DOCSLIB.ORG

Target-Focused Libraries from Otava

Total Page：16

File Type：pdf, Size：1020Kb

Download full-text PDF Read full-text
Target-Focused Libraries from Otava December 2008 www.otavachemicals.com TARGET-FOCUSED LIBRARIES FROM OTAVA more information, quotes and ordering, please send an e-mail to [email protected] or [email protected] OTAVA, North American Division, 55 Ellerslie Ave., Suite 524, Toronto, ON, M2N 1X9, CANADA Tel.: 1-416-305-9979, Fax: 1-866-881-9921 (Toll-free in US & Canada) Target Focused Libraries Table of Contents Receptor-Based Target-Focused Libraries Building Receptor-Based Target-Focused Libraries 2 Human Protein Kinase CK2 Inhibitors: OTAVA's Approach in Action 4 Kinase Inhibitor Candidates ERK2 (Extracellular Signal-Regulated Kinase 2) 5 DAPK2 (Death-Associated Protein Kinase 2) 6 p38 MAPK (p38 MAP Kinase Alpha) 7 JAK2 (Janus Kinase 2) 8 PI3K (Phosphatidylinositol 3-Kinase) 9 PDK-1 (3-Phosphoinositide-Dependent Kinase-1) 10 CDK2 (Cyclin-Dependent Kinase 2) 11 GSK3 (Glycogen Synthase Kinase-3) 12 FGFR1K (Fibroblast Growth Factor Receptor 1 Tyrosine Kinase) 13 PKA (cAMP-Dependent Protein Kinase) 14 AURKB (Aurora B Kinase) 15 VEGFR2 (Vascular Endothelial Growth Factor Receptor-2 Kinase) 16 Hydrolase Inhibitor Candidates Acetylcholinesterase 17 Phospholipase A2 18 Other Inhibitor Candidates Estrogen Receptor 19 Receptor-Based Target-Focused Libraries: Preparation on request List of OTAVA's Receptor-Based Target-Focused Libraries you may request for 22 Ligand-Based Target-Focused Libraries Building Ligand-Based Target-Focused Libraries 24 List of OTAVA's Ligand-Based Target-Focused Libraries 26 Ligand-Based Target-Focused Libraries (EXAMPLES) Lipid Signaling Inhibitor Candidates 34 Phosphorylation/Dephosphorylation Inhibitor Candidates 35 Phosphodiesterase Inhibitor Candidates 36 Protease inhibitors 37 Reductase inhibitors 38 For more information please send an e-mail to [email protected] or, for quotes and ordering, to [email protected] OTAVA - North American Division: 15 Dundonald St., Suite 1902, Toronto, ON, M4Y 1K4, Canada; Tel.: 1-416-305-9979, Fax: 1-866-881-9921 (Toll-free in US & Canada) Target Focused Libraries Receptor-Based Target-Focused Libraries For more information please send an e-mail to [email protected] or, for quotes and ordering, to [email protected] OTAVA - North American Division: 15 Dundonald St., Suite 1902, Toronto, ON, M4Y 1K4, Canada; Tel.: 1-416-305-9979, Fax: 1-866-881-9921 (Toll-free in US & Canada) 1 Receptor-Based Target-Focused Libraries OTAVA's Approach Building Receptor-Based Target-Focused Libraries During the early stages of drug development, it is often necessary to perform in silico screening of large numbers of small molecules. The aim is to find the most active members from a stock collection that are to be subjected to in vitro evaluation. The result is a library of molecules that possesses significant activity. The quality of the library, however, can only be as good as the screening method used. It is quality that OTAVA wants to bring to its customers. Our Receptor-Based Target-Focused libraries are created from an extensive stock collection, and a rigorous process of refinement that involves harnessing the most current methods of theoretical medicinal chemistry. Design of Receptor-Based focused libraries. OTAVA's Receptor-Based Target-Focused This approach was employed for each of libraries are generated through a unique OTAVA’s Receptor-Based Target-Focused libraries. approach. First, the stock collection is filtered according to the Lipinski and Veber rules: CLogP from 0 to 5 MW from 160 to 500 number of H-donors from 0 to 5 number of H-acceptors from 0 to 9 number of NO2 groups from 0 to 2 number of rotatable bonds from 0 to 10 For more information please send an e-mail to [email protected] or, for quotes and ordering, to [email protected] OTAVA - North American Division: 15 Dundonald St., Suite 1902, Toronto, ON, M4Y 1K4, Canada; Tel.: 1-416-305-9979, Fax: 1-866-881-9921 (Toll-free in US & Canada) 2 Receptor-Based Target-Focused Libraries OTAVA's Approach Building Receptor-Based Target-Focused Libraries, continued OTAVA's approach uses Sharp Focusing: each molecule's interaction is measured with only a single target in a protein family. The target's X-ray crystallography data is thus incorporated. Next, after preprocessing, the molecules are individually docked. Flexible molecular docking is the core of OTAVA's approach. After docking the ligand, a re-scoring algorithm is applied. This re-scoring procedure involves correcting the final summation of interaction Ligand in Aurora B active site. energies (the score) according to the ligand's Docking example from the OTAVA Aurora structural features. B Kinase Receptor-Based Target-Focused Finally, each docking complex is scanned for key library. contacts: H-bonds formed between the ligand and The detection of H-bonds between the critical amino acid residues in the protein's active ligand and a key Aurora B residue site. This detailed analysis of each docked (Ala173) was used in preparation of the library. protein-ligand complex is critical to OTAVA's approach. Our libraries, created this way, are expected to have a higher probability of interacting with potential drug targets. All of the Receptor-Based Target-Focused libraries in this catalogue are available upon request, and come with docking scores and values for drug-like properties. For more information please send an e-mail to [email protected] or, for quotes and ordering, to [email protected] OTAVA - North American Division: 15 Dundonald St., Suite 1902, Toronto, ON, M4Y 1K4, Canada; Tel.: 1-416-305-9979, Fax: 1-866-881-9921 (Toll-free in US & Canada) 3 Receptor-Based Target-Focused Libraries OTAVA's Approach Human Protein Kinase CK2 Inhibitors: OTAVA's Approach in Action Protein kinase CK2 is a molecule that participates in the development of some cancers, viral infections and inflammatory failures. As such, small organic inhibitors of CK2, besides application in scientific research, may have therapeutic significance. In our recent Journal of Medicinal Chemistry paper (see ref. below) we presented a new class of CK2 inhibitors: 3-carboxy-4(1H)-quinolones. This class of inhibitors was discovered through receptor-based virtual screening of the OTAVA 70,000-compound library. According to theoretical calculations and 3D representation of the structural experimental data, a structural model describing the model that characterizes binding key features of 3-carboxy-4(1H)-quinolones features of the inhibitors (A) and (B). responsible for tight binding to the CK2 active site The most important intermolecular and was developed. Docking and molecular dynamics intramolecular hydrogen bonds are represented as dashed lines. The CK2 studies allowed us to propose a binding mode in amino acid residues involved in key which the key interactions were hydrogen bonds hydrophobic interactions with the ligand between the ligand's 3-carboxy group and the two are indicated as well. residues (Lys68 and Asp175) in the CK2 ATP-binding cleft, as well as hydrophobic contacts with Val66, Ile174, and Phe113. The resulting model correlated well with X-ray data for the complex CK2-IQA. It was revealed that the most active compounds — 5,6,8-trichloro-4-oxo-1,4-dihydroquinoline-3- carboxylic acid (A) (IC = 0.3 µM) and 4-oxo-1,4- Ref.: Evaluation of 3-Carboxy-4(1H)-quinolones as 50 Inhibitors of Human Protein Kinase CK2. dihydrobenzo[h]quinoline-3-carboxylic acid (B) (IC50 Golub, A.G., Yakovenko, O.Ya., Bdzhola, = 1 µM) — were ATP competitive (K values were V.G., Sapelkin, V.M., Zien, P., and Yarmoluk, i S.M. J. Med. Chem., 2006, 10.1021/jm050048t 0.06 and 0.28 µM, respectively). In vitro evaluation of http://dx.doi.org/10.1021/jm050048t the inhibitors on seven protein kinases demonstrated considerable selectivity toward CK2. For more information please send an e-mail to [email protected] or, for quotes and ordering, to [email protected] OTAVA - North American Division: 15 Dundonald St., Suite 1902, Toronto, ON, M4Y 1K4, Canada; Tel.: 1-416-305-9979, Fax: 1-866-881-9921 (Toll-free in US & Canada) 4 Receptor-Based Target-Focused Libraries Kinase Inhibitors Extracellular Signal- NEW! Regulated Kinase 2 Extracellular signal-regulated kinase 2 (ERK2) has become an attractive target for the development of therapeutics for the treatment of cancer. Eight new inhibitors of ERK2 by means of a drug design protocol involving the virtual screening with docking simulations and in vitro enzyme assay were recently identified. The newly discovered inhibitors can be categorized into three structural classes and reveal a significant potency with IC50 values ranging from 1 to 30 μM. Ref.: Park H, Bahn YJ, Jeong DG, Woo EJ, Kwon JS, Ryu SE. Identification of novel inhibitors of extracellular signal-regulated kinase 2 based on the structure-based virtual screening. Bioorg Med Chem Lett. 2008 Oct 15;18(20):5372-6. Number of Product Description Target Source Input Libraries Compounds Extracellular Signal- 2053 Extracellular Homo sapiens OTAVA Stock Collection Regulated Kinase 2 Signal-Regulated + Life Chemicals Stock focused library Kinase 2 Collection 500,000 compounds For more information please send an e-mail to [email protected] or, for quotes and ordering, to [email protected] OTAVA - North American Division: 15 Dundonald St., Suite 1902, Toronto, ON, M4Y 1K4, Canada; Tel.: 1-416-305-9979, Fax: 1-866-881-9921 (Toll-free in US & Canada) 5 Receptor-Based Target-Focused Libraries Kinase Inhibitors Death-Associated Protein Kinase 2 Death associated protein kinase (DAPK) is a calmodulin (CaM)-regulated serine/threonine protein kinase implicated in diverse apoptosis pathways, including those involved in neuronal cell death and tumour suppression. The requirement of DAPK catalytic activity for its proposed cell functions and the validation of protein kinases as therapeutic targets demand that DAPK be examined as a potential therapeutic target in human disease. The current body of knowledge raises the possibility of DAPK as a therapeutic target for diseases characterised by rapid neurodegeneration, such as stroke or traumatic brain injury.
Load more

Recommended publications
  • Supplemental Information to Mammadova-Bach Et Al., “Laminin Α1 Orchestrates VEGFA Functions in the Ecosystem of Colorectal Carcinogenesis”
    Supplemental information to Mammadova-Bach et al., “Laminin α1 orchestrates VEGFA functions in the ecosystem of colorectal carcinogenesis” Supplemental material and methods Cloning of the villin-LMα1 vector The plasmid pBS-villin-promoter containing the 3.5 Kb of the murine villin promoter, the first non coding exon, 5.5 kb of the first intron and 15 nucleotides of the second villin exon, was generated by S. Robine (Institut Curie, Paris, France). The EcoRI site in the multi cloning site was destroyed by fill in ligation with T4 polymerase according to the manufacturer`s instructions (New England Biolabs, Ozyme, Saint Quentin en Yvelines, France). Site directed mutagenesis (GeneEditor in vitro Site-Directed Mutagenesis system, Promega, Charbonnières-les-Bains, France) was then used to introduce a BsiWI site before the start codon of the villin coding sequence using the 5’ phosphorylated primer: 5’CCTTCTCCTCTAGGCTCGCGTACGATGACGTCGGACTTGCGG3’. A double strand annealed oligonucleotide, 5’GGCCGGACGCGTGAATTCGTCGACGC3’ and 5’GGCCGCGTCGACGAATTCACGC GTCC3’ containing restriction site for MluI, EcoRI and SalI were inserted in the NotI site (present in the multi cloning site), generating the plasmid pBS-villin-promoter-MES. The SV40 polyA region of the pEGFP plasmid (Clontech, Ozyme, Saint Quentin Yvelines, France) was amplified by PCR using primers 5’GGCGCCTCTAGATCATAATCAGCCATA3’ and 5’GGCGCCCTTAAGATACATTGATGAGTT3’ before subcloning into the pGEMTeasy vector (Promega, Charbonnières-les-Bains, France). After EcoRI digestion, the SV40 polyA fragment was purified with the NucleoSpin Extract II kit (Machery-Nagel, Hoerdt, France) and then subcloned into the EcoRI site of the plasmid pBS-villin-promoter-MES. Site directed mutagenesis was used to introduce a BsiWI site (5’ phosphorylated AGCGCAGGGAGCGGCGGCCGTACGATGCGCGGCAGCGGCACG3’) before the initiation codon and a MluI site (5’ phosphorylated 1 CCCGGGCCTGAGCCCTAAACGCGTGCCAGCCTCTGCCCTTGG3’) after the stop codon in the full length cDNA coding for the mouse LMα1 in the pCIS vector (kindly provided by P.
    [Show full text]
  • Gene Symbol Gene Description ACVR1B Activin a Receptor, Type IB
    Table S1. Kinase clones included in human kinase cDNA library for yeast two-hybrid screening Gene Symbol Gene Description ACVR1B activin A receptor, type IB ADCK2 aarF domain containing kinase 2 ADCK4 aarF domain containing kinase 4 AGK multiple substrate lipid kinase;MULK AK1 adenylate kinase 1 AK3 adenylate kinase 3 like 1 AK3L1 adenylate kinase 3 ALDH18A1 aldehyde dehydrogenase 18 family, member A1;ALDH18A1 ALK anaplastic lymphoma kinase (Ki-1) ALPK1 alpha-kinase 1 ALPK2 alpha-kinase 2 AMHR2 anti-Mullerian hormone receptor, type II ARAF v-raf murine sarcoma 3611 viral oncogene homolog 1 ARSG arylsulfatase G;ARSG AURKB aurora kinase B AURKC aurora kinase C BCKDK branched chain alpha-ketoacid dehydrogenase kinase BMPR1A bone morphogenetic protein receptor, type IA BMPR2 bone morphogenetic protein receptor, type II (serine/threonine kinase) BRAF v-raf murine sarcoma viral oncogene homolog B1 BRD3 bromodomain containing 3 BRD4 bromodomain containing 4 BTK Bruton agammaglobulinemia tyrosine kinase BUB1 BUB1 budding uninhibited by benzimidazoles 1 homolog (yeast) BUB1B BUB1 budding uninhibited by benzimidazoles 1 homolog beta (yeast) C9orf98 chromosome 9 open reading frame 98;C9orf98 CABC1 chaperone, ABC1 activity of bc1 complex like (S. pombe) CALM1 calmodulin 1 (phosphorylase kinase, delta) CALM2 calmodulin 2 (phosphorylase kinase, delta) CALM3 calmodulin 3 (phosphorylase kinase, delta) CAMK1 calcium/calmodulin-dependent protein kinase I CAMK2A calcium/calmodulin-dependent protein kinase (CaM kinase) II alpha CAMK2B calcium/calmodulin-dependent
    [Show full text]
  • Reframing Psychiatry for Precision Medicine
    Reframing Psychiatry for Precision Medicine Elizabeth B Torres 1,2,3* 1 Rutgers University Department of Psychology; [email protected] 2 Rutgers University Center for Cognitive Science (RUCCS) 3 Rutgers University Computer Science, Center for Biomedicine Imaging and Modelling (CBIM) * Correspondence: [email protected]; Tel.: (011) +858-445-8909 (E.B.T) Supplementary Material Sample Psychological criteria that sidelines sensory motor issues in autism: The ADOS-2 manual [1, 2], under the “Guidelines for Selecting a Module” section states (emphasis added): “Note that the ADOS-2 was developed for and standardized using populations of children and adults without significant sensory and motor impairments. Standardized use of any ADOS-2 module presumes that the individual can walk independently and is free of visual or hearing impairments that could potentially interfere with use of the materials or participation in specific tasks.” Sample Psychiatric criteria from the DSM-5 [3] that does not include sensory-motor issues: A. Persistent deficits in social communication and social interaction across multiple contexts, as manifested by the following, currently or by history (examples are illustrative, not exhaustive, see text): 1. Deficits in social-emotional reciprocity, ranging, for example, from abnormal social approach and failure of normal back-and-forth conversation; to reduced sharing of interests, emotions, or affect; to failure to initiate or respond to social interactions. 2. Deficits in nonverbal communicative behaviors used for social interaction, ranging, for example, from poorly integrated verbal and nonverbal communication; to abnormalities in eye contact and body language or deficits in understanding and use of gestures; to a total lack of facial expressions and nonverbal communication.
    [Show full text]
  • PI4K-Beta and MKNK1 Are Regulators of Hepatitis C Virus
    www.nature.com/scientificreports OPEN PI4K-beta and MKNK1 are regulators of hepatitis C virus IRES-dependent translation Received: 26 March 2015 1,2 3 4 4 Accepted: 22 July 2015 Joachim Lupberger , Claudia Casanova , Benoit Fischer , Amelie Weiss , 1,2 1,2 5 4 4 Published: 01 September 2015 Isabel Fofana , Nelly Fontaine , Toshinobu Fujiwara , Mickael Renaud , Arnaud Kopp , Catherine Schuster1,2, Laurent Brino4, Thomas F. Baumert1,2,6 & Christian Thoma3 Cellular translation is down-regulated by host antiviral responses. Picornaviridae and Flaviviridae including hepatitis C virus (HCV) evade this process using internal ribosomal entry sequences (IRESs). Although HCV IRES translation is a prerequisite for HCV replication, only few host factors critical for IRES activity are known and the global regulator network remains largely unknown. Since signal transduction is an import regulator of viral infections and the host antiviral response we combined a functional RNAi screen targeting the human signaling network with a HCV IRES-specific reporter mRNA assay. We demonstrate that the HCV host cell cofactors PI4K and MKNK1 are positive regulators of HCV IRES translation representing a novel pathway with a functional relevance for the HCV life cycle and IRES-mediated translation of viral RNA. Hepatitis C virus (HCV) is a positive stranded RNA virus replicating in intracellular phospholipid-enriched membrane domains. Several unbiased RNAi screens identified a panel of host factors required for HCV entry, replication and assembly1–4 but none of these previous approaches discriminates effects on mRNA translation. Host protein translation is initiated with the recruitment of the 40S ribosomal subunit to mRNA. This process mostly involves the recognition of a 5′ m7GpppN cap structure by eIF4E of the cap binding complex eIF4F5.
    [Show full text]
  • Brief Genetics Report Haplotype Structures and Large
    Brief Genetics Report Haplotype Structures and Large-Scale Association Testing of the 5؅ AMP-Activated Protein Kinase Genes PRKAA2, PRKAB1, and PRKAB2 With Type 2 Diabetes Maria W. Sun,1,2 Jennifer Y. Lee,1,2 Paul I.W. de Bakker,1,2,3 Noe¨l P. Burtt,2 Peter Almgren,4 Lennart Råstam,5 Tiinamaija Tuomi,6 Daniel Gaudet,7 Mark J. Daly,2,8 Joel N. Hirschhorn,2,3,9 David Altshuler,1,2,3,8,10 Leif Groop,4,6 and Jose C. Florez1,2,8,10 AMP-activated protein kinase (AMPK) is a key molecular plasma glucose, or insulin sensitivity. Several nominal asso- regulator of cellular metabolism, and its activity is induced ciations of variants in PRKAA2 and PRKAB1 with BMI appear by both metformin and thiazolidinedione antidiabetic med- to be consistent with statistical noise. Diabetes 55:849–855, ications. It has therefore been proposed both as a putative 2006 agent in the pathophysiology of type 2 diabetes and as a valid target for therapeutic intervention. Thus, the genes that encode the various AMPK subunits are intriguing ype 2 diabetes arises from the complex interplay candidates for the inherited basis of type 2 diabetes. We therefore set out to test for the association of common of various pathophysiologic mechanisms involv- variants in the genes that encode three selected AMPK ing peripheral insulin resistance and relative subunits with type 2 diabetes and related phenotypes. Of Tinsulin insufficiency. The final expression of the the seven genes that encode AMPK isoforms, we initially diabetic phenotype is strongly influenced by inheritance; chose PRKAA2, PRKAB1, and PRKAB2 because of their however, with the exception of rare monogenic forms of higher prior probability of association with type 2 diabetes, diabetes, common type 2 diabetes is thought to have a based on previous reports of genetic linkage, functional polygenic architecture (1).
    [Show full text]
  • Coupling of Autism Genes to Tissue-Wide Expression and Dysfunction of Synapse, Calcium Signalling and Transcriptional Regulation
    PLOS ONE RESEARCH ARTICLE Coupling of autism genes to tissue-wide expression and dysfunction of synapse, calcium signalling and transcriptional regulation 1 2,3 4 1,5 Jamie ReillyID *, Louise Gallagher , Geraldine Leader , Sanbing Shen * 1 Regenerative Medicine Institute, School of Medicine, Biomedical Science Building, National University of a1111111111 Ireland (NUI) Galway, Galway, Ireland, 2 Discipline of Psychiatry, School of Medicine, Trinity College Dublin, Dublin, Ireland, 3 Trinity Translational Medicine Institute, Trinity Centre for Health SciencesÐTrinity College a1111111111 Dublin, St. James's Hospital, Dublin, Ireland, 4 Irish Centre for Autism and Neurodevelopmental Research a1111111111 (ICAN), Department of Psychology, National University of Ireland (NUI) Galway, Galway, Ireland, a1111111111 5 FutureNeuro Research Centre, Royal College of Surgeons in Ireland (RCSI), Dublin, Ireland a1111111111 * [email protected] (JR); [email protected] (SS) Abstract OPEN ACCESS Citation: Reilly J, Gallagher L, Leader G, Shen S Autism Spectrum Disorder (ASD) is a heterogeneous disorder that is often accompanied (2020) Coupling of autism genes to tissue-wide with many co-morbidities. Recent genetic studies have identified various pathways from expression and dysfunction of synapse, calcium hundreds of candidate risk genes with varying levels of association to ASD. However, it is signalling and transcriptional regulation. PLoS ONE unknown which pathways are specific to the core symptoms or which are shared by the co- 15(12): e0242773. https://doi.org/10.1371/journal. pone.0242773 morbidities. We hypothesised that critical ASD candidates should appear widely across dif- ferent scoring systems, and that comorbidity pathways should be constituted by genes Editor: Nirakar Sahoo, The University of Texas Rio Grande Valley, UNITED STATES expressed in the relevant tissues.
    [Show full text]
  • N-Glycan Trimming in the ER and Calnexin/Calreticulin Cycle
    Neurotransmitter receptorsGABA and A postsynapticreceptor activation signal transmission Ligand-gated ion channel transport GABAGABA Areceptor receptor alpha-5 alpha-1/beta-1/gamma-2 subunit GABA A receptor alpha-2/beta-2/gamma-2GABA receptor alpha-4 subunit GABAGABA receptor A receptor beta-3 subunitalpha-6/beta-2/gamma-2 GABA-AGABA receptor; A receptor alpha-1/beta-2/gamma-2GABA receptoralpha-3/beta-2/gamma-2 alpha-3 subunit GABA-A GABAreceptor; receptor benzodiazepine alpha-6 subunit site GABA-AGABA-A receptor; receptor; GABA-A anion site channel (alpha1/beta2 interface) GABA-A receptor;GABA alpha-6/beta-3/gamma-2 receptor beta-2 subunit GABAGABA receptorGABA-A receptor alpha-2receptor; alpha-1 subunit agonist subunit GABA site Serotonin 3a (5-HT3a) receptor GABA receptorGABA-C rho-1 subunitreceptor GlycineSerotonin receptor subunit3 (5-HT3) alpha-1 receptor GABA receptor rho-2 subunit GlycineGlycine receptor receptor subunit subunit alpha-2 alpha-3 Ca2+ activated K+ channels Metabolism of ingested SeMet, Sec, MeSec into H2Se SmallIntermediateSmall conductance conductance conductance calcium-activated calcium-activated calcium-activated potassium potassium potassiumchannel channel protein channel protein 2 protein 1 4 Small conductance calcium-activatedCalcium-activated potassium potassium channel alpha/beta channel 1 protein 3 Calcium-activated potassiumHistamine channel subunit alpha-1 N-methyltransferase Neuraminidase Pyrimidine biosynthesis Nicotinamide N-methyltransferase Adenosylhomocysteinase PolymerasePolymeraseHistidine basic
    [Show full text]
  • Profiling Data
    Compound Name DiscoveRx Gene Symbol Entrez Gene Percent Compound Symbol Control Concentration (nM) JNK-IN-8 AAK1 AAK1 69 1000 JNK-IN-8 ABL1(E255K)-phosphorylated ABL1 100 1000 JNK-IN-8 ABL1(F317I)-nonphosphorylated ABL1 87 1000 JNK-IN-8 ABL1(F317I)-phosphorylated ABL1 100 1000 JNK-IN-8 ABL1(F317L)-nonphosphorylated ABL1 65 1000 JNK-IN-8 ABL1(F317L)-phosphorylated ABL1 61 1000 JNK-IN-8 ABL1(H396P)-nonphosphorylated ABL1 42 1000 JNK-IN-8 ABL1(H396P)-phosphorylated ABL1 60 1000 JNK-IN-8 ABL1(M351T)-phosphorylated ABL1 81 1000 JNK-IN-8 ABL1(Q252H)-nonphosphorylated ABL1 100 1000 JNK-IN-8 ABL1(Q252H)-phosphorylated ABL1 56 1000 JNK-IN-8 ABL1(T315I)-nonphosphorylated ABL1 100 1000 JNK-IN-8 ABL1(T315I)-phosphorylated ABL1 92 1000 JNK-IN-8 ABL1(Y253F)-phosphorylated ABL1 71 1000 JNK-IN-8 ABL1-nonphosphorylated ABL1 97 1000 JNK-IN-8 ABL1-phosphorylated ABL1 100 1000 JNK-IN-8 ABL2 ABL2 97 1000 JNK-IN-8 ACVR1 ACVR1 100 1000 JNK-IN-8 ACVR1B ACVR1B 88 1000 JNK-IN-8 ACVR2A ACVR2A 100 1000 JNK-IN-8 ACVR2B ACVR2B 100 1000 JNK-IN-8 ACVRL1 ACVRL1 96 1000 JNK-IN-8 ADCK3 CABC1 100 1000 JNK-IN-8 ADCK4 ADCK4 93 1000 JNK-IN-8 AKT1 AKT1 100 1000 JNK-IN-8 AKT2 AKT2 100 1000 JNK-IN-8 AKT3 AKT3 100 1000 JNK-IN-8 ALK ALK 85 1000 JNK-IN-8 AMPK-alpha1 PRKAA1 100 1000 JNK-IN-8 AMPK-alpha2 PRKAA2 84 1000 JNK-IN-8 ANKK1 ANKK1 75 1000 JNK-IN-8 ARK5 NUAK1 100 1000 JNK-IN-8 ASK1 MAP3K5 100 1000 JNK-IN-8 ASK2 MAP3K6 93 1000 JNK-IN-8 AURKA AURKA 100 1000 JNK-IN-8 AURKA AURKA 84 1000 JNK-IN-8 AURKB AURKB 83 1000 JNK-IN-8 AURKB AURKB 96 1000 JNK-IN-8 AURKC AURKC 95 1000 JNK-IN-8
    [Show full text]
  • Regulation of Skeletal Muscle Metabolism and Development by Small, Non-Coding Rnas: Implications for Insulin Resistance and Type 2 Diabetes Mellitus
    From the Department of Molecular Medicine and Surgery Karolinska Institutet, Stockholm, Sweden Regulation of Skeletal Muscle Metabolism and Development by Small, Non-Coding RNAs: Implications for Insulin Resistance and Type 2 Diabetes Mellitus Rasmus Sjögren Stockholm 2018 All previously published papers were reproduced with permission from the publisher. © 2017 by the American Diabetes Association ® Diabetes 2017 Jul; 66(7): 1807-1818 Reprinted with permission from the American Diabetes Association ® Published by Karolinska Institutet. Printed by Eprint AB, 2018. © Rasmus Sjögren, 2018. ISBN 978-91-7831-057-9 Department of Molecular Medicine and Surgery Regulation of Skeletal Muscle Metabolism and Development by Small, Non-Coding RNAs: Implications for Insulin Resistance and Type 2 Diabetes Mellitus THESIS FOR DOCTORAL DEGREE (Ph.D.) by Rasmus Sjögren Defended on: Wednesday the 13th of June 2018, 12:30 pm Hillarpsalen, Retzius väg 8, Stockholm Principal Supervisor: Opponent: Prof Juleen R. Zierath Prof Markus Stoffel Karolinska Institutet Swiss Federal Institute of Technology in Zurich Department of Molecular Medicine and Surgery Department of Biology Division of Integrative Physiology Division of Metabolism and Metabolic Diseases Co-supervisor(s): Examination Board: Prof Anna Krook Prof Ulf Eriksson Karolinska Institutet Karolinska Insitutet Department of Physiology and Pharmacology Department of Medical Biochemistry and Bio- Division of Integrative Physiology physics Division of Vascular Biology Prof Eckardt Treuter Karolinska Insitutet Department of Biosciences and Nutrition Division of Epigenome Regulation Prof Lena Eliasson Lund University Department of Clinical Sciences, Malmö Division of Islet Cell Exocytosis ABSTRACT microRNAs (miRNAs) are a class of epigenetic post-transcriptional regulators. These short (~22 nucleotides) non-coding RNAs can potently reduce protein abundance through direction of the RNA-induced silencing complex to targeted genes.
    [Show full text]
  • Identification of DNA Response Elements Regulating Expression of CCAAT/Enhancer-Binding Protein (C/EBP) Β and Δ During Early A
    bioRxiv preprint doi: https://doi.org/10.1101/2020.05.22.110114; this version posted May 22, 2020. The copyright holder for this preprint (which was not certified by peer review) is the author/funder, who has granted bioRxiv a license to display the preprint in perpetuity. It is made available under aCC-BY-ND 4.0 International license. Identification of DNA response elements regulating expression of CCAAT/enhancer-binding protein (C/EBP) β and ẟ during early adipogenesis James E. Merrett1,2, Tao Bo1,4, Peter J. Psaltis1,3 and Christopher G. Proud1,2 * 1South Australian Health and Medical Research Institute, Lifelong Health, Adelaide, South Australia, Australia 2University of Adelaide, Department of Molecular and Biomedical Science, Adelaide, South Australia, Australia 3University of Adelaide, Adelaide Medical School, Adelaide, South Australia, Australia 4Shandong-South Australia Joint Laboratory of Metabolic Disease Research, Shandong Provincial Hospital affiliated to Shandong First Medical University *Corresponding author: Christopher Proud E-mail: [email protected] Running title: DNA response elements regulating early adipogenesis Keywords: adipogenesis, adipocyte, cyclic AMP (cAMP), cAMP response element-binding protein (CREB), CCAAT/enhancer-binding protein (C/EBP), glucocorticoid, glucocorticoid receptor, MAPK- interacting kinase (MNK) 1 bioRxiv preprint doi: https://doi.org/10.1101/2020.05.22.110114; this version posted May 22, 2020. The copyright holder for this preprint (which was not certified by peer review) is the author/funder, who has granted bioRxiv a license to display the preprint in perpetuity. It is made available under aCC-BY-ND 4.0 International license. Abstract Given the high and increasing prevalence of obesity and associated disorders, such as type-2 diabetes, it is important to understand the mechanisms that regulate lipid storage and the differentiation of fat cells, a process termed adipogenesis.
    [Show full text]
  • A New Computational Approach to Evaluating Systemic Gene–Gene Interactions in a Pathway Affected by Drug LY294002
    processes Article A New Computational Approach to Evaluating Systemic Gene–Gene Interactions in a Pathway Affected by Drug LY294002 Shinuk Kim College of Kyedang General Education, Sangmyung University, Cheonan 31066, Korea; [email protected]; Tel.: +82-(41)-550-5452; Fax: +82-(41)-550-5439 Received: 14 August 2020; Accepted: 23 September 2020; Published: 1 October 2020 Abstract: In this study, we investigate how drugs systemically affect genes via pathways by integrating information from interactions between chemical compounds and molecular expression datasets, and from pathway information such as gene sets using mathematical models. First, we adopt drug-induced gene expression datasets; then, employ gene set enrichment analysis tools for selecting candidate enrichment pathways; and lastly, implement the inverse algorithm package for identifying gene–gene regulatory networks in a pathway. We tested LY294002-induced datasets of the MCF7 breast cancer cell lines, and found a CELL CYCLE pathway with 101 genes, ERBB signaling pathway consisting of 82 genes, and MTOR pathway consisting of 45 genes. We consider two interactions: quantity strength depending on number of interactions, and quality strength depending on weight of interaction as positive (+) and negative ( ) interactions. Our methods revealed ANAPC1-CDK6 ( 0.412) and − − ORC2L- CHEK1(0.951) for the CELL CYCLE pathway; INS-RPS6 ( 3.125) and PRKAA2-PRKAA2 − (+1.319) for the MTOR pathway; and CBLB-RPS6KB1 ( 0.141), RPS6KB1-CBLC (+0.238) for the ERBB − signaling pathway to be top quality interactions. Top quantity interactions discovered include 12; the CDC ( ,+) gene family for the CELL CYCLE pathway, 20; PIK3 ( ), 23; PIK3CG (+) for the MTOR − − pathway, 11; PAK ( ), 10; PIK3 (+) for the ERBB signaling pathway.
    [Show full text]
  • Gene Expression Profiling of Micrornas Associated with UCA1 in Bladder Cancer Cells
    INTERNATIONAL JOURNAL OF ONCOLOGY 48: 1617-1627, 2016 Gene expression profiling of microRNAs associated with UCA1 in bladder cancer cells XIAOJUAN XIE1,2, JINGJING PAN1, LIQIANG WEI2, SHOUZHEN WU3, HUILIAN HOU4, XU LI3 and WEI CHEN1 1Department of Clinical Laboratory, The First Affiliated Hospital of Xi'an Jiaotong University, Xi'an, Shaanxi 710061; 2Shaanxi Center for Clinical Laboratory, Shaanxi Provincial People's Hospital, Xi'an, Shaanxi 710068; 3Center for Translational Medicine, 4Department of Pathology, The First Affiliated Hospital of Xi'an Jiaotong University, Xi'an, Shaanxi 710061, P.R. China Received November 11, 2015; Accepted December 27, 2015 DOI: 10.3892/ijo.2016.3357 Abstract. Emerging evidence indicates that non-coding and positively correlated with miR-196a, whereas UCA1 and RNAs, such as lncRNAs and microRNAs, play important miR-196a were negatively correlated with p27kip1, which was roles in diverse diseases, such as cancer, immune diseases downregulated in bladder cancer patients. Thus, our findings and cardiovascular diseases. Interestingly, lncRNAs could provided valuable information on miRNAs associated with directly or indirectly regulate the expression of miRNAs. UCA1 in bladder cancer, which could be helpful to further However, the expression profiling of miRNAs associated with explore the related genes and molecular networks fundamental UCA1 in bladder cancer remains unknown. Here, we used in bladder cancer progression. Illumina deep sequencing to sequence miRNA libraries from both the UCA1 knockdown and normal high-expression 5637 Introduction cells. We identified 225 and 235 miRNAs expressed in 5637 cells of normal high-expression and knockdown of UCA1, Recently, emerging studies have demonstrated that 70-90% of respectively.
    [Show full text]