

Latifyan, S., Vansteelandt, C., Lecomte, S., Efira, A. (2017). Tamoxifen induced

thromboembolic events in breast cancer. Some possible mechanisms. Rev Med Brux,

38(6), 494-500.

Lim, J. S., Chen, X. A., Singh, O., Yap, Y. S., Ng, R. C., Wong, N. S., Wong, M., Lee, E.

J., Chowbay, B. (2011). Impact of CYP2D6, CYP3A5, CYP2C9 and CYP2C19

polymorphisms on tamoxifen pharmacokinetics in Asian breast cancer patients. Br J

Clin Pharmacol, 71(5), 737-750. doi:10.1111/j.1365-2125.2011.03905.x

Lonning, P. E., Taylor, P. D., Anker, G., Iddon, J., Wie, L., Jorgensen, L. M., Mella, O.,

Howell, A. (2001). High-dose estrogen treatment in postmenopausal breast cancer

patients heavily exposed to endocrine therapy. Breast Cancer Res Treat, 67(2), 111-

116. doi:10.1023/a:1010619225209

Mahtani, R. L., Stein, A., Vogel, C. L. (2009). High-dose estrogen as salvage hormonal

therapy for highly refractory metastatic breast cancer: a retrospective chart review.

Clin Ther, 31 Pt 2, 2371-2378. doi:10.1016/j.clinthera.2009.11.002

Manikandan, R., Srirangam, S. J., Pearson, E., Brown, S. C., O'Reilly, P., Collins, G. N.

(2005). Diethylstilboestrol versus bicalutamide in hormone refractory prostate

carcinoma: a prospective randomized trial. Urol Int, 75(3), 217-221.

doi:10.1159/000087797

Mansel, R., Goyal, A., Nestour, E. L., Masini-Eteve, V., O'Connell, K., Afimoxifene

Breast Pain Research Group (2007). A phase II trial of Afimoxifene (4- 142

hydroxytamoxifen gel) for cyclical mastalgia in premenopausal women. Breast

Cancer Res Treat, 106(3), 389-397. doi:10.1007/s10549-007-9507-x

Mulder G. J., Jakoby W. B. (1990). Sulfation in conjugation reactions, in: Mulder GJ,

Jakoby WB, (Ed.), Drug Metabolism, Taylor and Francis, London, pp. 107-161.

Murdter, T. E., Schroth, W., Bacchus-Gerybadze, L., Winter, S., Heinkele, G., Simon,

W., Fasching, P. A., Fehm, T., German Tamoxifen and AI Clinician Group,

Eichelbaum, M., Schwab, M., Brauch, H. (2011). Activity levels of tamoxifen

metabolites at the estrogen receptor and the impact of genetic polymorphisms of

phase I and II enzymes on their concentration levels in plasma. Clin Pharmacol Ther,

89(5), 708-717. doi:10.1038/clpt.2011.27

Nakamura, Y., Suzuki, T., Fukuda, T., Ito, A., Endo, M., Moriya, T., Arai, Y., Sasano, H.

(2006). Steroid sulfatase and estrogen sulfotransferase in human prostate cancer.

Prostate, 66(9), 1005-1012. doi:10.1002/pros.20426

Nayfield, S. G., Gorin, M. B. (1996). Tamoxifen-associated eye disease. A review. J Clin

Oncol, 14(3), 1018-1026. doi:10.1200/JCO.1996.14.3.1018

Nishiyama, T., Ogura, K., Nakano, H., Ohnuma, T., Kaku, T., Hiratsuka, A., Muro, K.,

Watabe, T. (2002). Reverse geometrical selectivity in glucuronidation and sulfation

of cis- and trans-4-hydroxytamoxifens by human liver UDP-glucuronosyltransferases

and sulfotransferases. Biochem Pharmacol, 63(10), 1817-1830. doi:10.1016/s0006-

2952(02)00994-2

Osborne, C. K. (1998). Tamoxifen in the treatment of breast cancer. N Engl J Med,

339(22), 1609-1618. doi:10.1056/NEJM199811263392207

143

Pedersen, L. C., Petrotchenko, E., Shevtsov, S., Negishi, M. (2002). Crystal structure of

the human estrogen sulfotransferase-PAPS complex: evidence for catalytic role of

Ser137 in the sulfuryl transfer reaction. J Biol Chem, 277(20), 17928-17932.

doi:10.1074/jbc.M111651200

Petrotchenko, E. V., Pedersen, L. C., Borchers, C. H., Tomer, K. B., Negishi, M. (2001).

The dimerization motif of cytosolic sulfotransferases. FEBS Lett, 490(1-2), 39-43.

doi:10.1016/s0014-5793(01)02129-9

Qian, Y., Deng, C., Song, W. C. (1998). Expression of estrogen sulfotransferase in MCF-

7 cells by cDNA transfection suppresses the estrogen response: potential role of the

enzyme in regulating estrogen-dependent growth of breast epithelial cells. J

Pharmacol Exp Ther, 286(1), 555-560.

Rebbeck, T. R., Troxel, A. B., Wang, Y., Walker, A. H., Panossian, S., Gallagher, S.,

Shatalova, E. G., Blanchard, R., Bunin, G., DeMichele, A., Rubin, S. C., Baumgarten,

M., Berlin, M., Schinnar, R., Berlin, J. A. Strom, B. L. (2006). Estrogen sulfation

genes, hormone replacement therapy, and endometrial cancer risk. J Natl Cancer Inst,

98(18), 1311-1320. doi:10.1093/jnci/djj360

Salomao, S. R., Watanabe, S. E., Berezovsky, A., Motono, M. (2007). Multifocal

electroretinography, color discrimination and ocular toxicity in tamoxifen use. Curr

Eye Res, 32(4), 345-352. doi:10.1080/02713680701229638

Shevtsov, S., Petrotchenko, E. V., Pedersen, L. C., Negishi, M. (2003). Crystallographic

analysis of a hydroxylated polychlorinated biphenyl (OH-PCB) bound to the catalytic

estrogen binding site of human estrogen sulfotransferase. Environ Health Perspect,

111(7), 884-888. doi:10.1289/ehp.6056 144

Smith, D. C., Redman, B. G., Flaherty, L. E., Li, L., Strawderman, M., Pienta, K. J.

(1998). A phase II trial of oral diethylstilbesterol as a second-line hormonal agent in

advanced prostate cancer. Urology, 52(2), 257-260. doi:10.1016/s0090-

4295(98)00173-3

Suiko, M., Sakakibara, Y., Liu, M. C. (2000). Sulfation of environmental estrogen-like

chemicals by human cytosolic sulfotransferases. Biochem Biophys Res Commun,

267(1), 80-84. doi:10.1006/bbrc.1999.1935

Thomas, M. P., Potter, B. V. (2013). The structural biology of oestrogen metabolism. J

Steroid Biochem Mol Biol, 137, 27-49. doi:10.1016/j.jsbmb.2012.12.014

Turo, R., Tan, K., Thygesen, H., Sundaram, S. K., Chahal, R., Prescott, S., Cross, W. R.

(2015). Diethylstilboestrol (1 mg) in the management of castration-resistant prostate

cancer. Urol Int, 94(3), 307-312. doi:10.1159/000365198

Weinshilboum R., Otterness D (1994). Sulfotransferase enzymes, in: Kaufmann FC,

(Ed.), Conjugation-Deconjugation Reactions in Drug Metabolism and Toxicity,

Springer-Verlag, Berlin, pp. 45-78.

Woo, H. I., Lee, S. K., Kim, J., Kim, S. W., Yu, J., Bae, S. Y., Lee, J. E., Nam, S. J., Lee,

S. Y. (2017). Variations in plasma concentrations of tamoxifen metabolites and the

effects of genetic polymorphisms on tamoxifen metabolism in Korean patients with

breast cancer. Oncotarget, 8(59), 100296-100311. doi:10.18632/oncotarget.22220

Yanagisawa, K., Sakakibara, Y., Suiko, M., Takami, Y., Nakayama, T., Nakajima, H.,

Takayanagi, K., Natori, Y., Liu, M. C. (1998). cDNA cloning, expression, and

characterization of the human bifunctional ATP sulfurylase/adenosine 5'-

145

phosphosulfate kinase enzyme. Biosci Biotechnol Biochem, 62(5), 1037-1040.

doi:10.1271/bbb.62.1037

Zafra-Ceres, M., de Haro, T., Farez-Vidal, E., Blancas, I., Bandres, F., de Duenas, E. M.,

Ochoa-Aranda, E., Gomez-Capilla, J. A., Gomez-Llorente, C. (2013). Influence of

CYP2D6 polymorphisms on serum levels of tamoxifen metabolites in Spanish

women with breast cancer. Int J Med Sci, 10(7), 932-937. doi:10.7150/ijms.5708

Chapter 5

Agarwal, N., Alex, A. B., Farnham, J. M., Patel, S., Gill, D., Buckley, T. H., . . . Cannon-

Albright, L. (2016). Inherited Variants in SULT1E1 and Response to Abiraterone

Acetate by Men with Metastatic Castration Refractory Prostate Cancer. J Urol,

196(4), 1112-1116. doi:10.1016/j.juro.2016.04.079

Ajao, C., Andersson, M. A., Teplova, V. V., Nagy, S., Gahmberg, C. G., Andersson, L.

C., Hautaniemi, M., Kakasi, B., Roiainen, M., Salkinoja-Salonen, M. (2015).

Mitochondrial toxicity of triclosan on mammalian cells. Toxicol Rep, 2, 624-637.

doi:10.1016/j.toxrep.2015.03.012

Bertelsen, R. J., Longnecker, M. P., Lovik, M., Calafat, A. M., Carlsen, K. H., London, S.

J., & Lodrup Carlsen, K. C. (2013). Triclosan exposure and allergic sensitization

in Norwegian children. Allergy, 68(1), 84-91. doi:10.1111/all.12058

Choi, J. Y., Lee, K. M., Park, S. K., Noh, D. Y., Ahn, S. H., Chung, H. W., Han, W.,

Kim, J. S., Shin, S, G, Jang I. J., Yoo, K. Y., Hirvonen, A., Kang, D. (2005).

Genetic polymorphisms of SULT1A1 and SULT1E1 and the risk and survival of

146

breast cancer. Cancer Epidemiol Biomarkers Prev, 14(5), 1090-1095.

doi:10.1158/1055-9965.EPI-04-0688

Clayton, E. M., Todd, M., Dowd, J. B., & Aiello, A. E. (2011). The impact of bisphenol

A and triclosan on immune parameters in the U.S. population, NHANES 2003-

2006. Environ Health Perspect, 119(3), 390-396. doi:10.1289/ehp.1002883

Cohen, S., Laitman, Y., Kaufman, B., Milgrom, R., Nir, U., & Friedman, E. (2009).

SULT1E1 and ID2 genes as candidates for inherited predisposition to breast and

ovarian cancer in Jewish women. Fam Cancer, 8(2), 135-144.

doi:10.1007/s10689-008-9218-4

Daniels, J., & Kadlubar, S. (2013). Sulfotransferase genetic variation: from cancer risk to

treatment response. Drug Metab Rev, 45(4), 415-422.

doi:10.3109/03602532.2013.835621

Dhillon, G. S., Kaur, S., Pulicharla, R., Brar, S. K., Cledon, M., Verma, M., &

Surampalli, R. Y. (2015). Triclosan: current status, occurrence, environmental

risks and bioaccumulation potential. Int J Environ Res Public Health, 12(5),

5657-5684. doi:10.3390/ijerph120505657

Falany C, R. J. (1992). In E. H. Jeffery (Ed.), Human Drug Metabolism: From Molecular

Biology to Man (pp. 101-115): CRC-Press.

Feng, Y., Zhang, P., Zhang, Z., Shi, J., Jiao, Z., & Shao, B. (2016). Endocrine Disrupting

Effects of Triclosan on the Placenta in Pregnant Rats. PLoS One, 11(5),

e0154758. doi:10.1371/journal.pone.0154758

Foran, C. M., Bennett, E. R., & Benson, W. H. (2000). Developmental evaluation of a

potential non-steroidal estrogen: triclosan. Mar Environ Res, 50(1-5), 153-156. 147

Gee, R. H., Charles, A., Taylor, N., & Darbre, P. D. (2008). Oestrogenic and androgenic

activity of triclosan in breast cancer cells. J Appl Toxicol, 28(1), 78-91.

doi:10.1002/jat.1316

Geens, T., Neels, H., & Covaci, A. (2012). Distribution of bisphenol-A, triclosan and n-

nonylphenol in human adipose tissue, liver and brain. Chemosphere, 87(7), 796-

802. doi:10.1016/j.chemosphere.2012.01.002

Mulder G. J., Jakoby W. B. (1990). Sulfation in conjugation reactions, in: Mulder GJ,

Jakoby WB, (Ed.), Drug Metabolism, Taylor and Francis, London, pp. 107-161.

Hirata, H., Hinoda, Y., Okayama, N., Suehiro, Y., Kawamoto, K., Kikuno, N., Rabban, J.

T., Chen, L. M., Dahiya, R. (2008). CYP1A1, SULT1A1, and SULT1E1

polymorphisms are risk factors for endometrial cancer susceptibility. Cancer,

112(9), 1964-1973. doi:10.1002/cncr.23392

Honkisz, E., Zieba-Przybylska, D., & Wojtowicz, A. K. (2012). The effect of triclosan on

hormone secretion and viability of human choriocarcinoma JEG-3 cells. Reprod

Toxicol, 34(3), 385-392. doi:10.1016/j.reprotox.2012.05.094

Hui, Y., & Liu, M. C. (2015). Sulfation of ritodrine by the human cytosolic

sulfotransferases (SULTs): Effects of SULT1A3 genetic polymorphism. Eur J

Pharmacol, 761, 125-129. doi:10.1016/j.ejphar.2015.04.039

James, M. O., Li, W., Summerlot, D. P., Rowland-Faux, L., & Wood, C. E. (2010).

Triclosan is a potent inhibitor of estradiol and estrone sulfonation in sheep

placenta. Environ Int, 36(8), 942-949. doi:10.1016/j.envint.2009.02.004

James, M. O., Marth, C. J., & Rowland-Faux, L. (2012). Slow O-demethylation of methyl

triclosan to triclosan, which is rapidly glucuronidated and sulfonated in channel 148

catfish liver and intestine. Aquat Toxicol, 124-125, 72-82.

doi:10.1016/j.aquatox.2012.07.009

Jones, R. D., Jampani, H. B., Newman, J. L., & Lee, A. S. (2000). Triclosan: a review of

effectiveness and safety in health care settings. Am J Infect Control, 28(2), 184-

196.

Koeppe, E. S., Ferguson, K. K., Colacino, J. A., & Meeker, J. D. (2013). Relationship

between urinary triclosan and paraben concentrations and serum thyroid measures

in NHANES 2007-2008. Sci Total Environ, 445-446, 299-305.

doi:10.1016/j.scitotenv.2012.12.052

Kushida, A., Hattori, K., Yamaguchi, N., Kobayashi, T., Date, A., & Tamura, H. (2011).

Sulfation of estradiol in human epidermal keratinocyte. Biol Pharm Bull, 34(7),

1147-1151.

Moss, T., Howes, D., & Williams, F. M. (2000). Percutaneous penetration and dermal

metabolism of triclosan (2,4, 4'-trichloro-2'-hydroxydiphenyl ether). Food Chem

Toxicol, 38(4), 361-370.

Olaniyan, L. W., Mkwetshana, N., & Okoh, A. I. (2016). Triclosan in water, implications

for human and environmental health. Springerplus, 5(1), 1639.

doi:10.1186/s40064-016-3287-x

Paul, K. B., Hedge, J. M., Bansal, R., Zoeller, R. T., Peter, R., DeVito, M. J., & Crofton,

K. M. (2012). Developmental triclosan exposure decreases maternal, fetal, and

early neonatal thyroxine: a dynamic and kinetic evaluation of a putative mode-of-

action. Toxicology, 300(1-2), 31-45. doi:10.1016/j.tox.2012.05.023

149

Perencevich, E. N., Wong, M. T., & Harris, A. D. (2001). National and regional

assessment of the antibacterial soap market: a step toward determining the impact

of prevalent antibacterial soaps. Am J Infect Control, 29(5), 281-283.

Philippat, C., Botton, J., Calafat, A. M., Ye, X., Charles, M. A., Slama, R., & Group, E.

S. (2014). Prenatal exposure to phenols and growth in boys. Epidemiology, 25(5),

625-635. doi:10.1097/EDE.0000000000000132