Genome-Wide Identification of the NHX Gene Family in Punica Granatum L. and Their Expressional Patterns Under Salt Stress

agronomy

Article Genome-Wide Identiﬁcation of the NHX Gene Family in Punica granatum L. and Their Expressional Patterns under Salt Stress

Jianmei Dong 1,2, Cuiyu Liu 1,2, Yuying Wang 1,2, Yujie Zhao 1,2, Dapeng Ge 1,2 and Zhaohe Yuan 1,2,*

1 Co-Innovation Center for Sustainable Forestry in Southern China, Nanjing Forestry University, Nanjing 210037, China; [email protected] (J.D.); [email protected] (C.L.); [email protected] (Y.W.); [email protected] (Y.Z.); [email protected] (D.G.) 2 College of Forestry, Nanjing Forestry University, Nanjing 210037, China * Correspondence: [email protected]

Abstract: Most cultivated lands are suffering from soil salinization, which is a global problem affecting agricultural development and economy. High NaCl concentrations in the soil result in the accumulation of toxic Cl− and Na+ in plants. Na+/H+ antiporter (NHX) can regulate Na+ compartmentalization or efﬂux to reduce Na+ toxicity. This study aims to identify the NHX genes in pomegranate (Punica granatum L.) from the genome sequences and investigate their expression patterns under different concentrations of NaCl stress. In this study, we used the sequences of PgNHXs to analyze the physicochemical properties, phylogenetic evolution, conserved motifs, gene structures, cis-acting elements, protein tertiary structure and expression pattern. A total of 10 PgNHX genes were identiﬁed, and divided into three clades. Conserved motifs and gene structures showed

that most of them had an amiloride-binding site (FFI/LY/FLLPPI), except for the members of clade III. There were multiple cis-acting elements involved in abiotic stress in PgNHX genes. Additionally,

Citation: Dong, J.; Liu, C.; Wang, Y.; protein-protein interaction network analysis suggested that PgNHXs might play crucial roles in + Zhao, Y.; Ge, D.; Yuan, Z. keeping a balance of Na in cells. The qRT-PCR analysis suggested that PgNHXs had tissue-specific Genome-Wide Identification of the expressional patterns under salt stress. Overall, our findings indicated that the PgNHXs could play NHX Gene Family in Punica granatum significant roles in response to salt stress. The theoretical foundation was established in the present L. and Their Expressional Patterns study for the further functional characterization of the NHX gene family in pomegranate. under Salt Stress. Agronomy 2021, 11, 264. https://doi.org/10.3390/ Keywords: pomegranate; NHX gene family; salt stress; phylogenetic analysis; expression pattern agronomy11020264

Academic Editor: Søren Kjærsgaard Rasmussen 1. Introduction Received: 28 December 2020 Soil salinization has become one of the harmful factors for the loss of cultivated Accepted: 28 January 2021 Published: 30 January 2021 land. Most of the world’s arable lands are suffering from soil salinization, which is a global problem affecting agricultural development and economy [1]. The total areas of × 8 2 Publisher’s Note: MDPI stays neutral global saline-alkali soil have even reached 1.0 10 hm since in the 1980s, which are with regard to jurisdictional claims in still expanding [2]. Plant growth and development are affected by salt stress due to the published maps and institutional affil- destruction of osmotic balance and water deficiency [3–5]. + iations. When plants suffer from salt stress, Na will enter the cells through the non-selective ion channels and high-affinity K+ transporter-1 (HKT1) protein [6]. A high concentration of salt will disturb the balance of ions. Therefore, maintaining or reconstructing ionic equilibrium is essential for plants, the key of which is to reduce the concentration of Na+ in the cytoplasm. Plants relieve the harmful effects of excessive Na+ by separating Na+ into Copyright: © 2021 by the authors. + + Licensee MDPI, Basel, Switzerland. the vacuoles or removing Na from the cells [7]. The capacity of Na compartmentalization This article is an open access article and exclusion was mainly relying on the activities of ion transporters [8]. Ion transporters + + distributed under the terms and mainly consist of HKT1 and Na /H antiporter (NHX) in plants under salt stress [9,10]. + conditions of the Creative Commons The former can regulate the long-distance transport of Na , while the latter can control the + Attribution (CC BY) license (https:// compartmentalization or efflux of Na . + + creativecommons.org/licenses/by/ Na /H antiporter is belongs to the NHX gene family and is widely distributed in + + 4.0/). all organisms [11]. Na /H antiporter could be recognized as homodimers in the cell

Agronomy 2021, 11, 264. https://doi.org/10.3390/agronomy11020264 https://www.mdpi.com/journal/agronomy Agronomy 2021, 11, 264 2 of 14

membrane, with 10–12 transmembrane regions at the N terminus. The highly conservative regions of TM6 and TM7 could transport Na+ and H+ [12]. NHX genes play significant roles in osmotic regulation, stoma regulation and flower development [13,14]. The salt- tolerant effect of NHX genes has been highlighted, with the production of salt-tolerant transgenic plants. The NHX genes have also been identified in many plants, but the number of members is varied. For instance, there are eight NHX genes in Arabidopsis thaliana. (L.) Heynh [15], six in grapevine (Vitis vinifera L.) [16], five in sugar beet (Beta vulgaris)[17], seven in sorghum (Sorghum bicolor (L.) Moench) [18], 10 in soybean (Glycine max (L.) Merr.) [6], and 25 in cotton (Gossypium barbadense L.) [19]. Among the eight NHX genes in Arabidopsis, AtNHX1, AtNHX2, AtNHX3, and AtNHX4 were located on the vacuolar membrane; AtNHX5, and AtNHX6 were located on the endosomal; and AtNHX7 (AtSOS1) and AtNHX8 were located on the plasma membrane. They were divided into Vacu-clade, Endo-clade, and Plas-clade, respectively, according to their subcellular location [15,17]. AtNHX1, AtNHX2, AtNHX3, AtNHX4, AtNHX5, and AtNHX6 could participate in vesicle transport and cell expansion activities and regulate pH and K+. AtNHX7 endowed plants with salt tolerance by the SOS (Salt overly sensitivity) pathway. The SOS pathway includes SOS1, SOS2 (serine/threonine protein kinase), and SOS3 (calcineurin), and the SOS2-SOS3 compound could regulate SOS1 to remove Na+ from the cell [20,21]. AtNHX8 located on the plasma membrane, was also considered a Li+/H+ antiporter [22,23]. Pomegranate (Punica granatum L.) belongs to the Lythraceae family, with significant ecological, cultural and economic values [24–26]. Pomegranate with moderate salt tolerance is predominantly grown in arid and semi-arid regions [27,28]. Bhantana et al. [29] pointed out that pomegranate could be listed as a model crop for perennial deciduous fruit trees, and it is of a great significance for investigation into the response mechanism to abiotic stress. Our previous study found that Na+ accumulation in pomegranate tissues was closely associated with its salt tolerance under NaCl stress [27,28]. Thus, studying the NHX genes and their expression patterns in pomegranate tissues will contribute to revealing the mechanisms of Na+ uptake and transport. However, there are few studies based on the Na+/H+ antiporter, despite many kinds of research focused on the pomegranate salt tolerance [30–32]. In the present study, the NHX gene family in pomegranate was identified based on the genome sequences (ASM220158v1) [33]. Additionally, various characteristics of PgNHX genes were analyzed, including their conserved domains, gene structures, phylogenetic relationship, cis-acting elements, protein-protein interaction network, and qRT-PCR analysis. Our results could reveal the roles of PgNHXs in response to salt stress, and our study aimed to provide a valuable reference for the further functional verification of the NHX genes in pomegranate.

2. Materials and Methods 2.1. Identiﬁcation and Sequence Analysis of PgNHXs We downloaded the protein sequences of the NHX genes in Arabidopsis from the Arabidopsis Information Resource (TAIR) database (http://www.arabidopsis.org/)[34]. We then used the BLASTP to search for candidate PgNHXs from the pomegranate genome (set the cut-off at E-value of ≤1×10−10)[35]. The conserved protein domains of putative PgNHXs were conﬁrmed using the Conserved Domain Database (CDD) (https:// www.ncbi.nlm.nih.gov/cdd)[36] and simple modular architecture research tool (SMART) (http://smart.embl-heidelberg.de)[37]. The physicochemical properties of PgNHX proteins were predicted by ExPASy online tools (http://expasy.org/protparam/)[38], including amino acid residue lengths, molecular weight (MW), and isoelectric point (pI). Signal peptide information on the PgNHX proteins was predicted by SignalP v4.1 Server (http://www.cbs.dtu.dk/services/SignalP- 4.1/)[39]. Transmembrane helices (TMHs) in NHX protein sequences were predicted by using TMHMM Server v2.0 (http://www.cbs.dtu.dk/services/TMHMM-2.0/). Subcellu- Agronomy 2021, 11, 264 3 of 14

lar localization in the NHX protein sequences was predicted by Cell-Ploc v2.0 package ( http://www.csbio.sjtu.edu.cn/bioinf/plant-multi/)[40].

2.2. Phylogenetic Analysis Multiple sequence alignment was conducted by Clustal W (v2.1, Dublin, Ireland) using the NHX protein sequences from eight angiosperms, including two monocots Oryza sativa L. (Os, four sequences, 485–545 aa) and Zea mays L. (Zm, six sequences, 538–545 aa), and six core eudicots Arabidopsis thaliana (L.) Heynh. (At, eight sequences, 503–1146 aa), Citrus sinensis (L.) Osbeck (Cs, six sequences, 439–1148 aa), Eucalyptus grandis Hill ex Maiden (Eg, six sequences, 525–1145 aa), Pucica granatum L. (Pg), Populus euphratica Oliv. (Pe, seven sequences, 423–1145 aa), and Vitis vinifera L. (Vv, six sequences, 524–541 aa). All accession numbers and sequences of NHX proteins were presented in Supplementary File S1. The result of multiple sequence alignment of NHXs was visualized by Jalview [41]. A whole phylogenetic tree was constructed by MEGA (v5.0) [42] with the following settings: the neighbor-joining (NJ) method, 1000 bootstrap replicates, the Jones-Taylor-Thornton (JTT) model, and pairwise deletion. The EvolView (http://www.evolgenius.info/evolview/ #login)[43] was then used to visualize it.

2.3. Motif Identiﬁcation and Gene Structure Analysis Multiple Expectation Maximization for Motif Elicitation (MEME) (http://meme-suite. org/tools/meme)[44] could be used to acquire the conserved motifs of NHX proteins from eight species. Parameter settings that inﬂuence the query execution result were set as followed: the maximum number of motifs 10, and the optimum motif width ≥6 and ≤50. The coding sequence (CDS) was aligned with the corresponding pomegranate genomic DNA sequences to generate the intron/exons of PgNHX genes and analyze gene structures. Gene structures could be demonstrated using the TBtools (v1.075, Guangzhou, China) [45].

2.4. Protein Tertiary Structure and Protein Interaction Network Analysis To investigate the tertiary structure of PgNHX proteins, I-TASSER (https://zhanglab. ccmb.med.umich.edu/I-TASSER/)[46] was used to predict the structure of 10 PgNHX proteins. The Local Meta-Threading Server (LOMETS) was a multiple threading approach that could be used to search structure templates from the Protein Data Bank (PDB). Then we constructed a table about structural dependent modelling parameters for the PgNHX proteins. We analyzed the interaction network of PgNHX proteins using a model plant Ara- bidopsis on the String protein interaction database (http://string-db.org/)[47].

2.5. Cis-Acting Elements Located in NHX Gene Promoters Based on the pomegranate genome, 1500 bp upstream sequences of NHX genes were acquired. PlantCARE (http://bioinformatics.psb.ugent.be/webtools/plantcare/ html/)[48] was used to analyze them, with the default parameter.

2.6. Plant Material, Treatment, and qRT-PCR Analysis One-year-old ‘Taishanhong’ pomegranate cuttings were grown in pots (32 cm×25 cm) ﬁlled with a mixture substrate (turf and perlite 1:1), which were put in a phytotron of the Nanjing Forestry University (Nanjing, China) with a photoperiod of 14 h lighting/10 h darkness, temperatures of 28 ◦C (lighting)/22 ◦C (darkness), and 60% humidity. Three completely randomized blocks were designed in the present study with a total of 24 pots. Every eight pots were designed as a block, and there were two pots per biological replicate, each plot containing one plant. The mixed solution containing 0 (control), 100, 200, or 300 mM NaCl (Guangzhou Chemical Reagent Factory, Guangzhou, China) supplemented with half-strength Hoagland’s nutrient solution (Shanghai yuanye Bio-Technology Co., Ltd, Shanghai, China) was watered in each pot every 6 days, respectively. Moisture was Agronomy 2021, 11, 264 4 of 14

maintained by placing a saucer under each container. All samples of leaves and roots were collected separately after 18 days of treatments. Total RNA was extracted from pomegranate leaves and roots using a Trizol Total RNA Kit (Bio Teke, Wuxi, China). After that, the extracted RNA was used as a template for reverse transcription to obtain cDNA using the PrimeScriptTM RT reagent kit with gDNA Eraser (TaKaRa, Beijing, China). As shown in Table1, there were sequences of primers used for qRT-PCR. The PCRs were performed on 7500 Real-Time PCR System (Applied Biosystems, Foster City, CA, USA) with a TB Green Premix Ex TaqTM II Kit (TaKaRa, Beijing, China). The thermal cycler was set as follows: (a) 95 ◦C for 34 s, 95 ◦C for 5 s, 60 ◦C for 34 s for 40 cycles, and at the second step of each cycle, ﬂuorescence was obtained; (b) a dissolution curve was acquired as followed: 95 ◦C for 15 s, 60 ◦C for 60 s and 95 ◦C for 15 s. Three biological replicates were used for this study. The method of 2−∆∆CT [49] was adopted to represent relative expression levels of the PgNHX genes. The logarithm (base 2) was taken for the relative expression values, and represented by TBtools with heatmap.

Table 1. The sequences of primers used for qRT-PCR.

No. Gene Name Gene ID Forward Primer Sequence (50-30) Reverse Primer Sequence (50-30) 1 PgNHX01 CDL15_Pgr020251 AGTTGCTCGGAACCTTTCTC CAGCATCATGAGAGCGACTT 2 PgNHX02 CDL15_Pgr020284 TGGGACATACTCATCTGCGA CCATGCTGGTCCTATGCTTT 3 PgNHX03 CDL15_Pgr013571 TGTGATTGAACCTCCAGCAG CTGTCCTTGCAATCGTCTCA 4 PgNHX04 CDL15_Pgr008437 AGCTCGTCAGTGATAGTCCA TGATCTGTTGCTTCCAGTCG 5 PgNHX05 CDL15_Pgr018608 CTGATTATGGTGGGAAGGGC TCCTGACCTCGTGAACTGAT 6 PgNHX06 CDL15_Pgr016272 CTTCCATCGTGACTGGACTG GAGAGCCGTGATTGATTCGT 7 PgNHX07 CDL15_Pgr004028 GTTAGGCCTGCACATCGTAA ACTATAGCTGTGGTAGCCGT 8 PgNHX08 CDL15_Pgr019015 TACTTTCGGCAACGGATTCA GGCATCATTCACGACTCCTT 9 PgNHX09 CDL15_Pgr012091 TGTGCTCGATGCTCCATGTT AGTCACGGCTTGCGTTCATA 10 PgNHX10 CDL15_Pgr021015 CACAGGCACTCTGTTTGTCT CCAATATTCGCCTCTTCGCT 11 PgACTIN CDL15_Pgr015157 AGTCCTCTTCCAGCCATCTC ACTGAGCACAATGTTTCCA

3. Results 3.1. Identiﬁcation and Sequence Analysis of PgNHXs In total, 10 putative PgNHX genes were identiﬁed from the pomegranate genome. All the PgNHX genes were renamed according to the order of protein id. The physical and chemical properties showed that the CDS length of 10 PgNHXs ranged from 1419 bp (PgNHX09) to 3582 bp (PgNHX10) (Table2). The amino acid lengths were exhibited from 472 aa (PgNHX09) to 1193 aa (PgNHX10). The molecular weight ranged from 52.60 kDa (PgNHX09) to 132.31 kDa (PgNHX10). The predicted pI ranged from 5.45 (PgNHX07) to 9.32 (PgNHX09). The PgNHX04 and PgNHX07 were unstable proteins with high protein instability index (45.44 and 43.64 respectively), while other PgNHX proteins were stable. The grand average of hydropathy (GRAVY) value varied from 0.103 (PgNHX10) to 0.577 (PgNHX09), suggesting that all PgNHX proteins were hydrophobins. None of the PgNHX were secretory proteins and none had any signal peptide (Figure S1). In total, 10 PgNHXs were typical transmembrane transporters. PgNHX04 contained 12 transmembrane helices. PgNHX01 and PgNHX09 contained 11 transmembrane helices. The other seven proteins had ten transmembrane helices (Figure S2). The prediction of subcellular localization showed that most of these PgNHX proteins might located in the vacuoles, while PgNHX03 could be found in the vacuoles and on the cell membranes, and PgNHX10 was only located on the cell membranes.

3.2. Phylogenetic Analysis NHX proteins with full-length sequences from pomegranate and the other seven species were used to construct a phylogenetic tree to analyze the phylogenetic relationship of PgNHX genes (Figure1). According to the phylogenetic tree, all the NHX proteins were divided into three obvious clades: clades I, II and III, with strong support Agronomy 2021, 11, x FOR PEER REVIEW 5 of 15

Table 2. The identification and sequence analysis of the Na+/H+ antiporter (NHX) gene family in pomegranate.

CDS Length MW Instability Gene Name Protein ID pI GRAVY TMHs Subcellular Localization (bp) (aa) (kDa) Index AgronomyPgNHX012021, 11, 264OWM62957.1 1644 547 60.4 8.67 36.23 0.574 11 Vacuole 5 of 14 PgNHX02 OWM62990.1 1659 552 61.0 7.74 34.04 0.545 10 Vacuole PgNHX03 OWM66354.1 2826 941 103.8 5.59 35.77 0.425 10 Cell membrane; Vacuole PgNHX04 OWM74126.1 1632 543 60.6 9.21 45.44 0.479 12 Vacuole PgNHX05 OWM78039.1 (Bootstrap1617 538 = 100% ).59.5 Clade 9.32 I was the35.22 largest clade, 0.571 including 10 38 NHXs (7 Vacuole PgNHXs). Clade PgNHX06 OWM78548.1 II was1626 the smallest541 60.4 clade 8.17 including 39.49 7 NHXs (PgNHX07). 0.476 10 Clade III had 8 Vacuole NHXs, including PgNHX07 OWM83599.1 PgNHX031647 548 and PgNHX10.60.0 5.45 43.64 0.401 10 Vacuole PgNHX08 OWM85391.1 1653 550 60.3 8.32 36.53 0.546 10 Vacuole PgNHX09Table 2. TheOWM85841.1 identiﬁcation 1419 and sequence472 analysis52.6 of6.94 the Na+/H+35.40 antiporter 0.577 (NHX) gene 11 family in pomegranate. Vacuole PgNHX10 OWM90710.1 3582 1193 132.3 6.58 39.11 0.103 10 Cell membrane Gene CDS Length MW Instability Protein ID pI GRAVY TMHs Subcellular Localization Name (bp) (aa) (kDa) Index PgNHX01 OWM62957.1 16443.2. Phylogenetic 547 Analysis 60.4 8.67 36.23 0.574 11 Vacuole PgNHX02 OWM62990.1 1659NHX 552 proteins 61.0with full-length 7.74 sequences 34.04 from 0.545 pomegranate 10 and the Vacuoleother seven spe- PgNHX03 OWM66354.1 2826 941 103.8 5.59 35.77 0.425 10 Cell membrane; Vacuole PgNHX04 OWM74126.1 1632cies were 543used to construct 60.6 a 9.21 phylogenetic 45.44 tree to 0.479 analyze the 12 phylogenetic Vacuole relationship of PgNHX05 OWM78039.1 1617PgNHX genes 538 (Figure 59.5 1). According 9.32 35.22to the phylogenetic 0.571 tree, 10 all the NHX Vacuole proteins were PgNHX06 OWM78548.1 1626divided into 541 three 60.4obvious 8.17clades: clades 39.49 I, II and 0.476 III, with 10 strong support Vacuole (Bootstrap = PgNHX07 OWM83599.1 1647 548 60.0 5.45 43.64 0.401 10 Vacuole PgNHX08 OWM85391.1 1653100%). Clade 550 I was 60.3 the largest 8.32 clade, 36.53 including 0.54638 NHXs 10(7 PgNHXs). Clade Vacuole II was the PgNHX09 OWM85841.1 1419smallest clade 472 including 52.6 7 NHXs 6.94 (PgNHX07 35.40). Clade 0.577 III had 11 8 NHXs, including Vacuole PgNHX03 PgNHX10 OWM90710.1 3582and PgNHX10. 1193 132.3 6.58 39.11 0.103 10 Cell membrane

Figure 1. The phylogenetic tree of the NHX gene family, and sequences from Arabidopsis thaliana (L.) Heynh. (At), Citrus Figure 1. The phylogenetic tree of the NHX gene family, and sequences from Arabidopsis thaliana (L.) Heynh. (At), Citrus sinensis (L.) Osbeck (Cs), Eucalyptus grandis Hill ex Maiden (Eg), Oryza sativa L. (Os), Populus euphratica Oliv. (Pe), Punica sinensis (L.) Osbeck (Cs), Eucalyptus grandis Hill ex Maiden (Eg), Oryza sativa L. (Os), Populus euphratica Oliv. (Pe), Punica granatum L. (Pg), Vitis vinifera L. (Vv) and Zea mays L. (Zm). Various branch colors indicate different clades. The species granatumare presentedL. (Pg), byVitis various vinifera fontL. colors. (Vv)and TheZea values mays ofL. bootstrap (Zm). Various are presented branch colors by three indicate coloured different pots. clades. The species are presented by various font colors. The values of bootstrap are presented by three coloured pots. 3.3. Motif Identification and Gene Structure of PgNHXs 3.3. Motif Identiﬁcation and Gene Structure of PgNHXs A combined figure, including a phylogenetic tree, multiple sequence alignment, con- servedA combinedmotifs, and ﬁgure, sequence including logo showed a phylogenetic characteristics tree, multiple of the NHX sequence gene alignment, family (Figure con- served2). The motifs, conservative and sequence motif logodistribution showed characteristicsof PgNHX proteins of the NHX were gene consistent family ( Figurewith 2the). The conservative motif distribution of PgNHX proteins were consistent with the phylogenetic tree. Hence, PgNHXs in the same clade presented similar conserved motif compositions. Here, motifs 1–10 were mainly presented in clade I. However, motif 3 were absent from clades II and III, and motif 4 was lost in clade II. Interestingly, the amiloride-binding site (FFI/LY/FLLPPI), a typical feature of NHX protein, was presented in motif 1. We could see that the site was presented in most NHX proteins, but absent from clade III. There were differences in the amiloride-binding site concerning the composition. For instance, most of Agronomy 2021, 11, x FOR PEER REVIEW 6 of 15

phylogenetic tree. Hence, PgNHXs in the same clade presented similar conserved motif compositions. Here, motifs 1–10 were mainly presented in clade I. However, motif 3 were Agronomy 2021, 11, 264 absent from clades II and III, and motif 4 was lost in clade II. Interestingly, the6 of amiloride- 14 binding site (FFI/LY/FLLPPI), a typical feature of NHX protein, was presented in motif 1. We could see that the site was presented in most NHX proteins, but absent from clade III. There were differences in the amiloride-binding site concerning the composition. For in- the proteins werestance, FFIYLLPPI most of inthe clade proteins I, while were FFLFLLPPIFFIYLLPPI in in clade clade I, while II. Residue FFLFLLPPI IY or in LF clade at II. Res- this position couldidue be IY known or LF toat bethis related position to could its sensitivity be known to to amiloride be related [15to ].its Differentiation sensitivity to amiloride of sensitivity to amiloride[15]. Differentiation indicated of for sensitivity NHX in to different amiloride tissues indicated is most for likelyNHX in involved different in tissues is the structure of themost protein, likely involved such as in an the accessory structure regulatoryof the protein, co-factor such as [ 50an]. accessory Those results regulatory co- factor [50]. Those results might reveal that evolutionary patterns exist in this amiloride- might reveal that evolutionary patterns exist in this amiloride-binding site. binding site.

Figure 2.Figure Phylogenetic 2. Phylogenetic tree, alignments tree, alignmentsand conserved and motifs conserved of the NHX motifs gene of family. the NHX (A) The gene phylogenetic family. (A )tree The of 53 NHX proteins as shown in Figure 1. (B) Multiple sequence alignment of the amiloride-binding site. (C) Conserved motifs in the PgNHXphylogenetic proteins. tree Different of 53 colored NHX proteins boxes represented as shown different in Figure conserved1.( B) Multiplemotifs. (D) sequence Sequence alignmentlogo of motifs of 1, 3 and 4. the amiloride-binding site. (C) Conserved motifs in the PgNHX proteins. Different colored boxes represented different conserved motifs. (D) Sequence logo of motifs 1, 3 and 4.

Members from the same clade had similar gene structures, including the exon/intron number, intron phase, and exon length (Figure3). The results of the gene structure showed that PgNHX09, PgNHX07, PgNHX03, and PgNHX10 contained 13, 22, 21, and 23 exons, respectively, while other 6 PgNHX genes all had 14 exons. Overall, there was a unique and relatively conservative intron-exon arrangement. Agronomy 2021, 11, x FOR PEER REVIEW 7 of 15

Agronomy 2021, 11, x FOR PEER REVIEW 7 of 15

Members from the same clade had similar gene structures, including the exon/intron number,Members intron from phase, the sameand exonclade hadlength similar (Fig uregene 3). structures, The results including of the thegene exon/intron structure number,showed thatintron PgNHX09 phase, , andPgNHX07 exon , lengthPgNHX03 (Fig, ureand 3).PgNHX10 The results contained of the 13, gene 22, 21,structure and 23 Agronomy 2021, 11, 264 7 of 14 showedexons, respectively, that PgNHX09 while, PgNHX07 other 6, PgNHX03PgNHX genes, and allPgNHX10 had 14 exons.contained Overall, 13, 22, there 21, and was 23 a exons,unique respectively, and relatively while conserva othertive 6 PgNHXintron-exon genes arrangement. all had 14 exons. Overall, there was a unique and relatively conservative intron-exon arrangement.

Figure 3. Phylogenetic tree, and gene stru structuresctures of the PgNHX genes. ( A) The The phylogenetic phylogenetic tree of 10 PgNHX PgNHX proteins. ( (B)) FigureGene structures 3. Phylogenetic of the PgNHXtree, and genes. gene stru Bluectures boxesboxe ofs represent the PgNHX exons.exons. genes. Yellow (A) The boxesboxes phylogenetic representrepresent UTR. UTR.tree of 10 PgNHX proteins. (B) Gene structures of the PgNHX genes. Blue boxes represent exons. Yellow boxes represent UTR. 3.4. Protein Tertiary Structure and Protein Interaction Network Analysis 3.4. Protein Tertiary Structure and Protein Interaction Network Analysis 3.4. ProteinAll the Tertiary NHX proteinsStructure inand pomegranate Protein Interaction were Networkmodeled Analysis by I-TASSER to understand All the NHX proteins in pomegranate were modeled by I-TASSER to understand their theirAll functional the NHX mechanism. proteins in Based pomegranate on the ideal were structural modeled templates by I-TASSER and crystal to understand structures functional mechanism. Based on the ideal structural templates and crystal structures from theirfrom functionalPDB, tertiary mechanism. structures Based of PgNHX on the protein ideal structural were obtained templates (Figure and 4). crystal The confidence structures PDB, tertiary structures of PgNHX protein were obtained (Figure4). The conﬁdence of fromof constructed PDB, tertiary models structures evaluated of PgNHX by C-score, protein showed were thatobtained its value (Figure generally 4). The ranged confidence from constructed models evaluated by C-score, showed that its value generally ranged from −5 of−5 constructed to 2, and that models the more evaluated reliable by modelC-score, had showed a higher that value. its value In this generally study, ranged the ten from pre- to 2, and that the more reliable model had a higher value. In this study, the ten predicted −dicted5 to 2, NHX and thatprotein the modelsmore reliable in pomegranate model had with a higher a high value. credib Inility, this C-score study, thevaried ten frompre- NHX protein models in pomegranate with a high credibility, C-score varied from −1.92 dicted−1.92 (PgNHX09) NHX protein to models−0.11 (PgNHX10) in pomegranate (Table with 3). Most a high proteins credib ility,shared C-score the same varied PDB from hit (PgNHX09) to −0.11 (PgNHX10) (Table3). Most proteins shared the same PDB hit 4cz8A, −4cz8A,1.92 (PgNHX09) indicating tothat −0.11 their (PgNHX10) tertiary structures (Table 3). were Most similar. proteins shared the same PDB hit indicating that their tertiary structures were similar. 4cz8A, indicating that their tertiary structures were similar.

Figure 4. Tertiary structure of PgNHX proteins. The models of proteins were obtained by the online server I-TASSER. The Figure 4. Tertiary structure of PgNHX proteins. The models of proteins were obtained by the online server I-TASSER. The Figureα-helix, 4. β-strand,Tertiary and structure random of PgNHXcoil are proteins.marked by The red, models yellow of an proteinsd blue, wererespectively. obtained The by parameters the online serverof the I-TASSER.best PDB αstructure-helix, β -strand,for PgNHXs and arerandom listed coil in Table are marked 3. by red, yellow and blue, respectively. The parameters of the best PDB The α-helix, β-strand, and random coil are marked by red, yellow and blue, respectively. The parameters of the best PDB structure for PgNHXs are listed in Table 3. structure for PgNHXs are listed in Table3. Table 3. Structural dependent modeling parameters for the PgNHX proteins. Table 3. StructuralTo further dependent explore modeling the potential parameters function, for the signal PgNHX transduction proteins. and metabolic pathways Best Identified Structure Analogs in PDB Protein C-Score TM-Scoreof the PgNHX RMSD members, (Å) the protein-protein interaction network was constructed with the PDB Hit Best Identified TM-Score Structurea RMSD Analogsa in IDENPDB a Cov Protein C-Score TM-Scoreonline tool StringRMSD (Figure (Å) 5). All of them were on the protein-protein interaction network, PDB Hit TM-Scorea RMSDa IDENa Cov and they shared the same putatively interactive proteins, including AVP1 (AT1G15690.1), HKT1 (AT4G10310.1), SOS2 (AT5G35410.1) and SOS3 (AT5G24270.2). AVP1 was involved in the regulation of apoplastic pH and auxin transport. HKT1 could play a signiﬁcant role

in Na+ recirculation to roots from shoots. SOS2 and SOS3 were involved in the regulatory pathway of salt stress by controlling intracellular Na+ and Ca2+ homeostasis, and directly Agronomy 2021, 11, x FOR PEER REVIEW 8 of 15

PgNHX01 −1.69 0.51 ± 0.15 11.5 ± 4.5 4cz8A 0.707 1.06 0.209 0.717 PgNHX02 −1.21 0.56 ± 0.15 10.4 ± 4.6 4cz8A 0.701 1.08 0.227 0.710 PgNHX03 −0.66 0.63 ± 0.14 10.3 ± 4.6 6xteA 0.925 0.96 0.089 0.932 AgronomyPgNHX042021 , 11, 264−1.50 0.53 ± 0.15 11.0 ± 4.6 4cz8A 0.702 1.50 0.210 0.7208 of 14 PgNHX05 −1.67 0.51 ± 0.15 11.5 ± 4.5 4cz8A 0.697 1.93 0.204 0.729 PgNHX06 −1.80 0.50 ± 0.15 11.8 ± 4.5 4cz8A 0.702 1.51 0.223 0.723 PgNHX07 −1.48 0.53interacted ± 0.15 with 11.0 SOS1 ± 4.6 (PgNHX03and 6z3yB PgNHX10),0.690 NHX1 (PgNHX011.31 and0.402 PgNHX08), 0.704 and PgNHX08 −0.81 0.61 ± 0.14 9.4 ± 4.6 4cz8A 0.702 1.17 0.212 0.713 NHX2 (PgNHX02, PgNHX04, PgNHX05 and PgNHX06). Additionally, the interaction PgNHX09 −1.92 0.48 ± 0.15 11.8 ± 4.5 6z3yB 0.742 1.38 0.301 0.761 between SOS1 and RCD1 (AT1G32230.1), might respond to high salt or oxidative stress. PgNHX10 −0.11 0.70 ± 0.12 9.6 ± 4.6 6r9tA 0.986 0.87 0.105 0.991 All PgNHX proteins worked together to response to salt stress. Note: C-score ranged from −5 to 2, which signifies the confidence of each model. A higher value suggests a model with a higher confidence and vice-versa. TM-score and RMSD are evaluated derived from the C-score value and the protein Table 3. Structural dependent modeling parameters for the PgNHX proteins. length following the correlation observed between these qualities. The TM-scorea represents a measure of global structural a similarity between query and template protein. RMSD represents Bestthe RMSD Identified between Structure residues Analogs that inare PDB structurally aligned by TM-align. IDENa represents identity of the percentage sequence in the structurally aligned region. Cov is cov- Protein C-Score TM-Score RMSD (Å) a a a erage, representing the coverage of the alignment by TM-align,PDB Hit and its value TM-Score is equal to RMSDthe number of structurallyIDEN alignedCov PgNHX01residues divided−1.69 by length 0.51 of the± 0.15query protein. 11.5 ± 4.5 4cz8A 0.707 1.06 0.209 0.717 PgNHX02 −1.21 0.56 ± 0.15 10.4 ± 4.6 4cz8A 0.701 1.08 0.227 0.710 PgNHX03 −0.66 0.63 ±To0.14 further 10.3 explore± 4.6 the 6xteApotential function, 0.925 signal transduction 0.96 0.089and metabolic 0.932 path- PgNHX04 −1.50 0.53ways± 0.15of the PgNHX 11.0 ± 4.6 members, 4cz8A the protein-pr 0.702otein interaction 1.50 netw 0.210ork was constructed 0.720 PgNHX05 −1.67 0.51 ± 0.15 11.5 ± 4.5 4cz8A 0.697 1.93 0.204 0.729 with the online tool String (Figure 5). All of them were on the protein-protein interaction PgNHX06 −1.80 0.50 ± 0.15 11.8 ± 4.5 4cz8A 0.702 1.51 0.223 0.723 PgNHX07 −1.48 0.53network,± 0.15 and 11.0 they± 4.6 shared 6z3yBthe same putatively 0.690 interactive 1.31 proteins, 0.402 including 0.704 AVP1 PgNHX08 −0.81 0.61(AT1G15690.1),± 0.14 9.4 ±HKT14.6 (AT4G10310.1), 4cz8A SOS2 0.702 (AT5G35410.1) 1.17 and SOS3 0.212 (AT5G24270.2). 0.713 PgNHX09 −1.92 0.48AVP1± 0.15 was involved 11.8 ± 4.5 in the regulation 6z3yB of apoplastic 0.742 pH 1.38and auxin transport. 0.301 HKT1 0.761 could PgNHX10 −0.11 0.70play± a0.12 significant 9.6 ± role4.6 in Na 6r9tA+ recirculation 0.986 to roots from 0.87 shoots. SOS2 0.105 and SOS3 were 0.991 in- Note: C-score ranged from −5volved to 2, which in signifies the regulatory the confidence pathway of each model. of salt A higherstress value by controlling suggests a model intracellular with a higher Na confidence+ and Ca2+ and vice-versa. TM-score and RMSDhomeostasis, are evaluated and derived directly from the interacted C-score value andwith the SOS1 protein length(PgNHX03and following the correlationPgNHX10), observed NHX1 between these qualities. The TM-scorea represents a measure of global structural similarity between query and template protein. RMSDa represents the RMSD between(PgNHX01 residues that areand structurally PgNHX08), aligned and by TM-align.NHX2 (PgN IDENHX02,a represents PgNHX04, identity of PgNHX05 the percentage and sequence PgNHX06). in the structurally aligned region.Additionally, Cov is coverage, the representing interaction the between coverage of SOS1 the alignment and RCD1 by TM-align, (AT1G32230.1), and its value might is equal respond to the to number of structurally alignedhigh residues salt divided or oxidative by length ofstress. the query All protein. PgNHX proteins worked together to response to salt stress.

FigureFigure 5. 5. Protein-proteinProtein-protein interaction interaction network network of ofPgNHX PgNHX protein protein was was analyzed analyzed by bythe the Tool Tool String. String. NetworkNetwork nodes nodes represent represent proteins. proteins. Colored Colored nodes nodes re representpresent query proteins and ﬁrstfirst shell of interac-in- teractors.tors. Empty Empty nodes nodes indicate indicate proteins proteins of unknown of unknow 3Dn 3D structure. structure. Filled Filled nodes nodes indicate indicate that that some some 3D 3Dstructure structure is knownis known or or predicted. predicted.

3.5. Cis-Acting Elements Located in Promoters of PgNHXs We submitted upstream 1500 bp sequences in the promoter region to PlantCARE to obtain cis-acting elements. The results showed that 20 cis-elements involved in abiotic stress were found, including LTR, O2-site, ABRE, G-Box, CAAT-box, TGA-element, GARE- Agronomy 2021, 11, x FOR PEER REVIEW 9 of 15

Agronomy 2021, 11, 264 3.5. Cis-Acting Elements Located in Promoters of PgNHXs 9 of 14 We submitted upstream 1500 bp sequences in the promoter region to PlantCARE to obtain cis-acting elements. The results showed that 20 cis-elements involved in abiotic stress were found, including LTR, O2-site, ABRE, G-Box, CAAT-box, TGA-element, motif,GARE-motif, CGTCA-motif, CGTCA-motif, GATA-motif, GATA-motif, MBS, MRE, MBS, Sp1, MRE, P-box, Sp1, TATC-box, P-box, Box TATC-box, 4, TCA-element, Box 4, TCCC-motif, TGACG-motif, and AuxRR-core (Figure6 and Table S1). TCA-element, TCCC-motif, TGACG-motif, and AuxRR-core (Figure 6 and Table S1).

FigureFigure 6.6. Cis-acting-acting elementselements analysisanalysis ofof PgNHX genes. Note: ABRE was involved in the abscisic acid responsiveness; LTR involvedinvolved inin low-temperaturelow-temperature responsiveness;responsiveness; ACE,ACE, MRE,MRE, Sp1,Sp1, BoxBox 4, G-Box, GATA-motif,GATA-motif, andand TCCC-motifTCCC-motif werewere involvedinvolved inin lightlight responsiveness;responsiveness; O2-siteO2-site waswas involvedinvolved inin zeinzein metabolismmetabolism regulation; CAAT-box waswas involvedinvolved inin promoterpromoter andand enhancerenhancer regions;regions; TGA-element TGA-element and and AuxRR-core AuxRR-core were were involved involved in in auxin-responsiveness; auxin-responsiveness; GARE-motif, GARE-motif, P-box P-box and and TATC-box TATC- box involved in gibberellin-responsiveness; CGTCA-motif and TGACG-motif were involved in the MeJA-responsiveness; involved in gibberellin-responsiveness; CGTCA-motif and TGACG-motif were involved in the MeJA-responsiveness; MBS MBS was involved in drought-inducibility; TCA was involved in salicylic acid responsiveness. was involved in drought-inducibility; TCA was involved in salicylic acid responsiveness.

Most of thethe membersmembers containedcontained ABA-responsiveABA-responsive element ABRE, except PgNHX04. Half of the PgNHX genes contained the low-temperaturelow-temperature stress response element LTR. PgNHX genes all contained two or more elements related to light responsiveness, including ACE,ACE, MRE,MRE, Sp1,Sp1, BoxBox 4,4, G-Box,G-Box, GATA-motif,GATA-motif, andand TCCC-motif.TCCC-motif. 60% ofof thethe PgNHXPgNHX genes contained elements elements of of the the GARE-motif, GARE-motif, P-box P-box and and TATC-box TATC-box and and were were involved involved in ingibberellin gibberellin response. response. All All of the of the members members of PgNHX of PgNHX genesgenes contained contained MeJA MeJA responsive responsive el- elements,ements, CGTCA-motif CGTCA-motif an andd TGACG-motif. TGACG-motif. Only Only PgNHX02PgNHX02 andand PgNHX05 contained thethe drought-inducibility element MBS. OnlyOnly PgNHX01PgNHX01 andand PgNHX06PgNHX06 containedcontained thethe salicylicsalicylic acid responsive element TCA. A total ofof 20%20% andand 40%40% ofof PgNHXPgNHX genesgenes containedcontained thethe auxin responseresponse elementelement AuxRR-core AuxRR-core and and TGA-element. TGA-element. Above Above all, all,PgNHX PgNHXgenes genes might might be relatedbe related to theto the process process of photosynthetic,of photosynthetic, hormone hormone and and adversity adversity stress, stress, and and regulation regulation of growthof growth and and development. development.

3.6. qRT-PCR AnalysisAnalysis ofof PgNHXsPgNHXs underunder SaltSalt StressStress The results of the qRT-PCR analysis of PgNHX genes indicated that the expression patternsThe results were of the tissue-speciﬁc qRT-PCR analysis under of different PgNHX NaCl genes treatments indicated that (Figure the 7expression and Table pat- S2). Interestingly,terns were tissue-specific the relative expression under different levels NaCl of all PgNHXtreatmentsgenes (Figure in leaves 7 and were Table up-regulated, S2). Inter- whileestingly, most the of relativePgNHXs expressionwere down-regulated levels of all PgNHX or not genes changed in leaves in roots. were At up-regulated, a low salinity levelwhile (100 most mM of PgNHXs NaCl), the were relative down-regulated expression levels or not in changed leaves were in roots. up-regulated, At a low comparedsalinity withlevel the(100 control mM NaCl), (0 mM the NaCl). relative The expression up-regulated levels expression in leaves of werePgNHX10 up-regulated,was almost com- 9-fold higherpared with than the that control found (0 in mM control NaCl). plants. The up-regulated However, most expression of the PgNHX of PgNHX10genes was were al- the down-regulationmost 9-fold higher in than roots that compared found in with control control, plants. especially However,PgNHX01 most of. the Under PgNHX moderate genes salt stress (200 mM NaCl), the relative expression levels were increased continuously in were the down-regulation in roots compared with control, especially PgNHX01. Under leaves, except PgNHX02 and PgNHX08. Meanwhile, PgNHX02 and PgNHX09 were up- moderate salt stress (200 mM NaCl), the relative expression levels were increased contin- regulated in roots compared with control. When subjected to severe salt stress (300 mM uously in leaves, except PgNHX02 and PgNHX08. Meanwhile, PgNHX02 and PgNHX09 NaCl), the relative expression level still increased in leaves, and the expression level of PgNHX04were up-regulatedin roots wasin roots higher compared than other with treatments. control. When subjected to severe salt stress (300 mM NaCl), the relative expression level still increased in leaves, and the expression level of PgNHX04 in roots was higher than other treatments.

Agronomy 2021, 11, 264 10 of 14 Agronomy 2021, 11, x FOR PEER REVIEW 10 of 15

Figure 7. The relativeFigure expression 7. The relative levels expression of the PgNHX levels of genes the PgNH in leavesX genes and in roots leaves under and roots different under NaCl different treatments. T1, T2, T3, T4 represented theNaCl different treatments. treatments T1, T2, ofT3, 0,T4 100, represented 200, 300 the mM diffe NaClrent intreatments leaves, respectively.of 0, 100, 200, T5,300 mM T6, T7,NaCl T8 in represented the leaves, respectively. T5, T6, T7, T8 represented the different treatments of 0, 100, 200, 300 mM different treatments of 0, 100, 200, 300 mM NaCl in roots, respectively. NaCl in roots, respectively.

4. Discussion4. Discussion The NHX genes,The NHX codinggenes, for the coding Na+/H for+ antiporter, the Na+ /Hbelong+ antiporter, to the CPA1 belong family. to theThe CPA1 family. The Na+/H+ antiporterNa+/H plays+ antiporter critical roles plays in critical the steady roles state inthe of K steady+ and pH, state leaf of development K+ and pH, leaf development and responsesand to responses salt stress to [13,14,51]. salt stress In the [13 ,present14,51]. study, In the we present identified study, 10 weNHX identified genes 10 NHX genes + + in pomegranate.in pomegranate. PgNHX proteins PgNHX all contained proteins allNa contained/H exchanger Na +domains,/H+ exchanger which were domains, which were relatively conservative in the evolution. relatively conservative in the evolution. According to the phylogenetic tree, all genes were divided into three clades. Among According to the phylogenetic tree, all genes were divided into three clades. Among them, PgNHX01, PgNHX02, PgNHX04, PgNHX05, PgNHX06, PgNHX08, PgNHX09 and AtNHX01,them, AtNHX02, PgNHX01, AtNHX03, PgNHX02, AtNHX04 PgNHX04, of the Arabidopsis PgNHX05, were on PgNHX06, the same branch PgNHX08, of PgNHX09 and cladeI. PgNHX07,AtNHX01, AtNHX05 AtNHX02, and AtNHX03,AtNHX06 AtNHX04were on the of thesameArabidopsis branch ofwere clade on II. the same branch of PgNHX03,cladeI. PgNHX10, PgNHX07, AtNHX07 AtNHX05 and AtNHX08 and AtNHX06 were on werethe same on the branch same of branch clade ofIII. clade II. PgNHX03, Members ofPgNHX10, the same branch AtNHX07 in the andevolutiona AtNHX08ry tree were might on have the si samemilar branchbiological of func- clade III. Members of tions. The theevolutionary same branch relationship in the was evolutionary highly consistent tree might with the have subcellular similar biologicallocation functions. The classificationevolutionary of G.max, Brachypodium relationship distachyon was highly (L.) consistent Beauv., Populus with the trichocarpa subcellular Torr. location & classification Gray ex Brayshawof G.max and, Brachypodium Beta vulgaris L. distachyon [17,52,53](L.) As mentioned Beauv., Populus above, trichocarpa the NHX membersTorr. & Gray ex Brayshaw of Arabidopsisand wereBeta divided vulgaris intoL. three [17, 52clades,,53] Asaccording mentioned to its subcellular above, the location: NHX vacuo- members of Arabidopsis lar membrane,were endosomal divided into and threeplasma clades, membrane according [15]. However, to its subcellular subcellular location: locations vacuolarof membrane, PgNHX proteinsendosomal were not and consistent plasma membrane with Arabidopsis [15].. However,Most of the subcellular PgNHX proteins locations were of PgNHX proteins located in the vacuoles, while there were fewer on the cell membranes. Accordingly, this were not consistent with Arabidopsis. Most of the PgNHX proteins were located in the might indicate that the NaCl resistant mechanism of pomegranate was chiefly through the vacuoles, while there were fewer on the cell membranes. Accordingly, this might indicate regionalization of Na+ into vacuoles. In pomegranate,that the NaCl clade resistant I had fewer mechanism exons (13–14) of pomegranate than other two was clades chiefly (21–23). through The the regionalization + results wereof in Na lineinto with vacuoles. the NHX proteins in sugar beet, soybean, and poplar [6,17,52]. Our result showedIn pomegranate,clearly that their clade gene stru I hadctures fewer were exons highly (13–14) conserved. than Additionally, other two clades (21–23). The the same claderesults had were similar in motif line withcompositions, the NHX indicating proteins that in sugar the gene beet, structures soybean, of the and poplar [6,17,52]. NHX geneOur family result were showed relatively clearly conserved that theirduring gene evolution. structures The werebinding highly site of conserved. ami- Additionally, loride (FFI/LY/FLLPPI)the same clade is one had of the similar typical motifcharacteristics compositions, of NHX proteins. indicating NHX that is highly the gene structures of sensitive tothe amiloride, NHX gene and familycould be were completely relatively inhibited conserved due to duringthe high evolution. affinity of its The binding site of specific aminoamiloride acid residue (FFI/LY/FLLPPI) to amiloride. isNa one+ and of amiloride the typical could characteristics have the same of NHXfunc- proteins. NHX is tional bindinghighly site, sensitive according to to amiloride, amiloride, andwhich could was bea competitive completely inhibitor inhibited of dueNHX to the high affinity mediating Na+ transport [54,55]. In this study, the binding site of amiloride was found in of its specific amino acid residue to amiloride. Na+ and amiloride could have the same most members, but missing in three members, including PgNHX03, PgNHX09 and functional binding site, according to amiloride, which was a competitive inhibitor of PgNHX10. Similar amiloride-binding sites were observed in V.vinifera, A.thaliana, NHX mediating Na+ transport [54,55]. In this study, the binding site of amiloride was found in most members, but missing in three members, including PgNHX03, PgNHX09 and PgNHX10. Similar amiloride-binding sites were observed in V.vinifera, A.thaliana, P.trichocarpa and S.bicolor [11,18,52]. This finding implied that the motif (FFI/LY/FLLPPI)

on the transmembrane region of PgNHX is sensitive to the Na+ of the substrate. Agronomy 2021, 11, 264 11 of 14 Agronomy 2021, 11, x FOR PEER REVIEW 11 of 15

There were many cis-acting elements involved in hormone or abiotic stress response P.trichocarpa and S.bicolor [11,18,52]. This finding implied that the motif (FFI/LY/FLLPPI) in the promoter region of the PgNHX genes. For example, most of the PgNHX genes had on the transmembrane region of PgNHX is sensitive to the Na+ of the substrate. elementsThere relatedwere many to abscisic cis-acting acid elements (ABA) involved regulation, in horm lowone temperature, or abiotic stress light, response gibberellins, etc. inThese the promoter results might region indicate of the PgNHX that PgNHX genes.genes For example, participated most of in the the PgNHX growth genes anddevelopment had elementsof pomegranate related to through abscisic differentacid (ABA) hormone regulation, regulation low temperature, pathways, light, abiotic gibberellins, stress response, etc.and These other results physiological might indicate processes. that PgNHX genes participated in the growth and devel- opmentThe of protein-protein pomegranate through interaction different network hormone showed regulation that the pathways, PgNHXs abiotic played stress a crucial role response,in salt-stress and resistance.other physiological In the present processes. study, we found that all PgNHX proteins shared the sameThe putatively protein-protein interactive interaction protein network AVP1, showed HKT1, that SOS2 the and PgNHXs SOS3. played All of a these crucial putatively roleinteracted in salt-stress proteins resistance. play essential In the presen rolest instudy, response we found to abiotic that all stress. PgNHX Overexpression proteins of sharedthe AVP1 the samecan increaseputatively the interactive plant’s prot toleranceein AVP1, to saltHKT1, in SOS2Arabidopsis and SOS3.[56 ].All Romero-Aranda of these putativelyet al. [57] interacted pointed out proteins that HKT1play essential can improve roles in salt response tolerance to abiotic by extracting stress. Overex- Na+ from the pression of the AVP1 can increase the plant’s tolerance to salt in Arabidopsis [56]. Romero- xylem of different tissues and organs. SOS2 can encode a protein kinase to alleviate Aranda et al. [57] pointed out that HKT1 can improve salt tolerance by extracting Na+ from salt stress in Arabidopsis [58]. SOS3 is a Ca2+ sensor, which can escort SOS2 and SOS1 the xylem of different+ tissues and organs. SOS2 can encode a protein kinase to alleviate saltto promote stress in Arabidopsis Na efﬂux [58]. from SOS3 the is cells a Ca [2+18 sensor,]. As which shown can in escort the summarized SOS2 and SOS1 diagram, to salt promotetolerance Na regulation+ efflux from is the a multi-way cells [18]. As regulation shown in networkthe summarized (Figure diagram,8). It is highlysalt toler- consistent + ancewith regulation previous ﬁndingsis a multi-way [58,59 regulation]. The increases network in (Figure the transcription 8). It is highly level consistent of H -ATPase, with result + previousin improving findings tolerance [58,59]. The to salinity increases [60 in]. the Moreover, transcription we canlevel also of H regulate+-ATPase, the result amount in of K improvingby AKT1to tolerance reduce to salt salinity damage [60]. [59 Moreover]. It is well, we know can also that regulate many plantsthe amount tend of to K adapt+ by to high AKT1salinity to environmentsreduce salt damage by maintaining [59]. It is well a highknow K that+/Na many+ ratio. plants Notably, tend to AKT1 adapt playsto high important salinityroles in environments K+ uptake, maintenanceby maintaining and a high restoration K+/Na+ ratio. of KNotably,+ homeostasis AKT1 plays under important salt stress. The rolesoverexpression in K+ uptake, of maintenance AKT1 in transgenic and restorationArabidopsis of K+ homeostasisalso indicates under that salt AKT1 stress. could The enhance overexpressionthe salt resistance of AKT1 [61 ,in62 transgenic]. As explained Arabidopsis above, also theindicates response that AKT1 processes could ofenhance plant growth, thedevelopment, salt resistance biotic [61,62]. and As abiotic explained stresses above, are the closely response related. processes Thus, of they plant may growth, have similar development, biotic and abiotic stresses are closely related. Thus, they may have similar regulatory functions, and simultaneously induce expression during stress. regulatory functions, and simultaneously induce expression during stress.

+ + Figure 8. 8. CellCell signaling signaling pathways pathways that regulate that regulate activities activities of ion transporters of ion transporters to maintain to K maintain/Na K+/Na+ homoeostasis under salt stress. homoeostasis under salt stress. The results of qRT-PCR suggested that the relative expression levels of PgNHXs had The results of qRT-PCR suggested that the relative expression levels of PgNHXs had tissue-specific expressional patterns in pomegranate under salt stress, and the expression levelstissue-speciﬁc in leaves were expressional higher than patterns roots. inSu pomegranatech results might under be due salt to stress,the stimulation and the expressionof levels in leaves were higher than roots. Such results might be due to the stimulation of PgNHXs with the increasing of NaCl concentration, Na+ in leaf transfers from cytoplasm to vacuole, which were timely and effective, resulting in reducing ion toxicity [63]. Most genes showed adverse regulatory effects in roots, except PgNHX06. Under low and moderate salt stress, as the Na+ accumulated, the relative expression levels in leaves Agronomy 2021, 11, 264 12 of 14

of pomegranate increased as well. Thus, Na+ could be up-taken or sequestrated in the vacuoles of leaves. At a high salinity level, some PgNHX genes still had higher expression levels. However, at the same time, PgNHX01 could not compartmentalize excessive Na+ in leaves so that expression level was drastically reduced in leaves. The results of tissue- speciﬁc expressional patterns of NHX were similar to Quintero et al. [64] and Wu et al. [65], and Na+ accumulation resulted in up-regulation in leaves rather than roots. Thus, the PgNHX genes might perform the different functions in pomegranate roots and leaves. PgNHXs might alleviate the harmful effects of Na+ via sequestrating the excessive Na+ into vacuoles of leaves and reducing the Na+ accumulation in roots.

5. Conclusions In the present study, 10 PgNHX genes were identified, and the same clade had similar motif compositions and gene structures. The tissue-specific expressional patterns were displayed in PgNHX genes, with relatively low expression levels in roots and high expression levels in leaves under different concentrations of NaCl stress. The PgNHX genes were related to the uptake and transport of Na+ in pomegranate. Overall, our results could provide a reference for further research on the stress response of PgNHX and the functional verification of PgNHX.

Supplementary Materials: The following are available online at https://www.mdpi.com/2073-439 5/11/2/264/s1, Table S1: Cis-elements of 10 PgNHXs, Table S2: The relative expression levels of 10 PgNHXs, File S1: All protein sequences for tree, Figure S1: Signal peptide prediction of 10 PgNHX proteins, Figure S2: Transmembrane helices of 10 PgNHX proteins. Author Contributions: Conceptualization, J.D. and Z.Y.; methodology, Y.W. and D.G.; software, Y.W.; formal analysis, J.D.; investigation, J.D. and C.L.; writing—original draft preparation, J.D.; writing—review and editing, J.D., C.L., Y.W., Y.Z., D.G. and Z.Y.; supervision, C.L., Y.W., Y.Z. and Z.Y.; funding acquisition, Z.Y. All authors have read and agreed to the published version of the manuscript. Funding: This research was funded jointly by the Tibet Autonomous Region Natural Science Foundation [XZ201019ZRG-153], the Initiative Project for Talents of Nanjing Forestry University [GXL2014070, GXL2018032], the Priority Academic Program Development of Jiangsu High Education Institutions [PAPD], and the Natural Science Foundation of Jiangsu Province [BK20180768]. Conﬂicts of Interest: The authors declare no conﬂict of interest.

References 1. Zhu, J.K. Plant salt tolerance. Trends Plant Sci. 2001, 6, 66–71. [CrossRef] 2. Kovda, V.A. Loss of productive land due to salinization. Ambio 1983, 12, 91–93. [CrossRef] 3. Xiong, L.M.; Zhu, J.K. Molecular and genetic aspects of plant responses to osmotic stress. Plant Cell Environ. 2002, 25, 131–139. [CrossRef][PubMed] 4. Tester, M.; Davenport, R. Na+ tolerance and Na+ transport in higher plants. Ann. Bot. 2003, 91, 503–527. [CrossRef][PubMed] 5. Abdul Qados, A.M.S. Effect of salt stress on plant growth and metabolism of bean plant Vicia faba L. J. Saudi Soc. Agric. Sci. 2011, 10, 7–15. [CrossRef] 6. Chen, H.T.; Chen, X.; Wu, B.-Y.; Yuan, X.X.; Zhang, H.M.; Cui, X.Y.; Liu, X.Q. Whole-genome identiﬁcation and expression analysis of K+ efﬂux antiporter (KEA) and Na+/H+ antiporter (NHX) families under abiotic stress in soybean. J. Integr. Agric. 2015, 14, 1171–1183. [CrossRef] 7. Fukuda, A.; Nakamura, A.; Hara, N.; Toki, S.; Tanaka, Y. Molecular and functional analyses of rice NHX-type Na+/H+ antiporter genes. Planta 2010, 233, 175–188. [CrossRef] 8. Farooq, M.; Hussain, M.; Wakeel, A.; Siddique, K.H.M. Salt stress in maize: Effects, resistance mechanisms, and management. A review. Agron. Sustain. Dev. 2015, 35, 461–481. [CrossRef] 9. Rubio, F.; Gassmann, W.; Schroeder, J.I. Sodium-driven potassium uptake by the plant potassium transporter HKT1 and mutations conferring salt tolerance. Science 1995, 270, 1660–1663. [CrossRef] 10. Apse, M.P.; Aharon, G.S.; Snedden, W.A.; Blumwald, E. Salt tolerance conferred by overexpression of a vacuolar Na+/H+ antiport in Arabidopsis. Science 1999, 285, 1256–1258. [CrossRef] 11. Ayadi, M.; Ben Ayed, R.; Mzid, R.; Aifa, S.; Hanana, M. Computational approach for structural feature determination of grapevine NHX antiporters. BioMed Res. Int. 2019, 2019, 1–13. [CrossRef][PubMed] Agronomy 2021, 11, 264 13 of 14

12. Dibrov, P.; Fliegel, L. Comparative molecular analysis of Na+/H+ exchangers: A unified model for Na+/H+ antiport? FEBS Lett. 1998, 424, 1–5. [CrossRef] 13. Qiu, Q.S. Plant and yeast NHX antiporters: Roles in membrane trafficking. J. Integr. Plant Biol. 2012, 54, 66–72. [CrossRef] [PubMed] 14. Bassil, E.; Zhang, S.Q.; Gong, H.J.; Tajima, H.; Blumwald, E. Cation specificity of vacuolar NHX-type cation/H+ antiporters. Plant Physiol. 2019, 179, 616–629. [CrossRef][PubMed] 15. Brett, C.L.; Donowitz, M.; Rao, R. Evolutionary origins of eukaryotic sodium/proton exchangers. Am. J. Physiol. Cell Physiol. 2005, 288, C223–C239. [CrossRef][PubMed] 16. Ayadi, M.; Martins, V.; Ben Ayed, R.; Jbir, R.; Feki, M.; Mzid, R.; Géros, H.; Aifa, S.; Hanana, M. Genome wide identification, molecular characterization, and gene expression analyses of grapevine NHX antiporters suggest their involvement in growth, ripening, seed dormancy, and stress response. Biochem. Genet. 2020, 58, 102–128. [CrossRef][PubMed] 17. Wu, G.Q.; Wang, J.L.; Li, S.J. Genome-wide Identification of Na+ /H+ antiporter (NHX) genes in sugar beet (Beta vulgaris L.) and their regulated expression under salt stress. Genes 2019, 10, 401. [CrossRef] 18. Kumari, H.; Kumar, S.; Ramesh, K.; Palakolanu, S.R.; Marka, N.; Prakash, A.; Shah, T.; Henderson, A.; Srivastava, R.; Rajasheker, G.; et al. Genome-wide identification and analysis of arabidopsis sodium proton antiporter (NHX) and human sodium proton exchanger (NHE) homologs in Sorghum bicolor. Genes 2018, 9, 236. [CrossRef] 19. Akram, U.; Song, Y.; Liang, C.; Abid, M.; Askari, M.; Myat, A.; Abbas, M.; Malik, W.; Ali, Z.; Guo, S.; et al. Genome-wide characterization and expression analysis of NHX gene family under salinity stress in Gossypium barbadense and Its comparison with Gossypium hirsutum. Genes 2020, 11, 803. [CrossRef] 20. Qiu, Q.S.; Guo, Y.; Dietrich, M.A.; Schumaker, K.S.; Zhu, J.K. Regulation of SOS1, a plasma membrane Na+/H+ exchanger in Arabidopsis thaliana, by SOS2 and SOS3. Proc. Natl. Acad. Sci. USA 2002, 99, 8436–8441. [CrossRef] 21. Quintero, F.J.; Ohta, M.; Shi, H.Z.; Zhu, J.K.; Pardo, J.M. Reconstitution in yeast of the Arabidopsis SOS signaling pathway for Na+homeostasis. Proc. Natl. Acad. Sci. USA 2002, 99, 9061–9066. [CrossRef][PubMed] 22. Wang, M.; Zheng, Q.S.; Shen, Q.R.; Guo, S.W. The critical role of potassium in plant stress response. Int. J. Mol. Sci. 2013, 14, 7370–7390. [CrossRef][PubMed] 23. Meng, K.B.; Wu, Y.X. Footprints of divergent evolution in two Na+/H+ type antiporter gene families (NHX and SOS1) in the genus Populus. Tree Physiol. 2018, 38, 813–824. [CrossRef][PubMed] 24. Yuan, Z.H.; Yin, Y.L.; Qu, J.L.; Zhu, L.Q.; Li, Y. Population genetic diversity in chinese pomegranate (Punica granatum L.) cultivars revealed by fluorescent-AFLP markers. J. Genet. Genom. 2017, 34, 1061–1071. [CrossRef] 25. Fahmy, H.; Hegazi, N.; El-Shamy, S.; Farag, M.A. Pomegranate juice as a functional food: A comprehensive review of its polyphenols, therapeutic merits, and recent patents. Food Funct. 2020, 11, 1–27. [CrossRef] 26. Tozzi, F.; Legua, P.; Martínez-Nicolás, J.J.; Núez-Gómez, D.; Melgarejo, P. Morphological and nutraceutical characterization of six pomegranate cultivars of global commercial interest. Sci. Hortic. 2020, 272, 1–9. [CrossRef] 27. Liu, C.Y.; Zhao, X.Q.; Yan, J.X.; Yuan, Z.H.; Gu, M.M. Effects of salt stress on growth, photosynthesis, and mineral nutrients of 18 pomegranate (Punica granatum) cultivars. Agronomy 2019, 10, 27. [CrossRef] 28. Liu, C.Y.; Zhao, Y.J.; Zhao, X.Q.; Wang, J.P.; Gu, M.M.; Yuan, Z.H. Transcriptomic profiling of pomegranate provides insights into salt tolerance. Agronomy 2020, 10, 44. [CrossRef] 29. Bhantana, P.; Lazarovitch, N. Evapotranspiration, crop coefficient and growth of two young pomegranate (Punica granatum L.) varieties under salt stress. Agric.Water Manag. 2010, 97, 715–722. [CrossRef] 30. Cui, J.Q.; Hua, Y.P.; Zhou, T.; Liu, Y.; Huang, J.Y.; Yue, C.P. Global landscapes of the Na+/H+ antiporter (NHX) family members uncover their potential roles in regulating the rapeseed resistance to salt stress. Int. J. Mol. Sci. 2020, 21, 3429. [CrossRef] 31. Li, W.H.; Du, J.; Feng, H.M.; Wu, Q.; Xu, G.H.; Shabala, S.; Yu, L. Function of NHX-type transporters in improving rice tolerance to aluminum stress and soil acidity. Planta 2020, 251, 71. [CrossRef][PubMed] 32. Long, L.; Zhao, J.R.; Guo, D.D.; Ma, X.N.; Gao, W. Identification of NHXs in Gossypium species and the positive role of GhNHX1 in salt tolerance. BMC Plant Biol. 2020, 20, 147. [CrossRef][PubMed] 33. Qin, G.H.; Xu, C.Y.; Ming, R.; Tang, H.B.; Guyot, R.; Kramer, E.M.; Hu, Y.D.; Yi, X.K. The pomegranate (Punica granatum L.) genome and the genomics of punicalagin biosynthesis. Plant J. 2017, 91, 1108–1128. [CrossRef][PubMed] 34. Lamesch, P.; Berardini, T.Z.; Li, D.H.; Swarbreck, D.; Wilks, C.; Sasidharan, R. The Arabidopsis Information Resource (TAIR): Improved gene annotation and new tools. Nucleic Acids Res. 2012, 40, D1201–D1210. [CrossRef] 35. Zhang, T.; Liu, C.; Huang, X.; Zhang, H.; Yuan, Z. Land-plant phylogenomic and pomegranate transcriptomic analyses reveal an evolutionary scenario of CYP75 genes subsequent to whole genome duplications. J. Plant Biol. 2019, 62, 48–60. [CrossRef] 36. Marchler-Bauer, A.; Lu, S.; Anderson, J.B.; Chitsaz, F.; Derbyshire, M.K.; DeWeese-Scott, C.; Fong, J.H. CDD: A conserved domain database for the functional annotation of proteins. Nucleic Acids Res. 2011, 39, 225–229. [CrossRef] 37. Schultz, J.; Milpetz, F.; Bork, P.; Ponting, C.P. SMART, a simple modular architecture research tool: Identification of signaling domains. Proc. Natl. Acad. Sci. USA 1998, 95, 5857–5864. [CrossRef] 38. Gasteiger, E.; Hoogland, C.; Gattiker, A.; Duvaud, S.E.; Wilkins, M.R.; Appel, R.D.; Bairoch, A. Protein Identification and Analysis Tools on the ExPASy Server; Humana Press: Totowa, NJ, USA, 2005. [CrossRef] 39. Petersen, T.N.; Brunak, S.; Heijne, G.V.; Nielsen, H. SignalP 4.0: Discriminating signal peptides from transmembrane regions. Nat. Methods 2011, 8, 785–786. [CrossRef] Agronomy 2021, 11, 264 14 of 14

40. Chou, K.C.; Shen, H.B. Plant-mPLoc: A top-down strategy to augment the power for predicting plant protein subcellular localization. PLoS ONE 2010, 5, e11335. [CrossRef] 41. Michele, C.; James, C.; Stephen, M.S.; Geoffrey, J.B. The Jalview Java alignment editor. Bioinformatics 2004, 20, 426–427. [CrossRef] 42. Tamura, K.; Peterson, D.; Peterson, N.; Stecher, G.; Nei, M.; Kumar, S. MEGA5: Molecular evolutionary genetics analysis using maximum likelihood, evolutionary distance, and maximum parsimony methods. Mol. Biol. Evol. 2011, 28, 2731–2739. [CrossRef] [PubMed] 43. Subramanian, B.; Gao, S.H.; Lercher, M.J.; Hu, S.N.; Chen, W.H. Evolview v3: A webserver for visualization, annotation, and management of phylogenetic trees. Nucleic Acids Res. 2019, 47, W270–W275. [CrossRef][PubMed] 44. Bailey, T.L.; Boden, M.; Buske, F.A.; Frith, M.; Grant, C.E.; Clementi, L.; Ren, J.Y.; Li, W.W.; Noble, W.S. MEME SUITE: Tools for motif discovery and searching. Nucleic Acids Res. 2009, 37, W202–W208. [CrossRef][PubMed] 45. Chen, C.J.; Xia, R.; Chen, H.; He, Y.H. TBtools, a Toolkit for Biologists integrating various HTS-data handling tools with a user-friendly interface. BioRxiv 2018, 289660. [CrossRef] 46. Yang, J.; Zhang, Y. I-TASSER Server: New development for protein structure and function predictions. Nucleic Acids Res. 2015, 43, W174–W181. [CrossRef] 47. Szklarczyk, D.; Gable, A.L.; Lyon, D.; Junge, A.; Wyder, S.; Huerta-Cepas, J.; Simonovic, M.; Doncheva, N.T.; Morris, J.H.; Bork, P. STRING v11: Protein-protein association networks with increased coverage, supporting functional discovery in genome-wide experimental datasets. Nucleic Acids Res. 2018, 47, D607–D613. [CrossRef] 48. Lescot, M.; Déhais, P.; Thijs, G.; Marchal, K.; Moreau, Y.; Van de Peer, Y.; Rouzé, P.; Rombauts, S. PlantCARE, a database of plant cis-acting regulatory elements and a portal to tools for in silico analysis of promoter sequences. Nucleic Acids Res. 2002, 30, 325–327. [CrossRef] 49. Livak, K.J.; Schmittgen, T.D. Analysis of relative gene expression data using realtime quantitative PCR and the 2-∆∆CT method. Methods 2001, 25, 402–408. [CrossRef] 50. Yun, C.H.C.; Little, P.J.; Nath, S.K.; Levine, S.A.; Pouyssegur, J. Leu143 in the putative fourth membrane spanning domain is critical for amiloride inhibition of an epithelial Na+/H+ exchanger isoform (NHE-2). Biochem. Biophys. Res. Commun. 1993, 193, 532–539. [CrossRef] 51. Li, N.N.; Wang, X.; Ma, B.J.; Du, C.; Zheng, L.L.; Wang, Y.C. Expression of a Na(+)/H(+) antiporter RtNHX1 from a recreto- halophyte Reaumuria trigyna improved salt tolerance of transgenic Arabidopsis thaliana. J. Plant Physiol. 2017, 218, 109–120. [CrossRef] 52. Tian, F.X.; Chang, E.; Li, Y.; Sun, P.; Hu, J.J.; Zhang, J. Expression and integrated network analyses revealed functional divergence of NHX-type Na+/H+ exchanger genes in poplar. Sci. Rep. 2017, 7, 2607. [CrossRef][PubMed] 53. Bassil, E.; Coku, A.; Blumwald, E. Cellular ion homeostasis: Emerging roles of intracellular NHX Na+/H+ antiporters in plant growth and development. J. Exp. Bot. 2012, 63, 5727–5740. [CrossRef][PubMed] 54. Counillon, L.; Franchi, A.; Pouyssegur, J. A point mutation of the Na+/H+ exchanger gene (NHE1) and amplification of the mutated allele confer amiloride resistance upon chronic acidosis. Proc. Natl. Acad. Sci. USA 1993, 90, 4508–4512. [CrossRef] [PubMed] 55. Harris, C.; Fliegel, L. Amiloride and the Na(+)/H(+) exchanger protein: Mechanism and significance of inhibition of the Na(+)/H(+) exchanger (review). Int. J. Mol. Med. 1999, 3, 315–336. [CrossRef][PubMed] 56. Gaxiola, R.A.; Li, J.L.; Undurraga, S.; Dang, L.M.; Fink, G.R. Drought- and salt-tolerant plants result from overexpression of the AVP1 H+-pump. Proc. Natl. Acad. Sci. USA 2001, 98, 11444–11449. [CrossRef][PubMed] 57. Romero-Aranda, M.R.; Fernández, P.G.; López-Tienda, J.R.; López-Diaz, M.R.; Espinosa, J.; Granum, E.; Traverso, J.Á.; Pineda, B.; Garcia-Sogo, B.; Moreno, V.; et al. Na+ transporter HKT1;2 reduces flower Na+ content and considerably mitigates the decline in tomato fruit yields under saline conditions. Plant Physiol. Biochem. 2020, 154, 341–352. [CrossRef] 58. Wilkins, K.A.; Matthus, E.; Swarbreck, S.M.; Davies, J.M. Calcium-mediated abiotic stress signaling in roots. Front.Plant Sci. 2016, 7, 1296. [CrossRef] 59. Manik, S.M.N.; Shi, S.J.; Mao, J.J.; Dong, L.H.; Su, Y.L.; Wang, Q.; Liu, H. The calcium sensor CBL-CIPK is involved in plant's response to abiotic stresses. Int. J. Genom. 2015, 2015, 1–10. [CrossRef] 60. Bao, A.K.; Wang, S.M.; Wu, G.Q.; Xi, J.J.; Wang, C.M. Overexpression of the Arabidopsis H+-PPase enhanced resistance to salt and drought stress in transgenic alfalfa (Medicago sativa L.). Plant Sci. 2008, 176, 232–240. [CrossRef] 61. Chen, J.; Wang, W.H.; Wu, F.H.; He, E.M.; Zheng, H.L. Hydrogen sulfide enhances salt tolerance through nitric oxide-mediated maintenance of ion homeostasis in barley seedling roots. Sci. Rep. 2015, 5, 12516. [CrossRef] 62. Chen, Z.; Zhao, X.; Hu, Z.; Leng, P. Nitric oxide modulating ion balance in Hylotelephium erythrostictum roots subjected to NaCl stress based on the analysis of transcriptome, fluorescence, and ion fluxes. Sci. Rep. 2019, 9, 18137. [CrossRef][PubMed] 63. Apse, M.P.; Sottosanto, J.B.; Blumwald, E. Vacuolar cation/H+ exchange, ion homeostasis, and leaf development are altered in a T-DNA insertional mutant of AtNHX1, the Arabidopsis vacuolar Na+/H+ antiporter. Plant J. 2003, 36, 229–239. [CrossRef] [PubMed] 64. Quintero, F.J.; Blatt, M.R.; Pardo, J.M. Functional conservation between yeast and plant endosomal Na(+)/H(+) antiporters. FEBS Lett. 2000, 471, 224–228. [CrossRef] 65. Wu, C.A.; Yang, G.D.; Meng, Q.W.; Zheng, C.C. The cotton GhNHX1 gene encoding a novel putative tonoplast Na+/H+ antiporter plays an important role in salt stress. Plant Cell Physiol. 2004, 45, 600–607. [CrossRef][PubMed]