Aquaporin 0 Enhances Gap Junction Coupling Via Its Cell Adhesion Function and Interaction with Connexin 50

Home , Connexin, Gap junction

Research Article 198 Aquaporin 0 enhances gap junction coupling via its cell adhesion function and interaction with connexin 50

Jialu Liu1, Ji Xu2, Sumin Gu1, Bruce J. Nicholson1 and Jean X. Jiang1,* 1Department of Biochemistry and 2Department of Physiology, University of Texas Health Science Center, San Antonio, TX 78229-3900, USA *Author for correspondence ([email protected]) Accepted 16 September 2010 Journal of Cell Science 124, 198-206 © 2011. Published by The Company of Biologists Ltd doi:10.1242/jcs.072652

Summary Both connexin 50 (Cx50) and aquaporin 0 (AQP0) have important roles in lens development and homeostasis, and their mutations are associated with human congenital cataracts. We have previously shown that Cx50 directly interacts with AQP0. Here, we demonstrate the importance of the Cx50 intracellular loop (IL) domain in mediating the interaction with AQP0 in the lens in vivo. AQP0 significantly increased (~20–30%) the intercellular coupling and conductance of Cx50 gap junctions. However, this increase was not observed when the IL domain was replaced with those from other lens connexins. The Cx50–AQP0 interaction had no effect on Cx50 hemichannel function. A fusion protein containing three extracellular loop domains of AQP0 efficiently blocked the cell-to-cell adhesion of AQP0 and attenuated the stimulatory effect of AQP0 on Cx50 gap junction conductance. These data suggest that the specific interaction between Cx50 and AQP0 enhances the coupling of Cx50 gap junctions, but not hemichannels, through the cell adhesion function of AQP0. This result establishes a physiological role of AQP0 in the functional regulation of gap junction channels.

Key words: Gap junction, Connexin, Aquaporin, Hemichannel, Lens, Cell adhesion

Introduction AQP0, also known as lens major intrinsic protein (MIP), is the As an avascular organ, the lens is formed by an anterior epithelial most abundant membrane protein expressed in lens fibers. Although cell layer and highly differentiated fiber cells constituting the bulk it assembles as a tetramer in the lens fiber plasma membrane, each of the lenticular mass. Mitotically active epithelial cells at the lens monomer functions independently as a water channel (Chepelinsky, equator start to differentiate and form new lens fibers, which 2003). Unlike other aquaporins, the water permeability of AQP0 is gradually lose their intracellular nuclei and organelles during lens remarkably low, being 40-times lower than that of the AQP1

Journal of Cell Science development and turn into mature lens fibers with accumulating channel in lens anterior epithelial cells (Zampighi et al., 2002). high concentrations aquaporin 0 (AQP0) and soluble proteins Besides functioning as a water channel, AQP0 is also reported to known as crystallins. The eye lens is dependent upon an extensive have a crucial structural role as an adhesion molecule in mediating network of gap-junction-mediated intercellular communication, a the formation of thin junctions between lens fibers (Engel et al., crucial part of a micro-circulatory system, to compensate for lack 2008; Fotiadis et al., 2000; Kumari and Varadaraj, 2009). In of vasculature and to maintain lens transparency and homeostasis addition, the CT domain of AQP0 has been shown to interact with (Mathias et al., 2007). several proteins, such as calmodulin (Girsch and Peracchia, 1991), Gap junctions are clusters of transmembrane channels connecting lens-specific intermediate filament proteins filensin and CP49 the cytoplasm of adjacent cells, which allow small molecules (Lindsey Rose et al., 2006), as well as two types of -crystallins (Mr≤1 kDa), such as metabolites, ions and second messengers, to (Fan et al., 2004; Fan et al., 2005). Our previous studies have pass through. The structural units of gap junctions are a group of shown that only Cx50, not the other two lens connexins, directly membrane proteins called connexins, which belong to a multigene associates with AQP0 in the differentiating lens fibers (Yu and family consisting of more than 20 members (Mese et al., 2007). Jiang, 2004). The IL domain of Cx50 and the CT domain of AQP0 All connexins have four conserved transmembrane domains and are the two domains responsible for this interaction (Yu et al., two extracellular loop (EL) domains, whereas their intracellular 2005). Cleavage at the IL domain of Cx50 during lens development loop (IL) domains and C-terminal (CT) domains are the most is the possible cause of dissociation of these two proteins in the variable regions. Three major connexins have been identified in mature lens fibers. However, the molecular mechanism and the vertebrate lens. Connexin 43 (Cx43) is mainly localized in the functional importance of the Cx50–AQP0 interaction has been anterior epithelial cells and in the lens bow region along with largely unexplored. Cx50; whereas Cx50 and Cx46 predominantly colocalize in the In this study, we show that the IL domain of Cx50 is important lens fibers and are able to form heteromeric connexons (Jiang and in mediating the interaction with AQP0 in the lens in vivo. Goodenough, 1996). The physiological importance of lens gap Moreover, the Cx50–AQP0 interaction enhances the ability of junctions has been recognized in the past decade through the Cx50 to form functional gap junctions on the cell surface through identification of connexin mutations that cause lens congenital the cell adhesion function of AQP0, but not hemichannels. Together, cataracts in humans and the lens phenotypes displayed in connexin- these results suggest that AQP0 has a specific role in facilitating deficient mouse models (for reviews see Gerido and White, 2004; the function of gap junctions during early lens development, which Gong et al., 2007). is independent of hemichannel function. 199 Journal of Cell Science 124 (2)

Results when compared with the -actin control. To verify that the IL The IL domain of Cx50 facilitates the interaction with domain of Cx50 is essential for the interaction with the CT domain AQP0 in differentiating lens fibers of AQP0, lysates of CEF cells expressing exogenous wild-type or We have previously shown that the IL domain of Cx50 directly chimeric connexins, as well as a RCAS(A) vehicle control were interacts with the CT domain of AQP0 in vitro (Yu et al., 2005). subjected to pull-down assays using the CT domain of AQP0 fused To address whether the IL domain of Cx50 is essential for the to GST as an affinity matrix. A single band was observed in the association of Cx50 with AQP0 in the lens fibers in situ, four precipitated fraction of the AQP0(CT) pull-down from both Cx50 chimeric retroviral constructs containing chick lens connexins with and Cx43*50L, but not from lysates containing other connexins, swapped IL domains (Cx50*46L, Cx50*43L, Cx43*50L and or vehicle-expressing cells (Fig. 1B, lower panel). These results Cx43*46L, each with a short FLAG tag at the C-terminus) were suggest that the IL domain of Cx50 is sufficient to mediate the generated as illustrated in Fig. 1A. The exogenous expression of interaction with AQP0. lens connexins and their chimeric mutants were achieved by To determine whether the IL domain of Cx50 is involved in the infecting lens connexin-deficient chicken embryonic fibroblast association with AQP0 in the chick lens recombinant retroviruses (CEF) cells with recombinant retroviruses. Western blots showed containing exogenous wild-type or chimeric connexins were that Cx50, Cx46, Cx43, Cx50*46L, Cx50*43L, Cx43*50L and introduced into the lens vesicle lumen using microinjection Cx43*46L were all exogenously expressed at comparable levels approaches (Jiang, 2001; Jiang and Goodenough, 1998). Lens development offers a unique time frame in which the lens vesicle is formed with a large central lumen. Immunofluorescence studies showed that exogenous connexins expressed in the chick lens in vivo were primarily localized in the lens fibers with less expression in the lens epithelial cells. Both merged images and quantitative colocalization analysis indicated that Cx50, Cx50*46L, Cx50*43L and Cx43*50L all colocalized well with endogenous AQP0 in the differentiating lens fibers (Fig. 2). This colocalization can be explained by direct interactions with AQP0 through the IL domain of Cx50 (Cx50, Cx43*50L) or by indirect interactions through homomeric or heteromeric oligomerization with endogenous Cx50 (Cx50, Cx50*43L and Cx50*46L). By contrast, exogenous Cx43 and Cx43*46L did not colocalize with endogenous AQP0 and appeared to form different gap junction plaques when compared with endogenous lens fiber connexins. Without the IL domain of Cx50, as well as the capability to interact with endogenous lens fiber connexins, Cx43 and Cx43*46L have no ability to interact with endogenous AQP0 in lens fibers. Together, these results

Journal of Cell Science suggest that the IL domain of Cx50 is important in mediating the interaction between Cx50 and AQP0 in the differentiating lens fibers in vivo.

AQP0 increases Cx50-mediated intercellular communication in CEF cells and paired Xenopus oocytes To determine whether the Cx50–AQP0 interaction has any effect on the function of Cx50 gap junctions, Cx50 and its chimeras were expressed in CEF cells in the absence or presence of AQP0. Coupling levels were assessed by scrape-loading dye transfer with three different types of tracer molecules: Lucifer yellow (LY), Alexa Fluor 488 or Alexa Fluor 594. Rhodamine dextran (RD) Fig. 1. The IL domain of Cx50 is sufficient in mediating the interaction served as a non-transferring control. The extent of dye transfer was with AQP0. (A)Schematic representation of chimeric connexins with quantified by measuring the distance of dye travel from the scrape swapped IL domains. Cx50*46L was generated by fusing Cx50 lacking the IL line. As shown in Fig. 3A,B, CEF cells expressing exogenous domain with the IL from Cx46. Similarly, Cx50*43L was generated by fusing Cx50 plus AQP0 showed an approximately 25% increase in LY Cx50 lacking the IL domain with the IL from Cx43; Cx43*50L was generated transfer over cells expressing Cx50 alone, or other chimeras in the by fusing Cx43 lacking the IL domain with the IL from Cx50, and Cx43*46L absence or presence of AQP0, all of which showed similar coupling was generated by fusing Cx43 lacking the IL domain with the IL from Cx46. levels. A similar result was also obtained when using Alexa Fluor (B)Recombinant retroviruses containing RCAS(A) vehicle (lane 1), Cx50 488/RD (Fig. 3C). Gap junctions formed by Cx50 are reported to (lane 2), Cx46 (lane 3), Cx43 (lane 4), Cx50*46L (lane 5), Cx50*43L (lane 6), be impermeable to Alexa Fluor 594 (M , 759 Da), which is a larger Cx43*50L (lane 7) and Cx43*46L (lane 8) were infected into CEF cells. Six r dye with similar charge and molecular structure as Alexa Fluor 488 days after infection, cell lysates were analyzed by SDS-PAGE and immunoblotted with antibodies against FLAG (upper panel) or -actin (middle (Dong et al., 2006). Consistent with previous reports that Cx50 panel). Glutathione agarose beads conjugated with GST-tagged AQP0(CT) channels are much less permeable to the larger Alexa Fluor 594 were used to pull down proteins from the lysates of infected CEF cells. The (Dong et al., 2006), no Alexa Fluor 594 dye transfer was detected corresponding eluted fractions were immunoblotted with anti-FLAG antibody in CEF cells expressing Cx50 or other chimeric mutants in the (bottom panel). absence or presence of AQP0 (Fig. 3D). A non-invasive parachute AQP0 and Cx50 gap junctions 200

Fig. 2. The IL domain of Cx50 is crucial for the interaction with AQP0 in the differentiating lens fibers. Recombinant retroviruses containing Cx50, Cx43, Cx50*46L, Cx50*43L, Cx43*50L or Cx43*46L were microinjected into chick lens vesicle at stage 18. The injected lenses were dissected out at embryonic day 18 and cryosections of the embedded chick lenses were immunolabeled with antibody against FLAG (green) or against AQP0 (red). The primary antibodies were detected by fluorescein-conjugated anti- mouse IgG for anti-FLAG antibody and Rhodamine- conjugated anti-rabbit IgG for anti- AQP0 antibody. Immunostaining was visualized by confocal fluorescence microscopy. The corresponding merged images (Merged) are shown on the right. Colocalization coefficients between exogenous connexins and endogenous AQP0 were measured on the confocal images by using NIH ImageJ software with the Intensity Correlation Analysis plugin. The data are presented below as mean ± s.e.m. (n6). (***P<0.001 compared with Journal of Cell Science Cx43).

dye transfer approach was further used to complement the scrape- Differences in the rate of channel formation and conductance levels loading studies. This method measures dye transfer through newly of Cx50 and Cx50*43L in the absence of AQP0 probably reflect formed gap junctions between pre-loaded donor cells and unlabeled functional consequences of the chimeric construct, because all recipient cells (Goldberg et al., 1995). Immunofluorescence experiments were conducted in the same oocyte batches to control microscopy with merged images showed the dye transfer emanating for variability between batches. Together, these results suggest that from pre-loaded cells through gap junctions (Fig. 4A). CEF cells the interaction between Cx50 and AQP0 increases Cx50-mediated expressing Cx50 showed a larger increase in calcein transfer in the intercellular coupling, either through assisting the assembly of presence of AQP0 even after a short period of incubation, compared Cx50 gap junctions, inhibition of degradation or regulation of with those expressing Cx50 in the absence of AQP0 or other Cx50 channel gating. chimeric mutants in the presence or absence of AQP0 (Fig. 4B). Cells infected with retroviruses containing RCAS(A) vehicle or AQP0 has little effect on Cx50 hemichannel function AQP0 were used as negative controls because they can not form Cx50 forms functional hemichannels in CEF cells, which can be gap junctions. induced to open by mechanical stimulation (Banks et al., 2009). A The enhancement of Cx50 gap junction coupling by AQP0 was dye-uptake approach was used here to determine the effect of the further confirmed in paired Xenopus oocytes. Paired oocytes were Cx50–AQP0 interaction on Cx50 hemichannel function. analyzed for junctional conductance by the dual voltage-clamp Mechanical stimulation by fluid dropping triggered a significant method. Oocyte pairs expressing Cx50 plus AQP0 exhibited a increase in hemichannel opening in CEF cells expressing Cx50, higher total conductance compared with those expressing Cx50 Cx46, Cx50 plus Cx46, or the chimeric mutant Cx50*46L, alone (Fig. 5A). In addition, the initial establishment of coupling compared with untreated and vehicle controls (Fig. 6). However, was significantly accelerated (evident at 5 hours opposed to >10 hemichannel activities were not significantly affected when any of hours without AQP0), as was the average rate of junction formation. these connexins were co-expressed with AQP0. As a water channel, No significant difference was observed for oocyte pairs expressing AQP0 cannot contribute to ion conductance by itself and does not Cx50*46L in the absence or presence of AQP0 (Fig. 5B). appear to enhance hemichannel function. 201 Journal of Cell Science 124 (2)

Fig. 3. The Cx50–AQP0 interaction enhances Cx50 intercellular gap junction coupling by using scrape-loading dye transfer assay. CEF cells were infected with recombinant retroviruses containing RCAS(A), AQP0, Cx50, Cx50 plus AQP0, Cx46, Cx46 plus AQP0, Cx50*46L, Cx50*46L plus AQP0, Cx50*43L or Cx50*43L plus AQP0. Six days after infection, the scrape- loading dye transfer assay was performed using RD as a tracer dye (A,B,C) and LY (A,B), Alexa Fluor 488 (C) or Alexa Fluor 594 (D) as a transferring dye. The extent of dye transfer was quantified by measuring the distance from scrape lines to the dye front for LY (B), Alexa Fluor 488 (C), Alexa Fluor 594 (D), and RD (B and C). The data are presented as mean ± s.e.m. (n3). (*P<0.05, compared with Cx50).

Inhibition of the cell adhesion function of AQP0 attenuates coupling appears to be mediated through the cell-to-cell adhesion the stimulating effect of AQP0 on Cx50 intercellular function of AQP0 and its specific interaction with Cx50. By coupling stabilizing closer apposition of cells, specifically in domains where

Journal of Cell Science Previous studies have shown that AQP0 not only serves as a water Cx50 connexons are concentrated, docking frequency of connexons channel but also has an important role in the cell adhesion of lens could be enhanced, leading to increased coupling. fibers (Buzhynskyy et al., 2007; Engel et al., 2008). Most recently, Lens development provides a unique time frame in which the cell-to-cell adhesion function of intact AQP0 was clearly exogenous connexins can be introduced in the lens in situ through demonstrated in mouse fibroblast L-cells expressing exogenous retroviral microinjection (Jiang, 2001). Immunostaining results AQP0 using both a novel assay and traditional adhesion assays showed that endogenous AQP0, the most abundant membrane (Kumari and Varadaraj, 2009). To independently assess the role of protein in the lens fibers, is ubiquitously localized on the plasma cell-to-cell adhesion function of AQP0, a GST-tagged fusion protein membranes of lens fiber cells in both bow and core regions of the containing three EL domains of AQP0 was generated (Fig. 7A). embryonic lens. Exogenous Cx50 colocalizes well with endogenous The cell adhesion assay results indicated that this fusion protein AQP0 in the differentiating lens fibers, whereas exogenous Cx43, GST–AQP0(EL) could efficiently reduce the cell adhesiveness which is a lens epithelial connexin, does not colocalize with when AQP0 was expressed (Fig. 7B). Using the parachute dye endogenous AQP0. In accordance with the implication of the Cx50 transfer assay, we demonstrated that the enhancement of Cx50- CL domain in interactions with AQP0, the chimeric mutant mediated intercellular coupling initiated by AQP0 was completely Cx43*50L consistently colocalized with endogenous AQP0 in the blocked by pre-treatment with GST–AQP0(EL) (Fig. 7C). This differentiating lens fibers, whereas the Cx43*46L chimera showed strongly implicates the involvement of cell adhesion function of minimal overlap with AQP0. These results confirm the role of the AQP0 in the enhancement of Cx50-mediated coupling, and is IL domain of Cx50 in the interaction with AQP0 in the consistent with its lack of effect on Cx50 hemichannels. differentiating lens fibers in situ. Other chimeras that do not contain the CL domain of Cx50, or wild-type Cx46, also colocalize with Discussion AQP0 in situ, but this is probably due to oligomerization with In this study, we observed that the IL domain of Cx50 has an endogenous Cx50, which would mediate the association with important role in mediating the interaction with AQP0 in the lens AQP0. in vivo. We also demonstrated that the Cx50–AQP0 interaction We examined the effect of AQP0 on Cx50-mediated intercellular enhances the capability of Cx50 in forming functional lens fiber communication using three different approaches: invasive scrape- gap junction channels. However, this interaction has no effect on loading dye transfer, non-invasive parachute dye transfer and Cx50 hemichannels and does not alter the frequency of channel electrophysiological measurements in the Xenopus oocyte opening (as determined from dye-uptake studies). Indeed, increased expression system. Scrape-loading dye transfer confirmed the AQP0 and Cx50 gap junctions 202

Fig. 4. The Cx50–AQP0 interaction enhances Cx50 intercellular gap junction coupling using parachute dye transfer assay. Six days after infection with recombinant retroviruses containing RCAS(A), AQP0, Cx50, Cx50 plus AQP0, Cx46, Cx46 plus AQP0, Cx50*46L, Cx50*46L plus AQP0, Cx50*43L or Cx50*43L plus AQP0, a time-course analysis of parachute dye transfer assay was performed at different time points after parachute using Dil as a tracer dye and calcein as a transferring dye. (A)Immunofluorescence images show the

Journal of Cell Science calcein transfer emanating from pre-loaded cells through gap junctions into neighboring cells. (B)The extent of dye transfer was quantified by measuring the area of calcein-fluorescence-stained cells and comparing this with the area of DiI-stained cells. The data are presented as mean ± s.e.m. (n3). (*P<0.05 and **P<0.01, compared with Cx50).

selective transfer of LY and Alexa Fluor 488, but not Alexa Fluor allowing exchanges with the extracellular space (Goodenough and 594 through Cx50 channels, as reported previously (Dong et al., Paul, 2003). Cx50 has been reported to form functional 2006). These differences in dye transfer are probably due to the hemichannels in Xenopus oocytes and in transfected HeLa cells selectivity properties of gap junction channels, which can (Beahm and Hall, 2002; Srinivas et al., 2005; Valiunas and distinguish small molecules based on their size, shape and charge Weingart, 2000), which are sensitive to both voltage and mechanical state (Nicholson et al., 2000; Weber et al., 2004). Importantly, this stimulation (Bao et al., 2004). We showed that hemichannels selectivity was not affected by association with AQP0. Scrape- formed by two lens fiber connexins and the corresponding chimera loading results were also confirmed by the less invasive parachute were indeed sensitive to mechanical stimulation, demonstrated by dye-transfer assay. The differences between cells expressing both the dye-uptake assay using fluid dropping (Banks et al., 2009). Cx50 and AQP0 and those expressing only Cx50 were even more However, in contrast to its effect on gap junctions, AQP0 does not dramatic in this assay. This might have resulted from the mode of enhance the ability of Cx50 to form functional hemichannels. measurement (area of dye spread as opposed to linear spread Because the Cx50–AQP0 interaction enhances gap junction distance), but might also be due to the higher dependence of this coupling, but not hemichannel activities, we hypothesize that the assay on gap junction formation. This is consistent with the cell-to-cell adhesion function of AQP0 (Buzhynskyy et al., 2007; electrophysiological measurements in oocytes that also showed Chepelinsky, 2009) serves to increase the proximity of adjacent higher rates of gap junction formation in the presence of AQP0. fiber cells, thus enhancing the probability of gap junction formation. Besides being a component of gap junctions, connexin molecules Given the association between AQP0 and Cx50, this would occur can form functional hemichannels in nonjunctional membranes, selectively at sites where Cx50 connexons are concentrated. This which have a role that is distinct from that of gap junctions by hypothesis was tested using GST–AQP0(EL), a GST-tagged fusion 203 Journal of Cell Science 124 (2)

Fig. 7. A GST-tagged fusion protein containing three EL domains of AQP0 attenuates the increase of Cx50 gap junction coupling induced by AQP0. (A)Schematic illustration of AQP0 and a GST-tagged fusion protein containing all three EL domains of AQP0. GST–AQP0(EL) was generated by fusing all three EL domains of AQP0 with a GST tag at the N-terminus. (B)GST-AQP0(EL) efficiently blocks the cell adhesion of AQP0 on the cell surface. Cell adhesion assay was performed 6 days after CEF cells were Fig. 5. The channel assembly rate and total conductance of Cx50 are infected with recombinant retroviruses containing vehicle or AQP0. Donor increased when coexpressed with AQP0 in paired Xenopus oocytes. cells pre-loaded with DiI were mixed with the GST-tagged fusion proteins and Oocytes were pretreated with Cx38 antisense oligonucleotide. (A)Oocytes parachuted over the unlabeled recipient cells. Plates were washed with PBS to were microinjected with dH2O, Cx50 cRNA or Cx50 plus AQP0 cRNAs, remove non-adherent cells after 1.5-hour incubation. The extent of cell respectively. Gap junction conductance was measured in paired oocytes by adhesion was quantified by measuring the area of DiI-stained cells, which dual voltage clamp (right panel). Oocytes lysates were analyzed by SDS- represent adherent cells. The data are presented as mean ± s.e.m. (n3). PAGE and immunoblotted with antibodies against Cx50, AQP0 or -actin (left (***P<0.001, compared with vehicle). (C)GST–AQP0(EL) offsets the panel). The data are presented as mean ± s.e.m. (n3). (*P<0.05, compared stimulatory effect of AQP0 on Cx50 gap junction coupling. Six days after with Cx50). (B)Oocytes were microinjected with dH2O, Cx50*46L cRNA or infection with recombinant retroviruses containing Cx50, Cx50 plus AQP0, Cx50*46L plus AQP0 cRNAs, respectively. Gap junction conductance was Cx46, or Cx46 plus AQP0, donor cells pre-loaded with calcein were mixed measured in paired oocytes by dual voltage clamp (right panel). Oocytes with the GST fusion proteins and parachuted over the unlabeled recipient cells. lysates were analyzed by SDS-PAGE and immunoblotted with antibodies After incubation for 1.5 hours, the extent of dye transfer was quantified by against Cx50, AQP0 or -actin (left panel). The data are presented as mean ± measuring the area of calcein-stained cells and comparing this with the area of s.e.m. (n3). DiI-stained cells. The data are presented as mean ± s.e.m. (n3) (*P<0.05, compared with Cx50). Journal of Cell Science protein that contains all three EL domains of AQP0. The interaction between the ELs of two apposing AQP0 molecules and/or the crucial in the formation of 11–13 nm thin junctions with extremely interaction between the ELs of AQP0 and the negatively charged narrow intervening spaces between lens fibers (Kumari and lipid molecules of the adjacent cell membrane are proposed to be Varadaraj, 2009). As expected, GST–AQP0(EL) effectively inhibited the cell adhesion of AQP0, and also inhibited the AQP0- induced enhancement of Cx50 coupling. These results suggest that the AQP0-induced enhancement of Cx50 gap junction coupling is likely to be mediated through the cell-to-cell adhesion function of AQP0. As shown in the model (Fig. 8), our data suggest that in the actively differentiating lens fibers, Cx50 forms functional gap junctions as well as hemichannels on the cell surface. These channels could be either homomeric (Cx50 alone) or heteromeric (Cx50 and Cx46). In the presence of AQP0, the C-terminus of AQP0 directly interacts with the intracellular loop of Cx50. Through the cell-to-cell adhesion function of AQP0, which pulls the plasma membranes of apposing cells closer, and its specific interaction with Cx50, more Cx50 connexons on the cell surface are able to Fig. 6. The activity of hemichannels formed by Cx50, Cx46 or chimeric dock with their apposing counterparts from neighboring cells to mutants is not affected by AQP0. CEF cells infected with recombinant form functional gap junctions. Thus AQP0 provides a mechanism retroviruses containing RCAS(A), AQP0, Cx50, Cx46, Cx50*46L or various to selectively enhance the gap junction function of Cx50, while not combinations were cultured at low cell density with minimal physical contact. affecting its role as a hemichannel. Cx50 and AQP0 interaction is After applying mechanical stimulation through fluid dropping, the numbers of cells with LY or RD dye uptake were counted under a fluorescence microscope primarily in the differentiating lens fibers around the lens equator with non-dropping groups as a negative control. The extent of dye uptake was region, where fluid and metabolic wastes are mainly disposed out quantified as a percentage of fluorescent cells divided by the total number of based on the lens microcirculation mechanism (Mathias et al., cells. The data are presented as mean ± s.e.m. (n3). 2007). Previous microscopy studies have shown that the density of AQP0 and Cx50 gap junctions 204

terminus (residues 223–262) and affinity purified as previously described (Jiang et al., 1994). Anti-FLAG monoclonal antibody (F1804) was from Sigma (St Louis, MO). mMESSAGE mMACHINE SP6 kit for in vitro transcription was from Ambion (Austin, TX). Bicinchoninic acid (BCA) microprotein assay kit was purchased from Pierce Chemical (Rockford, IL). Fluorescein-conjugated goat anti-mouse IgG and Rhodamine-conjugated goat anti-rabbit IgG were from Jackson ImmunoResearch (West Grove, PA). Paraformaldehyde (PFA, 16% stock solution) was from Electron Microscopy Science (Fort Washington, PA). Trypsin, tissue culture reagents, Alexa Fluor 488, Alexa Fluor 594, LY, Rhodamine dextran (RD), calcein acetoxymethyl ester and dialkylcarbocyanine dye (DiI) were all obtained from Invitrogen (Carlsbad, CA). PVDF membrane was from Bio-Rad (Hercules, CA). Fetal bovine serum (FBS) was from Hyclone Laboratories (Logan, UT). Vectashield® fluorescence mounting medium was from Vector Laboratories (Burlingame, CA). All other chemicals were obtained from either Sigma or Fisher Scientific (Pittsburgh, PA).

Preparation of recombinant retroviral constructs containing Cx50, Cx46, Cx43 and chimeric connexins, and generation of high-titer retroviruses Retroviral constructs and high-titer retroviruses were prepared based on our protocol described previously (Jiang, 2001). In brief, the cDNA fragments containing Cx50, Fig. 8. Schematic model illustrating the enhancement of Cx50-mediated Cx46 and Cx43 were made by PCR and were constructed into the retroviral vector intercellular communication by AQP0 in the lens fibers. In the RCAS(A) as described previously (Jiang and Goodenough, 1998; Yin et al., 2000). differentiating fiber cells of lens, Cx50 forms functional gap junction channels For the construction of chimeric retroviral constructs Cx50*43L and Cx50*46L, a two-step PCR procedure was carried out. First, by using a Cla12NCO-Cx50 construct and hemichannels on the cell surface (top). When AQP0 is also present as the template, we obtained a fragment containing IL-deleted Cx50 (residues 1–97 (bottom), it pulls the plasma membranes of apposing cells much closer by and 149–400) as well as the Cla12NCO vector with the following pair of primers: functioning as an adhesion molecule. Meanwhile, the C-terminal domain of sense, CTCCTGAGAACCTACATCCT; antisense, CACCGCATGCCCAAAGTAC- AQP0 directly interacts with the intracellular loop domain of Cx50. As a result AC. Second, by using Cla12NCO-Cx43 and Cla12NCO-Cx46 constructs as the of this, more Cx50 connexons on the cell surface are able to dock with their templates, PCR fragments containing the ILs of Cx43 (residues 98–150) and Cx46 apposing counterparts from neighboring cells to form functional gap junction (residues 98–166) were also obtained with the following pairs of primers: sense, TACGTGATGAGGAAAGAAGAG; antisense, TCCTCCACGCATCTTTACCTTG; channels. sense, CACATTGTACGCATGGAAGAG; antisense, AGCACCTCCCAT - ACGGATTC, respectively. Third, the two blunt-ended fragments were ligated together to generate Cx50*43L and Cx50*46L constructs. Finally, connexin fragments gap junctions in the equator region is much higher than the central were isolated after digestion with ClaI and subcloned into a ClaI-linearized RCAS(A) region of the lens, which would accommodate the high metabolic retroviral vector. The constructs with correct insert were selected by ClaI and SalI needs of the lens around this region (Jacobs et al., 2001). AQP0 restriction enzyme digestion. Similar procedures were used for making chimeric retroviral constructs Cx43*50L and Cx43*46L. The first fragment contained the IL- mainly associates in the periphery of the large gap junctional deleted Cx43 (residues 1–97 and 151–381) as well as the Cla12NCO vector was plaques (Dunia et al., 1998). In the lens of AQP0-deficient mice, cloned by using a Cla12NCO-Cx43 construct as the template with the following pair the percentage of membrane areas specialized as gap junction of primers: sense, CTGCTTCGTACTTACATCATC; antisense, GAACAC- plaques is reduced by ~50% (Al-Ghoul et al., 2003). This in vivo GTGCGCCAGGTAC. The second fragments contained the ILs of Cx50 (residues 98–148) or Cx46 (residues 98–166) were cloned by using Cla12NCO-Cx50 and evidence implies a functional role of AQP0 in gap junction Cla12NCO-Cx46 constructs as the templates with the following pair of primers: formation and function. Interestingly, Cx50+/– mice have no obvious sense, CACCATGTCCGCATGGAGGAGA; antisense, GGTCCCCTC - CAGGCGAAAC; sense, CACATTGTACGCATGGAAGAG; antisense, Journal of Cell Science lens phenotype despite having 50% of the Cx50 protein and ~30% AGCACCTCCCATACGGATTC, respectively. The two fragments were fused of the gap junctional coupling seen in the lenses of wild-type together to generate Cx43*50L and Cx43*46L constructs. The C-termini of both animals (Mathias et al., 2010). We have observed that the interaction wild-type and chimeric connexins were epitope-tagged with FLAG sequences to between Cx50 and AQP0 occurs throughout early embryonic stages, distinguish the exogenous connexins from the endogenous ones. PCR primers were whereas at late embryonic and early postnatal stages it mainly synthesized at the University of Texas Health Science Center (UTHSCSA) DNA Core Facility. All the constructs generated were also sequenced at the UTHSCSA occurs close to the lens bow region where lens fiber cells DNA Core Facility to ensure the correctness of the sequences. High-titer recombinant differentiate. In the adult lens, this interaction only occurs in the retroviruses were generated through transfection with these constructs into CEF cells narrow region close to bow region (Yu and Jiang, 2004). The gap (1–5ϫ108 c.f.u. per ml). junction coupling comparisons of WT and heterozygote animals, Chick lens microinjection mentioned above, might not necessarily represent the regions of High-titer recombinant retroviruses containing wild-type and chimeric connexins the lens where AQP and Cx50 interact. In addition, the level of gap were prepared as described above. Microinjection of retroviruses into the lens of chicken embryos was based on our previously published procedure (Jiang and junction coupling might not directly correlate with the expression Goodenough, 1998). Briefly, chicken eggs were opened under sterile condition at the level of Cx50, especially in the presence of AQP0. It is possible developmental stage 18 (approximately 65–68 hours of incubation). The amnionic that the lack of the obvious lens phenotypes in heterozygotes could membrane was removed to provide unimpeded access to the developing eye. About ϫ 8 be explained by the enhancement of gap junction coupling around 10–40 nl concentrated viral stock (titers, 1-5 10 c.f.u. per ml) were directly microinjected into the lumen of the right lens vesicle using a glass pipette with a tip this region as a result of the interaction between Cx50 and AQP0. opening diameter of approximately 10 m. Viral stocks were colored with Fast Therefore, even a ~20–30% increase of gap junction function Green to visualize the filling of lens vesicle lumen. The left lens was kept intact to could be physiologically important in the region containing serve as a counterlateral control. After injection, the eggshell opening was sealed with tape and the embryo was returned to 39°C for further incubation. The injected metabolically active differentiating lens fibers that ultimately lenses were dissected on embryonic day 18 for immunofluorescence studies. specify lens size. The physiological role of Cx50 and AQP0 interaction in the lens warrants further investigation and will be a Immunofluorescence and confocal laser microscopy The dissected embryo lenses were fixed in 2% PFA for 30 minutes at room direction of future research. temperature, and then immersed in 1 M sucrose at 4°C overnight. After being immersed in Tissue-Tek compound for 5 minutes, the dissected lenses were quickly Materials and Methods frozen in liquid nitrogen. Sagittal and coronal sections (10–20 mm) were collected Materials and prepared at –20°C as described (Paul et al., 1991). For dual immunolabeling of Fertilized, unincubated white leghorn chicken eggs were obtained from Ideal Poultry exogenous connexins and endogenous AQP0, lens sections were first incubated in (Cameron, TX) and incubated in a humidified 37°C incubator. Rabbit anti-chick phosphate buffered saline (PBS) for 5 minutes, then in blocking solution containing AQP0 polyclonal antibody was generated from rabbit against chicken AQP0 C- 2% normal goat serum, 2% fish skin gelatin, 0.25% Triton X-100 and 1% bovine 205 Journal of Cell Science 124 (2)

serum albumin (BSA) in PBS for 30 minutes, and finally with monoclonal anti- transfer per measurement. The extent of dye transfer was quantified by measuring FLAG antibody (1:1000 dilution) mixed with affinity-purified anti-AQP0 antibody the ratios of the area of calcein-stained cells to the area of DiI-stained cells. (1:400 dilution) in blocking solution overnight at 4°C. Sections were washed four times for 5 minutes each in PBS and then incubated with fluorescein-conjugated Dye-uptake assay goat anti-mouse IgG against anti-FLAG (1:500 dilutions in blocking solution) plus The dye-uptake assay was performed as previously described (Cherian et al., 2005) Rhodamine-conjugated goat anti-rabbit IgG against anti-AQP0 (1:500 dilution in with some modifications. Briefly, CEF cells expressing exogenous Cx50, Cx46, blocking solution) for 2 hours at room temperature. After four washes in PBS for 5 Cx50*46L, AQP0 or various combinations by retroviral infection were grown at low minutes each, a drop of mounting medium was added before being covered by a cell density to ensure the majority of cells were not physically in contact. LY was glass coverslip. Control experiments were included: labeling with each primary used as a tracer for hemichannel activity with RD as a negative control. CEF cells antibody individually to ensure that binding of one antibody was not sterically were mechanically stimulated by dropping Ca2+-free MEM from pipette at a fixed hindered by the other; labeling with mixed secondary antibodies only to detect any distance, which led to the opening of hemichannels on the cell surface. Dye uptake nonspecific cross-reactivity between secondary antibodies; and labeling with pre- was conducted in the presence of 0.4% LY and 0.4% RD for 5 minutes, and the cells immune antibody to determine any background bindings. The specimens were were washed with medium containing 1.8 mM Ca2+ and then fixed with 1% PFA. analyzed using an Olympus FV-500 confocal laser scanning microscope (Olympus Similar fields were observed under the fluorescence microscope. Approximately Optical, Tokyo, Japan). Acquisition conditions were kept constant for each sample. eight images for each condition tested were collected. Dye uptake was presented as FITC was excited at 488 nm by an argon laser with a corresponding excitation the number of fluorescent cells divided by the total number of cells. wavelength range 505–525 nm using a barrier filter. Rhodamine was excited at 543 nm with a HeNe-G laser with a corresponding excitation wavelength of 560 nm In vitro transcription, Xenopus oocyte microinjection, electrophysiological using a long-pass barrier filter. Quantitative colocalization analysis of exogenous measurement and preparation of oocyte samples for western blots connexins and endogenous AQP0 signals was performed by using NIH ImageJ cDNAs encoding full-length Cx50, AQP0 and the chimeric mutant Cx50*46L were software with the Intensity Correlation Analysis plugin. Colocalization coefficients subcloned into a pSP64T transcription vector. The constructs were confirmed by measured here are Mander’s Colocalization coefficients for channel 1 (green) because sequencing, linearized with EcoRI, and transcribed using the mMESSAGE there are more red pixels (endogenous AQP0 signal) than green pixels (exogenous mMACHINE in vitro transcription kit in accordance with the manufacturer’s connexin signal). instructions. RNA concentrations were estimated by non-denaturing gel electrophoresis with ethidium bromide staining. Diluted working stock solutions Scrape-loading dye transfer assay were prepared with RNase-free water and stored at –80°C. Oocytes taken from CEF cells expressing exogenous Cx50, Cx46, chimeric mutants, AQP0 or various ovarian lobe tissue of Xenopus laevis were defolliculated and microinjected with a combinations by retroviral infection were grown to confluence to maximize the cell– 5 ng connexin cRNA and/or 5 ng AQP0 cRNA along with 6 ng Cx38 antisense RNA cell contact. The morphology of CEF cells makes it difficult to visualize dye transfer for endogenous Cx38 suppression (Barrio et al., 1991). Oocytes were constantly through individual cells. Therefore, a total distance of dye transfer from scrape line incubated in half-strength L15 medium with 2 mM Ca2+ (Sigma) during the whole was measured. Scrape-loading dye transfer was performed based on a modified process. procedure (El-Fouly et al., 1987). Briefly, cells were scratched in the presence of two Two days after cRNA injection, oocytes were stripped of their vitelline membrane fluorescent dyes: LY (Mr, 457 Da) or Alexa Fluor 488 (Mr, 570 Da), which can pass and paired in agar wells. Gap junctional currents were examined within 16–24 hours through gap junctions, plus RD (Mr, 10 kDa) which is too large to pass through gap of pairing, using dual electrode voltage clamps by using GeneClamp 500B voltage junctions. Therefore, LY and Alexa Fluor 488 staining indicates the degree of gap clamps (Axon Instruments, Foster City, CA). A 1ϫ L-head stage was used for junction coupling and RD serves as a tracer dye for cells originally receiving the voltage recording and a 10ϫ MG head stage was used for passing current. Bath dyes. Cells were washed three times with Hanks Balanced Salt Solution (HBSS) plus potential was actively clamped to 0 mV using a 100ϫ VG head stage. Resistances 1% BSA for 5 minutes each, and then plates were scraped lightly with a 26.5 gauge for electrodes were between 0.5 and 3 M with 150 mM KCl solution. The needle in a dye mixture containing 1% LY and 1% RD or 1 mM Alexa Fluor 488 amplifiers were interfaced to a computer through a Digidata 1200 A/D converter. and 1% RD in PBS. After incubation for 15 minutes, cells were washed with HBSS Data were acquired and analyzed using Pclamp 8 software (Axon Instruments). three times, twice with PBS and then fixed in fresh 2% PFA for 30 minutes. Dye Oocytes were clamped at –30 mV and transjunctional conductances were measured transfer was examined using a Zeiss Axiovert 35 fluorescence microscope (Carl using a 10 mV pulse. Zeiss International, Oberkochen, Germany) in which LY, Alexa Fluor 488 and RD After measurements, oocytes were collected in ice-cold lysis buffer (5 mM Tris, could be detected by using fluorescein and RD filters, respectively. For scrape 5 mM EDTA, 5 mM EGTA, pH 8.0) plus 2 mM phenylmethylsulfonyl fluoride, 10

Journal of Cell Science loading with Alexa Fluor 594 (Mr, 759 Da), CEF cells were just scraped in 1 mM mM N-ethylmaleimide, 2 mM sodium vanadate and 100 M leupeptin, and lysed Alexa Fluor 594 in PBS and detected by using RD filter. Acquisition conditions were with a 20 gauge needle. Extracts were centrifuged at 8000 g at 4°C for 10 minutes kept consistent for all measurements and no threshold adjustments were used. The to remove debris. The oocytes lysates were then subjected to SDS-PAGE and extent of dye transfer was quantified by measuring the distance from the scrape lines immunoblotting with specific antibodies. to the travel front for LY, Alexa Fluor 488, Alexa Fluor 594 or RD-stained cells. At least five images per condition tested with six measurements per image were used Preparation of a GST-tagged AQP0(CT) fusion protein and analysis of to assess the extent of dye transfer. protein pull-down A GST-tagged fusion protein containing the CT domain of AQP0 was prepared as Cell parachute dye-transfer assay follows. Briefly, a cDNA fragment encoding the CT domain of AQP0 (residues 223– This assay was conducted based on a published protocol (Goldberg et al., 1995) with 262) was generated by PCR using chick AQP0 cDNA clone as a template with the some modifications. Briefly, CEF cells expressing exogenous Cx50, Cx46, chimeric following pair of primers: sense, GGAATTCCATATGCTGTGTCCGCGGGCG; mutants, AQP0 or various combinations by retroviral infection were grown to antisense, CCGCTCGAGCAGCCCCTGCGTC TTC and was subcloned into the confluence in 60 mm and 100 mm plates, respectively. RCAS(A) vehicle was used expression vector pGEX-2T. The recombinant fusion protein was expressed in E. as a control. The donor cells cultured in 60 mm plates were incubated with calcein coli, induced with 1 mM IPTG, and then isolated and purified with glutathione– AM and DiI for 20 minutes at 37°C. Gap junction intercellular communication can agarose beads. For pull-down experiments, crude membranes obtained from CEF be followed by simultaneously labeling cells with calcein AM as a cytosolic tracer cells were first preincubated with glutathione–agarose beads at 4°C for 2 hours to dye along with the membrane label, DiI (Goldberg et al., 1995). Once inside the cell, eliminate any nonspecific binding to the beads. The supernatant fraction of the calcein AM is cleaved by non-specific esterases into calcein (Mr, 622.54 Da), which mixture was saved and incubated with the corresponding GST-tagged AQP0(CT) is spectrally similar to LY and Alexa Fluor 488. DiI fluoresces with similar wavelength fusion protein and glutathione-agarose beads overnight at 4°C. The beads were then spectra as RD and indicates the cell boundaries of preloaded cells. Preloaded cells washed four times with ice-cold GST lysis buffer (20 mM Tris-HCl, 200 mM NaCl, from 60 mm plates were layered (‘parachuted’) over the top of the unlabeled 1 mM EDTA, 0.5% NP-40, pH 8.0) plus protease inhibitors. The pull-down samples recipient cells cultured in 100 mm plates at a 1:150 donor to receiver ratio. Cells were isolated from the beads by boiling in SDS sample loading buffer for 5 minutes were allowed to attach for various periods (1, 1.5, 2, 2.5, 3, 3.5 and 4 hours), and and subjected to SDS-PAGE and immunoblotting. then fixed in fresh 2% PFA and examined with a fluorescence microscope. Competitive blocking with GST fusion proteins were done based on a smaller scale Culture of CEF cells, retroviral expression, and preparation of cell of parachute dye transfer to minimize the usage of fusion proteins prepared. Donor membranes cells from 35 mm plates preloaded with calcein AM and DiI were trypsinized and CEF cells were plated at 2.5ϫ105 cells in 60 mm culture plates with Dulbecco’s premixed with GST or GST-AQP0(EL) at 100 ng/ml before parachuted over the modified Eagle’s medium plus 10% fetal calf serum, 2% chick serum, 1% pyruvate unlabeled recipient cells in 35 mm plates. Cells were examined under fluorescence and 1% penicillin/streptomycin. CEF cells were infected on the second day with microscope after a 1.5 hour incubation. For calcein dye transfer, the threshold was high-titer retroviruses. After reaching confluence, CEF cells were digested with adjusted to clearly distinguish the dye-transfer boundaries for each image used for 0.05% trypsin and passaged into 60 mm or 100 mm culture plates. At confluence, measurement. Images were converted to a binary black–white scale, with black cells were collected in ice-cold lysis buffer and lysed with a 26.5 gauge needle. Cell representing the original calcein fluorescence. Finally, the black pixels were converted lysates were centrifuged for 5 minutes at 1000 g to remove cell debris. Crude to a percentage of the total black–white field and reported as a calcein-positive area. membranes were further pelleted at 100,000 g for 30 minutes (TLA-100.3 rotor, Five representative images for each condition tested were used to assess calcein dye Beckman) at 4°C. AQP0 and Cx50 gap junctions 206

SDS gel electrophoresis, fluorography and western blot Dunia, I., Recouvreur, M., Nicolas, P., Kumar, N., Bloemendahl, H. and Benedetti, E. Briefly, crude membrane samples resuspended in lysis buffer and boiled in 0.6% L. (1998). Assembly of connexins and MP26 in lens fiber plasma membranes studied SDS were analyzed by 10% SDS-PAGE. Western blots were performed by probing by SDS-fracture immunolabeling. J. Cell Sci. 111, 2109-2120. with anti-FLAG (1:1000 dilution), affinity-purified anti-AQP0 (1:400 dilution) or El-Fouly, M. H., Trosko, J. E. and Chang, C. C. (1987). Scrape-loading and dye transfer. anti--actin (1:5000 dilution) antibody. Primary antibodies were detected with A rapid and simple technique to study gap junctional intercellular communication. Exp. horseradish-peroxidase-conjugated goat anti-rabbit IgG (1:5000 dilution) or anti- Cell Res. 168, 422-430. mouse IgG (1:5000 dilution) using chemiluminescence reagent kit (ECL). The Engel, A., Fujiyoshi, Y., Gonen, T. and Walz, T. (2008). Junction-forming aquaporins. intensity of the bands on western blots was quantified by densitometry (ImageJ Curr. Opin. Struct. Biol. 18, 229-235. Software, NIH). Fan, J., Donovan, A. K., Ledee, D. R., Zelenka, P. S., Fariss, R. N. and Chepelinsky, A. B. (2004). GammaE-crystallin recruitment to the plasma membrane by specific Preparation of a GST-tagged AQP0(EL) fusion protein and cell adhesion interaction between lens MIP/aquaporin-O and gammaE-crystallin. Invest. Opthalmol. assay Vis. Sci. 45, 863-871. GST–AQP0(EL), a GST-tagged fusion protein containing all three EL domains of Fan, J., Fariss, R. N., Purkiss, A. G., Slingsby, C., Sandilands, A., Quinlan, R., AQP0, was prepared as follows. Briefly, a cDNA fragment encoding all three EL Wistow, G. and Chepelinsky, A. B. (2005). Specific interation between lens domains (residues 33–38, 109–127 and 196–200) of AQP0 was generated by PCR MIP/aquaporin-0 and two members of the -crystallin family. Mol. Vis. 11, 76-87. using chick AQP0 cDNA clone as a template with the following pair of primers: Fotiadis, D., Hasler, L., Müller, D. L., Stahlberg, H., Kistler, J. and Engel, A. (2000). sense, GCATGGATCCCCGCTGGGCCCCGGGCCCCCCGGCCGCCGTGCGC - Surface tongue-groove contours on lens MIP facilitate cell-to-cell adherence. J. Mol. GGC; antisense, ACATGAATTCGTTGGTGAAGTTGCGCGGACCCACGC TG - Biol. 300, 779-789. GGGTGCAG and was subcloned into the expression vector pGEX-2T. The recombinant fusion protein was expressed in E. coli, induced with 1 mM IPTG, and Gerido, D. A. and White, T. W. (2004). Connexin disorders of the ear, skin, and lens. purified with glutathione–agarose beads. Cell adhesion assay was performed based Biochim. Biophys. Acta 1662, 159-170. on a published protocol (Kumari and Varadaraj, 2009) with some modifications. Girsch, S. J. and Peracchia, C. (1991). Calmodulin interacts with a C-terminus peptide Briefly, CEF cells infected with retroviruses containing RCAS(A) or AQP0 were from the lens membrane protein MIP26. Curr. Eye Res. 10, 839-849. grown to confluence in 35 mm plates. RCAS(A) was used as a vehicle control. Equal Goldberg, G. S., Bechberger, J. F. and Naus, C. C. G. (1995). A pre-loading method of numbers of donor cells preloaded with DiI were premixed with GST or GST– evaluating gap junctional communication by fluorescent dye transfer. Biotechniques 18, AQP0(EL) at 100 ng/ml and parachuted over the unlabeled recipient cells at a 1:50 490-497. donor to receiver ratio. After incubation for 1.5 hours at 37°C, plates were washed Gong, X., Cheng, C. and Xia, C. (2007). Connexins in lens development and with PBS to remove non-adherent cells and examined under fluorescence microscope cataractogenesis. J. Membr. Biol. 218, 9-12. for cell adhesion. At least five representative images for each condition tested were Goodenough, D. A. and Paul, D. L. (2003). Beyond the gap: Functions of unpaired used to assess cell adhesion per measurement. connexon channels. Nat. Rev. Mol. Cell Biol. 4, 285-294. Jacobs, M. D., Soeller, C., Cannell, M. B. and Donaldson, P. J. (2001). Quantifying Statistical analysis changes in gap junction structure as a function of lens fiber cell differentiation. Cell Data were analyzed with one-way ANOVA and Newman–Keuls multiple comparison Commun. Adhes. 8, 349-353. test along with GraphPad Prism (GraphPad Software, La Jolla, CA). Data are Jiang, J. X. (2001). Use of retroviruses to express connexins. Methods Mol. Biol. 154, presented as the mean ± s.e.m. of multiple measurements. Asterisks represent the 159-174. degree of significance in comparison with controls (*P<0.05; **P<0.01; Jiang, J. X. and Goodenough, D. A. (1996). Heteromeric connexons in lens gap junction ***P<0.001). Some of the data presented were normalized to controls for easy channels. Proc. Natl. Acad. Sci. USA 93, 1287-1291. comparison, and the variables were analyzed as described above. Jiang, J. X. and Goodenough, D. A. (1998). Retroviral expression of connexins in embryonic chick lens. Invest. Ophthalmol. Vis. Sci. 39, 537-543. The work was supported by grants from the National Institute of Jiang, J. X., White, T. W., Goodenough, D. A. and Paul, D. L. (1994). Molecular Health (EY12085) (J.X.J.), (GM55437) (B.J.N.) and the Welch cloning and functional characterization of chick lens fiber connexin45.6. Mol. Biol. Cell Foundation (AQ-1507) (J.X.J.). Confocal images were generated in 5, 363-373. the Core Optical Imaging Facility, which is supported by UTHSCSA, Kumari, S. and Varadaraj, K. (2009). Intact AQP0 performs cell-to-cell adhesion. Journal of Cell Science Biochem. Biophys. Res. Commun. 390, 1034-1039. NIH-NCI P30 CA54174 (San Antonio Cancer Institute), NIH-NIA Lindsey Rose, K. M., Gourdie, R. G., Prescott, A. R., Quinlan, R. A., Crouch, R. K. P30 AG013319 (Nathan Shock Center) and (NIH-NIA P01AG19316), and Schey, K. L. (2006). The C terminus of lens aquaporin 0 interacts with the and we thank the staff for their assistance. Deposited in PMC for cytoskeletal proteins filensin and CP49. Invest. Opthalmol. Vis. Sci. 47, 1562-1570. release after 12 months. Mathias, R. T., Kistler, J. and Donaldson, P. (2007). The lens circulation. J. Membr. Biol. 216, 1-16. References Mathias, R. T., White, T. W. and Gong, X. (2010). Lens gap junctions in growth, Al-Ghoul, K. J., Kirk, Y., Kuszak, A. J., Zoltoski, R. K., Shiels, A. and Kuszak, J. R. differentiation, and homeostasis. Physiol. Rev. 90, 179-206. (2003). Lens structure in MIP-deficient mice. Anat. Rec. 273, 714-730. Mese, G., Richard, G. and White, T. W. (2007). Gap junctions: Basic structure and Banks, E. A., Toloue, M. M., Shi, Q., Zhou, Z. J., Liu, J., Nicholson, B. J. and Jiang, function. J. Invest. Dermatol. 127, 2516-2524. J. X. (2009). Connexin mutation that causes dominant congenital cataracts inhibits gap Nicholson, B. J., Weber, P. A., Cao, F., Chang, H., Lampe, P. and Goldberg, G. (2000). junctions, but not hemichannels, in a dominant negative manner. J. Cell Sci. 122, 378- The molecular basis of selective permeability of connexins is complex and includes 388. both size and charge. Braz. J. Med. Biol. Res. 33, 369-378. Bao, L., Sachs, F. and Dahl, G. (2004). Connexins are mechanosensitive. Am. J. Physiol. Paul, D. L., Ebihara, L., Takemoto, L. J., Swenson, K. I. and Goodenough, D. A. 287, C1389-C1395. (1991). Connexin46, a novel lens gap junction protein, induces voltage- gated currents Barrio, L. C., Suchyna, T., Bargiello, T., Xu, L. X., Roginski, R. S., Bennett, M. V. L. in nonjunctional plasma membrane of Xenopus oocytes. J. Cell Biol. 115, 1077-1089. and Nicholson, B. J. (1991). Gap junctions formed by connexins 26 and 32 alone and in combination are differently affected by voltage. Proc. Natl. Acad. Sci. USA 88, 8410- Srinivas, M., Kronengold, J., Bukauskas, F. F., Bargiello, T. A. and Versellis, V. K. 8414. (2005). Correlative studies of gating in Cx46 and Cx50 hemichannels and gap junction Beahm, D. L. and Hall, J. E. (2002). Hemichannel and junctional properties of connexin channels. Biophys. J. 88, 1725-1739. 50. Biophys. J. 82, 2016-2031. Valiunas, V. and Weingart, R. (2000). Electrical properties of gap junction hemichannels Buzhynskyy, N., Hite, R. K., Walz, T. and Scheuring, S. (2007). The supramolecular identified in transfected cells. Pflugers Arch. 440, 366-379. architecture of junctional microdomains in native lens membranes. EMBO Rep. 8, 51- Weber, P. A., Chang, H. C., Spaeth, K. E., Nitsche, J. M. and Nicholson, B. J. (2004). 55. The permeability of gap junction channels to probes of different size is dependent on Chepelinsky, A. B. (2003). The ocular lens fiber membrane specific protein MIP/aquaporin connexin composition and permeant-pore affinities. Biophys. J. 87, 958-973. 0. J. Exp. Zool. 300A, 41-46. Yin, X., Jedrzejewski, P. T. and Jiang, J. X. (2000). Casein kinase II phosphorylates lens Chepelinsky, A. B. (2009). Structural function of MIP/aquaporin 0 in the eye lens; genetic connexin 45.6 and is involved in its degradation. J. Biol. Chem. 275, 6850-6856. defects lead to congenital iinherited cataracts. Handb. Exp. Pharmacol. 190, 265-297. Yu, X. S. and Jiang, J. X. (2004). Interaction of major intrinsic protein (aquaporin-0) with Cherian, P. P., Siller-Jackson, A. J., Gu, S., Wang, X., Bonewald, L. F., Sprague, E. fiber connexins in lens development. J. Cell Sci. 117, 871-880. and Jiang, J. X. (2005). Mechanical strain opens connexin 43 hemichannels in osteocytes: a novel mechanism for the release of prostaglandin. Mol. Biol. Cell 16, Yu, X. S., Yin, X., Lafer, E. M. and Jiang, J. X. (2005). Developmental regulation of the 3100-3106. direct interaction between the intracellular loop of connexin 45.6 and the C-terminus of Dong, L., Liu, X., Li, H., Vertel, B. M. and Ebihara, L. (2006). Role of the N-terminus major intrinsic protein (aquaporin-0). J. Biol. Chem. 280, 22081-22090. in permeability of chicken connexin45.6 gap junctional channels. J. Physiol. 576, 787- Zampighi, G. A., Eskandari, S., Hall, J. E., Zampighi, L. and Kreman, M. (2002). 799. Micro-domains of AQP0 in lens equatorial fibers. Exp. Eye Res. 75, 505-519.